--- EXPERIMENT NOTES
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken.
#
### General parameters ###
#
# The maximum number of sequences to use for the master file
sequence_limit=90
# The random seed
random_seed=3976763
#
### Alignment ###
#
# The alignment method: clustalw, muscle, kalign, t_coffee, or amap
align_method=muscle
# Minimum support value for amino acid positions in the alignment
tcoffee_min_score=3
#
### MrBayes ###
#
# Number of iterations in MrBayes
mrbayes_generations=1000000
# MrBayes burnin
mrbayes_burnin=2500
#
### FUBAR ###
#
# The maximum number of sequences to be used by FUBAR.
#fubar_sequence_limit=90
# The number of FUBAR runs
#fubar_runs=1
#
### codeML ###
#
# The maximum number of sequences to be used by CodeML
codeml_sequence_limit=30
# The number of CodeML runs
codeml_runs=1
# The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'.
codeml_models=1 2 7 8
#
### OmegaMap ###
#
# The maximum number of sequences to use in OmegaMap
omegamap_sequence_limit=90
# The number of OmegaMap runs
omegamap_runs=1
# The number of OmegaMap iterations
omegamap_iterations=2500
--- EXPERIMENT PROPERTIES
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -57.64 -60.60
2 -57.64 -60.10
--------------------------------------
TOTAL -57.64 -60.38
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.807984 90.333854 0.000164 28.764700 5.735977 967.45 1028.50 1.000
r(A<->C){all} 0.165654 0.021068 0.000064 0.455182 0.123415 125.04 149.37 1.000
r(A<->G){all} 0.170900 0.018980 0.000083 0.433835 0.136099 124.89 132.60 1.000
r(A<->T){all} 0.151770 0.015273 0.000071 0.388614 0.125407 63.31 106.76 1.000
r(C<->G){all} 0.165822 0.018151 0.000039 0.444862 0.132736 116.46 122.07 1.006
r(C<->T){all} 0.167028 0.017793 0.000033 0.426189 0.139534 82.30 94.54 1.010
r(G<->T){all} 0.178825 0.022848 0.000025 0.478007 0.137987 126.63 141.55 1.000
pi(A){all} 0.259969 0.003852 0.143177 0.381620 0.257616 626.84 639.65 1.000
pi(C){all} 0.173732 0.002799 0.072980 0.272028 0.170368 413.96 587.62 1.000
pi(G){all} 0.195107 0.003215 0.092837 0.311387 0.190615 547.99 604.85 1.000
pi(T){all} 0.371192 0.004718 0.234261 0.500150 0.371798 617.62 637.33 1.000
alpha{1,2} 0.907621 1.022300 0.000028 2.861831 0.567431 772.01 782.94 1.002
alpha{3} 0.952881 0.921427 0.000589 2.884986 0.670476 562.48 798.47 1.001
pinvar{all} 0.938101 0.019642 0.757651 0.999936 0.977153 118.08 122.32 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
--- CODEML SUMMARY
Model 1: NearlyNeutral -52.877120
Model 2: PositiveSelection -52.876890
Model 7: beta -52.876890
Model 8: beta&w>1 -52.876890
Model 2 vs 1 .000460
Model 8 vs 7 0
-- Starting log on Thu Dec 22 09:28:30 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result--
-- Starting log on Thu Dec 22 09:31:39 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result--
-- Starting log on Thu Dec 22 15:31:58 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/gapped_alignment/codeml,Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1--
MrBayes v3.2.6 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/mrbayes_input.nex"
UNIX line termination
Longest line length = 56
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 30 taxa and 42 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C65
Taxon 2 -> C10
Taxon 3 -> C67
Taxon 4 -> C9
Taxon 5 -> C73
Taxon 6 -> C72
Taxon 7 -> C74
Taxon 8 -> C16
Taxon 9 -> C80
Taxon 10 -> C81
Taxon 11 -> C58
Taxon 12 -> C87
Taxon 13 -> C60
Taxon 14 -> C107
Taxon 15 -> C115
Taxon 16 -> C114
Taxon 17 -> C61
Taxon 18 -> C8
Taxon 19 -> C117
Taxon 20 -> C122
Taxon 21 -> C124
Taxon 22 -> C125
Taxon 23 -> C130
Taxon 24 -> C20
Taxon 25 -> C132
Taxon 26 -> C133
Taxon 27 -> C25
Taxon 28 -> C7
Taxon 29 -> C83
Taxon 30 -> C140
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1671723121
Setting output file names to "/data/mrbayes_input.nex.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called 'first_pos'
Defining charset called 'second_pos'
Defining charset called 'third_pos'
Defining partition called 'by_codon'
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 829510992
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 5749836261
Seed = 710388906
Swapseed = 1671723121
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Active parameters:
Partition(s)
Parameters 1 2 3
---------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
---------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:GammaDir(1.0,0.1000,1.0,1.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
0.91 % Dirichlet(Revmat{all})
0.91 % Slider(Revmat{all})
0.91 % Dirichlet(Pi{all})
0.91 % Slider(Pi{all})
1.82 % Multiplier(Alpha{1,2})
1.82 % Multiplier(Alpha{3})
1.82 % Slider(Pinvar{all})
9.09 % ExtSPR(Tau{all},V{all})
9.09 % ExtTBR(Tau{all},V{all})
9.09 % NNI(Tau{all},V{all})
9.09 % ParsSPR(Tau{all},V{all})
36.36 % Multiplier(V{all})
12.73 % Nodeslider(V{all})
5.45 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -91.179847 -- 82.122948
Chain 2 -- -91.179842 -- 82.122948
Chain 3 -- -91.179839 -- 82.122948
Chain 4 -- -91.179852 -- 82.122948
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -91.179842 -- 82.122948
Chain 2 -- -91.179846 -- 82.122948
Chain 3 -- -91.179848 -- 82.122948
Chain 4 -- -91.179849 -- 82.122948
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-91.180] (-91.180) (-91.180) (-91.180) * [-91.180] (-91.180) (-91.180) (-91.180)
1000 -- (-84.766) (-61.023) [-56.865] (-84.578) * (-63.764) (-84.628) [-57.876] (-91.725) -- 0:16:39
2000 -- (-75.130) (-64.335) [-57.561] (-69.278) * (-65.136) (-71.414) [-60.189] (-73.477) -- 0:08:19
3000 -- (-67.591) (-64.526) [-59.180] (-62.280) * (-76.377) (-69.909) [-57.410] (-67.871) -- 0:05:32
4000 -- (-58.607) (-60.545) [-57.977] (-59.831) * (-63.987) (-66.523) [-56.454] (-62.870) -- 0:08:18
5000 -- (-57.511) (-76.772) [-57.147] (-60.325) * (-69.282) (-56.445) [-58.003] (-57.863) -- 0:06:38
Average standard deviation of split frequencies: 0.079928
6000 -- (-59.378) (-71.657) [-56.793] (-59.877) * (-66.142) (-61.154) [-57.010] (-57.305) -- 0:05:31
7000 -- (-58.847) (-74.749) [-58.178] (-61.141) * (-62.495) (-56.237) [-59.000] (-57.608) -- 0:07:05
8000 -- (-57.899) (-65.033) [-58.008] (-57.713) * (-57.462) (-58.490) [-57.488] (-59.259) -- 0:06:12
9000 -- (-56.952) (-62.535) [-60.248] (-56.594) * (-56.752) (-58.351) [-58.093] (-59.953) -- 0:05:30
10000 -- (-57.952) (-63.220) [-58.103] (-58.829) * (-57.076) (-58.280) [-58.002] (-57.527) -- 0:06:36
Average standard deviation of split frequencies: 0.081260
11000 -- (-59.975) (-66.319) [-57.682] (-59.171) * (-59.825) (-58.377) [-58.108] (-59.076) -- 0:05:59
12000 -- (-57.603) (-60.370) [-60.194] (-60.561) * (-59.257) (-63.394) [-57.093] (-58.126) -- 0:05:29
13000 -- (-56.494) (-56.865) [-56.373] (-59.383) * (-56.389) (-58.846) [-56.596] (-57.695) -- 0:06:19
14000 -- (-59.567) (-59.779) [-56.777] (-57.937) * (-57.347) (-57.466) [-56.768] (-56.589) -- 0:05:52
15000 -- (-58.344) (-59.647) [-57.635] (-59.599) * (-56.313) (-59.985) [-57.765] (-58.226) -- 0:05:28
Average standard deviation of split frequencies: 0.073657
16000 -- (-60.326) (-56.760) [-59.365] (-60.553) * (-58.585) (-58.919) [-56.701] (-56.502) -- 0:05:07
17000 -- (-61.831) (-56.729) [-58.562] (-56.925) * (-57.461) (-61.149) [-58.669] (-60.899) -- 0:05:46
18000 -- (-64.566) (-57.880) [-57.660] (-56.949) * (-57.726) (-57.171) [-57.682] (-56.743) -- 0:05:27
19000 -- (-67.636) (-58.953) [-60.352] (-59.157) * (-58.196) (-58.224) [-56.938] (-58.202) -- 0:05:09
20000 -- (-61.553) (-57.842) [-58.251] (-60.380) * (-58.522) (-57.395) [-59.113] (-59.719) -- 0:05:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
21000 -- (-57.767) (-59.018) [-59.606] (-58.252) * (-58.129) (-60.250) [-57.515] (-61.428) -- 0:05:26
22000 -- (-57.462) (-58.093) [-57.529] (-62.090) * (-62.213) (-59.861) [-61.055] (-60.455) -- 0:05:11
23000 -- (-57.666) (-57.732) [-56.500] (-57.338) * (-59.933) (-58.482) [-58.886] (-60.690) -- 0:05:39
24000 -- (-58.784) (-62.891) [-56.987] (-58.282) * (-61.056) (-57.917) [-59.079] (-57.328) -- 0:05:25
25000 -- (-58.086) (-62.473) [-61.567] (-56.690) * (-58.047) (-58.447) [-58.172] (-60.369) -- 0:05:12
Average standard deviation of split frequencies: 0.060436
26000 -- (-57.180) (-59.271) [-58.750] (-56.175) * (-59.914) (-59.125) [-57.060] (-62.574) -- 0:05:37
27000 -- (-59.720) (-57.028) [-57.887] (-62.244) * (-59.228) (-58.045) [-58.287] (-57.146) -- 0:05:24
28000 -- (-58.548) (-57.908) [-58.496] (-58.815) * (-58.924) (-59.037) [-62.056] (-58.871) -- 0:05:12
29000 -- (-59.445) (-59.605) [-56.206] (-58.419) * (-56.605) (-56.936) [-64.070] (-57.332) -- 0:05:01
30000 -- (-58.674) (-56.378) [-56.841] (-61.382) * (-59.403) (-58.590) [-59.152] (-58.599) -- 0:05:23
Average standard deviation of split frequencies: 0.076859
31000 -- (-60.515) (-59.795) [-57.669] (-58.619) * (-57.736) (-58.097) [-58.138] (-59.470) -- 0:05:12
32000 -- (-57.580) (-58.152) [-59.912] (-58.701) * (-56.919) (-57.320) [-57.409] (-57.121) -- 0:05:02
33000 -- (-57.698) (-56.562) [-57.936] (-57.302) * (-59.403) (-60.515) [-59.879] (-59.725) -- 0:05:22
34000 -- (-61.331) (-56.763) [-59.709] (-59.506) * (-57.598) (-58.506) [-58.198] (-58.836) -- 0:05:12
35000 -- (-58.993) (-61.174) [-58.672] (-58.606) * (-58.768) (-58.136) [-56.392] (-59.086) -- 0:05:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
36000 -- (-58.035) (-59.120) [-59.053] (-57.464) * (-65.849) (-59.882) [-58.109] (-58.215) -- 0:05:21
37000 -- (-56.974) (-57.790) [-56.549] (-58.054) * (-56.678) (-57.432) [-56.907] (-56.347) -- 0:05:12
38000 -- (-59.298) (-58.729) [-56.509] (-57.156) * (-57.767) (-57.780) [-62.311] (-56.773) -- 0:05:03
39000 -- (-58.664) (-58.836) [-58.211] (-56.977) * (-58.228) (-59.117) [-57.417] (-59.952) -- 0:05:20
40000 -- (-59.457) (-58.072) [-57.976] (-61.036) * (-57.307) (-58.251) [-58.966] (-59.058) -- 0:05:12
Average standard deviation of split frequencies: 0.081143
41000 -- (-60.400) (-58.005) [-60.517] (-64.182) * (-58.274) (-56.877) [-56.773] (-62.665) -- 0:05:04
42000 -- (-62.386) (-57.318) [-61.061] (-58.681) * (-57.397) (-59.499) [-58.027] (-60.772) -- 0:05:19
43000 -- (-65.862) (-57.312) [-66.141] (-59.369) * (-57.788) (-58.882) [-59.121] (-61.168) -- 0:05:11
44000 -- (-57.602) (-57.018) [-58.621] (-59.449) * (-56.230) (-61.057) [-59.551] (-59.452) -- 0:05:04
45000 -- (-60.230) (-56.540) [-59.609] (-57.481) * (-59.387) (-57.348) (-57.947) [-59.679] -- 0:05:18
Average standard deviation of split frequencies: 0.071735
46000 -- (-57.854) (-58.124) [-57.340] (-59.648) * (-58.108) (-61.263) (-58.044) [-61.205] -- 0:05:11
47000 -- (-56.956) (-57.409) [-58.428] (-58.006) * (-62.486) (-58.755) (-56.708) [-59.113] -- 0:05:04
48000 -- (-57.930) (-59.176) [-57.436] (-57.825) * (-65.908) (-57.508) (-59.867) [-58.166] -- 0:04:57
49000 -- (-59.172) (-60.820) [-56.318] (-59.822) * (-57.400) (-57.515) (-58.746) [-58.366] -- 0:05:10
50000 -- (-58.591) (-57.236) [-56.150] (-60.801) * (-59.990) (-60.579) (-58.598) [-58.655] -- 0:05:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
51000 -- (-57.368) (-57.141) [-62.192] (-60.130) * (-58.412) (-61.544) (-57.391) [-60.211] -- 0:04:57
52000 -- (-59.551) (-56.932) [-57.654] (-57.553) * (-57.730) (-56.882) (-57.491) [-56.980] -- 0:05:09
53000 -- (-57.983) (-59.988) [-58.290] (-61.764) * (-56.811) (-61.884) (-61.403) [-57.417] -- 0:05:03
54000 -- (-57.289) (-58.438) [-56.676] (-60.837) * (-61.163) (-56.497) (-58.527) [-59.492] -- 0:04:57
55000 -- (-59.452) (-58.746) [-58.362] (-58.725) * (-60.432) (-57.095) (-57.417) [-60.001] -- 0:05:09
Average standard deviation of split frequencies: NA (no splits above min. frequency)
56000 -- (-57.596) (-57.629) [-57.254] (-61.891) * (-59.226) (-57.175) (-57.011) [-59.419] -- 0:05:03
57000 -- (-56.953) (-56.880) [-61.467] (-59.311) * (-56.910) (-58.061) [-56.688] (-57.500) -- 0:04:57
58000 -- (-60.243) (-62.608) [-59.996] (-58.153) * (-58.077) (-57.432) [-56.934] (-57.330) -- 0:05:08
59000 -- (-59.880) (-58.925) [-57.237] (-56.759) * (-59.078) (-56.848) [-56.692] (-58.582) -- 0:05:03
60000 -- [-58.672] (-58.442) (-59.784) (-62.585) * (-57.597) (-56.540) [-59.744] (-59.084) -- 0:04:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
61000 -- (-58.274) (-58.444) [-58.984] (-59.504) * (-57.035) (-57.003) [-58.750] (-62.258) -- 0:05:07
62000 -- [-63.552] (-57.060) (-62.912) (-60.311) * (-56.352) (-57.759) [-59.658] (-62.442) -- 0:05:02
63000 -- [-61.570] (-57.869) (-58.048) (-59.831) * (-57.613) (-58.534) [-57.488] (-58.652) -- 0:04:57
64000 -- [-61.134] (-59.317) (-59.965) (-57.444) * (-57.988) (-57.697) [-58.862] (-59.028) -- 0:05:07
65000 -- [-57.307] (-56.728) (-60.797) (-56.972) * (-58.060) (-59.459) [-57.378] (-62.648) -- 0:05:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
66000 -- [-57.030] (-59.547) (-60.790) (-56.721) * (-59.710) (-60.418) [-57.945] (-62.929) -- 0:04:57
67000 -- [-57.363] (-58.187) (-59.214) (-57.896) * (-60.368) (-62.542) [-58.110] (-57.542) -- 0:05:06
68000 -- [-59.210] (-60.728) (-58.836) (-61.035) * (-58.120) (-58.140) [-58.829] (-57.920) -- 0:05:01
69000 -- [-60.854] (-64.393) (-58.272) (-58.522) * (-57.579) (-57.790) [-56.810] (-60.639) -- 0:04:56
70000 -- (-60.243) (-61.841) [-59.648] (-58.289) * (-60.418) (-57.172) [-57.015] (-60.750) -- 0:04:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
71000 -- (-60.493) (-58.338) [-58.331] (-56.073) * (-59.550) (-56.533) [-57.589] (-62.677) -- 0:05:00
72000 -- (-58.550) (-61.511) (-60.182) [-57.419] * (-60.879) [-56.899] (-56.641) (-58.835) -- 0:04:56
73000 -- (-59.443) (-62.044) (-59.304) [-59.159] * (-61.084) [-57.297] (-57.480) (-60.478) -- 0:04:52
74000 -- (-59.429) (-56.417) [-57.254] (-58.242) * (-58.171) (-57.209) [-57.171] (-57.442) -- 0:05:00
75000 -- (-57.141) (-59.937) [-61.951] (-56.991) * (-57.551) [-58.730] (-57.874) (-62.222) -- 0:04:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
76000 -- (-57.903) (-60.132) [-57.942] (-56.863) * (-58.505) (-60.485) (-59.067) [-59.315] -- 0:04:51
77000 -- [-59.712] (-58.133) (-58.101) (-58.557) * (-56.465) (-58.406) (-57.244) [-56.648] -- 0:04:59
78000 -- [-59.234] (-60.371) (-57.297) (-57.058) * (-58.928) (-59.636) (-59.215) [-61.494] -- 0:04:55
79000 -- [-57.777] (-56.259) (-57.937) (-60.845) * (-57.890) (-61.875) (-58.793) [-61.010] -- 0:04:51
80000 -- [-57.752] (-58.349) (-60.777) (-57.319) * (-56.206) (-59.496) (-63.947) [-60.800] -- 0:04:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
81000 -- (-62.674) (-64.248) (-61.517) [-58.298] * (-58.150) (-56.701) (-60.857) [-59.613] -- 0:04:54
82000 -- (-60.869) (-61.188) (-59.986) [-56.550] * (-60.694) (-60.113) (-62.948) [-60.808] -- 0:04:51
83000 -- (-58.522) (-60.120) (-60.742) [-57.244] * [-57.623] (-57.591) (-57.853) (-57.513) -- 0:04:58
84000 -- (-59.860) (-59.450) (-59.425) [-59.940] * [-58.648] (-58.834) (-57.368) (-57.776) -- 0:04:54
85000 -- (-57.357) (-59.033) (-57.616) [-58.087] * [-57.519] (-58.523) (-60.225) (-57.368) -- 0:04:50
Average standard deviation of split frequencies: NA (no splits above min. frequency)
86000 -- (-68.490) (-59.688) (-58.779) [-57.146] * [-59.205] (-57.989) (-57.139) (-57.725) -- 0:04:57
87000 -- (-59.855) (-57.503) (-59.113) [-59.759] * (-58.140) [-58.520] (-57.878) (-60.770) -- 0:04:53
88000 -- (-58.414) (-57.519) (-57.338) [-60.863] * (-59.406) [-58.282] (-58.519) (-60.270) -- 0:04:50
89000 -- (-59.886) (-59.803) (-57.576) [-67.316] * (-61.582) (-57.335) [-57.445] (-57.671) -- 0:04:56
90000 -- (-58.501) (-58.524) [-56.803] (-60.837) * (-58.173) (-59.530) [-59.433] (-60.054) -- 0:04:53
Average standard deviation of split frequencies: NA (no splits above min. frequency)
91000 -- (-57.409) (-61.141) (-57.578) [-57.198] * (-60.450) (-58.764) [-60.943] (-60.092) -- 0:04:49
92000 -- (-60.016) (-59.688) (-59.928) [-56.730] * (-59.879) (-58.469) [-61.069] (-57.721) -- 0:04:46
93000 -- (-58.104) [-59.334] (-59.296) (-57.860) * (-56.503) [-59.149] (-58.429) (-59.492) -- 0:04:52
94000 -- (-59.328) [-56.918] (-57.540) (-58.308) * (-59.714) [-60.427] (-59.486) (-57.685) -- 0:04:49
95000 -- (-59.372) [-58.314] (-62.409) (-58.148) * (-57.262) [-56.713] (-62.437) (-60.140) -- 0:04:45
Average standard deviation of split frequencies: NA (no splits above min. frequency)
96000 -- (-59.300) [-59.162] (-57.861) (-58.207) * (-56.564) [-59.572] (-58.334) (-59.845) -- 0:04:51
97000 -- (-57.008) [-56.472] (-57.556) (-61.341) * (-57.037) [-58.629] (-58.127) (-61.346) -- 0:04:48
98000 -- (-57.517) [-57.926] (-57.740) (-59.835) * (-58.017) [-60.177] (-57.306) (-62.725) -- 0:04:45
99000 -- (-57.327) [-57.622] (-56.989) (-57.003) * [-58.200] (-60.711) (-64.187) (-60.359) -- 0:04:51
100000 -- (-58.411) [-57.169] (-58.569) (-61.646) * [-58.795] (-61.222) (-59.809) (-58.324) -- 0:04:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
101000 -- (-57.282) [-57.696] (-58.176) (-57.807) * [-58.049] (-62.520) (-58.174) (-60.722) -- 0:04:44
102000 -- (-58.592) (-58.974) [-58.405] (-59.816) * [-59.239] (-56.521) (-59.010) (-59.374) -- 0:04:50
103000 -- (-57.843) [-59.675] (-56.449) (-59.146) * (-57.504) [-56.825] (-58.509) (-57.432) -- 0:04:47
104000 -- (-61.176) [-56.458] (-65.833) (-60.058) * (-59.715) [-58.081] (-57.605) (-57.595) -- 0:04:44
105000 -- (-63.578) [-57.551] (-61.545) (-59.766) * (-57.210) (-58.667) [-58.424] (-57.427) -- 0:04:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
106000 -- [-57.395] (-56.923) (-59.358) (-59.235) * (-58.227) (-56.457) [-57.447] (-56.607) -- 0:04:46
107000 -- [-59.394] (-58.704) (-58.257) (-56.554) * (-59.708) (-58.125) [-58.716] (-61.092) -- 0:04:43
108000 -- [-60.135] (-56.211) (-60.317) (-59.662) * (-59.462) (-57.678) [-58.587] (-58.054) -- 0:04:49
109000 -- [-57.595] (-62.302) (-63.213) (-58.489) * (-63.773) (-58.304) (-59.439) [-56.958] -- 0:04:46
110000 -- [-58.828] (-60.252) (-59.554) (-58.409) * (-66.009) (-59.046) (-58.991) [-59.889] -- 0:04:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
111000 -- [-59.180] (-58.418) (-60.491) (-57.340) * (-57.871) (-58.920) [-57.977] (-57.462) -- 0:04:48
112000 -- [-59.793] (-57.730) (-62.823) (-59.724) * (-62.702) (-61.577) [-59.723] (-59.331) -- 0:04:45
113000 -- [-60.668] (-57.465) (-56.946) (-57.388) * (-60.780) (-62.590) [-57.457] (-59.530) -- 0:04:42
114000 -- [-60.823] (-57.132) (-58.864) (-58.996) * (-60.050) (-59.997) [-56.909] (-58.936) -- 0:04:47
115000 -- [-58.931] (-57.680) (-59.132) (-62.214) * (-58.146) (-56.708) [-58.927] (-59.961) -- 0:04:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
116000 -- [-58.028] (-61.744) (-58.233) (-59.590) * (-61.709) (-58.706) [-57.206] (-60.214) -- 0:04:41
117000 -- [-59.620] (-60.339) (-60.582) (-61.027) * (-58.281) (-60.792) [-57.079] (-64.584) -- 0:04:46
118000 -- [-57.003] (-59.242) (-57.817) (-56.405) * (-58.504) (-59.709) [-57.423] (-58.392) -- 0:04:44
119000 -- [-57.113] (-59.244) (-58.646) (-57.566) * [-57.529] (-57.124) (-58.104) (-58.759) -- 0:04:41
120000 -- [-58.789] (-58.067) (-60.924) (-56.431) * [-57.602] (-56.896) (-60.313) (-60.230) -- 0:04:46
Average standard deviation of split frequencies: NA (no splits above min. frequency)
121000 -- (-57.113) (-58.720) (-58.656) [-59.154] * [-59.036] (-57.678) (-59.292) (-59.121) -- 0:04:43
122000 -- (-61.488) (-63.629) (-58.113) [-58.459] * (-57.893) (-58.716) (-61.266) [-56.653] -- 0:04:40
123000 -- (-59.358) [-58.846] (-57.914) (-58.461) * (-58.376) (-60.141) (-58.228) [-57.087] -- 0:04:38
124000 -- (-58.182) [-57.086] (-58.556) (-57.997) * (-57.734) (-58.880) (-57.749) [-56.744] -- 0:04:42
125000 -- (-57.810) [-56.876] (-59.425) (-56.876) * (-60.436) (-62.591) (-58.200) [-57.530] -- 0:04:40
Average standard deviation of split frequencies: NA (no splits above min. frequency)
126000 -- (-59.334) [-56.910] (-58.424) (-56.245) * (-59.299) (-58.409) (-57.668) [-61.743] -- 0:04:37
127000 -- (-59.639) [-56.387] (-56.908) (-58.812) * (-57.956) (-59.712) [-61.343] (-56.981) -- 0:04:41
128000 -- (-59.952) [-56.387] (-57.482) (-57.070) * (-64.937) (-58.169) [-62.396] (-57.920) -- 0:04:39
129000 -- (-58.790) [-56.652] (-57.290) (-57.579) * (-58.629) (-56.859) [-62.181] (-60.220) -- 0:04:36
130000 -- (-56.281) (-59.624) [-57.852] (-58.715) * (-58.667) (-57.688) [-60.765] (-56.942) -- 0:04:41
Average standard deviation of split frequencies: NA (no splits above min. frequency)
131000 -- [-58.542] (-62.143) (-62.199) (-58.133) * (-57.228) (-57.698) [-60.186] (-59.893) -- 0:04:38
132000 -- [-58.379] (-59.005) (-56.716) (-61.391) * [-59.080] (-59.766) (-61.506) (-58.744) -- 0:04:36
133000 -- [-56.484] (-61.092) (-57.191) (-59.180) * (-57.936) [-57.611] (-60.673) (-57.097) -- 0:04:40
134000 -- [-58.895] (-59.599) (-58.073) (-59.374) * (-57.401) [-57.037] (-60.916) (-58.388) -- 0:04:37
135000 -- [-59.313] (-58.309) (-64.337) (-58.084) * (-57.421) [-57.584] (-57.274) (-59.392) -- 0:04:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
136000 -- [-58.805] (-60.249) (-64.210) (-58.194) * (-57.427) (-57.532) [-58.543] (-61.109) -- 0:04:39
137000 -- [-59.159] (-59.968) (-68.681) (-63.577) * (-56.612) (-58.765) [-57.604] (-56.804) -- 0:04:37
138000 -- [-57.299] (-56.699) (-57.389) (-62.307) * (-57.682) [-60.516] (-57.998) (-63.111) -- 0:04:34
139000 -- [-58.676] (-57.444) (-57.175) (-60.656) * (-58.081) [-58.318] (-60.591) (-56.416) -- 0:04:38
140000 -- (-56.396) (-60.218) (-57.899) [-61.972] * (-58.027) [-59.340] (-56.954) (-56.434) -- 0:04:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
141000 -- (-58.872) (-58.146) (-57.094) [-57.477] * [-59.269] (-57.229) (-56.491) (-57.457) -- 0:04:34
142000 -- (-57.828) (-58.270) (-57.611) [-57.301] * [-58.270] (-57.074) (-60.297) (-61.039) -- 0:04:37
143000 -- (-60.836) (-59.837) (-57.642) [-59.408] * (-56.771) (-59.812) [-57.882] (-59.631) -- 0:04:35
144000 -- (-62.131) (-57.425) (-58.155) [-60.540] * [-57.188] (-57.425) (-57.874) (-57.282) -- 0:04:33
145000 -- (-59.086) (-56.362) (-57.591) [-58.010] * [-58.056] (-59.239) (-57.854) (-57.373) -- 0:04:37
Average standard deviation of split frequencies: NA (no splits above min. frequency)
146000 -- (-57.395) (-57.585) (-59.419) [-57.087] * [-57.204] (-57.777) (-57.072) (-61.646) -- 0:04:34
147000 -- (-58.671) (-62.442) (-57.672) [-57.564] * (-60.346) (-57.561) (-57.323) [-62.949] -- 0:04:32
148000 -- (-57.151) (-56.438) (-57.617) [-57.361] * (-59.298) (-58.464) [-59.205] (-60.253) -- 0:04:36
149000 -- (-59.618) (-58.829) (-59.435) [-58.346] * (-60.699) (-58.817) [-59.855] (-59.144) -- 0:04:34
150000 -- (-59.329) (-58.234) (-57.063) [-56.960] * [-57.514] (-57.316) (-60.050) (-57.247) -- 0:04:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
151000 -- (-63.508) (-60.114) (-61.216) [-57.790] * [-56.665] (-57.911) (-57.417) (-59.125) -- 0:04:29
152000 -- (-58.454) (-63.441) (-63.506) [-58.267] * [-58.397] (-60.459) (-60.226) (-56.838) -- 0:04:33
153000 -- (-60.947) (-57.451) (-58.540) [-56.441] * (-57.108) (-58.897) (-58.715) [-60.118] -- 0:04:31
154000 -- (-58.789) [-59.886] (-59.089) (-58.019) * (-62.607) (-57.392) (-57.905) [-56.702] -- 0:04:29
155000 -- (-65.022) [-56.800] (-59.384) (-58.826) * (-58.207) (-59.610) (-61.510) [-58.377] -- 0:04:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
156000 -- (-57.818) [-58.663] (-57.676) (-57.667) * (-57.566) [-57.203] (-61.312) (-58.283) -- 0:04:30
157000 -- (-59.127) [-58.650] (-58.428) (-59.449) * [-59.404] (-59.929) (-66.479) (-59.200) -- 0:04:28
158000 -- (-56.540) [-58.444] (-56.457) (-56.320) * (-56.600) (-57.673) (-60.203) [-57.149] -- 0:04:31
159000 -- [-58.227] (-60.087) (-58.208) (-62.378) * (-57.392) (-58.471) (-58.944) [-56.768] -- 0:04:29
160000 -- (-59.837) (-58.527) [-56.672] (-60.989) * (-59.218) [-58.077] (-57.575) (-61.674) -- 0:04:27
Average standard deviation of split frequencies: NA (no splits above min. frequency)
161000 -- (-59.601) (-56.998) [-59.629] (-57.309) * (-58.714) [-61.292] (-57.321) (-58.146) -- 0:04:30
162000 -- (-58.167) (-58.205) (-61.357) [-57.638] * (-57.633) (-58.208) [-58.408] (-60.405) -- 0:04:28
163000 -- (-57.273) (-60.325) (-56.699) [-57.239] * (-56.424) (-57.213) [-56.988] (-59.289) -- 0:04:27
164000 -- (-59.363) (-59.598) (-57.516) [-56.648] * (-58.622) (-57.236) (-57.579) [-60.066] -- 0:04:30
165000 -- [-57.155] (-57.723) (-56.721) (-57.403) * (-56.965) (-57.637) (-59.171) [-56.977] -- 0:04:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
166000 -- (-58.213) (-57.010) (-59.734) [-58.775] * (-58.472) (-58.351) (-57.489) [-58.573] -- 0:04:26
167000 -- (-60.433) [-56.742] (-69.257) (-59.581) * (-61.075) (-57.921) (-60.963) [-58.605] -- 0:04:29
168000 -- (-59.156) [-56.536] (-63.770) (-57.967) * (-58.945) (-57.726) [-59.480] (-57.034) -- 0:04:27
169000 -- (-58.963) [-60.252] (-58.155) (-59.744) * (-57.362) (-57.480) [-56.404] (-59.012) -- 0:04:25
170000 -- (-60.662) [-63.152] (-58.602) (-56.769) * (-57.906) (-57.795) [-57.282] (-57.180) -- 0:04:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
171000 -- (-58.788) [-58.287] (-60.493) (-58.677) * (-57.368) (-58.466) [-58.515] (-61.510) -- 0:04:26
172000 -- (-60.393) [-57.127] (-61.496) (-57.633) * (-56.821) (-58.649) [-57.401] (-61.784) -- 0:04:24
173000 -- (-62.318) (-59.758) [-56.777] (-61.854) * (-59.025) (-57.101) [-57.822] (-60.802) -- 0:04:27
174000 -- (-60.461) (-62.031) [-57.483] (-59.383) * (-58.636) (-57.298) [-57.536] (-59.157) -- 0:04:25
175000 -- (-57.504) (-64.098) [-57.092] (-57.255) * (-58.814) (-57.400) [-57.255] (-56.771) -- 0:04:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
176000 -- (-59.078) (-57.512) [-58.084] (-57.304) * (-57.832) (-56.914) [-58.242] (-56.982) -- 0:04:22
177000 -- (-56.671) (-57.907) [-57.114] (-57.242) * (-60.019) (-58.556) [-58.424] (-56.597) -- 0:04:25
178000 -- (-58.661) (-59.881) [-56.815] (-60.881) * (-60.258) [-59.675] (-59.116) (-57.994) -- 0:04:23
179000 -- (-57.742) (-58.359) [-56.474] (-60.168) * [-58.165] (-58.549) (-59.514) (-61.512) -- 0:04:21
180000 -- (-56.311) [-57.485] (-58.672) (-61.370) * (-59.138) (-57.338) [-57.492] (-56.355) -- 0:04:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
181000 -- (-59.616) [-57.086] (-57.816) (-57.229) * (-60.449) (-57.727) [-59.486] (-63.570) -- 0:04:22
182000 -- (-64.068) [-58.200] (-57.965) (-57.511) * (-58.197) (-58.895) [-57.489] (-60.881) -- 0:04:20
183000 -- (-59.206) [-57.964] (-59.234) (-61.482) * (-65.640) (-63.166) (-58.297) [-59.193] -- 0:04:23
184000 -- (-56.214) [-60.392] (-60.087) (-59.399) * (-61.247) (-65.527) (-60.008) [-56.579] -- 0:04:21
185000 -- (-61.654) [-59.971] (-62.481) (-64.127) * (-57.761) [-57.934] (-61.340) (-57.731) -- 0:04:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
186000 -- (-64.303) [-57.812] (-57.589) (-61.456) * (-57.615) (-57.969) (-58.037) [-56.667] -- 0:04:22
187000 -- (-57.464) [-57.068] (-59.676) (-58.892) * [-58.363] (-59.123) (-57.894) (-59.624) -- 0:04:20
188000 -- (-57.384) [-57.036] (-56.258) (-61.348) * (-57.051) (-56.473) (-57.852) [-59.468] -- 0:04:19
189000 -- (-58.020) [-59.116] (-61.233) (-57.625) * [-57.391] (-60.494) (-56.760) (-58.401) -- 0:04:21
190000 -- (-59.929) [-56.966] (-59.626) (-58.596) * (-58.930) [-57.955] (-56.706) (-57.369) -- 0:04:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
191000 -- (-59.952) [-56.652] (-56.155) (-60.606) * (-61.354) [-57.196] (-57.720) (-58.252) -- 0:04:18
192000 -- (-57.869) (-59.231) (-57.446) [-60.040] * (-62.261) [-58.481] (-56.873) (-63.197) -- 0:04:20
193000 -- (-57.465) [-58.908] (-57.697) (-57.523) * (-64.899) [-57.905] (-59.184) (-62.370) -- 0:04:19
194000 -- (-59.356) [-60.463] (-57.092) (-59.692) * (-62.550) (-56.978) [-62.003] (-57.901) -- 0:04:17
195000 -- (-56.682) (-60.886) (-58.675) [-58.630] * (-57.847) (-56.918) [-57.596] (-58.317) -- 0:04:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
196000 -- (-61.340) (-62.443) (-57.042) [-60.990] * (-60.565) (-59.648) (-58.616) [-59.836] -- 0:04:18
197000 -- [-56.910] (-62.404) (-58.023) (-57.687) * (-58.547) [-56.922] (-59.657) (-57.880) -- 0:04:16
198000 -- [-58.048] (-58.013) (-63.669) (-57.535) * (-57.451) [-56.495] (-59.499) (-57.922) -- 0:04:19
199000 -- [-57.811] (-57.678) (-57.617) (-57.752) * (-58.130) [-57.588] (-62.513) (-61.661) -- 0:04:17
200000 -- [-58.495] (-56.847) (-56.771) (-57.123) * (-60.213) [-58.090] (-61.504) (-59.013) -- 0:04:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
201000 -- (-60.576) (-56.741) (-58.033) [-59.727] * (-61.146) [-56.370] (-57.130) (-58.501) -- 0:04:14
202000 -- [-56.791] (-57.784) (-61.011) (-56.812) * (-57.619) [-60.291] (-57.482) (-62.216) -- 0:04:16
203000 -- [-58.331] (-57.848) (-57.510) (-60.521) * (-58.861) [-57.927] (-57.468) (-57.647) -- 0:04:15
204000 -- [-58.749] (-58.750) (-57.773) (-57.959) * (-59.719) (-56.939) [-57.535] (-59.058) -- 0:04:13
205000 -- [-63.857] (-58.258) (-56.637) (-56.643) * (-57.488) [-56.992] (-60.680) (-58.539) -- 0:04:15
Average standard deviation of split frequencies: NA (no splits above min. frequency)
206000 -- [-57.221] (-58.548) (-57.622) (-62.049) * (-56.703) [-58.509] (-59.584) (-63.712) -- 0:04:14
207000 -- [-58.070] (-62.399) (-57.550) (-62.397) * [-57.704] (-56.278) (-58.470) (-59.163) -- 0:04:12
208000 -- [-56.167] (-57.934) (-61.739) (-60.808) * [-58.319] (-58.430) (-60.401) (-58.552) -- 0:04:15
209000 -- (-57.391) (-58.804) (-57.682) [-58.300] * [-57.015] (-59.544) (-57.184) (-58.688) -- 0:04:13
210000 -- [-57.946] (-58.203) (-56.638) (-59.827) * [-56.998] (-59.623) (-59.241) (-57.384) -- 0:04:12
Average standard deviation of split frequencies: NA (no splits above min. frequency)
211000 -- [-60.943] (-56.624) (-57.407) (-57.653) * (-59.523) [-59.274] (-58.514) (-57.021) -- 0:04:14
212000 -- [-60.949] (-58.065) (-61.262) (-64.031) * (-58.702) (-57.761) (-58.766) [-57.295] -- 0:04:12
213000 -- [-59.863] (-58.602) (-58.075) (-61.705) * (-62.757) (-59.665) (-56.890) [-59.347] -- 0:04:11
214000 -- (-58.659) [-57.546] (-60.361) (-57.963) * (-56.921) (-57.962) (-57.761) [-57.546] -- 0:04:13
215000 -- (-57.791) (-58.063) (-62.338) [-56.386] * (-58.334) [-61.202] (-58.791) (-60.597) -- 0:04:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
216000 -- (-58.282) (-61.663) [-60.835] (-59.596) * (-58.620) [-60.358] (-58.935) (-59.692) -- 0:04:10
217000 -- (-57.782) (-58.783) [-59.780] (-56.231) * (-58.041) [-59.603] (-60.822) (-57.270) -- 0:04:12
218000 -- (-58.080) (-61.255) [-57.032] (-59.749) * (-59.133) [-56.816] (-57.138) (-56.827) -- 0:04:11
219000 -- (-57.569) (-58.418) (-56.778) [-56.695] * (-58.799) [-57.807] (-59.419) (-56.788) -- 0:04:09
220000 -- (-59.949) (-57.117) (-58.846) [-58.915] * (-57.251) (-64.135) (-58.115) [-58.275] -- 0:04:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
221000 -- (-59.035) (-56.511) (-58.006) [-59.814] * (-60.637) (-59.727) (-56.647) [-58.093] -- 0:04:10
222000 -- (-61.966) (-57.523) (-57.114) [-59.324] * (-60.498) (-58.016) (-58.868) [-56.989] -- 0:04:08
223000 -- (-58.578) (-58.170) (-56.563) [-64.013] * (-57.959) (-58.511) (-58.662) [-57.510] -- 0:04:07
224000 -- [-57.837] (-57.996) (-65.505) (-59.433) * (-58.919) (-58.905) (-58.644) [-56.707] -- 0:04:09
225000 -- [-60.792] (-57.442) (-63.106) (-61.052) * (-59.377) (-60.925) (-58.844) [-57.795] -- 0:04:08
Average standard deviation of split frequencies: NA (no splits above min. frequency)
226000 -- [-57.153] (-59.775) (-59.805) (-58.169) * (-60.462) (-61.965) (-59.323) [-58.931] -- 0:04:06
227000 -- (-58.493) (-61.721) (-58.666) [-61.775] * (-58.547) (-58.462) (-57.862) [-57.281] -- 0:04:08
228000 -- (-56.781) (-60.055) (-59.368) [-57.013] * (-58.656) (-57.981) (-57.424) [-61.185] -- 0:04:07
229000 -- (-58.807) (-59.923) (-58.826) [-59.268] * (-57.981) (-58.278) (-60.156) [-63.163] -- 0:04:05
230000 -- (-58.720) (-56.847) (-59.735) [-59.872] * (-56.392) [-57.667] (-60.032) (-56.706) -- 0:04:07
Average standard deviation of split frequencies: NA (no splits above min. frequency)
231000 -- (-59.517) (-59.916) (-57.567) [-59.162] * (-57.600) [-59.811] (-65.378) (-58.260) -- 0:04:06
232000 -- (-58.398) (-57.474) (-59.395) [-57.658] * (-57.209) (-60.079) (-63.770) [-61.008] -- 0:04:04
233000 -- (-59.004) (-58.279) [-61.788] (-58.796) * (-60.629) (-58.573) (-63.201) [-61.058] -- 0:04:06
234000 -- (-59.893) (-57.367) [-59.204] (-57.853) * (-57.041) (-58.397) (-58.273) [-57.891] -- 0:04:05
235000 -- (-60.544) [-59.444] (-59.513) (-59.207) * (-59.479) [-56.570] (-58.794) (-57.202) -- 0:04:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
236000 -- (-60.274) [-60.493] (-57.649) (-57.965) * (-60.558) [-59.279] (-57.108) (-65.526) -- 0:04:06
237000 -- (-57.476) [-60.384] (-56.760) (-58.629) * (-61.941) [-56.757] (-58.989) (-63.373) -- 0:04:04
238000 -- (-61.041) [-59.486] (-57.360) (-57.236) * (-59.620) [-58.456] (-57.797) (-59.948) -- 0:04:03
239000 -- (-60.390) (-58.736) (-56.641) [-58.132] * (-61.124) [-57.789] (-57.302) (-61.648) -- 0:04:05
240000 -- (-60.178) (-60.065) (-58.074) [-57.649] * (-59.078) [-60.821] (-61.805) (-56.729) -- 0:04:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
241000 -- (-64.224) (-59.255) (-59.327) [-60.936] * (-57.296) [-60.244] (-56.687) (-59.035) -- 0:04:02
242000 -- (-61.470) (-63.654) (-59.152) [-58.096] * (-59.758) [-57.687] (-56.920) (-63.915) -- 0:04:01
243000 -- (-57.023) (-60.315) (-59.518) [-57.363] * (-58.072) [-58.065] (-64.978) (-58.575) -- 0:04:02
244000 -- (-57.564) [-58.917] (-60.303) (-59.036) * (-56.657) [-58.578] (-58.247) (-60.595) -- 0:04:01
245000 -- (-56.484) [-56.427] (-58.341) (-57.750) * (-58.716) [-59.822] (-57.374) (-58.505) -- 0:04:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
246000 -- (-56.574) [-56.454] (-59.883) (-57.408) * (-59.863) [-62.502] (-62.295) (-58.252) -- 0:04:02
247000 -- (-57.352) (-57.940) (-59.613) [-57.988] * (-58.834) (-60.477) (-58.188) [-58.755] -- 0:04:00
248000 -- (-58.537) (-57.268) (-58.496) [-57.985] * (-60.293) (-66.006) (-58.762) [-60.031] -- 0:03:59
249000 -- (-58.594) [-57.789] (-59.791) (-59.209) * (-60.847) (-58.544) (-58.277) [-57.426] -- 0:04:01
250000 -- (-58.340) [-63.463] (-60.952) (-56.909) * (-59.090) (-58.225) (-59.322) [-56.705] -- 0:04:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
251000 -- (-60.630) (-60.041) [-57.294] (-58.344) * (-57.024) (-59.323) (-60.174) [-58.192] -- 0:03:58
252000 -- (-57.485) (-60.033) [-56.297] (-59.154) * [-57.363] (-58.184) (-59.756) (-59.407) -- 0:04:00
253000 -- (-57.065) [-58.360] (-58.279) (-56.846) * (-58.464) [-59.408] (-57.600) (-56.935) -- 0:03:59
254000 -- (-60.121) [-56.880] (-57.448) (-58.405) * (-58.279) [-57.590] (-56.702) (-59.294) -- 0:03:57
255000 -- (-57.717) (-59.906) [-56.779] (-58.238) * (-61.749) [-58.434] (-59.861) (-58.049) -- 0:03:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
256000 -- (-59.370) (-59.922) [-59.084] (-62.102) * (-57.436) [-58.902] (-59.247) (-64.095) -- 0:03:58
257000 -- (-60.616) [-58.472] (-58.802) (-63.969) * (-59.341) [-58.776] (-59.256) (-57.181) -- 0:03:57
258000 -- (-57.499) [-56.962] (-59.496) (-58.009) * (-57.143) [-58.171] (-69.951) (-59.861) -- 0:03:58
259000 -- (-56.772) [-58.928] (-56.969) (-59.262) * (-60.911) [-57.180] (-58.001) (-59.025) -- 0:03:57
260000 -- (-59.445) (-58.073) [-59.143] (-57.798) * (-56.856) [-60.580] (-59.077) (-58.449) -- 0:03:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
261000 -- (-59.381) (-57.583) [-59.267] (-59.102) * (-58.059) [-57.146] (-59.875) (-59.981) -- 0:03:57
262000 -- (-58.464) (-56.972) [-57.074] (-61.694) * (-57.022) [-58.601] (-57.482) (-60.467) -- 0:03:56
263000 -- (-57.625) (-59.249) [-58.170] (-60.547) * (-57.491) [-56.788] (-57.022) (-57.911) -- 0:03:55
264000 -- (-58.275) (-56.664) [-58.424] (-57.097) * (-58.748) [-56.480] (-61.300) (-60.005) -- 0:03:56
265000 -- (-59.609) (-58.191) [-57.289] (-58.071) * (-61.977) [-65.151] (-57.632) (-57.712) -- 0:03:55
Average standard deviation of split frequencies: NA (no splits above min. frequency)
266000 -- (-58.377) (-56.532) [-57.841] (-57.707) * (-63.293) (-60.287) (-59.440) [-59.553] -- 0:03:54
267000 -- (-59.098) (-59.427) (-57.124) [-57.139] * (-63.408) [-59.173] (-58.052) (-58.774) -- 0:03:53
268000 -- (-59.152) (-58.161) (-58.155) [-58.181] * [-57.121] (-63.444) (-57.892) (-59.042) -- 0:03:54
269000 -- (-57.761) (-56.416) (-58.182) [-58.140] * (-61.421) (-60.760) [-59.159] (-59.232) -- 0:03:53
270000 -- [-58.401] (-59.889) (-60.658) (-58.170) * (-58.978) (-65.544) [-58.510] (-58.463) -- 0:03:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
271000 -- (-60.613) (-59.019) (-56.380) [-56.570] * (-57.842) (-60.284) [-57.201] (-57.882) -- 0:03:54
272000 -- [-58.198] (-58.331) (-57.792) (-59.422) * (-57.260) (-56.770) (-57.278) [-58.684] -- 0:03:52
273000 -- [-56.692] (-59.948) (-58.050) (-56.838) * (-57.501) (-57.453) (-57.815) [-57.278] -- 0:03:51
274000 -- [-57.014] (-58.820) (-59.069) (-57.950) * (-57.926) [-61.082] (-58.499) (-57.952) -- 0:03:53
275000 -- (-56.704) [-56.274] (-57.658) (-57.828) * (-63.465) (-60.239) (-57.106) [-56.835] -- 0:03:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
276000 -- (-58.555) [-60.298] (-58.205) (-57.808) * [-57.276] (-58.701) (-56.331) (-56.512) -- 0:03:50
277000 -- (-56.979) (-57.070) [-57.688] (-57.728) * (-61.588) (-58.192) (-58.143) [-57.744] -- 0:03:52
278000 -- (-61.541) (-60.907) [-58.443] (-56.316) * (-59.385) (-56.612) (-57.674) [-58.618] -- 0:03:51
279000 -- (-61.577) (-59.252) [-59.312] (-56.158) * (-57.985) (-58.157) (-57.954) [-57.138] -- 0:03:49
280000 -- (-58.860) (-61.617) [-59.631] (-57.963) * (-57.358) (-59.947) (-58.377) [-57.623] -- 0:03:51
Average standard deviation of split frequencies: NA (no splits above min. frequency)
281000 -- (-57.290) (-58.141) [-58.405] (-61.860) * (-57.651) (-59.014) (-58.300) [-58.247] -- 0:03:50
282000 -- (-56.131) (-56.867) [-62.472] (-60.347) * (-58.967) (-57.758) (-60.461) [-58.959] -- 0:03:49
283000 -- (-57.279) (-59.235) [-57.683] (-57.643) * (-56.744) (-58.909) (-57.938) [-57.784] -- 0:03:50
284000 -- [-58.159] (-56.286) (-59.121) (-58.181) * (-58.176) (-57.946) (-57.987) [-57.421] -- 0:03:49
285000 -- (-58.705) (-57.969) (-58.313) [-62.781] * (-56.499) [-58.772] (-60.698) (-57.201) -- 0:03:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
286000 -- (-59.336) (-56.610) (-59.903) [-60.777] * [-60.848] (-58.316) (-59.384) (-63.683) -- 0:03:49
287000 -- [-61.407] (-57.977) (-62.832) (-62.744) * [-57.742] (-57.909) (-58.389) (-59.600) -- 0:03:48
288000 -- (-56.834) (-59.152) (-58.711) [-59.605] * [-56.935] (-56.575) (-57.822) (-61.145) -- 0:03:47
289000 -- (-60.107) (-58.085) (-58.649) [-58.930] * [-57.396] (-58.136) (-57.082) (-56.631) -- 0:03:48
290000 -- (-57.645) (-59.244) (-59.553) [-57.060] * [-59.378] (-58.542) (-56.579) (-59.733) -- 0:03:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
291000 -- (-58.798) (-57.719) (-56.612) [-56.952] * [-59.473] (-63.491) (-58.006) (-59.202) -- 0:03:46
292000 -- [-57.059] (-60.266) (-56.289) (-57.317) * [-58.173] (-59.630) (-62.718) (-57.244) -- 0:03:47
293000 -- [-56.856] (-58.921) (-58.539) (-62.580) * [-60.684] (-56.874) (-61.360) (-56.270) -- 0:03:46
294000 -- [-59.155] (-59.387) (-56.664) (-59.652) * [-59.798] (-57.477) (-56.666) (-60.309) -- 0:03:45
295000 -- [-59.313] (-58.705) (-56.655) (-61.671) * (-59.690) [-58.961] (-56.670) (-58.288) -- 0:03:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
296000 -- [-58.126] (-58.320) (-58.986) (-63.348) * (-59.869) [-59.490] (-61.794) (-57.877) -- 0:03:45
297000 -- [-57.980] (-57.975) (-58.949) (-60.453) * [-58.963] (-60.864) (-57.537) (-56.455) -- 0:03:44
298000 -- [-56.937] (-58.590) (-58.502) (-59.972) * [-58.793] (-61.477) (-57.296) (-58.437) -- 0:03:43
299000 -- [-60.876] (-58.863) (-61.270) (-56.940) * [-56.700] (-59.698) (-57.639) (-57.315) -- 0:03:45
300000 -- (-62.330) [-61.929] (-59.780) (-56.650) * [-58.016] (-58.687) (-58.393) (-58.130) -- 0:03:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
301000 -- (-58.125) [-59.328] (-57.638) (-60.708) * [-57.167] (-59.030) (-59.452) (-58.224) -- 0:03:42
302000 -- (-57.268) (-57.892) [-58.984] (-57.308) * [-61.285] (-58.828) (-58.302) (-57.003) -- 0:03:44
303000 -- (-56.867) (-57.113) [-59.883] (-59.368) * (-60.898) (-58.203) [-58.783] (-59.279) -- 0:03:43
304000 -- (-59.877) (-57.605) [-56.758] (-59.041) * (-64.067) (-57.558) [-59.761] (-56.323) -- 0:03:42
305000 -- (-58.324) (-61.003) [-57.692] (-58.534) * (-61.765) (-58.004) [-57.415] (-56.544) -- 0:03:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
306000 -- (-56.587) (-59.426) [-57.776] (-56.684) * (-57.570) (-59.496) [-60.993] (-62.201) -- 0:03:42
307000 -- (-56.697) (-58.318) [-57.993] (-59.801) * (-56.602) (-60.406) [-56.941] (-57.046) -- 0:03:41
308000 -- (-56.779) (-60.649) [-58.487] (-57.015) * (-58.748) (-56.980) [-57.020] (-57.556) -- 0:03:42
309000 -- (-62.799) (-57.431) [-59.683] (-57.951) * (-57.994) (-58.807) [-58.976] (-63.756) -- 0:03:41
310000 -- (-58.302) (-58.795) [-58.750] (-56.761) * [-56.686] (-60.343) (-57.399) (-57.100) -- 0:03:40
Average standard deviation of split frequencies: NA (no splits above min. frequency)
311000 -- (-56.576) (-63.332) [-58.164] (-57.101) * [-59.822] (-57.431) (-56.941) (-59.528) -- 0:03:41
312000 -- (-59.299) (-64.004) [-58.833] (-57.524) * [-60.853] (-57.726) (-57.570) (-57.439) -- 0:03:40
313000 -- (-59.796) (-58.828) [-59.572] (-57.421) * [-63.425] (-60.856) (-58.588) (-57.177) -- 0:03:39
314000 -- (-58.876) (-58.523) (-59.849) [-58.322] * (-59.219) (-58.370) (-58.294) [-56.571] -- 0:03:38
315000 -- [-58.295] (-60.277) (-56.837) (-58.724) * (-58.812) (-59.509) (-56.854) [-59.234] -- 0:03:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
316000 -- [-59.270] (-57.504) (-63.070) (-56.160) * (-60.609) (-59.470) (-58.041) [-57.935] -- 0:03:38
317000 -- [-57.514] (-57.186) (-57.752) (-57.219) * (-58.916) (-57.157) (-60.821) [-58.055] -- 0:03:37
318000 -- [-57.292] (-58.205) (-56.919) (-59.867) * (-57.384) (-61.595) (-59.598) [-56.872] -- 0:03:38
319000 -- [-56.642] (-56.495) (-57.720) (-59.182) * [-57.559] (-57.997) (-59.080) (-61.097) -- 0:03:37
320000 -- (-57.196) [-56.867] (-61.055) (-59.740) * (-57.794) (-57.160) (-57.404) [-57.086] -- 0:03:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
321000 -- [-56.776] (-56.094) (-59.562) (-58.606) * (-57.114) (-56.822) (-60.803) [-56.922] -- 0:03:37
322000 -- [-56.953] (-62.097) (-58.992) (-56.624) * (-60.722) [-57.573] (-59.481) (-56.950) -- 0:03:36
323000 -- (-57.356) [-58.079] (-63.400) (-56.945) * [-60.047] (-58.907) (-58.723) (-57.257) -- 0:03:35
324000 -- (-60.057) [-58.577] (-57.156) (-57.004) * [-58.759] (-59.356) (-56.277) (-57.716) -- 0:03:36
325000 -- (-57.710) [-56.828] (-58.021) (-57.528) * [-58.875] (-57.568) (-56.890) (-57.771) -- 0:03:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
326000 -- (-59.382) [-60.409] (-61.325) (-59.176) * [-58.098] (-57.057) (-60.388) (-57.687) -- 0:03:35
327000 -- (-58.599) (-57.275) (-59.587) [-56.391] * (-61.328) [-57.841] (-59.760) (-56.676) -- 0:03:36
328000 -- (-61.828) [-58.021] (-63.697) (-57.159) * (-59.674) [-60.790] (-58.915) (-57.077) -- 0:03:35
329000 -- (-59.911) (-58.431) [-60.557] (-59.153) * (-56.672) (-57.971) [-56.644] (-57.345) -- 0:03:34
330000 -- (-61.459) (-64.529) [-58.531] (-58.892) * (-58.636) (-56.967) [-58.167] (-57.489) -- 0:03:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
331000 -- [-62.560] (-58.166) (-59.465) (-56.826) * (-58.850) (-58.885) [-58.968] (-61.986) -- 0:03:34
332000 -- (-59.292) [-58.783] (-56.393) (-58.433) * (-58.527) (-63.104) [-60.590] (-59.188) -- 0:03:33
333000 -- (-61.290) [-57.430] (-56.906) (-57.550) * (-57.569) (-61.488) [-57.441] (-58.358) -- 0:03:34
334000 -- (-57.173) [-57.239] (-58.102) (-60.553) * (-61.141) (-58.309) [-57.209] (-58.805) -- 0:03:33
335000 -- (-58.070) [-59.371] (-57.474) (-57.700) * (-57.264) (-60.840) [-60.724] (-57.028) -- 0:03:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
336000 -- (-59.751) [-56.520] (-60.389) (-57.867) * (-57.713) [-59.263] (-56.673) (-58.269) -- 0:03:33
337000 -- (-57.852) (-57.394) (-60.133) [-59.015] * (-60.626) [-59.357] (-57.643) (-61.135) -- 0:03:32
338000 -- (-60.517) [-57.417] (-66.241) (-59.807) * (-60.598) [-59.143] (-57.976) (-61.489) -- 0:03:31
339000 -- (-60.066) [-58.029] (-59.163) (-58.386) * (-61.840) (-57.872) [-59.891] (-58.724) -- 0:03:32
340000 -- (-57.658) [-58.718] (-60.712) (-57.141) * (-58.857) (-57.680) [-58.303] (-59.990) -- 0:03:31
Average standard deviation of split frequencies: NA (no splits above min. frequency)
341000 -- (-56.887) (-57.654) [-58.272] (-57.600) * (-63.959) (-58.106) [-57.088] (-61.815) -- 0:03:30
342000 -- (-62.530) (-56.180) [-57.986] (-57.199) * (-60.517) (-58.331) [-58.833] (-56.338) -- 0:03:31
343000 -- (-63.518) [-57.129] (-60.999) (-60.025) * (-61.342) (-56.904) [-59.252] (-58.611) -- 0:03:30
344000 -- (-60.893) [-56.812] (-57.272) (-57.612) * (-60.625) (-56.870) (-57.426) [-57.520] -- 0:03:29
345000 -- (-57.819) [-56.993] (-56.585) (-59.047) * (-58.473) (-61.605) (-63.409) [-59.721] -- 0:03:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
346000 -- (-57.635) [-60.279] (-60.268) (-57.318) * (-58.396) (-61.365) [-59.761] (-56.384) -- 0:03:29
347000 -- (-57.864) [-63.415] (-56.514) (-57.241) * (-60.765) (-56.718) [-60.584] (-58.736) -- 0:03:28
348000 -- [-58.555] (-60.696) (-58.265) (-57.723) * (-56.621) (-57.602) [-60.126] (-60.622) -- 0:03:27
349000 -- [-56.244] (-63.260) (-61.923) (-60.160) * (-58.622) (-59.116) [-57.957] (-59.316) -- 0:03:28
350000 -- (-57.033) (-59.036) (-58.281) [-58.342] * [-58.230] (-57.528) (-56.625) (-59.457) -- 0:03:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
351000 -- (-60.292) [-58.199] (-58.133) (-58.303) * [-56.258] (-61.137) (-61.396) (-60.131) -- 0:03:27
352000 -- (-56.639) [-56.875] (-56.990) (-57.102) * [-56.967] (-66.045) (-60.285) (-60.034) -- 0:03:28
353000 -- (-60.086) (-58.685) [-59.121] (-57.837) * [-56.595] (-58.481) (-60.348) (-58.456) -- 0:03:27
354000 -- (-57.803) (-59.101) (-58.598) [-59.089] * [-57.530] (-58.321) (-57.443) (-60.409) -- 0:03:26
355000 -- (-57.262) (-60.562) (-59.003) [-57.140] * [-60.104] (-59.877) (-60.124) (-61.469) -- 0:03:27
Average standard deviation of split frequencies: NA (no splits above min. frequency)
356000 -- (-60.022) [-60.460] (-57.996) (-59.476) * [-59.747] (-57.880) (-62.418) (-58.325) -- 0:03:26
357000 -- [-57.571] (-57.891) (-59.620) (-60.326) * (-58.328) (-57.656) [-59.264] (-59.232) -- 0:03:25
358000 -- (-60.816) (-57.496) (-58.823) [-60.362] * (-57.047) (-58.840) [-59.679] (-57.287) -- 0:03:26
359000 -- [-57.303] (-57.569) (-61.121) (-59.218) * [-59.128] (-58.915) (-60.182) (-60.324) -- 0:03:25
360000 -- [-57.651] (-58.527) (-57.488) (-63.575) * [-58.751] (-62.946) (-61.208) (-57.607) -- 0:03:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
361000 -- [-57.851] (-57.183) (-57.080) (-57.849) * [-56.344] (-57.185) (-57.806) (-58.246) -- 0:03:25
362000 -- [-57.150] (-56.890) (-59.735) (-58.629) * [-60.672] (-58.386) (-57.468) (-57.140) -- 0:03:24
363000 -- [-59.483] (-57.460) (-58.539) (-61.658) * (-60.751) (-59.168) (-57.967) [-60.516] -- 0:03:23
364000 -- [-58.648] (-57.285) (-56.119) (-56.964) * (-62.068) (-58.727) (-61.829) [-58.066] -- 0:03:24
365000 -- [-56.434] (-58.214) (-59.620) (-56.428) * (-57.248) (-57.601) (-61.131) [-56.799] -- 0:03:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
366000 -- [-57.907] (-56.812) (-58.381) (-59.994) * (-58.431) (-57.915) (-57.838) [-58.342] -- 0:03:22
367000 -- [-59.337] (-62.503) (-57.982) (-60.469) * (-59.374) (-59.454) (-57.892) [-58.728] -- 0:03:23
368000 -- [-57.675] (-56.260) (-61.010) (-58.708) * (-64.573) (-57.566) (-56.995) [-57.960] -- 0:03:22
369000 -- [-59.324] (-59.248) (-59.029) (-60.204) * (-60.089) (-62.013) (-57.774) [-56.598] -- 0:03:21
370000 -- [-58.750] (-59.114) (-64.254) (-58.157) * (-57.636) (-59.516) (-59.798) [-57.456] -- 0:03:22
Average standard deviation of split frequencies: NA (no splits above min. frequency)
371000 -- (-58.704) [-59.236] (-57.918) (-57.429) * (-57.961) (-59.820) (-61.685) [-59.193] -- 0:03:21
372000 -- (-57.854) [-57.440] (-59.096) (-56.978) * (-57.311) (-58.297) [-57.813] (-57.732) -- 0:03:20
373000 -- (-57.201) [-59.919] (-56.836) (-58.167) * [-62.003] (-59.484) (-58.738) (-60.169) -- 0:03:21
374000 -- [-60.693] (-58.621) (-59.354) (-56.325) * [-60.572] (-57.655) (-58.495) (-59.400) -- 0:03:20
375000 -- [-60.544] (-58.539) (-57.751) (-57.038) * [-57.305] (-58.573) (-59.026) (-58.477) -- 0:03:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
376000 -- [-57.610] (-57.872) (-56.996) (-56.410) * (-59.361) (-57.127) (-57.717) [-57.286] -- 0:03:19
377000 -- [-57.625] (-58.285) (-57.170) (-56.712) * (-60.159) [-58.208] (-56.930) (-56.908) -- 0:03:19
378000 -- (-57.693) [-57.689] (-58.126) (-58.507) * (-60.102) (-58.198) (-57.485) [-59.080] -- 0:03:19
379000 -- (-58.050) (-58.602) (-59.638) [-56.602] * (-61.306) [-57.624] (-57.192) (-59.680) -- 0:03:18
380000 -- (-59.632) (-61.098) (-59.510) [-57.512] * [-57.099] (-56.167) (-62.046) (-58.176) -- 0:03:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
381000 -- (-58.285) (-59.279) (-60.135) [-57.719] * [-58.744] (-60.650) (-57.217) (-57.286) -- 0:03:18
382000 -- (-58.220) (-61.222) (-56.946) [-58.811] * [-58.398] (-58.082) (-57.872) (-57.321) -- 0:03:17
383000 -- (-58.310) (-57.567) (-60.072) [-59.056] * [-56.819] (-57.491) (-58.697) (-57.622) -- 0:03:18
384000 -- (-57.594) (-60.332) (-57.529) [-58.232] * [-58.189] (-58.143) (-60.598) (-56.191) -- 0:03:17
385000 -- (-58.860) (-59.526) (-56.731) [-56.922] * [-57.744] (-58.946) (-56.656) (-58.979) -- 0:03:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
386000 -- (-60.784) (-58.416) (-57.683) [-59.253] * (-58.411) (-61.329) (-57.899) [-59.950] -- 0:03:17
387000 -- (-58.334) (-57.933) (-58.955) [-57.166] * [-57.627] (-59.434) (-60.016) (-59.291) -- 0:03:16
388000 -- (-57.315) (-60.904) (-57.245) [-57.852] * [-57.708] (-59.856) (-56.856) (-58.006) -- 0:03:15
389000 -- (-57.206) [-62.915] (-56.628) (-59.479) * [-58.607] (-59.232) (-59.553) (-56.854) -- 0:03:16
390000 -- (-58.057) [-57.096] (-58.260) (-59.136) * [-57.555] (-60.409) (-61.556) (-58.675) -- 0:03:15
Average standard deviation of split frequencies: NA (no splits above min. frequency)
391000 -- (-58.476) [-60.484] (-56.726) (-59.740) * [-62.496] (-58.030) (-59.631) (-57.566) -- 0:03:14
392000 -- (-58.336) (-57.571) (-61.087) [-57.641] * (-61.678) (-57.342) [-60.470] (-57.379) -- 0:03:15
393000 -- (-58.514) (-57.516) (-58.357) [-57.334] * (-57.420) (-61.386) [-60.360] (-61.204) -- 0:03:14
394000 -- [-57.873] (-58.762) (-57.204) (-67.047) * (-57.871) (-58.976) [-57.161] (-58.826) -- 0:03:13
395000 -- (-57.798) [-57.433] (-57.907) (-62.600) * (-57.116) (-57.199) [-62.762] (-57.945) -- 0:03:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
396000 -- (-59.842) [-59.550] (-59.032) (-62.233) * (-56.681) (-57.675) [-58.107] (-57.476) -- 0:03:13
397000 -- (-57.064) [-57.595] (-61.519) (-60.249) * (-59.170) (-59.057) (-57.287) [-58.394] -- 0:03:12
398000 -- (-59.034) [-57.988] (-57.431) (-58.195) * [-56.591] (-63.643) (-56.573) (-57.134) -- 0:03:13
399000 -- (-58.598) (-56.748) (-56.300) [-58.436] * (-56.489) (-56.824) (-59.546) [-61.854] -- 0:03:12
400000 -- (-56.545) (-57.129) (-57.389) [-57.980] * (-62.502) (-58.375) (-57.060) [-58.071] -- 0:03:12
Average standard deviation of split frequencies: NA (no splits above min. frequency)
401000 -- (-60.109) (-62.233) (-56.319) [-56.471] * (-59.294) (-61.600) (-56.672) [-60.124] -- 0:03:12
402000 -- (-61.310) (-58.818) (-57.801) [-58.672] * (-59.642) (-60.829) [-58.089] (-57.305) -- 0:03:11
403000 -- (-58.969) (-59.151) (-56.640) [-57.021] * (-58.839) (-58.609) [-57.337] (-56.153) -- 0:03:11
404000 -- (-56.749) (-56.529) (-57.867) [-56.720] * (-57.236) (-57.164) (-57.571) [-58.251] -- 0:03:10
405000 -- [-56.774] (-59.508) (-58.520) (-58.265) * (-61.568) (-57.188) [-57.171] (-59.798) -- 0:03:10
Average standard deviation of split frequencies: NA (no splits above min. frequency)
406000 -- [-57.063] (-57.037) (-61.619) (-57.098) * (-60.079) [-61.894] (-57.598) (-58.131) -- 0:03:10
407000 -- [-57.663] (-58.993) (-58.661) (-56.436) * (-57.613) [-57.971] (-60.555) (-57.058) -- 0:03:09
408000 -- [-61.572] (-58.286) (-58.127) (-57.634) * (-61.632) [-57.451] (-58.227) (-57.933) -- 0:03:10
409000 -- [-58.084] (-57.514) (-60.966) (-62.732) * (-59.702) [-60.549] (-59.875) (-59.580) -- 0:03:09
410000 -- (-61.706) (-58.071) [-57.748] (-60.668) * (-58.344) [-57.319] (-57.379) (-58.132) -- 0:03:08
Average standard deviation of split frequencies: NA (no splits above min. frequency)
411000 -- (-56.874) (-57.235) [-58.788] (-61.867) * (-59.992) [-57.852] (-57.762) (-58.092) -- 0:03:09
412000 -- [-58.912] (-59.443) (-59.631) (-60.928) * (-61.355) (-57.320) (-57.767) [-56.882] -- 0:03:08
413000 -- [-58.100] (-56.164) (-57.434) (-56.900) * (-61.144) (-60.602) (-58.186) [-59.271] -- 0:03:09
414000 -- (-59.908) [-57.729] (-63.671) (-58.164) * (-57.715) (-56.947) (-63.989) [-58.348] -- 0:03:08
415000 -- (-59.115) [-59.070] (-59.388) (-58.877) * (-58.452) [-56.754] (-57.955) (-58.625) -- 0:03:07
Average standard deviation of split frequencies: NA (no splits above min. frequency)
416000 -- (-59.580) [-57.185] (-59.164) (-57.456) * (-56.844) (-66.364) (-56.974) [-59.218] -- 0:03:08
417000 -- (-60.526) (-57.269) (-61.502) [-57.620] * (-58.110) (-58.169) (-60.083) [-65.209] -- 0:03:07
418000 -- (-57.380) (-57.532) (-56.312) [-59.133] * (-57.332) [-59.443] (-57.862) (-58.414) -- 0:03:06
419000 -- (-58.683) (-58.095) (-58.307) [-56.484] * (-60.177) (-57.510) [-58.517] (-59.054) -- 0:03:05
420000 -- [-58.026] (-57.970) (-58.287) (-57.656) * (-57.485) (-58.996) [-56.574] (-59.776) -- 0:03:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
421000 -- (-56.765) (-58.311) [-57.426] (-56.546) * (-60.789) (-56.758) [-57.629] (-59.156) -- 0:03:05
422000 -- (-56.758) (-56.858) [-58.769] (-58.852) * (-63.343) (-59.966) [-57.651] (-60.762) -- 0:03:04
423000 -- (-56.998) (-60.545) [-57.428] (-58.122) * [-56.683] (-56.386) (-56.915) (-58.100) -- 0:03:05
424000 -- (-59.572) (-59.813) [-57.333] (-58.678) * [-57.681] (-59.188) (-60.165) (-57.275) -- 0:03:04
425000 -- (-60.265) (-56.911) (-57.381) [-58.790] * [-58.240] (-58.885) (-61.477) (-59.120) -- 0:03:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
426000 -- (-59.522) (-57.780) (-57.996) [-60.050] * [-58.879] (-57.225) (-61.677) (-60.547) -- 0:03:04
427000 -- (-58.969) (-57.080) (-57.966) [-57.356] * [-60.074] (-57.974) (-57.423) (-62.583) -- 0:03:03
428000 -- (-59.316) (-61.163) (-59.486) [-57.813] * [-58.246] (-57.373) (-58.258) (-59.222) -- 0:03:03
429000 -- (-61.782) [-57.490] (-58.434) (-59.180) * [-59.228] (-59.259) (-60.326) (-58.010) -- 0:03:03
430000 -- (-59.993) [-57.921] (-57.660) (-57.297) * [-56.417] (-61.034) (-57.804) (-57.107) -- 0:03:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
431000 -- (-57.465) [-59.408] (-57.595) (-64.780) * [-63.854] (-56.155) (-56.912) (-58.309) -- 0:03:02
432000 -- (-59.376) [-58.469] (-58.219) (-59.957) * (-58.792) (-56.864) [-57.313] (-58.016) -- 0:03:02
433000 -- (-61.265) [-56.278] (-60.124) (-58.267) * (-60.299) (-57.638) [-57.047] (-57.731) -- 0:03:02
434000 -- (-56.487) [-57.507] (-57.897) (-57.071) * (-60.741) (-57.277) [-56.760] (-57.471) -- 0:03:01
435000 -- [-61.586] (-60.757) (-58.308) (-58.567) * (-58.210) (-59.167) [-57.803] (-58.484) -- 0:03:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
436000 -- [-57.050] (-58.770) (-58.218) (-60.285) * (-57.928) (-61.289) [-57.822] (-56.627) -- 0:03:01
437000 -- [-56.238] (-58.697) (-57.155) (-57.585) * (-57.505) (-61.492) [-57.244] (-59.453) -- 0:03:00
438000 -- [-60.530] (-58.679) (-56.682) (-56.407) * (-59.968) (-58.196) [-58.225] (-59.031) -- 0:03:00
439000 -- [-58.580] (-58.370) (-58.055) (-59.030) * (-60.724) (-59.233) [-56.779] (-57.403) -- 0:03:00
440000 -- [-57.915] (-57.560) (-57.016) (-57.565) * (-57.206) (-61.676) [-60.256] (-64.241) -- 0:02:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
441000 -- (-57.481) [-60.827] (-57.587) (-57.352) * (-59.012) (-63.040) [-58.728] (-61.728) -- 0:02:58
442000 -- (-56.243) [-57.766] (-56.848) (-57.225) * (-58.985) (-57.551) (-57.700) [-57.798] -- 0:02:59
443000 -- (-58.641) [-61.215] (-57.240) (-56.262) * (-56.960) (-60.337) (-57.419) [-57.310] -- 0:02:58
444000 -- (-59.334) [-57.473] (-60.703) (-56.675) * (-57.989) (-57.255) (-58.336) [-58.043] -- 0:02:57
445000 -- (-64.519) (-58.563) (-57.472) [-60.743] * (-56.472) (-58.756) (-57.710) [-57.649] -- 0:02:58
Average standard deviation of split frequencies: NA (no splits above min. frequency)
446000 -- (-56.815) (-64.572) (-57.808) [-60.918] * (-59.522) (-58.059) (-60.246) [-59.657] -- 0:02:57
447000 -- (-58.905) (-56.471) [-56.425] (-59.845) * (-57.811) (-57.467) (-58.050) [-59.082] -- 0:02:56
448000 -- (-60.610) (-57.735) [-58.382] (-63.177) * (-56.820) [-57.075] (-59.199) (-57.865) -- 0:02:57
449000 -- [-57.527] (-59.563) (-57.967) (-57.277) * (-58.430) [-57.747] (-59.345) (-58.125) -- 0:02:56
450000 -- [-58.650] (-59.388) (-56.902) (-59.716) * (-57.130) [-60.760] (-59.300) (-58.540) -- 0:02:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
451000 -- (-57.049) (-59.023) (-59.345) [-58.702] * (-57.345) [-58.418] (-57.489) (-56.692) -- 0:02:56
452000 -- (-59.877) (-56.993) (-57.277) [-59.166] * (-58.204) [-59.466] (-57.717) (-57.925) -- 0:02:55
453000 -- (-61.785) (-56.742) (-59.554) [-56.826] * (-58.152) [-57.340] (-57.565) (-59.587) -- 0:02:55
454000 -- (-63.745) (-58.671) [-56.497] (-56.206) * (-57.259) [-56.260] (-57.177) (-58.817) -- 0:02:55
455000 -- (-63.139) (-58.689) [-58.224] (-57.083) * (-62.029) [-58.320] (-58.556) (-61.707) -- 0:02:54
Average standard deviation of split frequencies: NA (no splits above min. frequency)
456000 -- (-62.099) (-59.483) [-56.834] (-57.119) * (-58.475) [-57.270] (-59.158) (-60.854) -- 0:02:54
457000 -- (-60.618) [-58.324] (-57.878) (-57.092) * (-65.789) [-59.544] (-59.537) (-56.169) -- 0:02:54
458000 -- (-57.232) [-56.950] (-59.089) (-64.914) * (-57.270) (-60.180) [-57.238] (-56.569) -- 0:02:53
459000 -- [-58.695] (-59.372) (-57.212) (-60.135) * (-59.787) (-56.461) [-57.660] (-56.709) -- 0:02:53
460000 -- [-57.291] (-56.411) (-58.795) (-59.570) * (-58.405) (-57.369) [-58.336] (-61.472) -- 0:02:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
461000 -- (-65.215) [-57.170] (-62.835) (-59.840) * (-59.014) (-57.485) [-58.664] (-62.244) -- 0:02:53
462000 -- [-58.608] (-59.908) (-57.384) (-59.949) * (-58.392) (-61.001) [-56.906] (-56.992) -- 0:02:52
463000 -- [-59.033] (-60.793) (-59.152) (-60.041) * (-57.383) (-56.797) [-59.029] (-58.018) -- 0:02:51
464000 -- (-58.013) (-56.735) (-59.228) [-58.040] * (-61.684) (-56.944) [-57.393] (-57.279) -- 0:02:52
465000 -- (-60.393) (-58.843) (-58.400) [-62.304] * [-57.462] (-59.524) (-56.370) (-57.966) -- 0:02:51
Average standard deviation of split frequencies: NA (no splits above min. frequency)
466000 -- (-62.971) (-56.883) (-56.818) [-57.149] * [-56.504] (-59.720) (-57.967) (-59.379) -- 0:02:50
467000 -- (-60.602) (-58.250) (-58.623) [-56.453] * [-57.640] (-60.069) (-59.045) (-61.118) -- 0:02:51
468000 -- (-57.287) (-59.089) (-58.388) [-56.934] * [-56.742] (-59.413) (-60.279) (-56.621) -- 0:02:50
469000 -- (-58.994) (-57.657) (-57.852) [-57.438] * [-58.409] (-58.835) (-57.261) (-57.607) -- 0:02:49
470000 -- [-57.531] (-58.880) (-57.452) (-60.647) * [-59.198] (-59.579) (-57.501) (-58.088) -- 0:02:50
Average standard deviation of split frequencies: NA (no splits above min. frequency)
471000 -- [-56.425] (-57.486) (-58.956) (-57.582) * (-57.594) (-59.325) (-57.673) [-56.813] -- 0:02:49
472000 -- [-57.548] (-61.324) (-60.893) (-60.421) * (-61.775) (-60.888) (-59.004) [-58.987] -- 0:02:48
473000 -- [-58.162] (-58.607) (-62.260) (-58.286) * (-59.116) (-57.007) (-61.748) [-56.424] -- 0:02:49
474000 -- [-60.292] (-59.779) (-58.636) (-57.521) * (-61.745) (-56.715) (-57.280) [-57.527] -- 0:02:48
475000 -- [-57.961] (-58.118) (-60.225) (-61.952) * (-59.308) (-58.297) (-56.504) [-56.276] -- 0:02:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
476000 -- [-56.715] (-57.396) (-59.569) (-58.987) * (-63.931) [-59.149] (-56.248) (-58.016) -- 0:02:48
477000 -- [-57.902] (-56.569) (-60.079) (-58.745) * (-56.664) (-59.402) [-60.839] (-60.921) -- 0:02:47
478000 -- [-58.319] (-59.995) (-61.764) (-56.718) * (-56.807) (-58.046) [-59.692] (-63.742) -- 0:02:47
479000 -- [-57.865] (-60.118) (-61.946) (-57.833) * (-59.851) [-60.381] (-56.733) (-60.522) -- 0:02:47
480000 -- (-58.306) (-60.446) (-57.379) [-57.370] * (-57.457) [-56.853] (-56.949) (-56.658) -- 0:02:46
Average standard deviation of split frequencies: NA (no splits above min. frequency)
481000 -- (-58.144) (-57.666) [-60.319] (-58.765) * (-56.856) [-56.752] (-59.472) (-58.811) -- 0:02:46
482000 -- (-60.383) [-58.739] (-57.444) (-56.739) * (-59.994) [-59.301] (-58.418) (-63.365) -- 0:02:46
483000 -- (-56.367) [-57.090] (-58.847) (-58.136) * (-57.757) [-62.603] (-59.054) (-57.492) -- 0:02:45
484000 -- (-57.178) (-59.723) (-62.267) [-57.882] * (-58.721) [-62.402] (-57.520) (-60.261) -- 0:02:45
485000 -- (-61.612) [-58.296] (-57.845) (-57.586) * (-57.895) [-59.812] (-56.753) (-57.153) -- 0:02:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
486000 -- (-58.239) [-57.042] (-59.242) (-59.391) * (-59.658) (-60.328) (-57.387) [-57.928] -- 0:02:44
487000 -- (-65.058) [-56.889] (-57.591) (-58.862) * (-59.531) (-59.917) (-58.969) [-59.602] -- 0:02:44
488000 -- (-61.212) [-61.295] (-57.732) (-60.787) * (-57.916) (-58.303) (-57.561) [-58.534] -- 0:02:43
489000 -- (-56.610) [-58.451] (-59.659) (-57.950) * (-56.387) (-58.494) (-57.883) [-58.964] -- 0:02:44
490000 -- (-57.485) [-58.048] (-60.034) (-56.770) * (-56.884) (-58.985) [-58.637] (-62.578) -- 0:02:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
491000 -- (-57.391) (-60.110) [-57.871] (-58.299) * (-59.659) (-59.806) (-57.719) [-57.130] -- 0:02:42
492000 -- (-57.104) [-58.574] (-57.216) (-60.115) * (-59.186) (-56.919) [-58.873] (-59.857) -- 0:02:43
493000 -- (-58.636) (-60.997) [-57.012] (-57.469) * (-57.229) (-59.002) [-61.778] (-59.409) -- 0:02:42
494000 -- (-57.480) (-58.208) [-61.004] (-58.718) * (-59.366) (-61.240) [-62.327] (-56.806) -- 0:02:41
495000 -- (-57.679) (-61.430) [-57.159] (-61.421) * (-57.922) (-61.459) [-59.308] (-57.589) -- 0:02:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
496000 -- (-57.952) (-57.507) [-59.362] (-61.656) * [-60.107] (-67.846) (-59.210) (-58.533) -- 0:02:41
497000 -- (-56.836) (-57.796) [-56.786] (-58.503) * [-58.082] (-59.154) (-60.657) (-57.418) -- 0:02:40
498000 -- (-60.236) (-58.320) [-56.675] (-57.442) * [-59.005] (-60.675) (-58.235) (-59.179) -- 0:02:41
499000 -- (-63.121) (-57.887) [-58.473] (-67.056) * [-59.320] (-59.747) (-58.188) (-57.446) -- 0:02:40
500000 -- [-59.024] (-59.163) (-58.610) (-61.482) * [-57.729] (-56.962) (-57.381) (-59.082) -- 0:02:40
Average standard deviation of split frequencies: NA (no splits above min. frequency)
501000 -- [-61.221] (-59.376) (-59.143) (-57.448) * [-60.007] (-57.939) (-56.877) (-60.936) -- 0:02:40
502000 -- [-60.473] (-60.308) (-61.488) (-59.974) * [-60.608] (-58.535) (-64.928) (-57.130) -- 0:02:39
503000 -- [-60.367] (-60.763) (-58.937) (-58.572) * [-59.462] (-58.568) (-64.304) (-57.827) -- 0:02:39
504000 -- [-57.338] (-58.402) (-64.169) (-58.360) * [-56.630] (-59.504) (-59.901) (-61.281) -- 0:02:39
505000 -- [-57.945] (-56.994) (-58.720) (-59.518) * [-59.902] (-58.073) (-57.917) (-58.518) -- 0:02:38
Average standard deviation of split frequencies: NA (no splits above min. frequency)
506000 -- [-57.486] (-58.468) (-58.213) (-58.316) * [-59.228] (-61.167) (-59.288) (-57.674) -- 0:02:38
507000 -- (-57.063) (-59.670) (-59.748) [-60.077] * [-59.786] (-58.541) (-58.448) (-57.815) -- 0:02:38
508000 -- (-60.032) (-58.655) (-64.088) [-59.946] * [-57.805] (-60.261) (-57.866) (-60.543) -- 0:02:37
509000 -- (-57.602) (-60.111) (-64.572) [-57.449] * [-57.913] (-58.895) (-59.200) (-59.503) -- 0:02:37
510000 -- [-59.071] (-57.743) (-58.336) (-58.388) * [-59.426] (-60.547) (-59.527) (-59.260) -- 0:02:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
511000 -- [-56.893] (-57.442) (-58.686) (-58.500) * (-58.278) [-59.782] (-60.780) (-58.691) -- 0:02:36
512000 -- (-57.775) (-56.232) [-57.214] (-58.781) * (-58.658) (-62.496) (-60.061) [-58.117] -- 0:02:36
513000 -- (-58.156) [-58.894] (-56.751) (-60.897) * (-57.020) (-58.138) (-60.531) [-58.077] -- 0:02:35
514000 -- (-57.438) [-58.065] (-60.298) (-60.509) * (-60.431) (-58.231) [-56.968] (-59.227) -- 0:02:36
515000 -- (-58.009) [-57.843] (-64.541) (-60.233) * (-57.767) (-57.247) [-58.293] (-57.756) -- 0:02:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
516000 -- [-57.828] (-57.980) (-57.372) (-56.774) * (-57.644) (-57.418) [-60.279] (-60.475) -- 0:02:34
517000 -- (-59.530) (-58.615) (-58.540) [-58.641] * (-57.493) (-56.290) (-59.986) [-59.402] -- 0:02:35
518000 -- (-57.898) (-56.884) (-56.814) [-57.446] * [-58.468] (-58.225) (-57.352) (-60.409) -- 0:02:34
519000 -- (-59.102) (-58.910) (-57.042) [-60.451] * (-56.892) [-57.442] (-58.987) (-58.433) -- 0:02:33
520000 -- (-57.452) (-60.624) (-60.892) [-58.488] * (-58.950) [-58.165] (-61.069) (-58.144) -- 0:02:34
Average standard deviation of split frequencies: NA (no splits above min. frequency)
521000 -- (-64.520) (-58.753) (-59.266) [-57.240] * (-60.652) [-58.755] (-57.324) (-58.412) -- 0:02:33
522000 -- (-57.050) (-61.550) (-59.287) [-61.116] * [-57.230] (-57.257) (-57.276) (-57.747) -- 0:02:32
523000 -- (-57.564) [-57.127] (-57.430) (-58.635) * (-58.291) (-56.743) [-58.041] (-58.182) -- 0:02:33
524000 -- (-58.683) (-57.304) (-57.064) [-59.679] * (-61.098) (-58.050) [-60.627] (-58.765) -- 0:02:32
525000 -- (-56.962) (-57.261) (-64.570) [-57.246] * (-62.704) (-58.229) [-58.581] (-57.384) -- 0:02:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
526000 -- (-56.607) (-59.485) (-61.454) [-56.716] * (-57.540) (-57.815) [-56.439] (-56.662) -- 0:02:31
527000 -- (-59.475) (-57.033) (-62.508) [-60.120] * (-57.652) (-57.314) (-59.008) [-58.922] -- 0:02:31
528000 -- (-61.406) (-57.527) (-58.107) [-56.847] * [-63.824] (-58.216) (-56.455) (-61.858) -- 0:02:31
529000 -- (-58.808) (-60.872) (-58.637) [-57.706] * [-60.385] (-61.484) (-57.982) (-56.616) -- 0:02:30
530000 -- (-60.561) (-57.758) (-56.666) [-58.929] * [-56.937] (-59.828) (-57.268) (-59.624) -- 0:02:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
531000 -- (-58.871) (-57.079) [-57.331] (-58.135) * [-56.808] (-56.544) (-59.202) (-59.712) -- 0:02:30
532000 -- (-58.459) (-58.431) [-57.327] (-60.080) * [-57.482] (-58.602) (-66.616) (-58.336) -- 0:02:29
533000 -- (-58.777) (-59.654) [-58.095] (-57.025) * [-60.226] (-61.225) (-58.487) (-57.752) -- 0:02:29
534000 -- (-62.174) [-56.619] (-60.606) (-57.409) * (-59.045) [-59.198] (-57.230) (-56.536) -- 0:02:29
535000 -- (-60.785) [-57.742] (-59.914) (-57.294) * (-59.285) [-59.493] (-57.468) (-58.431) -- 0:02:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
536000 -- (-60.760) (-57.308) (-61.571) [-58.219] * (-60.014) [-61.674] (-60.721) (-62.043) -- 0:02:28
537000 -- (-59.605) (-56.444) (-57.937) [-59.551] * (-57.884) [-58.126] (-58.520) (-56.814) -- 0:02:28
538000 -- (-58.362) (-58.425) (-56.946) [-59.788] * (-58.353) [-58.753] (-64.641) (-59.163) -- 0:02:27
539000 -- (-59.698) (-57.591) (-60.313) [-58.293] * (-57.602) [-57.778] (-58.345) (-56.414) -- 0:02:27
540000 -- (-58.115) (-59.285) (-59.405) [-58.812] * (-58.031) [-57.916] (-63.640) (-59.615) -- 0:02:27
Average standard deviation of split frequencies: NA (no splits above min. frequency)
541000 -- [-56.891] (-59.053) (-58.122) (-60.411) * (-57.046) (-57.487) (-66.632) [-56.938] -- 0:02:26
542000 -- [-58.169] (-59.014) (-58.937) (-67.169) * (-57.853) (-57.754) (-58.363) [-58.274] -- 0:02:27
543000 -- [-58.297] (-60.725) (-59.162) (-59.474) * (-57.897) (-60.380) (-59.862) [-59.797] -- 0:02:26
544000 -- [-58.231] (-62.109) (-59.173) (-57.275) * (-59.445) (-59.930) [-59.202] (-59.464) -- 0:02:25
545000 -- (-57.316) [-57.661] (-56.860) (-56.903) * (-59.284) (-58.414) [-57.578] (-58.125) -- 0:02:26
Average standard deviation of split frequencies: NA (no splits above min. frequency)
546000 -- (-56.742) [-59.095] (-61.121) (-59.403) * (-56.951) (-56.678) [-56.497] (-59.442) -- 0:02:25
547000 -- (-59.337) [-59.327] (-59.031) (-61.741) * (-57.055) (-56.779) [-57.639] (-62.814) -- 0:02:24
548000 -- (-58.367) [-60.166] (-57.817) (-57.110) * (-58.071) (-57.488) [-59.781] (-56.314) -- 0:02:24
549000 -- (-57.733) [-56.598] (-60.082) (-57.516) * (-57.130) (-58.756) [-56.928] (-60.572) -- 0:02:24
550000 -- (-57.244) [-56.988] (-59.802) (-57.568) * (-60.548) (-57.349) [-58.139] (-58.956) -- 0:02:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
551000 -- (-58.432) [-58.404] (-60.625) (-58.553) * (-61.112) (-58.721) [-57.990] (-56.680) -- 0:02:23
552000 -- (-59.729) [-59.284] (-59.433) (-60.337) * (-58.267) (-57.789) [-57.677] (-56.804) -- 0:02:23
553000 -- (-58.889) [-57.652] (-56.697) (-58.245) * (-58.438) (-58.403) [-56.853] (-56.329) -- 0:02:23
554000 -- (-58.940) [-57.400] (-58.298) (-58.726) * (-58.131) (-59.319) [-56.412] (-58.664) -- 0:02:22
555000 -- (-56.536) [-57.779] (-59.664) (-56.823) * (-60.136) [-59.542] (-60.610) (-56.052) -- 0:02:22
Average standard deviation of split frequencies: NA (no splits above min. frequency)
556000 -- (-59.099) [-57.136] (-58.247) (-59.231) * (-60.736) [-57.058] (-59.478) (-59.087) -- 0:02:22
557000 -- (-59.825) [-56.855] (-57.722) (-59.635) * (-60.226) (-58.459) (-60.138) [-56.985] -- 0:02:21
558000 -- (-57.391) [-57.741] (-60.192) (-61.109) * (-58.743) (-58.708) (-59.837) [-58.096] -- 0:02:21
559000 -- (-59.377) [-62.517] (-56.589) (-57.717) * (-60.379) (-58.698) (-59.841) [-57.563] -- 0:02:21
560000 -- (-58.874) [-57.548] (-58.775) (-59.188) * (-59.588) (-57.581) (-57.911) [-57.904] -- 0:02:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
561000 -- (-57.434) [-56.706] (-56.336) (-57.958) * (-57.054) (-61.404) (-56.524) [-57.610] -- 0:02:20
562000 -- (-56.914) (-59.753) (-58.005) [-64.472] * (-57.573) (-57.935) (-59.734) [-57.925] -- 0:02:20
563000 -- (-60.771) (-64.104) (-63.646) [-63.038] * (-61.709) (-59.286) (-57.819) [-57.552] -- 0:02:19
564000 -- (-63.648) (-58.524) (-57.820) [-57.110] * [-59.827] (-57.998) (-58.219) (-65.963) -- 0:02:19
565000 -- (-61.905) (-57.802) (-59.420) [-57.693] * (-60.309) (-59.008) [-57.136] (-58.676) -- 0:02:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
566000 -- (-59.900) (-57.310) (-62.899) [-59.266] * (-65.076) (-58.790) [-58.090] (-56.656) -- 0:02:18
567000 -- (-57.364) (-57.808) (-59.480) [-57.648] * (-62.661) (-57.250) [-56.977] (-58.229) -- 0:02:18
568000 -- (-60.193) (-58.971) (-56.326) [-60.645] * (-58.964) (-60.236) (-57.892) [-57.604] -- 0:02:18
569000 -- (-58.416) (-60.271) (-60.832) [-60.758] * [-56.749] (-56.475) (-57.636) (-61.998) -- 0:02:17
570000 -- (-58.679) (-56.839) (-58.013) [-58.596] * [-60.561] (-62.641) (-59.909) (-56.798) -- 0:02:17
Average standard deviation of split frequencies: NA (no splits above min. frequency)
571000 -- (-61.628) (-58.569) (-61.085) [-58.986] * (-59.182) (-59.977) [-59.124] (-61.955) -- 0:02:17
572000 -- [-61.586] (-58.098) (-57.642) (-58.728) * (-59.793) (-57.888) [-56.914] (-57.268) -- 0:02:16
573000 -- [-56.277] (-56.330) (-57.883) (-59.042) * (-56.380) (-58.593) [-58.081] (-57.010) -- 0:02:16
574000 -- [-56.895] (-59.270) (-58.906) (-61.210) * (-60.354) (-58.746) [-58.346] (-61.103) -- 0:02:16
575000 -- [-58.537] (-60.575) (-57.240) (-59.186) * (-57.414) (-60.209) (-59.808) [-56.843] -- 0:02:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
576000 -- (-58.512) [-56.415] (-56.910) (-59.971) * (-59.551) (-60.620) (-59.891) [-60.466] -- 0:02:15
577000 -- (-57.595) [-58.277] (-59.056) (-61.351) * (-59.332) (-58.442) (-57.449) [-57.755] -- 0:02:15
578000 -- (-59.084) (-59.239) (-60.307) [-56.764] * (-58.120) (-61.823) (-60.008) [-56.786] -- 0:02:15
579000 -- (-57.899) (-58.422) (-57.297) [-57.786] * (-59.535) (-60.849) (-59.296) [-56.984] -- 0:02:14
580000 -- [-58.358] (-58.490) (-58.623) (-57.118) * [-58.128] (-58.136) (-56.357) (-56.582) -- 0:02:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
581000 -- [-56.645] (-59.246) (-57.148) (-56.968) * [-58.542] (-56.453) (-56.442) (-57.526) -- 0:02:14
582000 -- [-58.181] (-57.445) (-56.739) (-57.122) * [-56.994] (-58.558) (-65.420) (-59.755) -- 0:02:13
583000 -- (-59.405) (-57.048) [-59.791] (-58.345) * (-57.617) (-59.074) (-59.463) [-59.182] -- 0:02:13
584000 -- (-58.574) (-56.224) [-60.059] (-57.268) * (-61.809) (-57.371) (-59.080) [-56.638] -- 0:02:13
585000 -- (-57.396) (-59.864) [-57.089] (-59.581) * [-63.517] (-57.052) (-61.446) (-59.945) -- 0:02:12
Average standard deviation of split frequencies: NA (no splits above min. frequency)
586000 -- (-58.504) (-58.771) [-58.231] (-68.837) * [-58.638] (-58.290) (-57.540) (-58.462) -- 0:02:12
587000 -- (-64.162) (-59.238) (-56.932) [-62.077] * [-60.218] (-58.790) (-60.567) (-56.693) -- 0:02:12
588000 -- (-57.881) (-60.075) (-56.759) [-57.770] * [-59.427] (-60.074) (-63.754) (-57.300) -- 0:02:11
589000 -- (-56.661) (-60.356) (-58.902) [-58.126] * [-59.744] (-58.148) (-58.748) (-58.944) -- 0:02:11
590000 -- (-57.853) (-58.041) (-57.169) [-59.033] * (-59.668) [-58.419] (-60.172) (-59.771) -- 0:02:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
591000 -- (-57.558) (-58.489) (-56.530) [-59.575] * (-58.155) [-60.590] (-58.497) (-57.064) -- 0:02:10
592000 -- [-58.393] (-61.520) (-56.962) (-58.893) * (-62.078) [-57.300] (-58.645) (-59.688) -- 0:02:10
593000 -- (-57.752) [-58.970] (-57.488) (-56.445) * (-59.169) [-59.132] (-56.602) (-58.033) -- 0:02:10
594000 -- (-58.102) [-60.346] (-63.351) (-58.294) * (-56.721) [-57.448] (-59.324) (-57.432) -- 0:02:09
595000 -- [-58.889] (-58.497) (-59.681) (-62.819) * (-61.884) [-57.853] (-60.425) (-56.802) -- 0:02:09
Average standard deviation of split frequencies: NA (no splits above min. frequency)
596000 -- [-56.750] (-58.220) (-57.774) (-59.504) * (-60.671) [-57.389] (-57.989) (-61.149) -- 0:02:09
597000 -- [-57.125] (-57.469) (-58.099) (-63.798) * (-61.646) [-57.730] (-57.233) (-56.747) -- 0:02:08
598000 -- [-58.288] (-56.879) (-59.549) (-58.107) * (-59.150) [-57.436] (-59.943) (-59.294) -- 0:02:08
599000 -- [-56.760] (-59.134) (-58.166) (-58.526) * [-57.961] (-59.411) (-56.494) (-59.135) -- 0:02:08
600000 -- [-59.764] (-60.353) (-59.761) (-57.506) * [-57.020] (-57.556) (-57.686) (-61.651) -- 0:02:08
Average standard deviation of split frequencies: NA (no splits above min. frequency)
601000 -- [-58.095] (-59.067) (-58.745) (-60.169) * (-59.722) (-58.323) [-60.429] (-63.571) -- 0:02:07
602000 -- [-60.920] (-57.932) (-61.605) (-61.530) * (-58.268) (-59.840) [-59.605] (-60.060) -- 0:02:07
603000 -- (-56.368) (-59.915) (-56.443) [-57.765] * (-58.496) (-57.336) [-58.208] (-58.770) -- 0:02:07
604000 -- (-56.568) (-56.140) [-58.273] (-56.729) * (-58.269) (-57.082) [-58.872] (-57.628) -- 0:02:06
605000 -- (-56.960) (-59.271) [-58.240] (-56.693) * (-60.668) (-57.931) [-57.582] (-58.859) -- 0:02:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
606000 -- [-57.894] (-61.525) (-60.152) (-57.647) * [-61.751] (-58.471) (-57.952) (-58.837) -- 0:02:06
607000 -- (-57.115) (-57.774) [-62.661] (-57.551) * [-57.265] (-56.829) (-61.715) (-61.184) -- 0:02:05
608000 -- (-60.398) (-57.952) [-60.048] (-57.422) * [-56.773] (-57.610) (-58.615) (-57.004) -- 0:02:05
609000 -- (-58.569) (-59.352) [-57.107] (-56.778) * (-58.612) (-58.077) [-57.692] (-58.540) -- 0:02:05
610000 -- (-57.290) (-56.615) [-56.270] (-58.340) * (-58.982) (-56.939) [-57.518] (-57.619) -- 0:02:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
611000 -- (-59.078) (-59.466) [-58.004] (-56.765) * (-57.312) (-57.830) [-57.216] (-58.150) -- 0:02:04
612000 -- (-57.898) (-57.119) [-58.377] (-56.871) * (-56.891) (-59.047) [-58.778] (-57.415) -- 0:02:04
613000 -- (-56.863) (-58.607) [-58.211] (-57.017) * (-57.027) (-57.283) [-56.255] (-58.641) -- 0:02:03
614000 -- (-62.386) (-56.959) [-57.923] (-61.761) * (-59.142) (-56.873) (-56.980) [-57.463] -- 0:02:03
615000 -- (-64.326) (-59.225) [-57.637] (-59.256) * (-56.694) (-57.936) (-60.225) [-59.306] -- 0:02:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
616000 -- (-60.755) (-58.092) [-56.900] (-58.824) * (-58.525) (-60.601) (-59.960) [-59.567] -- 0:02:02
617000 -- (-61.541) (-59.086) [-58.704] (-60.537) * (-61.583) (-58.683) [-58.251] (-57.978) -- 0:02:02
618000 -- [-60.565] (-59.618) (-56.913) (-59.301) * (-60.647) (-57.107) [-60.942] (-60.491) -- 0:02:02
619000 -- (-61.498) (-58.597) (-58.560) [-57.265] * (-57.955) (-57.408) [-57.796] (-58.242) -- 0:02:01
620000 -- (-59.449) (-56.492) (-61.026) [-56.823] * (-57.951) (-59.268) [-59.094] (-60.201) -- 0:02:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
621000 -- (-58.194) (-58.945) (-58.044) [-57.244] * (-56.821) (-57.406) [-58.271] (-56.643) -- 0:02:01
622000 -- (-57.528) (-58.988) (-57.904) [-58.432] * (-59.515) (-58.063) [-56.855] (-63.323) -- 0:02:00
623000 -- (-57.819) (-58.514) [-57.801] (-59.108) * (-57.541) (-57.123) [-57.213] (-58.304) -- 0:02:00
624000 -- (-57.348) (-57.765) (-58.286) [-57.846] * (-61.013) (-57.707) [-56.476] (-61.590) -- 0:02:00
625000 -- (-56.717) (-59.731) (-59.049) [-58.565] * (-59.253) (-56.850) [-59.083] (-57.224) -- 0:02:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
626000 -- (-56.350) (-65.095) (-56.998) [-59.763] * (-57.988) (-59.862) [-56.957] (-56.677) -- 0:01:59
627000 -- (-59.408) (-57.318) (-57.243) [-59.554] * (-57.753) (-58.115) [-57.778] (-56.614) -- 0:01:59
628000 -- (-60.536) (-58.382) (-59.580) [-61.223] * (-60.048) (-62.442) [-57.792] (-59.920) -- 0:01:59
629000 -- (-58.186) (-60.960) (-60.277) [-58.793] * (-57.662) (-58.157) (-57.725) [-58.289] -- 0:01:58
630000 -- (-58.675) (-64.648) (-59.783) [-60.525] * (-58.190) [-59.391] (-58.009) (-58.579) -- 0:01:58
Average standard deviation of split frequencies: NA (no splits above min. frequency)
631000 -- (-57.173) (-58.225) (-57.964) [-59.248] * (-58.265) [-57.622] (-56.952) (-62.190) -- 0:01:58
632000 -- [-56.402] (-57.611) (-62.458) (-57.093) * (-59.490) [-56.359] (-56.712) (-56.928) -- 0:01:57
633000 -- [-59.415] (-59.273) (-58.925) (-56.909) * (-58.625) [-56.776] (-61.756) (-58.723) -- 0:01:57
634000 -- (-57.982) (-57.755) [-58.889] (-58.388) * (-58.830) [-56.781] (-57.894) (-57.208) -- 0:01:57
635000 -- [-58.255] (-56.829) (-59.421) (-58.882) * (-59.192) [-58.482] (-58.258) (-57.045) -- 0:01:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
636000 -- [-57.682] (-57.426) (-58.900) (-59.628) * [-62.422] (-57.656) (-59.374) (-57.304) -- 0:01:56
637000 -- [-58.675] (-58.820) (-59.963) (-58.716) * [-59.623] (-57.240) (-59.347) (-58.673) -- 0:01:56
638000 -- (-57.643) [-58.864] (-58.315) (-58.298) * [-58.234] (-59.365) (-61.970) (-57.713) -- 0:01:55
639000 -- (-56.906) [-58.079] (-59.415) (-57.259) * [-57.401] (-59.124) (-57.516) (-56.486) -- 0:01:55
640000 -- (-57.560) (-60.550) [-57.595] (-58.956) * (-57.662) (-58.918) (-57.707) [-57.920] -- 0:01:55
Average standard deviation of split frequencies: NA (no splits above min. frequency)
641000 -- (-59.155) (-58.371) [-57.257] (-57.375) * (-56.327) (-56.936) (-59.154) [-60.655] -- 0:01:54
642000 -- (-58.264) (-58.381) [-57.079] (-59.462) * (-57.490) (-60.063) (-57.883) [-57.854] -- 0:01:54
643000 -- (-57.167) (-57.094) [-59.451] (-59.333) * (-60.713) (-57.015) (-58.413) [-56.829] -- 0:01:54
644000 -- (-57.460) (-62.304) [-56.994] (-57.469) * (-59.223) (-58.529) [-56.903] (-58.189) -- 0:01:53
645000 -- [-57.119] (-60.398) (-60.577) (-65.283) * (-59.800) (-56.559) [-57.677] (-57.039) -- 0:01:53
Average standard deviation of split frequencies: NA (no splits above min. frequency)
646000 -- [-58.443] (-57.534) (-57.579) (-58.750) * (-57.115) (-57.310) [-58.418] (-58.903) -- 0:01:53
647000 -- [-58.951] (-57.844) (-56.376) (-62.512) * (-57.974) (-56.975) [-56.988] (-58.342) -- 0:01:52
648000 -- [-59.171] (-57.487) (-59.454) (-59.726) * (-56.331) (-58.612) [-59.804] (-57.587) -- 0:01:52
649000 -- (-58.336) (-61.010) (-59.764) [-57.330] * (-57.596) (-58.483) [-58.958] (-59.176) -- 0:01:51
650000 -- (-60.342) (-57.900) (-59.271) [-57.083] * (-56.628) (-58.578) (-56.577) [-57.638] -- 0:01:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
651000 -- [-57.796] (-60.396) (-60.033) (-57.391) * (-60.808) (-57.267) (-57.120) [-56.764] -- 0:01:51
652000 -- [-57.345] (-58.714) (-59.358) (-58.886) * (-62.908) (-56.621) (-58.596) [-56.344] -- 0:01:51
653000 -- [-56.648] (-57.555) (-62.552) (-59.244) * (-57.233) (-57.265) (-58.397) [-56.677] -- 0:01:51
654000 -- [-59.923] (-57.101) (-57.248) (-60.445) * (-56.500) (-59.011) (-59.333) [-59.563] -- 0:01:50
655000 -- (-57.598) (-59.769) (-57.548) [-60.293] * [-57.510] (-57.001) (-59.779) (-56.741) -- 0:01:50
Average standard deviation of split frequencies: NA (no splits above min. frequency)
656000 -- (-58.981) (-56.643) [-57.956] (-57.466) * [-59.268] (-64.623) (-56.971) (-57.905) -- 0:01:50
657000 -- [-56.277] (-58.517) (-58.185) (-57.657) * [-58.920] (-59.208) (-59.669) (-58.424) -- 0:01:49
658000 -- [-58.985] (-59.617) (-60.222) (-58.215) * [-58.611] (-57.198) (-60.068) (-57.175) -- 0:01:49
659000 -- [-58.448] (-58.453) (-60.057) (-58.877) * (-59.863) (-57.740) [-62.024] (-58.629) -- 0:01:49
660000 -- (-61.645) [-57.115] (-60.178) (-57.837) * (-56.550) [-59.634] (-57.897) (-56.849) -- 0:01:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
661000 -- (-56.993) [-57.142] (-60.527) (-57.125) * (-57.953) [-57.917] (-60.450) (-59.157) -- 0:01:48
662000 -- (-57.372) [-56.550] (-60.404) (-59.936) * (-57.758) [-57.269] (-60.005) (-58.540) -- 0:01:48
663000 -- (-56.459) [-58.823] (-57.587) (-57.055) * (-57.131) [-59.440] (-58.640) (-58.177) -- 0:01:47
664000 -- (-58.044) [-58.801] (-60.086) (-57.079) * (-56.698) [-58.866] (-59.555) (-61.424) -- 0:01:47
665000 -- (-58.551) [-59.351] (-59.205) (-60.106) * (-56.647) [-58.393] (-57.353) (-61.848) -- 0:01:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
666000 -- (-58.308) [-56.860] (-56.820) (-57.980) * (-59.844) (-58.538) (-57.322) [-56.211] -- 0:01:46
667000 -- (-57.672) [-58.706] (-59.117) (-57.897) * (-60.651) (-57.349) [-59.172] (-57.569) -- 0:01:46
668000 -- (-58.747) [-58.062] (-57.518) (-60.494) * (-59.368) (-61.585) [-58.009] (-58.745) -- 0:01:46
669000 -- (-63.109) (-56.490) [-56.714] (-59.113) * (-64.480) (-60.478) [-57.090] (-60.808) -- 0:01:45
670000 -- (-59.884) (-58.866) [-58.324] (-59.768) * (-59.699) (-56.486) [-58.980] (-58.972) -- 0:01:45
Average standard deviation of split frequencies: NA (no splits above min. frequency)
671000 -- (-67.093) (-64.534) [-58.570] (-57.279) * [-56.661] (-62.763) (-57.397) (-58.147) -- 0:01:44
672000 -- (-56.694) (-59.960) [-57.040] (-57.102) * [-58.592] (-57.657) (-60.026) (-57.312) -- 0:01:44
673000 -- (-57.946) (-60.877) [-57.052] (-61.525) * [-58.271] (-56.395) (-58.485) (-58.327) -- 0:01:44
674000 -- (-60.259) (-59.822) [-57.366] (-56.426) * [-60.455] (-65.651) (-58.225) (-59.662) -- 0:01:43
675000 -- (-58.086) (-61.370) [-56.262] (-62.115) * [-59.025] (-58.098) (-58.752) (-59.194) -- 0:01:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
676000 -- [-57.598] (-63.230) (-58.406) (-62.242) * (-56.165) (-57.016) [-59.151] (-57.795) -- 0:01:43
677000 -- [-56.979] (-57.203) (-57.700) (-57.508) * (-58.015) (-57.263) [-58.952] (-57.820) -- 0:01:43
678000 -- [-57.419] (-59.886) (-58.075) (-56.779) * (-57.392) (-59.817) [-59.067] (-60.013) -- 0:01:43
679000 -- [-57.813] (-56.693) (-59.276) (-60.715) * (-57.640) [-56.632] (-60.841) (-60.418) -- 0:01:42
680000 -- [-60.972] (-58.161) (-57.116) (-58.086) * (-57.559) [-56.609] (-61.947) (-60.016) -- 0:01:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
681000 -- [-61.315] (-57.137) (-58.718) (-60.585) * (-57.143) [-57.334] (-57.381) (-56.479) -- 0:01:42
682000 -- [-56.919] (-62.370) (-60.859) (-58.560) * (-57.429) [-57.570] (-58.883) (-59.457) -- 0:01:41
683000 -- [-59.426] (-58.917) (-61.074) (-59.343) * (-58.576) (-58.437) [-57.788] (-59.342) -- 0:01:41
684000 -- (-63.254) (-57.524) (-58.742) [-58.622] * (-59.409) (-57.163) [-57.571] (-58.541) -- 0:01:41
685000 -- (-56.811) (-57.822) (-64.984) [-57.103] * (-60.107) (-57.136) [-60.392] (-57.510) -- 0:01:40
Average standard deviation of split frequencies: NA (no splits above min. frequency)
686000 -- (-57.755) (-56.738) [-57.454] (-57.982) * (-61.802) (-57.977) [-58.790] (-60.281) -- 0:01:40
687000 -- (-58.214) (-57.965) [-57.443] (-56.561) * (-57.240) (-56.440) [-56.351] (-59.628) -- 0:01:40
688000 -- (-59.678) [-60.078] (-58.658) (-56.902) * [-57.058] (-57.481) (-59.481) (-61.129) -- 0:01:39
689000 -- (-58.216) [-57.646] (-56.482) (-59.377) * [-56.936] (-59.107) (-60.075) (-59.600) -- 0:01:39
690000 -- (-57.193) (-58.943) (-60.894) [-62.134] * [-59.222] (-59.406) (-57.697) (-60.951) -- 0:01:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
691000 -- (-61.699) (-58.085) (-58.339) [-59.489] * (-57.226) (-58.157) (-61.905) [-57.795] -- 0:01:38
692000 -- (-56.888) (-57.245) (-59.169) [-56.595] * (-57.763) [-58.988] (-62.332) (-58.010) -- 0:01:38
693000 -- (-58.194) (-61.265) (-62.363) [-59.580] * (-59.167) [-58.277] (-58.334) (-60.856) -- 0:01:37
694000 -- (-56.851) (-62.916) (-58.688) [-56.112] * (-57.190) [-58.790] (-58.737) (-57.429) -- 0:01:37
695000 -- (-58.320) (-61.085) (-58.101) [-58.868] * (-60.563) (-60.616) [-58.824] (-57.130) -- 0:01:37
Average standard deviation of split frequencies: NA (no splits above min. frequency)
696000 -- (-62.310) (-58.584) (-58.679) [-57.070] * (-60.798) (-57.652) (-57.018) [-56.894] -- 0:01:36
697000 -- (-59.488) (-56.296) (-57.986) [-56.938] * (-59.932) (-61.983) (-59.202) [-56.956] -- 0:01:36
698000 -- (-58.803) [-58.529] (-60.410) (-67.103) * (-60.451) (-59.616) (-59.114) [-57.978] -- 0:01:36
699000 -- (-57.101) [-57.090] (-57.345) (-60.234) * (-59.580) (-59.071) (-57.564) [-58.215] -- 0:01:36
700000 -- (-64.114) (-57.041) [-56.674] (-57.961) * (-57.955) (-56.159) (-59.767) [-56.538] -- 0:01:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
701000 -- (-58.621) (-60.389) (-58.423) [-57.313] * (-59.267) (-58.979) (-65.841) [-57.255] -- 0:01:35
702000 -- (-59.795) (-61.275) (-58.000) [-56.490] * (-56.927) (-58.554) (-61.187) [-56.923] -- 0:01:35
703000 -- (-58.243) (-59.317) (-57.567) [-61.710] * (-58.651) (-58.014) (-58.683) [-58.965] -- 0:01:35
704000 -- (-60.751) (-57.214) (-58.256) [-56.679] * (-61.830) (-57.745) (-57.261) [-57.929] -- 0:01:34
705000 -- [-57.175] (-56.507) (-57.444) (-58.278) * (-57.842) (-58.824) [-56.765] (-61.451) -- 0:01:34
Average standard deviation of split frequencies: NA (no splits above min. frequency)
706000 -- [-57.974] (-58.806) (-57.603) (-58.680) * (-59.202) (-57.677) [-57.512] (-57.183) -- 0:01:33
707000 -- (-59.934) [-57.279] (-59.933) (-58.543) * (-60.907) (-58.787) [-57.272] (-58.073) -- 0:01:33
708000 -- (-57.791) [-61.423] (-56.823) (-63.070) * (-58.611) (-58.123) [-58.284] (-60.397) -- 0:01:33
709000 -- (-57.925) [-56.683] (-58.462) (-60.167) * [-57.343] (-57.369) (-58.038) (-58.516) -- 0:01:32
710000 -- (-57.934) [-56.654] (-59.553) (-56.466) * [-57.479] (-57.842) (-56.835) (-58.631) -- 0:01:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
711000 -- (-59.741) (-59.473) [-59.201] (-56.457) * [-59.327] (-58.978) (-58.442) (-59.610) -- 0:01:32
712000 -- (-58.308) (-57.452) [-57.989] (-57.633) * [-61.169] (-58.901) (-61.472) (-59.794) -- 0:01:31
713000 -- (-57.158) (-57.864) [-59.195] (-59.751) * [-57.791] (-59.589) (-64.387) (-59.283) -- 0:01:31
714000 -- (-57.336) (-60.818) [-58.876] (-59.263) * [-57.826] (-60.663) (-57.482) (-56.835) -- 0:01:31
715000 -- (-56.981) (-61.249) [-58.904] (-56.501) * [-58.635] (-58.769) (-57.725) (-57.181) -- 0:01:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
716000 -- (-56.954) (-56.658) [-57.304] (-57.547) * [-57.514] (-58.617) (-59.391) (-58.205) -- 0:01:30
717000 -- [-58.397] (-56.831) (-59.330) (-56.879) * (-59.151) (-57.695) (-58.606) [-61.504] -- 0:01:30
718000 -- [-62.699] (-58.453) (-63.890) (-59.536) * (-57.012) [-61.563] (-57.921) (-57.136) -- 0:01:29
719000 -- [-60.281] (-57.595) (-57.256) (-58.719) * (-60.541) [-57.195] (-57.850) (-56.488) -- 0:01:29
720000 -- (-56.553) (-58.873) [-59.129] (-60.420) * (-62.135) [-57.104] (-57.548) (-57.709) -- 0:01:29
Average standard deviation of split frequencies: NA (no splits above min. frequency)
721000 -- (-56.730) (-57.294) [-56.280] (-60.906) * (-57.001) [-57.456] (-59.406) (-59.921) -- 0:01:29
722000 -- (-58.111) [-57.929] (-60.128) (-61.260) * (-59.237) [-57.697] (-58.330) (-59.695) -- 0:01:28
723000 -- (-58.348) [-60.787] (-60.085) (-63.868) * (-59.265) [-58.278] (-57.381) (-58.583) -- 0:01:28
724000 -- (-57.804) [-57.978] (-59.686) (-57.114) * (-62.902) [-58.489] (-57.948) (-58.914) -- 0:01:28
725000 -- (-59.030) [-58.192] (-57.710) (-58.766) * (-58.546) [-56.356] (-59.156) (-57.405) -- 0:01:27
Average standard deviation of split frequencies: NA (no splits above min. frequency)
726000 -- (-58.448) [-59.392] (-60.648) (-59.955) * (-57.501) [-57.233] (-59.441) (-57.996) -- 0:01:27
727000 -- (-59.105) [-58.692] (-59.848) (-59.348) * (-56.708) (-57.671) (-56.781) [-57.322] -- 0:01:27
728000 -- (-58.147) [-57.376] (-59.460) (-57.412) * (-57.516) (-59.452) (-57.054) [-58.281] -- 0:01:26
729000 -- (-64.692) (-58.968) [-60.316] (-58.409) * [-57.958] (-57.003) (-58.510) (-59.420) -- 0:01:26
730000 -- (-59.380) (-59.512) [-60.207] (-59.825) * [-57.820] (-57.809) (-66.256) (-58.355) -- 0:01:26
Average standard deviation of split frequencies: NA (no splits above min. frequency)
731000 -- (-56.984) (-60.201) [-57.453] (-62.434) * [-57.433] (-56.993) (-59.952) (-59.809) -- 0:01:25
732000 -- (-56.541) (-58.084) [-59.996] (-59.676) * (-58.324) (-57.350) (-61.720) [-56.730] -- 0:01:25
733000 -- (-60.390) (-60.990) [-58.340] (-58.085) * [-57.113] (-56.897) (-58.960) (-56.402) -- 0:01:25
734000 -- (-58.709) (-56.987) [-57.584] (-56.870) * (-57.511) (-57.739) (-57.800) [-60.147] -- 0:01:24
735000 -- (-57.564) (-62.297) [-56.817] (-59.187) * (-58.154) (-57.974) (-60.088) [-57.078] -- 0:01:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
736000 -- (-57.586) (-66.248) [-60.643] (-61.220) * [-59.142] (-59.864) (-58.240) (-57.049) -- 0:01:24
737000 -- (-57.901) (-60.892) [-58.604] (-62.800) * (-57.203) (-57.911) (-56.458) [-57.495] -- 0:01:23
738000 -- (-57.665) (-59.229) [-57.188] (-57.169) * (-59.381) (-59.409) (-58.871) [-58.428] -- 0:01:23
739000 -- (-58.451) (-58.581) [-58.079] (-58.090) * (-58.071) (-61.700) (-60.737) [-57.670] -- 0:01:23
740000 -- (-58.818) (-57.822) [-58.340] (-58.784) * (-62.514) (-60.042) [-57.511] (-58.337) -- 0:01:22
Average standard deviation of split frequencies: NA (no splits above min. frequency)
741000 -- (-59.253) (-58.125) [-58.103] (-59.357) * (-57.453) (-58.643) [-57.642] (-56.841) -- 0:01:22
742000 -- (-56.979) (-60.191) [-58.163] (-56.793) * (-56.215) (-58.922) [-56.115] (-57.555) -- 0:01:22
743000 -- (-56.804) (-58.633) [-59.856] (-58.501) * (-60.742) (-58.101) [-59.013] (-59.165) -- 0:01:21
744000 -- (-57.791) (-62.244) (-58.967) [-57.042] * (-57.885) (-62.894) [-57.717] (-62.102) -- 0:01:21
745000 -- (-57.195) [-58.834] (-58.108) (-58.028) * (-57.557) [-59.167] (-59.400) (-61.731) -- 0:01:21
Average standard deviation of split frequencies: NA (no splits above min. frequency)
746000 -- (-64.492) [-57.346] (-59.088) (-58.658) * (-57.258) [-61.453] (-59.070) (-57.471) -- 0:01:21
747000 -- (-57.460) [-57.645] (-61.029) (-57.290) * (-58.351) [-58.770] (-57.155) (-58.657) -- 0:01:20
748000 -- (-57.729) [-58.412] (-60.986) (-60.822) * (-58.418) [-56.323] (-56.887) (-58.596) -- 0:01:20
749000 -- (-60.677) [-64.797] (-60.246) (-58.284) * (-59.872) [-57.613] (-60.511) (-60.098) -- 0:01:20
750000 -- (-58.194) [-58.402] (-57.664) (-57.561) * (-57.004) (-57.425) [-56.797] (-58.345) -- 0:01:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
751000 -- (-58.815) [-56.546] (-58.230) (-57.784) * (-57.151) (-57.786) [-57.706] (-56.623) -- 0:01:19
752000 -- (-58.332) (-57.166) [-58.206] (-57.370) * (-57.941) (-58.124) (-58.664) [-56.362] -- 0:01:19
753000 -- (-57.715) (-59.176) [-56.731] (-59.719) * [-56.975] (-57.845) (-56.634) (-60.757) -- 0:01:18
754000 -- (-59.924) (-58.495) [-59.369] (-59.702) * (-58.423) (-60.315) [-58.271] (-57.711) -- 0:01:18
755000 -- (-57.457) (-57.275) [-62.383] (-59.243) * (-59.967) (-58.725) [-57.327] (-57.275) -- 0:01:18
Average standard deviation of split frequencies: NA (no splits above min. frequency)
756000 -- (-58.554) (-57.769) [-57.601] (-57.974) * [-58.486] (-64.257) (-57.035) (-59.660) -- 0:01:17
757000 -- (-61.871) (-57.928) [-58.467] (-62.104) * (-61.097) [-61.455] (-57.593) (-64.082) -- 0:01:17
758000 -- (-58.634) (-57.305) [-57.391] (-62.301) * (-66.602) (-57.343) [-58.985] (-59.008) -- 0:01:17
759000 -- (-60.099) [-58.857] (-59.546) (-59.479) * (-61.899) (-57.643) (-62.801) [-57.708] -- 0:01:16
760000 -- (-57.069) [-58.200] (-57.255) (-59.667) * (-60.254) (-57.251) (-57.922) [-59.151] -- 0:01:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
761000 -- [-56.670] (-58.170) (-56.968) (-57.995) * (-59.215) (-60.154) (-59.759) [-57.607] -- 0:01:16
762000 -- [-57.654] (-58.160) (-59.853) (-58.650) * (-62.937) (-62.574) (-58.056) [-59.217] -- 0:01:15
763000 -- [-57.345] (-61.487) (-59.259) (-59.549) * (-59.637) (-60.217) (-59.256) [-58.358] -- 0:01:15
764000 -- [-56.194] (-56.620) (-60.191) (-58.114) * (-58.740) (-59.750) (-59.181) [-57.224] -- 0:01:15
765000 -- [-57.788] (-56.893) (-58.833) (-57.421) * (-57.382) (-58.222) (-57.777) [-57.944] -- 0:01:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
766000 -- [-59.961] (-59.082) (-61.640) (-57.146) * (-58.052) (-59.486) (-56.477) [-58.201] -- 0:01:14
767000 -- (-57.066) (-57.114) (-58.518) [-59.236] * (-60.820) (-58.522) (-57.686) [-57.381] -- 0:01:14
768000 -- [-60.655] (-57.153) (-60.038) (-60.873) * (-57.045) (-57.457) (-57.196) [-57.581] -- 0:01:14
769000 -- (-59.462) [-57.696] (-57.944) (-60.501) * (-57.919) (-57.702) (-57.156) [-57.620] -- 0:01:13
770000 -- (-60.372) [-58.944] (-56.978) (-61.004) * (-59.483) (-58.041) (-57.186) [-57.073] -- 0:01:13
Average standard deviation of split frequencies: NA (no splits above min. frequency)
771000 -- (-59.664) [-58.978] (-59.746) (-57.059) * (-57.807) (-65.845) (-58.322) [-57.873] -- 0:01:13
772000 -- (-57.131) [-57.724] (-57.146) (-59.078) * (-57.414) (-57.279) [-58.166] (-58.776) -- 0:01:12
773000 -- (-57.662) [-56.770] (-57.552) (-58.571) * (-59.919) (-58.066) [-58.312] (-57.918) -- 0:01:12
774000 -- (-57.534) [-57.211] (-58.189) (-61.478) * (-58.824) (-57.490) [-56.647] (-61.594) -- 0:01:12
775000 -- (-56.464) [-61.851] (-58.099) (-59.650) * (-56.893) (-59.391) [-58.616] (-59.694) -- 0:01:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
776000 -- (-59.133) [-56.748] (-57.109) (-59.012) * (-61.664) (-59.830) [-57.037] (-59.896) -- 0:01:11
777000 -- (-59.686) [-57.174] (-58.963) (-59.834) * (-58.384) (-57.639) (-58.473) [-57.215] -- 0:01:11
778000 -- (-61.878) [-56.842] (-60.938) (-59.947) * (-57.626) [-58.131] (-59.740) (-58.636) -- 0:01:10
779000 -- (-56.732) (-62.431) (-58.199) [-57.667] * (-56.313) [-57.293] (-56.763) (-58.799) -- 0:01:10
780000 -- (-61.341) (-59.541) (-57.477) [-61.129] * (-58.132) [-58.991] (-57.201) (-62.378) -- 0:01:10
Average standard deviation of split frequencies: NA (no splits above min. frequency)
781000 -- (-60.827) (-59.789) (-60.375) [-59.175] * (-57.535) [-60.039] (-60.148) (-57.727) -- 0:01:09
782000 -- (-60.706) (-59.213) (-58.233) [-56.995] * (-56.494) [-57.125] (-57.568) (-60.717) -- 0:01:09
783000 -- (-64.146) (-56.759) (-62.803) [-59.345] * (-57.151) [-56.916] (-58.980) (-57.292) -- 0:01:09
784000 -- (-58.731) (-58.714) [-57.930] (-58.482) * (-58.633) [-56.721] (-56.749) (-63.153) -- 0:01:08
785000 -- (-57.384) (-56.662) [-58.237] (-57.346) * (-56.847) [-58.464] (-58.967) (-59.563) -- 0:01:08
Average standard deviation of split frequencies: NA (no splits above min. frequency)
786000 -- (-56.821) (-61.277) [-62.504] (-59.629) * (-59.619) [-56.417] (-60.962) (-58.511) -- 0:01:08
787000 -- (-58.066) (-60.199) [-56.743] (-60.360) * (-57.845) [-58.060] (-57.804) (-57.775) -- 0:01:07
788000 -- (-62.430) (-59.124) [-56.667] (-59.865) * (-59.738) [-57.640] (-60.675) (-57.168) -- 0:01:07
789000 -- (-59.513) (-57.768) (-59.688) [-61.092] * (-59.239) [-60.457] (-60.652) (-58.465) -- 0:01:07
790000 -- (-65.713) (-57.935) (-60.073) [-57.292] * (-59.431) (-60.614) (-58.058) [-56.934] -- 0:01:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
791000 -- (-57.312) [-56.961] (-57.816) (-59.656) * (-63.856) (-59.667) (-59.169) [-58.641] -- 0:01:06
792000 -- (-56.392) [-57.861] (-57.032) (-58.066) * (-57.935) (-57.422) (-59.595) [-60.655] -- 0:01:06
793000 -- (-59.900) [-59.422] (-56.706) (-58.181) * (-57.651) (-57.810) (-61.535) [-57.098] -- 0:01:06
794000 -- (-66.714) (-59.423) [-58.875] (-60.180) * (-60.834) (-59.341) (-62.527) [-57.678] -- 0:01:05
795000 -- (-62.112) (-60.918) (-61.103) [-57.253] * (-57.965) (-58.878) (-58.985) [-58.138] -- 0:01:05
Average standard deviation of split frequencies: NA (no splits above min. frequency)
796000 -- (-57.967) (-58.791) (-58.681) [-56.382] * (-57.990) (-57.413) [-61.280] (-58.802) -- 0:01:05
797000 -- (-58.740) (-59.849) (-59.002) [-58.875] * (-56.603) (-58.383) [-58.197] (-57.149) -- 0:01:04
798000 -- (-65.600) (-61.100) (-57.156) [-56.274] * (-58.573) (-59.033) [-59.168] (-58.295) -- 0:01:04
799000 -- (-61.128) (-58.550) (-59.810) [-59.682] * (-61.851) (-58.220) [-57.866] (-61.913) -- 0:01:04
800000 -- (-57.149) (-59.872) (-57.097) [-59.815] * (-59.168) (-59.132) [-58.354] (-56.880) -- 0:01:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
801000 -- (-60.778) [-58.154] (-59.452) (-56.645) * (-56.939) (-60.609) [-56.888] (-57.940) -- 0:01:03
802000 -- (-58.325) [-58.600] (-57.225) (-58.515) * (-56.636) (-57.827) (-58.940) [-58.691] -- 0:01:03
803000 -- (-60.388) [-58.450] (-61.502) (-60.769) * (-59.830) (-56.975) (-58.567) [-59.624] -- 0:01:02
804000 -- (-58.941) (-57.134) (-56.765) [-56.447] * (-59.174) [-57.437] (-56.966) (-58.183) -- 0:01:02
805000 -- (-58.145) (-57.450) (-58.187) [-56.289] * (-58.570) [-60.049] (-61.850) (-56.214) -- 0:01:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
806000 -- (-57.493) (-58.198) [-58.699] (-58.514) * (-59.552) [-58.236] (-58.361) (-58.514) -- 0:01:01
807000 -- (-57.220) (-58.098) (-62.647) [-57.591] * (-58.405) (-60.673) (-59.479) [-58.600] -- 0:01:01
808000 -- (-58.743) (-57.867) (-58.815) [-59.010] * (-58.583) (-58.062) (-59.047) [-60.539] -- 0:01:01
809000 -- [-57.266] (-59.791) (-58.731) (-59.740) * (-57.625) (-58.126) (-57.655) [-59.205] -- 0:01:00
810000 -- [-57.443] (-58.647) (-58.643) (-58.118) * (-59.336) (-58.716) (-57.361) [-57.833] -- 0:01:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
811000 -- [-56.443] (-59.931) (-59.954) (-56.459) * (-60.875) (-60.657) [-58.929] (-57.448) -- 0:01:00
812000 -- [-57.482] (-58.871) (-62.298) (-57.481) * (-63.211) (-57.411) [-56.946] (-59.071) -- 0:00:59
813000 -- [-56.922] (-58.369) (-63.109) (-58.844) * (-62.899) (-58.610) [-59.968] (-59.356) -- 0:00:59
814000 -- (-56.486) (-59.694) (-58.588) [-58.547] * (-57.059) (-57.192) (-58.939) [-56.419] -- 0:00:59
815000 -- (-60.768) (-62.846) (-58.698) [-56.466] * (-56.772) (-58.318) (-59.814) [-56.511] -- 0:00:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
816000 -- (-58.824) (-57.099) (-57.062) [-58.868] * (-57.134) (-61.473) [-57.174] (-58.222) -- 0:00:58
817000 -- (-57.983) (-57.201) (-61.973) [-58.061] * (-60.038) (-58.174) [-57.667] (-58.905) -- 0:00:58
818000 -- (-58.233) (-60.067) (-60.309) [-57.713] * (-58.221) (-57.565) [-58.043] (-57.052) -- 0:00:58
819000 -- (-57.276) (-60.029) (-57.567) [-57.943] * (-57.549) (-59.048) [-57.718] (-58.475) -- 0:00:57
820000 -- (-57.277) (-61.356) [-57.844] (-57.259) * (-60.785) (-56.462) [-57.524] (-59.684) -- 0:00:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
821000 -- [-59.276] (-56.390) (-57.748) (-57.408) * (-63.962) (-57.315) [-57.459] (-56.667) -- 0:00:57
822000 -- (-63.137) [-58.052] (-59.846) (-56.970) * (-56.600) (-61.310) [-57.078] (-59.269) -- 0:00:56
823000 -- (-57.714) [-61.046] (-57.277) (-57.840) * (-57.631) (-62.192) [-58.152] (-61.581) -- 0:00:56
824000 -- (-56.181) (-57.815) [-58.552] (-60.283) * (-56.302) (-59.889) (-58.095) [-58.178] -- 0:00:56
825000 -- (-58.811) (-61.959) [-57.838] (-57.849) * (-58.933) (-57.852) (-58.578) [-56.628] -- 0:00:55
Average standard deviation of split frequencies: NA (no splits above min. frequency)
826000 -- (-57.245) (-63.226) [-59.816] (-60.345) * (-58.944) (-58.749) (-56.565) [-60.423] -- 0:00:55
827000 -- (-57.546) (-60.553) [-59.423] (-58.731) * (-58.866) (-59.331) (-57.537) [-57.672] -- 0:00:55
828000 -- (-60.300) (-60.594) [-58.992] (-57.648) * (-59.879) (-58.483) (-59.265) [-60.968] -- 0:00:54
829000 -- (-56.366) (-56.168) [-57.802] (-58.138) * (-62.260) (-57.467) (-57.269) [-56.917] -- 0:00:54
830000 -- (-56.974) (-56.528) [-59.575] (-58.749) * [-60.133] (-61.184) (-57.695) (-57.740) -- 0:00:54
Average standard deviation of split frequencies: NA (no splits above min. frequency)
831000 -- [-57.791] (-57.207) (-58.650) (-57.231) * [-59.307] (-60.343) (-56.547) (-56.914) -- 0:00:53
832000 -- [-58.923] (-58.347) (-58.273) (-57.380) * (-57.222) (-58.659) [-59.229] (-61.749) -- 0:00:53
833000 -- (-57.043) (-59.321) (-56.447) [-56.421] * [-60.783] (-59.888) (-59.117) (-59.393) -- 0:00:53
834000 -- (-56.759) (-56.887) (-57.952) [-59.268] * [-56.979] (-59.096) (-59.044) (-59.502) -- 0:00:52
835000 -- (-57.328) [-58.827] (-57.024) (-57.371) * [-56.478] (-57.900) (-58.186) (-60.142) -- 0:00:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
836000 -- (-57.988) [-57.811] (-60.522) (-56.975) * [-57.584] (-57.099) (-57.259) (-58.946) -- 0:00:52
837000 -- [-56.161] (-58.263) (-61.352) (-60.045) * [-57.314] (-61.470) (-60.972) (-56.896) -- 0:00:51
838000 -- [-58.058] (-56.572) (-58.388) (-57.066) * (-62.061) (-57.849) [-60.050] (-60.334) -- 0:00:51
839000 -- (-57.244) (-57.270) (-63.611) [-58.771] * (-58.376) [-57.440] (-59.929) (-58.877) -- 0:00:51
840000 -- (-58.950) (-59.396) (-56.635) [-58.380] * (-58.077) [-57.066] (-57.830) (-58.386) -- 0:00:51
Average standard deviation of split frequencies: NA (no splits above min. frequency)
841000 -- (-57.216) (-57.308) (-62.746) [-60.422] * (-57.835) [-59.111] (-58.595) (-58.871) -- 0:00:50
842000 -- (-57.278) (-59.093) (-56.989) [-59.376] * (-61.316) [-58.772] (-63.053) (-58.613) -- 0:00:50
843000 -- [-57.389] (-57.156) (-61.717) (-61.795) * (-60.340) [-57.969] (-57.830) (-56.817) -- 0:00:50
844000 -- [-56.944] (-58.940) (-57.454) (-60.072) * (-56.876) (-57.829) (-59.415) [-58.791] -- 0:00:49
845000 -- [-57.146] (-57.749) (-59.494) (-61.533) * (-58.625) (-61.292) (-58.059) [-58.052] -- 0:00:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
846000 -- [-59.701] (-61.293) (-57.737) (-59.626) * (-59.271) (-58.590) (-59.590) [-58.169] -- 0:00:49
847000 -- (-58.060) (-60.839) [-59.654] (-56.704) * (-58.839) (-58.246) (-57.650) [-59.596] -- 0:00:48
848000 -- (-59.315) (-57.296) [-57.669] (-57.235) * (-60.528) (-59.847) (-57.336) [-57.864] -- 0:00:48
849000 -- [-57.941] (-57.457) (-58.859) (-56.647) * (-60.779) (-57.264) (-58.196) [-57.021] -- 0:00:48
850000 -- (-58.188) (-56.462) (-58.397) [-56.830] * (-57.171) (-59.186) (-60.791) [-57.016] -- 0:00:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
851000 -- (-59.130) (-58.062) (-56.809) [-56.982] * (-56.472) (-58.402) (-57.640) [-56.384] -- 0:00:47
852000 -- (-60.385) (-57.711) (-57.232) [-57.005] * (-58.814) (-61.974) (-60.790) [-56.885] -- 0:00:47
853000 -- [-58.275] (-60.007) (-58.177) (-58.825) * [-56.773] (-57.019) (-61.129) (-61.945) -- 0:00:46
854000 -- [-62.393] (-56.665) (-60.085) (-64.253) * [-58.017] (-57.530) (-60.831) (-58.320) -- 0:00:46
855000 -- [-61.967] (-58.081) (-58.452) (-60.121) * [-58.287] (-58.036) (-59.760) (-56.986) -- 0:00:46
Average standard deviation of split frequencies: NA (no splits above min. frequency)
856000 -- [-58.515] (-58.987) (-57.817) (-57.337) * (-58.563) [-59.643] (-60.532) (-58.336) -- 0:00:45
857000 -- [-57.088] (-62.455) (-59.999) (-58.571) * (-59.237) [-57.354] (-57.589) (-56.597) -- 0:00:45
858000 -- [-57.167] (-58.097) (-57.899) (-57.827) * (-58.610) [-58.350] (-61.735) (-57.222) -- 0:00:45
859000 -- [-61.860] (-57.587) (-60.162) (-59.630) * (-57.588) [-57.958] (-57.992) (-58.421) -- 0:00:44
860000 -- [-57.889] (-56.545) (-60.157) (-61.839) * (-56.148) [-59.614] (-56.733) (-56.587) -- 0:00:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
861000 -- [-63.545] (-58.027) (-58.414) (-60.359) * (-56.849) (-56.684) (-58.331) [-60.229] -- 0:00:44
862000 -- (-66.164) (-59.230) [-57.303] (-58.059) * (-58.707) (-60.500) (-64.136) [-58.032] -- 0:00:44
863000 -- (-58.656) (-61.820) [-60.452] (-60.206) * (-56.634) (-57.390) (-63.032) [-59.470] -- 0:00:43
864000 -- (-57.175) (-63.998) [-61.306] (-61.667) * (-57.999) (-59.199) (-58.755) [-56.916] -- 0:00:43
865000 -- (-57.128) (-58.076) [-56.306] (-60.916) * (-57.671) (-57.204) (-59.696) [-59.347] -- 0:00:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
866000 -- [-60.411] (-56.954) (-56.694) (-59.626) * (-59.324) (-61.277) [-57.846] (-57.270) -- 0:00:42
867000 -- (-57.321) (-56.550) [-57.061] (-58.651) * (-58.899) [-57.176] (-59.441) (-56.795) -- 0:00:42
868000 -- (-56.710) (-57.416) [-58.534] (-58.594) * (-58.587) [-56.674] (-57.454) (-57.804) -- 0:00:42
869000 -- (-59.260) (-56.328) [-63.561] (-57.979) * (-59.926) (-56.694) [-61.158] (-58.428) -- 0:00:41
870000 -- (-61.177) (-59.397) [-58.009] (-58.905) * (-56.572) (-57.710) [-56.945] (-58.513) -- 0:00:41
Average standard deviation of split frequencies: NA (no splits above min. frequency)
871000 -- (-58.095) (-58.502) [-57.056] (-59.695) * (-57.883) [-57.134] (-57.364) (-58.117) -- 0:00:41
872000 -- (-57.100) (-57.652) [-58.108] (-57.037) * (-58.780) [-62.805] (-57.247) (-63.940) -- 0:00:40
873000 -- (-56.802) [-57.704] (-57.876) (-57.480) * (-57.517) [-59.293] (-60.008) (-59.978) -- 0:00:40
874000 -- (-56.325) [-57.359] (-57.393) (-59.227) * (-58.558) [-57.171] (-56.754) (-59.688) -- 0:00:40
875000 -- [-56.911] (-58.276) (-59.328) (-57.664) * (-58.586) [-57.315] (-57.531) (-57.435) -- 0:00:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
876000 -- [-57.498] (-58.923) (-57.706) (-61.241) * (-58.476) [-56.725] (-58.723) (-58.724) -- 0:00:39
877000 -- [-56.301] (-60.007) (-57.315) (-62.475) * (-59.372) (-58.105) [-57.848] (-59.448) -- 0:00:39
878000 -- [-59.863] (-57.792) (-56.874) (-57.815) * (-56.228) (-57.145) [-58.056] (-58.775) -- 0:00:38
879000 -- (-57.368) [-57.837] (-58.184) (-58.233) * (-57.918) (-58.310) [-59.452] (-58.507) -- 0:00:38
880000 -- (-59.006) (-57.496) [-58.633] (-57.231) * (-58.232) (-60.159) [-57.915] (-62.175) -- 0:00:38
Average standard deviation of split frequencies: NA (no splits above min. frequency)
881000 -- (-57.706) (-60.913) (-56.978) [-56.224] * (-56.561) (-59.138) [-57.813] (-63.872) -- 0:00:37
882000 -- (-58.003) (-59.326) [-58.389] (-56.568) * (-56.629) (-60.536) [-58.181] (-65.767) -- 0:00:37
883000 -- (-57.147) (-57.941) (-56.449) [-57.324] * [-59.077] (-58.198) (-57.987) (-64.416) -- 0:00:37
884000 -- (-57.550) (-58.110) (-58.863) [-59.469] * [-57.341] (-56.497) (-62.013) (-60.673) -- 0:00:37
885000 -- (-61.587) (-57.665) (-57.850) [-57.240] * (-58.339) (-64.597) [-59.170] (-60.745) -- 0:00:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
886000 -- [-57.527] (-58.700) (-57.671) (-57.934) * (-57.796) (-61.425) [-58.634] (-58.721) -- 0:00:36
887000 -- (-58.929) (-59.500) (-60.278) [-56.435] * [-58.647] (-61.111) (-57.307) (-57.815) -- 0:00:36
888000 -- (-57.012) [-57.226] (-56.376) (-57.370) * (-57.310) (-57.546) [-57.216] (-57.113) -- 0:00:35
889000 -- (-59.471) (-58.395) (-56.817) [-58.832] * (-57.596) [-57.588] (-62.674) (-57.820) -- 0:00:35
890000 -- (-56.375) (-62.358) (-57.585) [-61.822] * (-57.851) [-57.317] (-59.544) (-62.592) -- 0:00:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
891000 -- (-67.991) (-58.901) (-57.496) [-56.825] * (-57.268) [-57.577] (-59.964) (-59.465) -- 0:00:34
892000 -- [-57.693] (-58.290) (-58.672) (-58.881) * (-58.137) [-57.379] (-57.927) (-58.165) -- 0:00:34
893000 -- [-56.837] (-57.688) (-59.159) (-58.496) * (-61.516) (-60.772) [-57.948] (-58.155) -- 0:00:34
894000 -- [-56.959] (-56.483) (-58.776) (-56.498) * (-58.805) (-58.013) [-59.577] (-60.136) -- 0:00:33
895000 -- (-63.606) (-58.633) [-57.196] (-58.956) * (-58.838) (-57.827) [-56.939] (-59.000) -- 0:00:33
Average standard deviation of split frequencies: NA (no splits above min. frequency)
896000 -- (-59.397) (-61.377) [-59.277] (-59.989) * (-59.170) (-59.919) [-58.549] (-60.372) -- 0:00:33
897000 -- (-56.624) (-62.286) [-56.543] (-62.651) * (-57.873) (-57.454) [-57.794] (-56.922) -- 0:00:32
898000 -- (-57.980) (-60.415) [-56.718] (-57.732) * (-57.246) (-56.835) [-56.400] (-56.663) -- 0:00:32
899000 -- (-57.002) (-59.783) [-57.423] (-59.152) * (-57.300) (-59.437) [-58.002] (-58.655) -- 0:00:32
900000 -- (-57.519) (-58.258) [-58.195] (-58.001) * (-57.886) [-57.708] (-58.937) (-61.132) -- 0:00:31
Average standard deviation of split frequencies: NA (no splits above min. frequency)
901000 -- [-58.203] (-60.224) (-57.692) (-58.885) * (-58.105) [-57.873] (-58.153) (-57.121) -- 0:00:31
902000 -- (-57.118) (-61.040) [-58.019] (-57.166) * (-56.836) [-59.335] (-56.861) (-58.318) -- 0:00:31
903000 -- (-61.678) (-57.368) [-58.206] (-58.234) * (-58.633) [-58.017] (-61.391) (-59.309) -- 0:00:30
904000 -- (-57.045) (-57.379) [-61.496] (-58.136) * [-57.068] (-57.919) (-59.918) (-57.329) -- 0:00:30
905000 -- (-58.249) (-60.710) (-58.470) [-57.319] * [-56.140] (-59.753) (-56.690) (-61.047) -- 0:00:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
906000 -- (-59.385) (-58.384) (-57.074) [-59.061] * [-56.403] (-58.102) (-57.187) (-60.592) -- 0:00:29
907000 -- (-58.826) (-57.966) (-60.930) [-59.034] * [-56.520] (-56.706) (-57.419) (-59.967) -- 0:00:29
908000 -- (-56.560) (-60.106) (-60.083) [-57.564] * [-59.425] (-62.692) (-60.359) (-61.007) -- 0:00:29
909000 -- (-58.217) (-59.290) (-59.936) [-58.994] * [-57.644] (-60.368) (-59.923) (-63.546) -- 0:00:29
910000 -- (-56.658) (-60.484) (-62.604) [-57.063] * [-57.760] (-62.141) (-59.572) (-60.011) -- 0:00:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
911000 -- (-58.213) (-57.035) (-62.337) [-58.928] * [-59.214] (-61.191) (-60.604) (-62.849) -- 0:00:28
912000 -- (-57.897) [-57.993] (-57.979) (-57.706) * [-57.749] (-57.828) (-59.514) (-64.556) -- 0:00:28
913000 -- (-57.060) [-56.856] (-56.662) (-61.573) * [-57.838] (-60.440) (-59.876) (-62.098) -- 0:00:27
914000 -- (-57.973) [-57.302] (-58.164) (-61.608) * [-57.597] (-56.987) (-59.045) (-60.672) -- 0:00:27
915000 -- (-58.855) [-58.001] (-62.131) (-57.119) * [-57.598] (-59.538) (-58.018) (-56.490) -- 0:00:27
Average standard deviation of split frequencies: NA (no splits above min. frequency)
916000 -- (-59.040) [-58.672] (-57.090) (-57.137) * (-60.493) [-57.224] (-57.560) (-57.794) -- 0:00:26
917000 -- (-58.263) [-62.323] (-59.293) (-57.233) * (-56.431) [-59.699] (-56.926) (-59.983) -- 0:00:26
918000 -- (-57.190) [-59.424] (-58.705) (-58.082) * (-59.321) (-57.375) (-57.303) [-58.339] -- 0:00:26
919000 -- [-59.495] (-57.643) (-61.948) (-59.541) * (-57.702) [-59.366] (-60.281) (-61.553) -- 0:00:25
920000 -- [-56.690] (-59.071) (-59.652) (-57.467) * (-58.723) [-57.642] (-58.173) (-57.179) -- 0:00:25
Average standard deviation of split frequencies: NA (no splits above min. frequency)
921000 -- (-58.420) [-56.576] (-58.489) (-58.398) * (-58.705) [-58.778] (-63.872) (-60.774) -- 0:00:25
922000 -- (-59.905) [-57.086] (-66.348) (-57.813) * (-58.009) [-61.116] (-57.665) (-56.985) -- 0:00:24
923000 -- (-59.168) [-62.273] (-57.342) (-60.825) * (-57.717) [-58.773] (-57.026) (-58.650) -- 0:00:24
924000 -- (-57.925) [-60.276] (-57.391) (-58.128) * (-58.990) [-58.324] (-59.465) (-59.894) -- 0:00:24
925000 -- (-57.930) [-59.828] (-58.095) (-57.583) * (-61.904) [-57.807] (-58.335) (-57.820) -- 0:00:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
926000 -- (-59.784) [-57.036] (-58.225) (-57.186) * (-59.096) (-59.132) [-59.312] (-57.573) -- 0:00:23
927000 -- (-59.392) [-57.309] (-58.895) (-61.872) * (-57.892) [-58.884] (-58.650) (-64.136) -- 0:00:23
928000 -- (-57.512) [-58.794] (-58.853) (-61.250) * (-58.515) (-60.102) [-58.877] (-61.260) -- 0:00:22
929000 -- (-60.133) [-57.708] (-58.972) (-59.784) * (-60.810) (-66.421) (-60.552) [-57.052] -- 0:00:22
930000 -- (-57.654) [-57.112] (-60.978) (-57.682) * (-58.945) (-57.643) (-58.193) [-57.851] -- 0:00:22
Average standard deviation of split frequencies: NA (no splits above min. frequency)
931000 -- (-58.225) [-59.985] (-63.643) (-60.943) * (-59.481) (-57.620) (-58.357) [-58.610] -- 0:00:22
932000 -- (-57.887) [-61.528] (-59.893) (-56.698) * (-58.311) (-58.195) (-57.088) [-56.810] -- 0:00:21
933000 -- (-57.906) [-62.297] (-56.464) (-59.381) * (-56.946) (-60.400) (-58.890) [-59.091] -- 0:00:21
934000 -- (-57.209) [-58.276] (-57.356) (-56.093) * (-56.717) (-58.751) (-59.487) [-57.526] -- 0:00:21
935000 -- [-59.680] (-61.739) (-57.060) (-56.615) * (-60.592) (-59.095) (-57.623) [-58.105] -- 0:00:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
936000 -- [-58.702] (-59.012) (-57.976) (-58.968) * (-58.477) (-58.119) (-58.317) [-59.242] -- 0:00:20
937000 -- (-56.773) (-58.335) (-56.592) [-57.419] * (-57.230) (-60.176) (-58.482) [-56.772] -- 0:00:20
938000 -- (-57.594) (-58.299) (-62.192) [-57.440] * (-58.816) (-61.493) (-59.253) [-56.854] -- 0:00:19
939000 -- (-57.894) (-59.372) (-59.217) [-60.225] * (-59.787) (-60.281) (-60.016) [-57.551] -- 0:00:19
940000 -- (-58.845) (-56.763) (-59.907) [-58.913] * [-56.859] (-56.275) (-57.356) (-56.476) -- 0:00:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
941000 -- (-58.800) (-58.179) (-56.927) [-57.723] * [-58.748] (-57.794) (-58.908) (-58.951) -- 0:00:18
942000 -- (-66.005) (-57.468) [-58.026] (-60.162) * [-58.232] (-59.394) (-58.212) (-56.916) -- 0:00:18
943000 -- (-59.750) (-57.712) [-57.547] (-60.580) * [-56.179] (-59.810) (-56.792) (-59.759) -- 0:00:18
944000 -- (-59.221) (-56.979) [-57.392] (-57.991) * [-57.994] (-59.458) (-57.702) (-58.643) -- 0:00:17
945000 -- (-59.059) (-59.237) [-60.022] (-60.997) * (-58.461) (-60.049) [-58.057] (-56.420) -- 0:00:17
Average standard deviation of split frequencies: NA (no splits above min. frequency)
946000 -- (-58.456) (-57.604) (-56.995) [-59.410] * [-56.297] (-57.776) (-58.960) (-57.365) -- 0:00:17
947000 -- (-57.496) (-58.335) [-57.567] (-61.526) * (-57.859) (-58.778) (-62.540) [-57.849] -- 0:00:16
948000 -- [-56.921] (-61.115) (-58.728) (-58.896) * (-57.389) (-60.303) (-57.911) [-57.368] -- 0:00:16
949000 -- (-62.421) [-60.390] (-62.409) (-57.938) * (-59.299) (-58.973) (-60.675) [-57.019] -- 0:00:16
950000 -- (-60.221) (-60.466) [-60.136] (-58.067) * (-58.137) (-58.929) (-62.830) [-56.961] -- 0:00:15
Average standard deviation of split frequencies: NA (no splits above min. frequency)
951000 -- (-57.751) (-59.629) (-60.527) [-60.796] * (-56.808) (-58.108) (-59.362) [-57.304] -- 0:00:15
952000 -- [-60.129] (-58.629) (-59.839) (-61.160) * (-58.514) (-59.091) (-59.338) [-58.364] -- 0:00:15
953000 -- [-57.406] (-59.867) (-57.714) (-59.060) * (-57.379) (-58.359) [-56.444] (-58.269) -- 0:00:14
954000 -- (-56.645) (-68.060) (-57.064) [-58.070] * (-58.196) (-57.529) [-58.830] (-59.088) -- 0:00:14
955000 -- (-61.021) (-61.068) (-58.062) [-56.852] * (-58.236) [-56.990] (-58.279) (-58.459) -- 0:00:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
956000 -- (-58.804) (-57.078) (-57.588) [-60.682] * (-57.539) [-56.907] (-58.257) (-58.315) -- 0:00:14
957000 -- (-57.482) (-60.977) (-57.843) [-58.885] * (-57.795) [-57.159] (-58.939) (-58.126) -- 0:00:13
958000 -- (-58.789) (-59.452) (-57.514) [-56.611] * (-58.391) [-61.726] (-58.605) (-57.217) -- 0:00:13
959000 -- (-59.287) (-56.993) (-56.450) [-59.447] * (-58.516) [-57.373] (-56.880) (-57.272) -- 0:00:13
960000 -- [-56.230] (-59.234) (-59.671) (-59.321) * (-60.890) [-57.647] (-58.530) (-56.286) -- 0:00:12
Average standard deviation of split frequencies: NA (no splits above min. frequency)
961000 -- [-57.900] (-59.208) (-58.414) (-57.109) * (-59.297) [-58.687] (-59.646) (-57.745) -- 0:00:12
962000 -- [-57.783] (-63.391) (-58.475) (-61.665) * (-59.387) (-57.649) [-57.585] (-60.490) -- 0:00:12
963000 -- [-57.837] (-58.927) (-61.061) (-63.491) * (-57.509) (-58.021) [-58.012] (-57.215) -- 0:00:11
964000 -- (-61.979) [-59.285] (-57.854) (-61.728) * (-58.180) [-57.541] (-57.381) (-58.460) -- 0:00:11
965000 -- (-61.750) [-58.396] (-57.007) (-65.856) * (-58.601) [-56.748] (-58.196) (-57.479) -- 0:00:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
966000 -- (-56.887) [-56.059] (-56.436) (-58.574) * (-57.653) [-58.660] (-56.982) (-59.232) -- 0:00:10
967000 -- (-62.917) [-57.359] (-56.802) (-60.165) * [-59.889] (-58.184) (-56.869) (-58.390) -- 0:00:10
968000 -- (-58.009) [-56.885] (-58.417) (-56.966) * (-57.743) (-59.529) [-57.657] (-58.640) -- 0:00:10
969000 -- (-60.201) [-58.972] (-61.335) (-59.398) * (-61.088) (-58.354) [-57.851] (-58.419) -- 0:00:09
970000 -- (-62.105) [-56.844] (-60.162) (-57.630) * (-59.106) (-58.079) [-57.403] (-58.396) -- 0:00:09
Average standard deviation of split frequencies: NA (no splits above min. frequency)
971000 -- (-60.831) [-56.602] (-57.980) (-60.386) * (-59.845) (-57.052) (-56.644) [-57.701] -- 0:00:09
972000 -- (-57.673) [-62.762] (-56.244) (-62.509) * (-63.523) [-58.253] (-60.337) (-58.784) -- 0:00:08
973000 -- (-56.603) [-56.036] (-58.061) (-59.041) * (-56.837) (-57.682) [-56.198] (-59.665) -- 0:00:08
974000 -- (-57.518) [-57.133] (-58.698) (-58.752) * (-58.311) (-61.596) [-57.889] (-58.400) -- 0:00:08
975000 -- [-59.178] (-57.801) (-60.361) (-57.190) * (-57.410) (-60.668) [-57.388] (-61.829) -- 0:00:07
Average standard deviation of split frequencies: NA (no splits above min. frequency)
976000 -- [-57.437] (-56.410) (-59.520) (-58.867) * (-58.467) [-58.753] (-58.300) (-56.969) -- 0:00:07
977000 -- [-57.170] (-64.380) (-57.219) (-60.057) * (-59.562) [-60.673] (-56.856) (-57.468) -- 0:00:07
978000 -- [-59.183] (-57.709) (-57.466) (-60.049) * (-58.804) [-58.689] (-64.781) (-58.340) -- 0:00:07
979000 -- [-62.081] (-62.715) (-60.426) (-57.981) * (-59.625) (-60.982) [-57.204] (-58.496) -- 0:00:06
980000 -- [-58.084] (-65.439) (-58.248) (-58.559) * (-60.509) (-56.872) [-61.248] (-58.661) -- 0:00:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
981000 -- [-59.857] (-61.007) (-58.650) (-58.238) * (-60.506) (-57.942) [-58.934] (-56.396) -- 0:00:06
982000 -- [-57.423] (-57.845) (-58.490) (-57.356) * (-60.459) (-60.510) (-59.274) [-59.761] -- 0:00:05
983000 -- (-57.556) (-58.626) (-61.775) [-58.440] * (-58.986) [-57.297] (-61.857) (-57.341) -- 0:00:05
984000 -- (-58.208) (-60.169) (-57.271) [-56.671] * (-58.197) [-57.725] (-57.039) (-57.898) -- 0:00:05
985000 -- (-56.772) (-58.942) (-60.791) [-57.544] * (-57.719) [-58.587] (-57.299) (-59.583) -- 0:00:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
986000 -- [-56.997] (-57.592) (-59.222) (-56.178) * (-58.023) [-59.764] (-57.577) (-57.409) -- 0:00:04
987000 -- [-56.346] (-61.520) (-58.219) (-58.514) * (-57.937) [-57.593] (-56.609) (-57.496) -- 0:00:04
988000 -- [-57.041] (-60.073) (-59.570) (-58.360) * (-56.588) [-57.525] (-58.169) (-57.949) -- 0:00:03
989000 -- (-59.566) (-59.226) (-63.161) [-57.702] * (-58.442) [-58.517] (-57.248) (-59.753) -- 0:00:03
990000 -- (-62.828) (-57.916) (-58.981) [-56.506] * (-57.792) [-57.321] (-57.082) (-58.504) -- 0:00:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
991000 -- (-60.864) (-58.258) (-57.004) [-58.462] * (-57.200) [-58.774] (-56.531) (-57.824) -- 0:00:02
992000 -- (-61.704) (-58.603) (-58.616) [-59.928] * (-62.772) [-62.272] (-60.634) (-58.575) -- 0:00:02
993000 -- (-58.146) [-57.458] (-57.082) (-56.299) * (-61.000) [-58.813] (-57.779) (-58.573) -- 0:00:02
994000 -- (-57.395) [-58.639] (-58.855) (-56.405) * (-60.127) [-56.884] (-59.452) (-57.595) -- 0:00:01
995000 -- (-59.120) [-57.104] (-57.370) (-56.382) * [-58.446] (-60.000) (-56.406) (-57.366) -- 0:00:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
996000 -- [-56.521] (-62.312) (-59.321) (-58.822) * [-57.150] (-57.613) (-57.935) (-58.471) -- 0:00:01
997000 -- (-59.936) (-56.720) [-57.392] (-66.011) * [-57.183] (-59.768) (-59.929) (-59.531) -- 0:00:00
998000 -- (-58.381) [-58.527] (-56.870) (-57.239) * [-56.789] (-57.744) (-58.226) (-60.046) -- 0:00:00
999000 -- (-56.948) (-56.441) [-57.926] (-56.863) * [-57.095] (-58.705) (-56.826) (-59.537) -- 0:00:00
1000000 -- (-58.438) (-59.111) [-60.125] (-57.811) * [-56.200] (-57.517) (-58.048) (-59.144) -- 0:00:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
Analysis completed in 5 mins 19 seconds
Analysis used 318.15 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -56.01
Likelihood of best state for "cold" chain of run 2 was -56.02
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
76.1 % ( 72 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
71.2 % ( 65 %) Dirichlet(Pi{all})
70.1 % ( 58 %) Slider(Pi{all})
81.0 % ( 66 %) Multiplier(Alpha{1,2})
80.6 % ( 57 %) Multiplier(Alpha{3})
49.6 % ( 35 %) Slider(Pinvar{all})
98.7 % (100 %) ExtSPR(Tau{all},V{all})
98.3 % ( 98 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
97.3 % ( 94 %) ParsSPR(Tau{all},V{all})
27.9 % ( 27 %) Multiplier(V{all})
96.6 % ( 97 %) Nodeslider(V{all})
41.5 % ( 20 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
77.2 % ( 76 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
71.8 % ( 63 %) Dirichlet(Pi{all})
70.5 % ( 56 %) Slider(Pi{all})
81.3 % ( 68 %) Multiplier(Alpha{1,2})
81.2 % ( 67 %) Multiplier(Alpha{3})
49.0 % ( 34 %) Slider(Pinvar{all})
98.7 % (100 %) ExtSPR(Tau{all},V{all})
98.3 % ( 99 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
97.4 % ( 98 %) ParsSPR(Tau{all},V{all})
27.8 % ( 25 %) Multiplier(V{all})
96.5 % ( 96 %) Nodeslider(V{all})
41.2 % ( 25 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.02 0.00 0.00
2 | 165961 0.21 0.03
3 | 166628 167146 0.34
4 | 167098 166593 166574
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.02 0.00 0.00
2 | 166557 0.21 0.03
3 | 166551 167149 0.34
4 | 166425 166668 166650
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/mrbayes_input.nex.run1.p and /data/mrbayes_input.nex.run2.p
Writing summary statistics to file /data/mrbayes_input.nex.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -57.53
| 2 2 |
| 2 2 |
| 1 1 2 2 1 |
| 1 1 2 21 1 1 2 1 12 212 21 |
| 2 2 2 22 1 2 122 21 1 2 2 *|
| 1 1 1*1*21 1 1 1 21 2 2 22 2 1 1 |
|1 * 12 21 2 211 2 1 2 2 |
|2 2 2 12*1 11 2 2 2 |
| 1 2 1 2 1 1 1 1 1 11 1 |
| 2 2 2 1 2 1 1 1 2 |
| 2 2 1 |
| 1 |
| 1 |
| 1 |
| 2 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -59.46
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -57.64 -60.60
2 -57.64 -60.10
--------------------------------------
TOTAL -57.64 -60.38
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.807984 90.333854 0.000164 28.764700 5.735977 967.45 1028.50 1.000
r(A<->C){all} 0.165654 0.021068 0.000064 0.455182 0.123415 125.04 149.37 1.000
r(A<->G){all} 0.170900 0.018980 0.000083 0.433835 0.136099 124.89 132.60 1.000
r(A<->T){all} 0.151770 0.015273 0.000071 0.388614 0.125407 63.31 106.76 1.000
r(C<->G){all} 0.165822 0.018151 0.000039 0.444862 0.132736 116.46 122.07 1.006
r(C<->T){all} 0.167028 0.017793 0.000033 0.426189 0.139534 82.30 94.54 1.010
r(G<->T){all} 0.178825 0.022848 0.000025 0.478007 0.137987 126.63 141.55 1.000
pi(A){all} 0.259969 0.003852 0.143177 0.381620 0.257616 626.84 639.65 1.000
pi(C){all} 0.173732 0.002799 0.072980 0.272028 0.170368 413.96 587.62 1.000
pi(G){all} 0.195107 0.003215 0.092837 0.311387 0.190615 547.99 604.85 1.000
pi(T){all} 0.371192 0.004718 0.234261 0.500150 0.371798 617.62 637.33 1.000
alpha{1,2} 0.907621 1.022300 0.000028 2.861831 0.567431 772.01 782.94 1.002
alpha{3} 0.952881 0.921427 0.000589 2.884986 0.670476 562.48 798.47 1.001
pinvar{all} 0.938101 0.019642 0.757651 0.999936 0.977153 118.08 122.32 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/mrbayes_input.nex.run1.t" and "/data/mrbayes_input.nex.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/mrbayes_input.nex.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/mrbayes_input.nex.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a parameter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C65
2 -- C10
3 -- C67
4 -- C9
5 -- C73
6 -- C72
7 -- C74
8 -- C16
9 -- C80
10 -- C81
11 -- C58
12 -- C87
13 -- C60
14 -- C107
15 -- C115
16 -- C114
17 -- C61
18 -- C8
19 -- C117
20 -- C122
21 -- C124
22 -- C125
23 -- C130
24 -- C20
25 -- C132
26 -- C133
27 -- C25
28 -- C7
29 -- C83
30 -- C140
Key to taxon bipartitions (saved to file "/data/mrbayes_input.nex.parts"):
ID -- Partition
------------------------------------
1 -- .*****************************
2 -- .*............................
3 -- ..*...........................
4 -- ...*..........................
5 -- ....*.........................
6 -- .....*........................
7 -- ......*.......................
8 -- .......*......................
9 -- ........*.....................
10 -- .........*....................
11 -- ..........*...................
12 -- ...........*..................
13 -- ............*.................
14 -- .............*................
15 -- ..............*...............
16 -- ...............*..............
17 -- ................*.............
18 -- .................*............
19 -- ..................*...........
20 -- ...................*..........
21 -- ....................*.........
22 -- .....................*........
23 -- ......................*.......
24 -- .......................*......
25 -- ........................*.....
26 -- .........................*....
27 -- ..........................*...
28 -- ...........................*..
29 -- ............................*.
30 -- .............................*
------------------------------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/mrbayes_input.nex.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/mrbayes_input.nex.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.152348 0.073135 0.000000 0.637465 0.051540 1.000 2
length{all}[2] 0.153166 0.081573 0.000000 0.627303 0.053868 1.000 2
length{all}[3] 0.152607 0.071784 0.000000 0.628300 0.052942 1.000 2
length{all}[4] 0.150931 0.071055 0.000000 0.640067 0.050872 1.000 2
length{all}[5] 0.164205 0.107590 0.000000 0.673566 0.056485 1.000 2
length{all}[6] 0.155545 0.074384 0.000000 0.663627 0.057048 1.000 2
length{all}[7] 0.162205 0.084173 0.000000 0.673026 0.060859 1.000 2
length{all}[8] 0.152510 0.078984 0.000000 0.601391 0.056614 1.000 2
length{all}[9] 0.149315 0.072561 0.000000 0.595047 0.055679 1.000 2
length{all}[10] 0.152370 0.075339 0.000000 0.622868 0.052295 1.000 2
length{all}[11] 0.148701 0.067251 0.000001 0.574946 0.051974 1.001 2
length{all}[12] 0.155064 0.083117 0.000001 0.639672 0.053962 1.000 2
length{all}[13] 0.154576 0.073893 0.000000 0.661124 0.054962 1.000 2
length{all}[14] 0.156661 0.085042 0.000000 0.610730 0.056133 1.000 2
length{all}[15] 0.159201 0.082651 0.000001 0.688888 0.055520 1.000 2
length{all}[16] 0.156201 0.075080 0.000000 0.639506 0.055373 1.000 2
length{all}[17] 0.160769 0.092451 0.000002 0.667067 0.056027 1.000 2
length{all}[18] 0.153348 0.075845 0.000000 0.677450 0.051711 1.000 2
length{all}[19] 0.160313 0.080849 0.000000 0.658970 0.052173 1.000 2
length{all}[20] 0.160897 0.079999 0.000000 0.704230 0.053880 1.000 2
length{all}[21] 0.158101 0.079078 0.000000 0.676335 0.055654 1.000 2
length{all}[22] 0.152004 0.074276 0.000001 0.650814 0.057066 1.000 2
length{all}[23] 0.160039 0.093882 0.000000 0.646842 0.058292 1.001 2
length{all}[24] 0.152274 0.076246 0.000000 0.636179 0.051815 1.000 2
length{all}[25] 0.149245 0.069377 0.000000 0.611037 0.054396 1.000 2
length{all}[26] 0.157037 0.091784 0.000000 0.636829 0.057106 1.000 2
length{all}[27] 0.159204 0.080766 0.000000 0.647701 0.057424 1.000 2
length{all}[28] 0.152482 0.068435 0.000000 0.641991 0.054287 1.000 2
length{all}[29] 0.160293 0.087215 0.000000 0.628756 0.057293 1.000 2
length{all}[30] 0.155090 0.075276 0.000001 0.661081 0.052639 1.000 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = -nan
Maximum standard deviation of split frequencies = 0.000000
Average PSRF for parameter values (excluding NA and >10.0) = 1.000
Maximum PSRF for parameter values = 1.001
Clade credibility values:
/--------------------------------------------------------------------- C65 (1)
|
|--------------------------------------------------------------------- C10 (2)
|
|--------------------------------------------------------------------- C67 (3)
|
|--------------------------------------------------------------------- C9 (4)
|
|--------------------------------------------------------------------- C73 (5)
|
|--------------------------------------------------------------------- C72 (6)
|
|--------------------------------------------------------------------- C74 (7)
|
|--------------------------------------------------------------------- C16 (8)
|
|--------------------------------------------------------------------- C80 (9)
|
|--------------------------------------------------------------------- C81 (10)
|
|--------------------------------------------------------------------- C58 (11)
|
|--------------------------------------------------------------------- C87 (12)
|
|--------------------------------------------------------------------- C60 (13)
|
|--------------------------------------------------------------------- C107 (14)
|
|--------------------------------------------------------------------- C115 (15)
+
|--------------------------------------------------------------------- C114 (16)
|
|--------------------------------------------------------------------- C61 (17)
|
|--------------------------------------------------------------------- C8 (18)
|
|--------------------------------------------------------------------- C117 (19)
|
|--------------------------------------------------------------------- C122 (20)
|
|--------------------------------------------------------------------- C124 (21)
|
|--------------------------------------------------------------------- C125 (22)
|
|--------------------------------------------------------------------- C130 (23)
|
|--------------------------------------------------------------------- C20 (24)
|
|--------------------------------------------------------------------- C132 (25)
|
|--------------------------------------------------------------------- C133 (26)
|
|--------------------------------------------------------------------- C25 (27)
|
|--------------------------------------------------------------------- C7 (28)
|
|--------------------------------------------------------------------- C83 (29)
|
\--------------------------------------------------------------------- C140 (30)
Phylogram (based on average branch lengths):
/------------------------------------------------------------ C65 (1)
|
|--------------------------------------------------------------- C10 (2)
|
|-------------------------------------------------------------- C67 (3)
|
|----------------------------------------------------------- C9 (4)
|
|------------------------------------------------------------------ C73 (5)
|
|------------------------------------------------------------------- C72 (6)
|
|----------------------------------------------------------------------- C74 (7)
|
|------------------------------------------------------------------ C16 (8)
|
|----------------------------------------------------------------- C80 (9)
|
|------------------------------------------------------------- C81 (10)
|
|------------------------------------------------------------- C58 (11)
|
|--------------------------------------------------------------- C87 (12)
|
|---------------------------------------------------------------- C60 (13)
|
|----------------------------------------------------------------- C107 (14)
|
|----------------------------------------------------------------- C115 (15)
+
|----------------------------------------------------------------- C114 (16)
|
|----------------------------------------------------------------- C61 (17)
|
|------------------------------------------------------------ C8 (18)
|
|------------------------------------------------------------- C117 (19)
|
|--------------------------------------------------------------- C122 (20)
|
|----------------------------------------------------------------- C124 (21)
|
|------------------------------------------------------------------- C125 (22)
|
|-------------------------------------------------------------------- C130 (23)
|
|------------------------------------------------------------ C20 (24)
|
|--------------------------------------------------------------- C132 (25)
|
|------------------------------------------------------------------- C133 (26)
|
|------------------------------------------------------------------- C25 (27)
|
|--------------------------------------------------------------- C7 (28)
|
|------------------------------------------------------------------- C83 (29)
|
\------------------------------------------------------------- C140 (30)
|----------| 0.010 expected changes per site
Calculating tree probabilities...
Credible sets of trees (3002 trees sampled):
50 % credible set contains 1501 trees
90 % credible set contains 2702 trees
95 % credible set contains 2852 trees
99 % credible set contains 2972 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
-- Starting log on Thu Dec 22 09:28:30 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result--
-- Starting log on Thu Dec 22 19:24:41 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/codeml,Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1--
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 1 2 7 8
processing fasta file
reading seq# 1 C107 42 sites
reading seq# 2 C114 42 sites
reading seq# 3 C115 42 sites
reading seq# 4 C58 42 sites
reading seq# 5 C8 42 sites
reading seq# 6 C61 42 sites
reading seq# 7 C117 42 sites
reading seq# 8 C60 42 sites
reading seq# 9 C7 42 sites
reading seq#10 C122 42 sites
reading seq#11 C10 42 sites
reading seq#12 C65 42 sites
reading seq#13 C67 42 sites
reading seq#14 C124 42 sites
reading seq#15 C125 42 sites
reading seq#16 C73 42 sites
reading seq#17 C9 42 sites
reading seq#18 C72 42 sites
reading seq#19 C20 42 sites
reading seq#20 C130 42 sites
reading seq#21 C16 42 sites
reading seq#22 C74 42 sites
reading seq#23 C133 42 sites
reading seq#24 C25 42 sites
reading seq#25 C132 42 sites
reading seq#26 C81 42 sites
reading seq#27 C80 42 sites
reading seq#28 C140 42 sites
reading seq#29 C83 42 sites
reading seq#30 C87 42 sitesns = 30 ls = 42
Reading sequences, sequential format..
Reading seq # 1: C107
Reading seq # 2: C114
Reading seq # 3: C115
Reading seq # 4: C58
Reading seq # 5: C8
Reading seq # 6: C61
Reading seq # 7: C117
Reading seq # 8: C60
Reading seq # 9: C7
Reading seq #10: C122
Reading seq #11: C10
Reading seq #12: C65
Reading seq #13: C67
Reading seq #14: C124
Reading seq #15: C125
Reading seq #16: C73
Reading seq #17: C9
Reading seq #18: C72
Reading seq #19: C20
Reading seq #20: C130
Reading seq #21: C16
Reading seq #22: C74
Reading seq #23: C133
Reading seq #24: C25
Reading seq #25: C132
Reading seq #26: C81
Reading seq #27: C80
Reading seq #28: C140
Reading seq #29: C83
Reading seq #30: C87
Sequences read..
Counting site patterns.. 0:00
Compressing, 13 patterns at 14 / 14 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 13 patterns at 14 / 14 sites (100.0%), 0:00
Counting codons..
3480 bytes for distance
12688 bytes for conP
1144 bytes for fhK
5000000 bytes for space
Model 1: NearlyNeutral
TREE # 1
(12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
0.041064 0.085107 0.066853 0.019240 0.081230 0.075195 0.030794 0.052702 0.026193 0.024556 0.065421 0.064502 0.019550 0.101919 0.034667 0.065901 0.036936 0.043024 0.034993 0.049490 0.064217 0.103452 0.029382 0.020678 0.044724 0.040256 0.062111 0.060331 0.087720 0.020845 0.300000 0.595837 0.322502
ntime & nrate & np: 30 2 33
Bounds (np=33):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 10.746972
np = 33
lnL0 = -72.109326
Iterating by ming2
Initial: fx= 72.109326
x= 0.04106 0.08511 0.06685 0.01924 0.08123 0.07519 0.03079 0.05270 0.02619 0.02456 0.06542 0.06450 0.01955 0.10192 0.03467 0.06590 0.03694 0.04302 0.03499 0.04949 0.06422 0.10345 0.02938 0.02068 0.04472 0.04026 0.06211 0.06033 0.08772 0.02084 0.30000 0.59584 0.32250
1 h-m-p 0.0000 0.0017 61.0802 ++++ 65.470370 m 0.0017 40 | 1/33
2 h-m-p 0.0000 0.0000 456.5712 ++ 65.359469 m 0.0000 76 | 2/33
3 h-m-p 0.0000 0.0001 72.0484 ++ 64.994614 m 0.0001 112 | 3/33
4 h-m-p 0.0000 0.0000 589.1190 ++ 64.942003 m 0.0000 148 | 4/33
5 h-m-p 0.0000 0.0001 307.2820 ++ 63.806684 m 0.0001 184 | 5/33
6 h-m-p 0.0000 0.0001 136.4933 ++ 63.317057 m 0.0001 220 | 6/33
7 h-m-p 0.0000 0.0000 725.1316 ++ 62.402383 m 0.0000 256 | 7/33
8 h-m-p 0.0000 0.0001 145.6530 ++ 62.007901 m 0.0001 292 | 8/33
9 h-m-p 0.0000 0.0000 521.8820 ++ 60.971355 m 0.0000 328 | 9/33
10 h-m-p 0.0000 0.0000 117.7931 ++ 60.886452 m 0.0000 364 | 10/33
11 h-m-p 0.0000 0.0000 241.8249 ++ 60.410086 m 0.0000 400 | 11/33
12 h-m-p 0.0000 0.0000 561.1085 ++ 59.627880 m 0.0000 436 | 12/33
13 h-m-p 0.0000 0.0000 268050.4531 ++ 59.445823 m 0.0000 472 | 13/33
14 h-m-p 0.0000 0.0000 2743.2798 ++ 59.025765 m 0.0000 508 | 14/33
15 h-m-p 0.0000 0.0000 1437.5624 ++ 58.681847 m 0.0000 544 | 15/33
16 h-m-p 0.0000 0.0000 1636.5158 ++ 57.763802 m 0.0000 580 | 16/33
17 h-m-p 0.0000 0.0000 2273.6891 ++ 57.173102 m 0.0000 616 | 17/33
18 h-m-p 0.0000 0.0001 415.3223 ++ 55.824559 m 0.0001 652 | 18/33
19 h-m-p 0.0000 0.0001 146.8153 ++ 55.520136 m 0.0001 688 | 19/33
20 h-m-p 0.0000 0.0000 741.0695 ++ 55.183048 m 0.0000 724 | 20/33
21 h-m-p 0.0000 0.0000 3960.3383 ++ 55.141339 m 0.0000 760 | 21/33
22 h-m-p 0.0000 0.0000 169562.8381 ++ 55.021300 m 0.0000 796 | 22/33
23 h-m-p 0.0000 0.0000 618.8999 ++ 54.965853 m 0.0000 832 | 23/33
24 h-m-p 0.0000 0.0000 6099.2306 ++ 54.869836 m 0.0000 868 | 24/33
25 h-m-p 0.0000 0.0001 475.1046 ++ 54.144286 m 0.0001 904 | 25/33
26 h-m-p 0.0000 0.0001 358.0722 ++ 53.694741 m 0.0001 940 | 26/33
27 h-m-p 0.0000 0.0000 973.0327 ++ 53.519539 m 0.0000 976 | 27/33
28 h-m-p 0.0049 0.1089 2.1721 ------------.. | 27/33
29 h-m-p 0.0000 0.0001 27.0192 ++ 53.458471 m 0.0001 1058 | 28/33
30 h-m-p 0.0008 0.1492 2.5829 -----------.. | 28/33
31 h-m-p 0.0000 0.0002 23.4764 +++ 53.340667 m 0.0002 1140 | 29/33
32 h-m-p 0.0017 0.1659 2.3268 ------------.. | 29/33
33 h-m-p 0.0000 0.0012 19.3053 ++++ 52.901449 m 0.0012 1224 | 30/33
34 h-m-p 0.0099 0.2442 1.6010 -------------.. | 30/33
35 h-m-p 0.0000 0.0001 14.1658 ++ 52.877120 m 0.0001 1307 | 31/33
36 h-m-p 1.6000 8.0000 0.0000 ++ 52.877120 m 8.0000 1343 | 31/33
37 h-m-p 0.0160 8.0000 0.0006 ------------Y 52.877120 0 0.0000 1393
Out..
lnL = -52.877120
1394 lfun, 4182 eigenQcodon, 83640 P(t)
end of tree file.
Time used: 0:21
Model 2: PositiveSelection
TREE # 1
(12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
0.105282 0.032544 0.092562 0.102186 0.019792 0.041284 0.067584 0.087054 0.059218 0.022843 0.055405 0.074062 0.032374 0.065086 0.033005 0.066926 0.051356 0.014640 0.055740 0.037360 0.043322 0.016436 0.068683 0.012034 0.068825 0.069568 0.036237 0.078182 0.038870 0.097885 0.196475 1.396886 0.269011 0.451567 1.556827
ntime & nrate & np: 30 3 35
Bounds (np=35):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 9.594998
np = 35
lnL0 = -73.202696
Iterating by ming2
Initial: fx= 73.202696
x= 0.10528 0.03254 0.09256 0.10219 0.01979 0.04128 0.06758 0.08705 0.05922 0.02284 0.05540 0.07406 0.03237 0.06509 0.03301 0.06693 0.05136 0.01464 0.05574 0.03736 0.04332 0.01644 0.06868 0.01203 0.06882 0.06957 0.03624 0.07818 0.03887 0.09789 0.19647 1.39689 0.26901 0.45157 1.55683
1 h-m-p 0.0000 0.0011 61.4661 ++++ 69.091050 m 0.0011 42 | 1/35
2 h-m-p 0.0000 0.0000 725.6692 ++ 68.183418 m 0.0000 80 | 2/35
3 h-m-p 0.0001 0.0004 24.5609 ++ 67.623720 m 0.0004 118 | 3/35
4 h-m-p 0.0000 0.0000 963.6412 ++ 66.582138 m 0.0000 156 | 4/35
5 h-m-p 0.0000 0.0000 8821.0192 ++ 65.662557 m 0.0000 194 | 5/35
6 h-m-p 0.0000 0.0002 259.6300 ++ 62.813140 m 0.0002 232 | 6/35
7 h-m-p 0.0000 0.0000 50.7997 ++ 62.760345 m 0.0000 270 | 7/35
8 h-m-p 0.0000 0.0000 836.4499 ++ 62.624009 m 0.0000 308 | 8/35
9 h-m-p 0.0000 0.0000 542350.2803 ++ 61.709649 m 0.0000 346 | 9/35
10 h-m-p 0.0000 0.0000 2102.9884 ++ 61.403912 m 0.0000 384 | 10/35
11 h-m-p 0.0000 0.0000 14640.1628 ++ 61.010959 m 0.0000 422 | 11/35
12 h-m-p 0.0000 0.0000 13100.8170 ++ 60.414356 m 0.0000 460 | 12/35
13 h-m-p 0.0000 0.0000 1907.5414 ++ 59.933398 m 0.0000 498 | 13/35
14 h-m-p 0.0000 0.0000 409079.7598 ++ 58.145219 m 0.0000 536 | 14/35
15 h-m-p 0.0001 0.0004 94.3774 ++ 57.259285 m 0.0004 574 | 15/35
16 h-m-p 0.0000 0.0000 1040.9530 ++ 57.189125 m 0.0000 612 | 16/35
17 h-m-p 0.0000 0.0000 59941.6454 ++ 56.514806 m 0.0000 650 | 17/35
18 h-m-p 0.0000 0.0000 4922.1867 ++ 55.472479 m 0.0000 688 | 18/35
19 h-m-p 0.0000 0.0001 192.6434 ++ 55.161369 m 0.0001 726 | 19/35
20 h-m-p 0.0000 0.0000 38194.0851 ++ 55.059534 m 0.0000 764 | 20/35
21 h-m-p 0.0000 0.0000 11894.6752 ++ 54.905848 m 0.0000 802 | 21/35
22 h-m-p 0.0000 0.0000 7916.1754 ++ 54.888028 m 0.0000 840 | 22/35
23 h-m-p 0.0000 0.0000 2627.7148 ++ 54.805574 m 0.0000 878 | 23/35
24 h-m-p 0.0000 0.0000 1964.7699 ++ 54.379676 m 0.0000 916 | 24/35
25 h-m-p 0.0000 0.0000 10205.9336 ++ 54.049710 m 0.0000 954 | 25/35
26 h-m-p 0.0000 0.0000 55858.2676 ++ 53.477341 m 0.0000 992 | 26/35
27 h-m-p 0.0000 0.0000 911.9123 ++ 53.264328 m 0.0000 1030 | 27/35
28 h-m-p 0.0160 8.0000 3.0949 -------------.. | 27/35
29 h-m-p 0.0000 0.0001 27.1234 ++ 53.204445 m 0.0001 1117 | 28/35
30 h-m-p 0.0017 0.0086 0.8968 ------------.. | 28/35
31 h-m-p 0.0000 0.0003 23.6110 +++ 53.017217 m 0.0003 1211 | 29/35
32 h-m-p 0.0021 0.0105 0.7626 ------------.. | 29/35
33 h-m-p 0.0000 0.0003 19.6531 +++ 52.914459 m 0.0003 1304 | 30/35
34 h-m-p 0.0029 0.0146 0.5961 ------------.. | 30/35
35 h-m-p 0.0000 0.0002 14.0491 +++ 52.877110 m 0.0002 1396 | 31/35
36 h-m-p 0.1338 8.0000 0.0000 +++ 52.877110 m 8.0000 1435 | 31/35
37 h-m-p 0.0448 8.0000 0.0005 ---C 52.877110 0 0.0002 1480 | 31/35
38 h-m-p 0.0160 8.0000 0.0001 +++++ 52.877110 m 8.0000 1525 | 31/35
39 h-m-p 0.0015 0.1182 0.5857 ------Y 52.877110 0 0.0000 1573 | 31/35
40 h-m-p 0.0160 8.0000 0.0062 +++++ 52.877110 m 8.0000 1618 | 31/35
41 h-m-p 0.1064 2.3166 0.4634 ---------Y 52.877110 0 0.0000 1669 | 31/35
42 h-m-p 0.0160 8.0000 0.0001 +++++ 52.877110 m 8.0000 1714 | 31/35
43 h-m-p 0.0160 8.0000 0.4017 ---------Y 52.877110 0 0.0000 1765 | 31/35
44 h-m-p 0.0160 8.0000 0.0003 -------------.. | 31/35
45 h-m-p 0.0160 8.0000 0.0001 +++++ 52.877110 m 8.0000 1863 | 31/35
46 h-m-p 0.0160 8.0000 0.5355 ----------C 52.877110 0 0.0000 1915 | 31/35
47 h-m-p 0.0160 8.0000 0.0006 -------C 52.877110 0 0.0000 1964 | 31/35
48 h-m-p 0.0160 8.0000 0.0001 +++++ 52.877110 m 8.0000 2009 | 31/35
49 h-m-p 0.0000 0.0167 21.4761 +++++ 52.877097 m 0.0167 2054 | 32/35
50 h-m-p 0.1486 8.0000 2.1411 +C 52.877085 0 0.5845 2093 | 32/35
51 h-m-p 1.0209 5.1043 0.3117 C 52.877083 0 0.9684 2131 | 32/35
52 h-m-p 1.6000 8.0000 0.0012 ------Y 52.877083 0 0.0001 2178 | 32/35
53 h-m-p 0.0160 8.0000 0.0062 +++++ 52.877083 m 8.0000 2222 | 32/35
54 h-m-p 0.4917 8.0000 0.1013 Y 52.877083 0 1.1691 2263 | 32/35
55 h-m-p 1.6000 8.0000 0.0011 ++ 52.877082 m 8.0000 2304 | 32/35
56 h-m-p 0.0160 8.0000 1.1894 ------------C 52.877082 0 0.0000 2357 | 32/35
57 h-m-p 0.0160 8.0000 1.6200 ++++YC 52.877033 1 2.5637 2400 | 32/35
58 h-m-p 1.6000 8.0000 0.2032 Y 52.877032 0 3.6762 2438 | 32/35
59 h-m-p 1.6000 8.0000 0.0669 Y 52.877032 0 0.7057 2479 | 32/35
60 h-m-p 1.6000 8.0000 0.0005 ++ 52.877032 m 8.0000 2520 | 32/35
61 h-m-p 0.2916 8.0000 0.0129 +Y 52.877032 0 2.5779 2562 | 32/35
62 h-m-p 1.6000 8.0000 0.0001 ++ 52.877032 m 8.0000 2603 | 32/35
63 h-m-p 0.0000 0.0017 2517.2951 +++CYC 52.877006 2 0.0008 2650 | 32/35
64 h-m-p 1.6000 8.0000 0.1373 --------------Y 52.877006 0 0.0000 2702 | 32/35
65 h-m-p 0.0000 0.0153 66.7231 +++++ 52.876922 m 0.0153 2746 | 33/35
66 h-m-p 0.0369 4.2100 27.1895 ++++ 52.876890 m 4.2100 2786 | 33/35
67 h-m-p 1.6000 8.0000 0.0000 Y 52.876890 0 1.6000 2824
Out..
lnL = -52.876890
2825 lfun, 11300 eigenQcodon, 254250 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -52.905172 S = -52.877460 -0.010660
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 13 patterns 1:23
did 13 / 13 patterns 1:23end of tree file.
Time used: 1:23
Model 7: beta
TREE # 1
(12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
0.107405 0.063384 0.014840 0.088588 0.077350 0.015098 0.099550 0.058055 0.046617 0.090387 0.036605 0.086295 0.037654 0.031904 0.103854 0.036678 0.065884 0.030721 0.017798 0.093100 0.028391 0.068754 0.023006 0.090048 0.048377 0.067341 0.017772 0.044925 0.055057 0.077910 0.000100 0.931885 1.560475
ntime & nrate & np: 30 1 33
Bounds (np=33):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 17.954912
np = 33
lnL0 = -71.936638
Iterating by ming2
Initial: fx= 71.936638
x= 0.10740 0.06338 0.01484 0.08859 0.07735 0.01510 0.09955 0.05806 0.04662 0.09039 0.03660 0.08630 0.03765 0.03190 0.10385 0.03668 0.06588 0.03072 0.01780 0.09310 0.02839 0.06875 0.02301 0.09005 0.04838 0.06734 0.01777 0.04493 0.05506 0.07791 0.00011 0.93188 1.56047
1 h-m-p 0.0000 0.0000 48.7778 ++ 71.934070 m 0.0000 38 | 1/33
2 h-m-p 0.0001 0.0269 16.7501 +++++ 66.306495 m 0.0269 77 | 2/33
3 h-m-p 0.0000 0.0002 16.1770 ++ 66.267336 m 0.0002 113 | 3/33
4 h-m-p 0.0000 0.0002 105.4915 ++ 66.018869 m 0.0002 149 | 4/33
5 h-m-p 0.0000 0.0000 371.5058 ++ 66.016831 m 0.0000 185 | 5/33
6 h-m-p 0.0000 0.0004 104.5886 +++ 65.537931 m 0.0004 222 | 6/33
7 h-m-p 0.0000 0.0000 36929.7543 ++ 65.006774 m 0.0000 258 | 7/33
8 h-m-p 0.0000 0.0001 288.5754 ++ 64.758916 m 0.0001 294 | 8/33
9 h-m-p 0.0000 0.0000 1899.0825 ++ 64.639210 m 0.0000 330 | 9/33
10 h-m-p 0.0000 0.0001 552.0048 ++ 64.129124 m 0.0001 366 | 10/33
11 h-m-p 0.0000 0.0000 988.2256 ++ 64.120491 m 0.0000 402 | 11/33
12 h-m-p 0.0000 0.0000 550.2145 ++ 64.020727 m 0.0000 438 | 12/33
13 h-m-p 0.0000 0.0001 816.2432 ++ 63.219587 m 0.0001 474 | 13/33
14 h-m-p 0.0000 0.0000 413.9412 ++ 63.005370 m 0.0000 510 | 14/33
15 h-m-p 0.0000 0.0000 602.2911 ++ 62.789973 m 0.0000 546 | 15/33
16 h-m-p 0.0000 0.0002 475.4323 ++ 61.922116 m 0.0002 582 | 16/33
17 h-m-p 0.0000 0.0001 430.1435 ++ 61.481359 m 0.0001 618 | 17/33
18 h-m-p 0.0000 0.0002 394.3968 ++ 60.622273 m 0.0002 654 | 18/33
19 h-m-p 0.0000 0.0001 398.5033 ++ 60.189345 m 0.0001 690 | 19/33
20 h-m-p 0.0000 0.0001 328.8285 ++ 59.937296 m 0.0001 726 | 20/33
21 h-m-p 0.0000 0.0000 386.9930 ++ 59.698585 m 0.0000 762 | 21/33
22 h-m-p 0.0001 0.0005 270.1824 ++ 58.126766 m 0.0005 798 | 22/33
23 h-m-p 0.0000 0.0001 133.9284 ++ 58.031987 m 0.0001 834 | 23/33
24 h-m-p 0.0000 0.0004 300.7632 +++ 56.092586 m 0.0004 871 | 24/33
25 h-m-p 0.0046 0.0232 5.9492 ++ 55.564994 m 0.0232 907 | 25/33
26 h-m-p 0.0008 0.0038 4.5768 ++ 55.141254 m 0.0038 943 | 26/33
27 h-m-p 0.0068 0.0884 2.3671 -------------.. | 26/33
28 h-m-p 0.0000 0.0008 28.6235 ++++ 54.482168 m 0.0008 1028 | 27/33
29 h-m-p 0.0160 8.0000 1.4020 -------------.. | 27/33
30 h-m-p 0.0000 0.0014 26.3312 ++++ 53.499460 m 0.0014 1113 | 28/33
31 h-m-p 0.0259 8.0000 1.2646 -------------.. | 28/33
32 h-m-p 0.0000 0.0007 24.0826 ++++ 53.110649 m 0.0007 1198 | 29/33
33 h-m-p 0.0160 8.0000 1.0949 -------------.. | 29/33
34 h-m-p 0.0000 0.0001 21.0710 ++ 53.077003 m 0.0001 1281 | 30/33
35 h-m-p 0.0160 8.0000 0.8887 -------------.. | 30/33
36 h-m-p 0.0000 0.0004 17.1544 +++ 52.964837 m 0.0004 1368 | 31/33
37 h-m-p 0.0160 8.0000 0.6288 -------------.. | 31/33
38 h-m-p 0.0000 0.0006 12.1492 +++ 52.876890 m 0.0006 1454 | 32/33
39 h-m-p 1.6000 8.0000 0.0000 N 52.876890 0 1.6000 1490 | 32/33
40 h-m-p 0.7491 8.0000 0.0000 Y 52.876890 0 0.7491 1527
Out..
lnL = -52.876890
1528 lfun, 16808 eigenQcodon, 458400 P(t)
end of tree file.
Time used: 3:14
Model 8: beta&w>1
TREE # 1
(12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
0.053703 0.025673 0.057816 0.084769 0.015500 0.092290 0.075157 0.035162 0.091925 0.098424 0.056107 0.079694 0.033317 0.022150 0.023570 0.054343 0.066339 0.064132 0.081431 0.081574 0.060007 0.045516 0.075076 0.074632 0.084993 0.099477 0.025637 0.031580 0.045864 0.092358 0.000100 0.900000 1.151539 1.825194 1.300000
ntime & nrate & np: 30 2 35
Bounds (np=35):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 14.997527
np = 35
lnL0 = -72.409791
Iterating by ming2
Initial: fx= 72.409791
x= 0.05370 0.02567 0.05782 0.08477 0.01550 0.09229 0.07516 0.03516 0.09193 0.09842 0.05611 0.07969 0.03332 0.02215 0.02357 0.05434 0.06634 0.06413 0.08143 0.08157 0.06001 0.04552 0.07508 0.07463 0.08499 0.09948 0.02564 0.03158 0.04586 0.09236 0.00011 0.90000 1.15154 1.82519 1.30000
1 h-m-p 0.0000 0.0000 47.3185 ++ 72.407169 m 0.0000 40 | 1/35
2 h-m-p 0.0000 0.0007 165.0554 ++++ 67.973110 m 0.0007 80 | 2/35
3 h-m-p 0.0009 0.0043 20.5144 ++ 65.888269 m 0.0043 118 | 3/35
4 h-m-p 0.0000 0.0001 113.5180 ++ 65.483532 m 0.0001 156 | 4/35
5 h-m-p 0.0002 0.0009 34.3961 ++ 64.844312 m 0.0009 194 | 5/35
6 h-m-p 0.0000 0.0000 25.8953 ++ 64.835064 m 0.0000 232 | 6/35
7 h-m-p 0.0000 0.0008 108.1305 ++++ 63.156344 m 0.0008 272 | 7/35
8 h-m-p 0.0000 0.0002 137.5236 ++ 62.707020 m 0.0002 310 | 8/35
9 h-m-p 0.0001 0.0003 90.5269 ++ 62.219850 m 0.0003 348 | 9/35
10 h-m-p 0.0003 0.0015 92.1881 ++ 59.737394 m 0.0015 386 | 10/35
11 h-m-p 0.0000 0.0002 41.6561 ++ 59.633716 m 0.0002 424 | 11/35
12 h-m-p 0.0001 0.0010 145.0043 ++ 57.858634 m 0.0010 462 | 12/35
13 h-m-p 0.0000 0.0002 95.8422 ++ 57.695511 m 0.0002 500 | 13/35
14 h-m-p 0.0000 0.0001 495.4254 ++ 57.318776 m 0.0001 538 | 14/35
15 h-m-p 0.0000 0.0000 951.2003 ++ 56.998114 m 0.0000 576 | 15/35
16 h-m-p 0.0000 0.0000 1157.9086 ++ 56.556545 m 0.0000 614 | 16/35
17 h-m-p 0.0000 0.0001 1451.6347 ++ 55.842543 m 0.0001 652 | 17/35
18 h-m-p 0.0000 0.0000 36603.6229 ++ 55.488640 m 0.0000 690 | 18/35
19 h-m-p 0.0000 0.0001 2927.2332 ++ 54.328788 m 0.0001 728 | 19/35
20 h-m-p 0.0000 0.0000 955.8975 ++ 54.238262 m 0.0000 766 | 20/35
21 h-m-p 0.0000 0.0000 1869.7877 ++ 54.224291 m 0.0000 804 | 21/35
22 h-m-p 0.0000 0.0001 963.0287 ++ 53.757937 m 0.0001 842 | 22/35
23 h-m-p 0.0000 0.0001 99.5439 ++ 53.693170 m 0.0001 880 | 23/35
24 h-m-p 0.0085 1.9983 0.2322 -------------.. | 23/35
25 h-m-p 0.0000 0.0001 36.0647 ++ 53.619865 m 0.0001 979 | 24/35
26 h-m-p 0.0006 0.0051 3.4516 ++ 53.583085 m 0.0051 1017 | 25/35
27 h-m-p 0.0004 0.0038 46.2169 ++ 53.458769 m 0.0038 1055 | 25/35
28 h-m-p 0.0000 0.0000 1.1125
h-m-p: 0.00000000e+00 0.00000000e+00 1.11252792e+00 53.458769
.. | 25/35
29 h-m-p 0.0000 0.0000 32.1660 ++ 53.434134 m 0.0000 1128 | 26/35
30 h-m-p 0.0000 0.0000 1053.2050 ++ 53.428364 m 0.0000 1166 | 27/35
31 h-m-p 0.0000 0.0018 7.9500 ++++ 53.032307 m 0.0018 1206 | 28/35
32 h-m-p 0.0160 8.0000 1.1753 -------------.. | 28/35
33 h-m-p 0.0000 0.0000 24.4682 ++ 53.025091 m 0.0000 1293 | 29/35
34 h-m-p 0.0000 0.0001 11.4019 ++ 53.015221 m 0.0001 1331 | 30/35
35 h-m-p 0.0003 0.0016 4.6523 ++ 52.883239 m 0.0016 1369 | 31/35
36 h-m-p 0.0000 0.0001 6.4231 ++ 52.876891 m 0.0001 1407 | 32/35
37 h-m-p 0.5125 2.5626 0.0001 ++ 52.876890 m 2.5626 1445 | 33/35
38 h-m-p 1.6000 8.0000 0.0000 C 52.876890 0 0.4000 1486 | 33/35
39 h-m-p 0.0160 8.0000 0.0002 ----C 52.876890 0 0.0000 1530
Out..
lnL = -52.876890
1531 lfun, 18372 eigenQcodon, 505230 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -52.913565 S = -52.877460 -0.015960
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 13 patterns 5:19
did 13 / 13 patterns 5:19end of tree file.
Time used: 5:19
The loglikelihoods for models M1, M2, M7 and M8 are -52.877120 -52.876890 -52.876890 -52.876890 respectively
CLUSTAL W (1.8) multiple sequence alignment (ALTER 1.3.3)
Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS SKDSNFLNESGVLL
Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS SKDSNFLNESGVLL
Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS SKDSNFLNESGVLL
Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS SKDSNFLNESGVLL
Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS SKDSNFLNESGVLL
Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS SKDSNFLNESGVLL
Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS SKDSNFLNESGVLL
camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL
Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS SKDSNFLNESGVLL
Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS SKDSNFLNESGVLL
Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS SKDSNFLNESGVLL
camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL
camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL
Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS SKDSNFLNESGVLL
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS SKDSNFLNESGVLL
Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS SKDSNFLNESGVLL
Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS SKDSNFLNESGVLL
camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL
Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS SKDSNFLNESGVLL
Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS SKDSNFLNESGVLL
camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL
Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS SKDSNFLNESGVLL
camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL
KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS SKDSNFLNESGVLL
KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS SKDSNFLNESGVLL
camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS SKDSNFLNESGVLL
KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS SKDSNFLNESGVLL
KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS SKDSNFLNESGVLL
**************
>Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG
>Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS SKDSNFLNESGVLL >Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS SKDSNFLNESGVLL >Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS SKDSNFLNESGVLL >Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS SKDSNFLNESGVLL >Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS SKDSNFLNESGVLL >Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS SKDSNFLNESGVLL >Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS SKDSNFLNESGVLL >Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS SKDSNFLNESGVLL >KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS SKDSNFLNESGVLL >KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS SKDSNFLNESGVLL >KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS SKDSNFLNESGVLL
Reading sequence file /data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/codeml/fasta/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1 Found 30 sequences of length 42 Alignment looks like a valid DNA alignment. Estimated diversity is (pairwise deletion - ignoring missing/ambig): 0.0% Found 0 informative sites. Writing alignment of informative sites to: Phi.inf.sites Writing list of informative sites to: Phi.inf.list Calculating all pairwise incompatibilities... 100.0% Using a window size of 80 with k as 1 Too few informative sites to use normal approximation. Try doing a permutation test or increasing alignment length Can also try decreasing windowsize.
#NEXUS
[ID: 5749836261]
begin taxa;
dimensions ntax=30;
taxlabels
Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS
Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS
Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS
Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS
Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS
Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS
Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS
KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS
KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS
Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS
KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS
Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS
Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS
Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS
Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS
Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS
Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS
camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS
Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS
camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS
Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS
KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS
camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS
;
end;
begin trees;
translate
1 Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS,
2 Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS,
3 Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS,
4 Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS,
5 Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS,
6 Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS,
7 Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS,
8 Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS,
9 KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS,
10 KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS,
11 Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS,
12 KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS,
13 Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS,
14 Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS,
15 Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS,
16 Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS,
17 Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS,
18 Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS,
19 Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS,
20 camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS,
21 camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS,
22 camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS,
23 camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS,
24 Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS,
25 camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS,
26 camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS,
27 Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS,
28 Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS,
29 KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS,
30 camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:5.153989e-02,2:5.386794e-02,3:5.294203e-02,4:5.087192e-02,5:5.648497e-02,6:5.704840e-02,7:6.085931e-02,8:5.661436e-02,9:5.567863e-02,10:5.229475e-02,11:5.197404e-02,12:5.396240e-02,13:5.496182e-02,14:5.613308e-02,15:5.551973e-02,16:5.537264e-02,17:5.602719e-02,18:5.171073e-02,19:5.217302e-02,20:5.388035e-02,21:5.565383e-02,22:5.706562e-02,23:5.829160e-02,24:5.181455e-02,25:5.439618e-02,26:5.710637e-02,27:5.742367e-02,28:5.428662e-02,29:5.729293e-02,30:5.263926e-02);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:5.153989e-02,2:5.386794e-02,3:5.294203e-02,4:5.087192e-02,5:5.648497e-02,6:5.704840e-02,7:6.085931e-02,8:5.661436e-02,9:5.567863e-02,10:5.229475e-02,11:5.197404e-02,12:5.396240e-02,13:5.496182e-02,14:5.613308e-02,15:5.551973e-02,16:5.537264e-02,17:5.602719e-02,18:5.171073e-02,19:5.217302e-02,20:5.388035e-02,21:5.565383e-02,22:5.706562e-02,23:5.829160e-02,24:5.181455e-02,25:5.439618e-02,26:5.710637e-02,27:5.742367e-02,28:5.428662e-02,29:5.729293e-02,30:5.263926e-02);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -57.64 -60.60
2 -57.64 -60.10
--------------------------------------
TOTAL -57.64 -60.38
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.807984 90.333854 0.000164 28.764700 5.735977 967.45 1028.50 1.000
r(A<->C){all} 0.165654 0.021068 0.000064 0.455182 0.123415 125.04 149.37 1.000
r(A<->G){all} 0.170900 0.018980 0.000083 0.433835 0.136099 124.89 132.60 1.000
r(A<->T){all} 0.151770 0.015273 0.000071 0.388614 0.125407 63.31 106.76 1.000
r(C<->G){all} 0.165822 0.018151 0.000039 0.444862 0.132736 116.46 122.07 1.006
r(C<->T){all} 0.167028 0.017793 0.000033 0.426189 0.139534 82.30 94.54 1.010
r(G<->T){all} 0.178825 0.022848 0.000025 0.478007 0.137987 126.63 141.55 1.000
pi(A){all} 0.259969 0.003852 0.143177 0.381620 0.257616 626.84 639.65 1.000
pi(C){all} 0.173732 0.002799 0.072980 0.272028 0.170368 413.96 587.62 1.000
pi(G){all} 0.195107 0.003215 0.092837 0.311387 0.190615 547.99 604.85 1.000
pi(T){all} 0.371192 0.004718 0.234261 0.500150 0.371798 617.62 637.33 1.000
alpha{1,2} 0.907621 1.022300 0.000028 2.861831 0.567431 772.01 782.94 1.002
alpha{3} 0.952881 0.921427 0.000589 2.884986 0.670476 562.48 798.47 1.001
pinvar{all} 0.938101 0.019642 0.757651 0.999936 0.977153 118.08 122.32 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
CODONML (in paml version 4.9h, March 2018) /data/fasta_checked/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 30 ls = 14
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 2 2 2 2 2 2 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 1 1 1 1 1 1 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 1 1 1 1 1 1 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 1 1 1 1 1 1 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 1 1 1 1 1 1 | Ala GCT 0 0 0 0 0 0 | Asp GAT 1 1 1 1 1 1 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 0 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 0 0 0 0 0 0 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 0 | GAG 1 1 1 1 1 1 | GGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 2 2 2 2 2 2 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 1 1 1 1 1 1 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 1 1 1 1 1 1 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 1 1 1 1 1 1 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 1 1 1 1 1 1 | Ala GCT 0 0 0 0 0 0 | Asp GAT 1 1 1 1 1 1 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 0 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 0 0 0 0 0 0 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 0 | GAG 1 1 1 1 1 1 | GGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 2 2 2 2 2 2 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 1 1 1 1 1 1 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 1 1 1 1 1 1 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 1 1 1 1 1 1 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 1 1 1 1 1 1 | Ala GCT 0 0 0 0 0 0 | Asp GAT 1 1 1 1 1 1 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 0 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 0 0 0 0 0 0 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 0 | GAG 1 1 1 1 1 1 | GGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 2 2 2 2 2 2 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 1 1 1 1 1 1 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 1 1 1 1 1 1 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 1 1 1 1 1 1 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 1 1 1 1 1 1 | Ala GCT 0 0 0 0 0 0 | Asp GAT 1 1 1 1 1 1 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 0 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 0 0 0 0 0 0 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 0 | GAG 1 1 1 1 1 1 | GGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 2 2 2 2 2 2 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 1 1 1 1 1 1 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 1 1 1 1 1 1 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 1 1 1 1 1 1 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 1 1 1 1 1 1 | Ala GCT 0 0 0 0 0 0 | Asp GAT 1 1 1 1 1 1 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 0 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 0 0 0 0 0 0 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 0 | GAG 1 1 1 1 1 1 | GGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: C107
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#2: C114
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#3: C115
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#4: C58
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#5: C8
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#6: C61
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#7: C117
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#8: C60
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#9: C7
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#10: C122
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#11: C10
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#12: C65
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#13: C67
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#14: C124
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#15: C125
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#16: C73
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#17: C9
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#18: C72
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#19: C20
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#20: C130
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#21: C16
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#22: C74
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#23: C133
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#24: C25
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#25: C132
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#26: C81
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#27: C80
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#28: C140
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#29: C83
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
#30: C87
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 30 | Ser S TCT 30 | Tyr Y TAT 0 | Cys C TGT 0
TTC 0 | TCC 60 | TAC 0 | TGC 0
Leu L TTA 30 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 30 | TCG 0 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 0 | Pro P CCT 0 | His H CAT 0 | Arg R CGT 0
CTC 0 | CCC 0 | CAC 0 | CGC 0
CTA 30 | CCA 0 | Gln Q CAA 0 | CGA 0
CTG 0 | CCG 0 | CAG 0 | CGG 0
------------------------------------------------------------------------------
Ile I ATT 0 | Thr T ACT 0 | Asn N AAT 30 | Ser S AGT 0
ATC 0 | ACC 0 | AAC 30 | AGC 0
ATA 0 | ACA 0 | Lys K AAA 30 | Arg R AGA 0
Met M ATG 0 | ACG 0 | AAG 0 | AGG 0
------------------------------------------------------------------------------
Val V GTT 30 | Ala A GCT 0 | Asp D GAT 30 | Gly G GGT 0
GTC 0 | GCC 0 | GAC 0 | GGC 0
GTA 0 | GCA 0 | Glu E GAA 0 | GGA 0
GTG 0 | GCG 0 | GAG 30 | GGG 30
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.42857 C:0.07143 A:0.21429 G:0.28571
position 2: T:0.35714 C:0.21429 A:0.35714 G:0.07143
position 3: T:0.35714 C:0.21429 A:0.21429 G:0.21429
Average T:0.38095 C:0.16667 A:0.26190 G:0.19048
Model 1: NearlyNeutral (2 categories)
TREE # 1: (12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
lnL(ntime: 30 np: 33): -52.877120 +0.000000
31..12 31..11 31..13 31..17 31..16 31..18 31..22 31..21 31..27 31..26 31..4 31..30 31..8 31..1 31..3 31..2 31..6 31..5 31..7 31..10 31..14 31..15 31..20 31..19 31..25 31..23 31..24 31..9 31..29 31..28
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.196475 0.635480 0.000001
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000120
(12: 0.000004, 11: 0.000004, 13: 0.000004, 17: 0.000004, 16: 0.000004, 18: 0.000004, 22: 0.000004, 21: 0.000004, 27: 0.000004, 26: 0.000004, 4: 0.000004, 30: 0.000004, 8: 0.000004, 1: 0.000004, 3: 0.000004, 2: 0.000004, 6: 0.000004, 5: 0.000004, 7: 0.000004, 10: 0.000004, 14: 0.000004, 15: 0.000004, 20: 0.000004, 19: 0.000004, 25: 0.000004, 23: 0.000004, 24: 0.000004, 9: 0.000004, 29: 0.000004, 28: 0.000004);
(C65: 0.000004, C10: 0.000004, C67: 0.000004, C9: 0.000004, C73: 0.000004, C72: 0.000004, C74: 0.000004, C16: 0.000004, C80: 0.000004, C81: 0.000004, C58: 0.000004, C87: 0.000004, C60: 0.000004, C107: 0.000004, C115: 0.000004, C114: 0.000004, C61: 0.000004, C8: 0.000004, C117: 0.000004, C122: 0.000004, C124: 0.000004, C125: 0.000004, C130: 0.000004, C20: 0.000004, C132: 0.000004, C133: 0.000004, C25: 0.000004, C7: 0.000004, C83: 0.000004, C140: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.19647
MLEs of dN/dS (w) for site classes (K=2)
p: 0.63548 0.36452
w: 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
31..12 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..11 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..13 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..17 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..16 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..18 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..22 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..21 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..27 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..26 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..4 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..30 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..8 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..1 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..3 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..2 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..6 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..5 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..7 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..10 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..14 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..15 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..20 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..19 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..25 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..23 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..24 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..9 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..29 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
31..28 0.000 35.3 6.7 0.3645 0.0000 0.0000 0.0 0.0
Time used: 0:21
Model 2: PositiveSelection (3 categories)
TREE # 1: (12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
lnL(ntime: 30 np: 35): -52.876890 +0.000000
31..12 31..11 31..13 31..17 31..16 31..18 31..22 31..21 31..27 31..26 31..4 31..30 31..8 31..1 31..3 31..2 31..6 31..5 31..7 31..10 31..14 31..15 31..20 31..19 31..25 31..23 31..24 31..9 31..29 31..28
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 1.000000 0.000000 0.000001 1.000000
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000120
(12: 0.000004, 11: 0.000004, 13: 0.000004, 17: 0.000004, 16: 0.000004, 18: 0.000004, 22: 0.000004, 21: 0.000004, 27: 0.000004, 26: 0.000004, 4: 0.000004, 30: 0.000004, 8: 0.000004, 1: 0.000004, 3: 0.000004, 2: 0.000004, 6: 0.000004, 5: 0.000004, 7: 0.000004, 10: 0.000004, 14: 0.000004, 15: 0.000004, 20: 0.000004, 19: 0.000004, 25: 0.000004, 23: 0.000004, 24: 0.000004, 9: 0.000004, 29: 0.000004, 28: 0.000004);
(C65: 0.000004, C10: 0.000004, C67: 0.000004, C9: 0.000004, C73: 0.000004, C72: 0.000004, C74: 0.000004, C16: 0.000004, C80: 0.000004, C81: 0.000004, C58: 0.000004, C87: 0.000004, C60: 0.000004, C107: 0.000004, C115: 0.000004, C114: 0.000004, C61: 0.000004, C8: 0.000004, C117: 0.000004, C122: 0.000004, C124: 0.000004, C125: 0.000004, C130: 0.000004, C20: 0.000004, C132: 0.000004, C133: 0.000004, C25: 0.000004, C7: 0.000004, C83: 0.000004, C140: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
MLEs of dN/dS (w) for site classes (K=3)
p: 1.00000 0.00000 0.00000
w: 0.00000 1.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
31..12 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..11 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..13 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..17 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..16 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..18 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..22 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..21 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..27 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..26 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..4 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..30 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..8 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..1 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..3 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..2 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..6 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..5 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..7 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..10 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..14 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..15 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..20 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..19 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..25 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..23 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..24 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..9 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..29 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..28 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C107)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
w2: 0.102 0.101 0.101 0.101 0.100 0.100 0.099 0.099 0.099 0.098
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.010
0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
sum of density on p0-p1 = 1.000000
Time used: 1:23
Model 7: beta (10 categories)
TREE # 1: (12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
lnL(ntime: 30 np: 33): -52.876890 +0.000000
31..12 31..11 31..13 31..17 31..16 31..18 31..22 31..21 31..27 31..26 31..4 31..30 31..8 31..1 31..3 31..2 31..6 31..5 31..7 31..10 31..14 31..15 31..20 31..19 31..25 31..23 31..24 31..9 31..29 31..28
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.933478
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000120
(12: 0.000004, 11: 0.000004, 13: 0.000004, 17: 0.000004, 16: 0.000004, 18: 0.000004, 22: 0.000004, 21: 0.000004, 27: 0.000004, 26: 0.000004, 4: 0.000004, 30: 0.000004, 8: 0.000004, 1: 0.000004, 3: 0.000004, 2: 0.000004, 6: 0.000004, 5: 0.000004, 7: 0.000004, 10: 0.000004, 14: 0.000004, 15: 0.000004, 20: 0.000004, 19: 0.000004, 25: 0.000004, 23: 0.000004, 24: 0.000004, 9: 0.000004, 29: 0.000004, 28: 0.000004);
(C65: 0.000004, C10: 0.000004, C67: 0.000004, C9: 0.000004, C73: 0.000004, C72: 0.000004, C74: 0.000004, C16: 0.000004, C80: 0.000004, C81: 0.000004, C58: 0.000004, C87: 0.000004, C60: 0.000004, C107: 0.000004, C115: 0.000004, C114: 0.000004, C61: 0.000004, C8: 0.000004, C117: 0.000004, C122: 0.000004, C124: 0.000004, C125: 0.000004, C130: 0.000004, C20: 0.000004, C132: 0.000004, C133: 0.000004, C25: 0.000004, C7: 0.000004, C83: 0.000004, C140: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M7 (beta):
p = 0.00500 q = 0.93348
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00004
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
31..12 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..11 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..13 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..17 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..16 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..18 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..22 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..21 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..27 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..26 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..4 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..30 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..8 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..1 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..3 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..2 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..6 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..5 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..7 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..10 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..14 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..15 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..20 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..19 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..25 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..23 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..24 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..9 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..29 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..28 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
Time used: 3:14
Model 8: beta&w>1 (11 categories)
TREE # 1: (12, 11, 13, 17, 16, 18, 22, 21, 27, 26, 4, 30, 8, 1, 3, 2, 6, 5, 7, 10, 14, 15, 20, 19, 25, 23, 24, 9, 29, 28); MP score: 0
lnL(ntime: 30 np: 35): -52.876890 +0.000000
31..12 31..11 31..13 31..17 31..16 31..18 31..22 31..21 31..27 31..26 31..4 31..30 31..8 31..1 31..3 31..2 31..6 31..5 31..7 31..10 31..14 31..15 31..20 31..19 31..25 31..23 31..24 31..9 31..29 31..28
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.999990 0.005000 1.876698 1.536901
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000120
(12: 0.000004, 11: 0.000004, 13: 0.000004, 17: 0.000004, 16: 0.000004, 18: 0.000004, 22: 0.000004, 21: 0.000004, 27: 0.000004, 26: 0.000004, 4: 0.000004, 30: 0.000004, 8: 0.000004, 1: 0.000004, 3: 0.000004, 2: 0.000004, 6: 0.000004, 5: 0.000004, 7: 0.000004, 10: 0.000004, 14: 0.000004, 15: 0.000004, 20: 0.000004, 19: 0.000004, 25: 0.000004, 23: 0.000004, 24: 0.000004, 9: 0.000004, 29: 0.000004, 28: 0.000004);
(C65: 0.000004, C10: 0.000004, C67: 0.000004, C9: 0.000004, C73: 0.000004, C72: 0.000004, C74: 0.000004, C16: 0.000004, C80: 0.000004, C81: 0.000004, C58: 0.000004, C87: 0.000004, C60: 0.000004, C107: 0.000004, C115: 0.000004, C114: 0.000004, C61: 0.000004, C8: 0.000004, C117: 0.000004, C122: 0.000004, C124: 0.000004, C125: 0.000004, C130: 0.000004, C20: 0.000004, C132: 0.000004, C133: 0.000004, C25: 0.000004, C7: 0.000004, C83: 0.000004, C140: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M8 (beta&w>1):
p0 = 0.99999 p = 0.00500 q = 1.87670
(p1 = 0.00001) w = 1.53690
MLEs of dN/dS (w) for site classes (K=11)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.00001
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00001 1.53690
(note that p[10] is zero)
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
31..12 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..11 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..13 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..17 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..16 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..18 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..22 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..21 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..27 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..26 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..4 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..30 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..8 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..1 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..3 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..2 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..6 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..5 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..7 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..10 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..14 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..15 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..20 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..19 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..25 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..23 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..24 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..9 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..29 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
31..28 0.000 36.3 5.7 0.0000 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C107)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.097 0.098 0.098 0.099 0.100 0.100 0.101 0.102 0.102 0.103
p : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
q : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
ws: 0.103 0.102 0.101 0.101 0.100 0.100 0.099 0.099 0.098 0.097
Time used: 5:19
Model 1: NearlyNeutral -52.877120 Model 2: PositiveSelection -52.876890 Model 7: beta -52.876890 Model 8: beta&w>1 -52.876890 Model 2 vs 1 .000460 Model 8 vs 7 0
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken. # ### General parameters ### # # The maximum number of sequences to use for the master file sequence_limit=90 # The random seed random_seed=3976763 # ### Alignment ### # # The alignment method: clustalw, muscle, kalign, t_coffee, or amap align_method=muscle # Minimum support value for amino acid positions in the alignment tcoffee_min_score=3 # ### MrBayes ### # # Number of iterations in MrBayes mrbayes_generations=1000000 # MrBayes burnin mrbayes_burnin=2500 # ### FUBAR ### # # The maximum number of sequences to be used by FUBAR. #fubar_sequence_limit=90 # The number of FUBAR runs #fubar_runs=1 # ### codeML ### # # The maximum number of sequences to be used by CodeML codeml_sequence_limit=30 # The number of CodeML runs codeml_runs=1 # The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'. codeml_models=1 2 7 8 # ### OmegaMap ### # # The maximum number of sequences to use in OmegaMap omegamap_sequence_limit=90 # The number of OmegaMap runs omegamap_runs=1 # The number of OmegaMap iterations omegamap_iterations=2500
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
