--- EXPERIMENT NOTES
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken
#
### General parameters ###
#
# The maximum number of sequences to use for the master file
sequence_limit=90
# The random seed
random_seed=3976763
#
### Alignment ###
#
# The alignment method: clustalw, muscle, kalign, t_coffee, or amap
align_method=muscle
# Minimum support value for amino acid positions in the alignment
tcoffee_min_score=3
#
### MrBayes ###
#
# Number of iterations in MrBayes
mrbayes_generations=1000000
# MrBayes burnin
mrbayes_burnin=2500
#
### FUBAR ###
#
# The maximum number of sequences to be used by FUBAR.
#fubar_sequence_limit=90
# The number of FUBAR runs
#fubar_runs=1
#
### codeML ###
#
# The maximum number of sequences to be used by CodeML
codeml_sequence_limit=30
# The number of CodeML runs
codeml_runs=1
# The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'.
codeml_models=1 2 7 8
#
### OmegaMap ###
#
# The maximum number of sequences to use in OmegaMap
omegamap_sequence_limit=90
# The number of OmegaMap runs
omegamap_runs=1
# The number of OmegaMap iterations
omegamap_iterations=2500
--- EXPERIMENT PROPERTIES
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -57.64 -60.60
2 -57.64 -60.10
--------------------------------------
TOTAL -57.64 -60.38
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.807984 90.333854 0.000164 28.764700 5.735977 967.45 1028.50 1.000
r(A<->C){all} 0.165654 0.021068 0.000064 0.455182 0.123415 125.04 149.37 1.000
r(A<->G){all} 0.170900 0.018980 0.000083 0.433835 0.136099 124.89 132.60 1.000
r(A<->T){all} 0.151770 0.015273 0.000071 0.388614 0.125407 63.31 106.76 1.000
r(C<->G){all} 0.165822 0.018151 0.000039 0.444862 0.132736 116.46 122.07 1.006
r(C<->T){all} 0.167028 0.017793 0.000033 0.426189 0.139534 82.30 94.54 1.010
r(G<->T){all} 0.178825 0.022848 0.000025 0.478007 0.137987 126.63 141.55 1.000
pi(A){all} 0.259969 0.003852 0.143177 0.381620 0.257616 626.84 639.65 1.000
pi(C){all} 0.173732 0.002799 0.072980 0.272028 0.170368 413.96 587.62 1.000
pi(G){all} 0.195107 0.003215 0.092837 0.311387 0.190615 547.99 604.85 1.000
pi(T){all} 0.371192 0.004718 0.234261 0.500150 0.371798 617.62 637.33 1.000
alpha{1,2} 0.907621 1.022300 0.000028 2.861831 0.567431 772.01 782.94 1.002
alpha{3} 0.952881 0.921427 0.000589 2.884986 0.670476 562.48 798.47 1.001
pinvar{all} 0.938101 0.019642 0.757651 0.999936 0.977153 118.08 122.32 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
--- CODEML SUMMARY
-- Starting log on Thu Dec 22 09:28:30 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result--
-- Starting log on Thu Dec 22 09:31:39 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result--
-- Starting log on Thu Dec 22 09:28:30 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result--
-- Starting log on Thu Dec 22 15:34:11 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/gapped_alignment/fubar,Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1--
MrBayes v3.2.6 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/mrbayes_input.nex"
UNIX line termination
Longest line length = 56
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 90 taxa and 42 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C52
Taxon 2 -> C65
Taxon 3 -> C10
Taxon 4 -> C67
Taxon 5 -> C68
Taxon 6 -> C9
Taxon 7 -> C14
Taxon 8 -> C73
Taxon 9 -> C72
Taxon 10 -> C17
Taxon 11 -> C74
Taxon 12 -> C59
Taxon 13 -> C75
Taxon 14 -> C16
Taxon 15 -> C21
Taxon 16 -> C80
Taxon 17 -> C79
Taxon 18 -> C24
Taxon 19 -> C81
Taxon 20 -> C82
Taxon 21 -> C23
Taxon 22 -> C28
Taxon 23 -> C58
Taxon 24 -> C87
Taxon 25 -> C86
Taxon 26 -> C31
Taxon 27 -> C88
Taxon 28 -> C89
Taxon 29 -> C30
Taxon 30 -> C35
Taxon 31 -> C94
Taxon 32 -> C93
Taxon 33 -> C38
Taxon 34 -> C3
Taxon 35 -> C95
Taxon 36 -> C96
Taxon 37 -> C37
Taxon 38 -> C42
Taxon 39 -> C101
Taxon 40 -> C100
Taxon 41 -> C45
Taxon 42 -> C102
Taxon 43 -> C103
Taxon 44 -> C44
Taxon 45 -> C60
Taxon 46 -> C49
Taxon 47 -> C108
Taxon 48 -> C107
Taxon 49 -> C1
Taxon 50 -> C109
Taxon 51 -> C110
Taxon 52 -> C51
Taxon 53 -> C56
Taxon 54 -> C115
Taxon 55 -> C114
Taxon 56 -> C61
Taxon 57 -> C8
Taxon 58 -> C116
Taxon 59 -> C117
Taxon 60 -> C4
Taxon 61 -> C64
Taxon 62 -> C6
Taxon 63 -> C123
Taxon 64 -> C122
Taxon 65 -> C12
Taxon 66 -> C124
Taxon 67 -> C2
Taxon 68 -> C125
Taxon 69 -> C15
Taxon 70 -> C18
Taxon 71 -> C69
Taxon 72 -> C131
Taxon 73 -> C130
Taxon 74 -> C20
Taxon 75 -> C132
Taxon 76 -> C133
Taxon 77 -> C25
Taxon 78 -> C7
Taxon 79 -> C77
Taxon 80 -> C29
Taxon 81 -> C139
Taxon 82 -> C138
Taxon 83 -> C83
Taxon 84 -> C140
Taxon 85 -> C32
Taxon 86 -> C142
Taxon 87 -> C85
Taxon 88 -> C33
Taxon 89 -> C66
Taxon 90 -> C147
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1671723255
Setting output file names to "/data/mrbayes_input.nex.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called 'first_pos'
Defining charset called 'second_pos'
Defining charset called 'third_pos'
Defining partition called 'by_codon'
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1067599789
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 5374269164
Seed = 1630813372
Swapseed = 1671723255
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Active parameters:
Partition(s)
Parameters 1 2 3
---------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
---------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:GammaDir(1.0,0.1000,1.0,1.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
0.91 % Dirichlet(Revmat{all})
0.91 % Slider(Revmat{all})
0.91 % Dirichlet(Pi{all})
0.91 % Slider(Pi{all})
1.82 % Multiplier(Alpha{1,2})
1.82 % Multiplier(Alpha{3})
1.82 % Slider(Pinvar{all})
9.09 % ExtSPR(Tau{all},V{all})
9.09 % ExtTBR(Tau{all},V{all})
9.09 % NNI(Tau{all},V{all})
9.09 % ParsSPR(Tau{all},V{all})
36.36 % Multiplier(V{all})
12.73 % Nodeslider(V{all})
5.45 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -124.224919 -- 149.597508
Chain 2 -- -124.224912 -- 149.597508
Chain 3 -- -124.224921 -- 149.597508
Chain 4 -- -124.224921 -- 149.597508
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -124.224925 -- 149.597508
Chain 2 -- -124.224920 -- 149.597508
Chain 3 -- -124.224929 -- 149.597508
Chain 4 -- -124.224924 -- 149.597508
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-124.225] (-124.225) (-124.225) (-124.225) * [-124.225] (-124.225) (-124.225) (-124.225)
1000 -- [-57.356] (-97.378) (-94.976) (-133.629) * [-57.191] (-104.345) (-109.360) (-83.160) -- 0:16:39
2000 -- [-57.344] (-80.037) (-70.891) (-94.133) * [-58.213] (-74.506) (-98.348) (-73.197) -- 0:16:38
3000 -- [-61.240] (-70.689) (-66.450) (-72.251) * [-62.422] (-67.686) (-71.282) (-71.176) -- 0:16:37
4000 -- [-59.442] (-68.084) (-62.255) (-65.594) * [-57.532] (-65.566) (-58.868) (-66.864) -- 0:16:36
5000 -- [-60.392] (-61.123) (-59.756) (-63.623) * [-57.158] (-62.920) (-57.702) (-65.071) -- 0:16:35
Average standard deviation of split frequencies: 0.081183
6000 -- [-59.611] (-62.844) (-60.607) (-63.892) * [-56.189] (-64.663) (-56.653) (-61.369) -- 0:13:48
7000 -- [-57.295] (-60.864) (-59.076) (-60.849) * [-58.967] (-59.843) (-57.575) (-65.009) -- 0:14:11
8000 -- [-58.140] (-56.876) (-56.535) (-63.416) * [-57.250] (-57.131) (-58.664) (-64.552) -- 0:14:28
9000 -- [-56.690] (-59.467) (-56.488) (-58.522) * [-58.244] (-56.912) (-58.809) (-63.841) -- 0:14:40
10000 -- [-59.637] (-56.199) (-59.515) (-59.373) * [-60.542] (-56.621) (-61.945) (-66.631) -- 0:14:51
Average standard deviation of split frequencies: 0.088388
11000 -- [-59.743] (-57.802) (-57.347) (-57.109) * [-57.141] (-61.389) (-60.828) (-62.540) -- 0:14:59
12000 -- [-58.312] (-58.279) (-62.949) (-57.519) * [-58.778] (-57.906) (-57.513) (-60.233) -- 0:15:05
13000 -- [-59.211] (-58.679) (-56.626) (-58.517) * [-59.252] (-57.059) (-57.950) (-57.546) -- 0:15:11
14000 -- [-59.893] (-61.440) (-56.305) (-58.098) * [-60.128] (-57.287) (-62.569) (-58.713) -- 0:15:15
15000 -- [-57.648] (-58.339) (-57.270) (-59.042) * [-59.823] (-61.979) (-57.581) (-60.213) -- 0:15:19
Average standard deviation of split frequencies: 0.095321
16000 -- [-56.507] (-56.577) (-60.343) (-57.521) * [-61.194] (-57.135) (-57.583) (-59.667) -- 0:15:22
17000 -- [-57.300] (-57.363) (-59.361) (-58.263) * [-58.475] (-57.517) (-57.079) (-59.434) -- 0:14:27
18000 -- [-60.238] (-58.308) (-58.426) (-56.677) * [-57.669] (-56.429) (-57.701) (-57.990) -- 0:14:32
19000 -- [-65.541] (-61.578) (-56.978) (-59.850) * [-57.320] (-56.463) (-57.197) (-56.743) -- 0:14:37
20000 -- [-60.297] (-66.075) (-58.284) (-56.392) * [-60.742] (-56.660) (-58.670) (-56.715) -- 0:14:42
Average standard deviation of split frequencies: 0.091240
21000 -- [-61.557] (-72.714) (-56.368) (-60.416) * [-62.799] (-58.140) (-57.742) (-56.354) -- 0:14:45
22000 -- [-59.806] (-64.451) (-57.706) (-59.561) * [-59.057] (-60.775) (-60.094) (-58.002) -- 0:14:49
23000 -- [-59.254] (-62.052) (-56.593) (-59.502) * [-60.246] (-58.763) (-59.285) (-56.859) -- 0:14:52
24000 -- [-59.004] (-59.213) (-60.215) (-58.203) * [-60.693] (-59.570) (-58.370) (-56.629) -- 0:14:54
25000 -- [-56.604] (-60.066) (-58.384) (-58.636) * [-60.119] (-59.348) (-57.105) (-60.501) -- 0:14:57
Average standard deviation of split frequencies: 0.072524
26000 -- [-56.367] (-57.779) (-58.572) (-58.450) * [-56.460] (-59.482) (-57.185) (-56.732) -- 0:14:59
27000 -- [-60.195] (-60.306) (-62.825) (-60.031) * [-59.365] (-57.809) (-58.763) (-58.031) -- 0:14:24
28000 -- [-56.918] (-56.508) (-58.294) (-58.003) * [-57.780] (-58.040) (-59.127) (-57.945) -- 0:14:27
29000 -- [-57.113] (-59.514) (-57.782) (-58.685) * [-58.953] (-57.659) (-58.671) (-60.363) -- 0:14:30
30000 -- [-58.730] (-58.593) (-63.649) (-59.202) * [-59.640] (-57.330) (-58.486) (-63.881) -- 0:14:33
Average standard deviation of split frequencies: 0.076859
31000 -- [-59.219] (-57.581) (-62.106) (-60.716) * [-58.049] (-57.467) (-56.997) (-57.236) -- 0:14:35
32000 -- [-58.042] (-60.697) (-58.202) (-58.684) * [-57.508] (-57.623) (-59.720) (-56.679) -- 0:14:37
33000 -- [-57.336] (-58.753) (-57.389) (-59.366) * [-57.794] (-63.645) (-57.127) (-58.774) -- 0:14:39
34000 -- [-58.550] (-59.698) (-56.962) (-62.478) * [-57.288] (-60.210) (-65.287) (-58.181) -- 0:14:40
35000 -- [-58.884] (-59.473) (-57.971) (-58.037) * [-59.213] (-60.264) (-58.658) (-58.604) -- 0:14:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
36000 -- [-58.106] (-58.358) (-56.808) (-61.322) * [-60.135] (-58.336) (-58.882) (-57.831) -- 0:14:16
37000 -- [-57.324] (-59.210) (-59.050) (-60.362) * [-60.189] (-57.999) (-57.988) (-59.710) -- 0:14:18
38000 -- [-58.758] (-57.194) (-60.268) (-59.148) * [-57.703] (-56.452) (-57.061) (-57.218) -- 0:14:20
39000 -- [-57.816] (-57.029) (-59.607) (-56.604) * [-58.158] (-57.948) (-60.806) (-57.208) -- 0:14:22
40000 -- [-58.832] (-56.733) (-61.107) (-57.112) * [-56.999] (-56.730) (-59.224) (-57.266) -- 0:14:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
41000 -- [-58.973] (-57.542) (-60.017) (-57.219) * [-58.589] (-57.620) (-60.137) (-57.342) -- 0:14:25
42000 -- [-57.316] (-57.914) (-60.523) (-57.287) * [-57.617] (-58.295) (-63.246) (-60.028) -- 0:14:26
43000 -- [-58.599] (-56.396) (-58.213) (-57.201) * [-56.871] (-59.616) (-59.778) (-57.764) -- 0:14:27
44000 -- [-58.671] (-57.712) (-56.405) (-57.162) * [-60.709] (-59.230) (-58.798) (-58.552) -- 0:14:29
45000 -- [-57.530] (-57.332) (-57.735) (-57.564) * [-58.940] (-59.482) (-59.678) (-61.430) -- 0:14:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
46000 -- [-63.955] (-56.595) (-57.132) (-56.500) * [-59.267] (-57.011) (-57.898) (-57.116) -- 0:14:31
47000 -- [-58.892] (-57.529) (-59.494) (-57.292) * [-57.039] (-59.523) (-59.795) (-58.944) -- 0:14:31
48000 -- [-62.020] (-58.391) (-61.357) (-56.264) * [-57.742] (-56.091) (-58.431) (-57.087) -- 0:14:32
49000 -- [-56.529] (-57.713) (-58.055) (-57.045) * [-57.391] (-57.744) (-59.889) (-57.970) -- 0:14:33
50000 -- [-59.130] (-56.723) (-62.498) (-56.564) * [-57.672] (-57.454) (-60.161) (-57.574) -- 0:14:34
Average standard deviation of split frequencies: NA (no splits above min. frequency)
51000 -- [-57.441] (-58.512) (-62.064) (-56.705) * [-58.310] (-58.118) (-60.655) (-57.006) -- 0:14:34
52000 -- [-59.653] (-58.549) (-60.560) (-57.243) * [-56.706] (-60.199) (-59.964) (-58.055) -- 0:14:35
53000 -- [-57.378] (-57.067) (-62.416) (-65.013) * [-56.507] (-56.304) (-56.210) (-58.457) -- 0:14:17
54000 -- [-56.404] (-58.981) (-58.155) (-60.353) * [-56.736] (-57.643) (-56.755) (-60.024) -- 0:14:18
55000 -- [-59.512] (-59.786) (-56.822) (-58.762) * [-57.752] (-59.405) (-65.149) (-57.559) -- 0:14:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
56000 -- [-58.882] (-61.866) (-58.403) (-57.826) * [-57.702] (-61.744) (-59.164) (-57.283) -- 0:14:19
57000 -- [-59.145] (-56.838) (-58.643) (-57.562) * [-57.580] (-59.304) (-59.250) (-59.927) -- 0:14:20
58000 -- [-60.287] (-58.537) (-58.462) (-57.430) * [-57.021] (-58.332) (-58.512) (-57.489) -- 0:14:20
59000 -- [-57.869] (-59.919) (-57.511) (-57.918) * [-57.741] (-56.871) (-57.827) (-59.644) -- 0:14:21
60000 -- [-57.457] (-57.826) (-57.563) (-58.541) * [-56.705] (-57.441) (-57.362) (-58.921) -- 0:14:21
Average standard deviation of split frequencies: NA (no splits above min. frequency)
61000 -- [-59.262] (-58.611) (-58.449) (-58.042) * [-57.292] (-58.118) (-60.885) (-60.292) -- 0:14:22
62000 -- [-57.526] (-57.196) (-62.787) (-59.300) * [-56.881] (-57.780) (-58.711) (-57.593) -- 0:14:22
63000 -- [-58.766] (-62.596) (-61.393) (-60.802) * [-59.352] (-57.133) (-58.989) (-57.926) -- 0:14:22
64000 -- [-58.378] (-57.318) (-62.407) (-59.556) * [-57.964] (-56.853) (-59.618) (-57.180) -- 0:14:22
65000 -- [-60.006] (-56.669) (-65.077) (-59.272) * [-56.772] (-60.270) (-57.357) (-58.453) -- 0:14:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
66000 -- [-56.773] (-57.417) (-57.863) (-59.669) * [-57.986] (-57.299) (-57.038) (-57.715) -- 0:14:23
67000 -- [-58.080] (-59.567) (-57.866) (-62.036) * [-58.739] (-56.340) (-58.587) (-60.733) -- 0:14:09
68000 -- [-57.890] (-60.069) (-58.404) (-58.402) * [-62.597] (-58.598) (-60.317) (-60.849) -- 0:14:09
69000 -- [-56.726] (-56.848) (-56.306) (-60.965) * [-60.887] (-57.211) (-60.830) (-61.330) -- 0:14:10
70000 -- [-58.283] (-58.928) (-57.816) (-58.093) * [-58.444] (-59.756) (-57.447) (-57.778) -- 0:14:10
Average standard deviation of split frequencies: NA (no splits above min. frequency)
71000 -- [-60.451] (-58.266) (-57.173) (-57.020) * [-58.041] (-57.430) (-58.445) (-59.245) -- 0:14:10
72000 -- [-57.683] (-56.683) (-56.621) (-57.177) * [-56.563] (-59.052) (-59.635) (-57.977) -- 0:14:10
73000 -- [-58.799] (-57.311) (-57.073) (-59.169) * [-59.683] (-60.908) (-57.328) (-57.702) -- 0:14:10
74000 -- [-58.839] (-58.725) (-59.146) (-59.863) * [-62.299] (-57.212) (-57.637) (-56.851) -- 0:14:10
75000 -- [-58.671] (-56.684) (-58.086) (-61.731) * [-57.629] (-61.379) (-59.754) (-59.161) -- 0:14:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
76000 -- [-57.277] (-58.440) (-58.868) (-60.700) * [-57.240] (-58.102) (-61.108) (-57.252) -- 0:14:11
77000 -- [-56.972] (-57.126) (-58.117) (-58.261) * [-57.104] (-59.370) (-61.935) (-56.672) -- 0:14:11
78000 -- [-58.332] (-56.094) (-59.004) (-57.763) * [-56.814] (-61.592) (-60.927) (-57.620) -- 0:14:11
79000 -- [-56.279] (-60.786) (-57.054) (-58.015) * [-57.693] (-61.411) (-62.535) (-57.667) -- 0:14:11
80000 -- [-57.976] (-57.531) (-57.600) (-56.592) * [-57.182] (-60.040) (-57.181) (-58.284) -- 0:14:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
81000 -- [-58.176] (-56.253) (-58.097) (-57.082) * [-57.890] (-61.114) (-56.373) (-60.564) -- 0:13:59
82000 -- [-58.318] (-58.889) (-58.785) (-56.769) * [-57.775] (-57.374) (-57.020) (-56.547) -- 0:13:59
83000 -- [-58.522] (-57.905) (-58.802) (-58.277) * [-59.847] (-57.995) (-57.106) (-59.871) -- 0:13:59
84000 -- [-58.722] (-62.382) (-58.045) (-57.184) * [-59.125] (-56.739) (-58.792) (-57.874) -- 0:13:59
85000 -- [-57.240] (-60.691) (-57.728) (-58.194) * [-57.966] (-56.630) (-57.089) (-57.904) -- 0:13:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
86000 -- [-56.762] (-58.442) (-58.337) (-56.976) * [-56.693] (-56.963) (-58.049) (-56.851) -- 0:13:59
87000 -- [-57.565] (-58.876) (-60.420) (-57.368) * [-56.260] (-57.051) (-56.814) (-58.885) -- 0:13:59
88000 -- [-56.517] (-59.769) (-58.020) (-58.874) * [-57.120] (-57.263) (-57.040) (-57.884) -- 0:13:59
89000 -- [-57.899] (-58.458) (-57.535) (-58.520) * [-59.070] (-57.980) (-57.514) (-58.589) -- 0:13:49
90000 -- [-56.821] (-58.393) (-58.218) (-58.761) * [-56.834] (-57.842) (-56.354) (-58.554) -- 0:13:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
91000 -- [-57.158] (-59.085) (-56.658) (-59.725) * [-56.372] (-57.046) (-57.620) (-58.347) -- 0:13:49
92000 -- [-58.137] (-57.619) (-57.408) (-57.198) * [-59.246] (-56.874) (-57.290) (-57.873) -- 0:13:49
93000 -- [-57.438] (-57.374) (-57.527) (-56.402) * [-56.956] (-57.204) (-63.813) (-56.564) -- 0:13:48
94000 -- [-57.160] (-56.839) (-56.623) (-58.653) * [-56.550] (-59.129) (-61.557) (-56.397) -- 0:13:48
95000 -- [-59.455] (-56.583) (-58.650) (-59.197) * [-56.451] (-56.956) (-60.623) (-56.884) -- 0:13:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
96000 -- [-58.021] (-57.570) (-57.254) (-58.289) * [-59.884] (-57.572) (-58.514) (-60.436) -- 0:13:48
97000 -- [-57.648] (-58.240) (-57.349) (-57.173) * [-57.441] (-58.313) (-59.347) (-60.266) -- 0:13:48
98000 -- [-57.328] (-59.367) (-57.690) (-56.523) * [-57.405] (-57.464) (-58.049) (-58.713) -- 0:13:48
99000 -- [-57.767] (-57.872) (-59.591) (-58.970) * [-56.486] (-58.721) (-58.198) (-61.125) -- 0:13:48
100000 -- [-58.982] (-61.652) (-59.072) (-60.149) * [-66.853] (-58.774) (-57.104) (-58.300) -- 0:13:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
101000 -- [-57.473] (-58.648) (-59.307) (-59.806) * [-60.644] (-60.736) (-59.585) (-60.728) -- 0:13:38
102000 -- [-58.229] (-58.799) (-57.659) (-56.192) * [-58.611] (-60.487) (-59.052) (-58.422) -- 0:13:38
103000 -- [-57.785] (-57.474) (-58.912) (-59.949) * [-59.657] (-60.296) (-57.229) (-57.975) -- 0:13:38
104000 -- [-57.187] (-60.027) (-62.016) (-60.014) * [-56.889] (-58.003) (-57.685) (-62.232) -- 0:13:38
105000 -- [-57.179] (-61.441) (-59.731) (-60.875) * [-56.987] (-57.370) (-57.582) (-57.533) -- 0:13:38
Average standard deviation of split frequencies: NA (no splits above min. frequency)
106000 -- [-57.430] (-57.413) (-57.351) (-61.241) * [-57.578] (-56.917) (-58.365) (-58.582) -- 0:13:38
107000 -- [-60.947] (-58.998) (-58.494) (-62.547) * [-58.725] (-58.494) (-58.916) (-56.434) -- 0:13:37
108000 -- [-60.034] (-56.264) (-56.828) (-59.085) * [-56.641] (-57.121) (-57.715) (-57.170) -- 0:13:37
109000 -- [-57.423] (-58.324) (-57.379) (-57.016) * [-59.565] (-57.524) (-57.220) (-58.679) -- 0:13:37
110000 -- [-58.661] (-57.994) (-58.510) (-58.070) * [-57.234] (-56.292) (-57.823) (-58.067) -- 0:13:37
Average standard deviation of split frequencies: NA (no splits above min. frequency)
111000 -- [-56.554] (-61.226) (-61.423) (-58.101) * [-57.617] (-60.245) (-56.910) (-56.334) -- 0:13:28
112000 -- [-60.109] (-56.841) (-61.625) (-56.862) * [-56.621] (-58.926) (-56.197) (-59.913) -- 0:13:28
113000 -- [-59.302] (-59.353) (-58.005) (-58.122) * [-58.408] (-56.836) (-59.548) (-59.819) -- 0:13:28
114000 -- [-59.226] (-56.212) (-57.809) (-56.195) * [-58.118] (-57.441) (-57.969) (-58.802) -- 0:13:28
115000 -- [-56.273] (-56.095) (-57.516) (-58.991) * [-57.457] (-56.716) (-56.497) (-61.962) -- 0:13:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
116000 -- [-57.711] (-57.970) (-60.757) (-57.420) * [-57.511] (-56.755) (-63.463) (-59.984) -- 0:13:27
117000 -- [-56.677] (-59.472) (-58.363) (-57.337) * [-56.907] (-57.524) (-62.253) (-60.179) -- 0:13:27
118000 -- [-59.608] (-57.504) (-60.139) (-58.568) * [-57.169] (-59.415) (-58.431) (-56.999) -- 0:13:27
119000 -- [-61.853] (-60.103) (-58.397) (-56.813) * [-60.842] (-56.922) (-60.812) (-59.869) -- 0:13:26
120000 -- [-57.928] (-59.278) (-59.150) (-56.701) * [-59.071] (-57.062) (-57.583) (-59.120) -- 0:13:26
Average standard deviation of split frequencies: NA (no splits above min. frequency)
121000 -- [-56.290] (-59.153) (-61.369) (-59.804) * [-57.406] (-57.594) (-59.280) (-61.109) -- 0:13:26
122000 -- [-57.854] (-59.995) (-60.365) (-57.966) * [-58.442] (-58.432) (-58.700) (-57.514) -- 0:13:26
123000 -- [-58.241] (-59.323) (-60.285) (-57.601) * [-59.358] (-57.431) (-57.169) (-65.100) -- 0:13:25
124000 -- [-56.658] (-58.409) (-58.655) (-56.692) * [-56.470] (-60.727) (-59.431) (-58.391) -- 0:13:18
125000 -- [-56.523] (-57.649) (-56.701) (-56.714) * [-58.153] (-58.600) (-60.324) (-58.697) -- 0:13:18
Average standard deviation of split frequencies: NA (no splits above min. frequency)
126000 -- [-58.730] (-58.497) (-57.565) (-56.633) * [-59.385] (-56.794) (-57.115) (-58.433) -- 0:13:17
127000 -- [-56.397] (-60.492) (-56.882) (-56.613) * [-57.136] (-59.118) (-58.569) (-57.039) -- 0:13:17
128000 -- [-56.450] (-57.314) (-57.097) (-58.236) * [-58.493] (-57.430) (-58.340) (-56.639) -- 0:13:17
129000 -- [-57.537] (-56.442) (-59.239) (-58.582) * [-57.297] (-57.777) (-57.485) (-60.592) -- 0:13:16
130000 -- [-58.536] (-58.618) (-60.020) (-60.735) * [-56.723] (-57.104) (-57.931) (-57.824) -- 0:13:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
131000 -- [-59.418] (-59.173) (-56.817) (-63.518) * [-56.790] (-60.752) (-56.551) (-58.203) -- 0:13:16
132000 -- [-62.773] (-57.271) (-56.489) (-61.066) * [-59.517] (-57.163) (-57.623) (-56.486) -- 0:13:15
133000 -- [-59.506] (-56.601) (-57.430) (-57.265) * [-56.750] (-57.179) (-59.856) (-57.698) -- 0:13:15
134000 -- [-58.311] (-58.287) (-59.372) (-57.647) * [-58.692] (-56.553) (-57.495) (-57.202) -- 0:13:14
135000 -- [-58.188] (-60.573) (-57.461) (-57.328) * [-59.689] (-57.814) (-56.283) (-58.203) -- 0:13:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
136000 -- [-58.915] (-57.982) (-57.719) (-58.209) * [-59.051] (-58.643) (-56.476) (-59.674) -- 0:13:14
137000 -- [-62.678] (-58.154) (-56.120) (-57.056) * [-57.921] (-59.709) (-59.824) (-56.609) -- 0:13:13
138000 -- [-59.264] (-60.569) (-58.426) (-56.562) * [-59.445] (-58.530) (-57.364) (-56.871) -- 0:13:13
139000 -- [-57.142] (-59.405) (-58.950) (-57.047) * [-61.837] (-56.234) (-59.323) (-58.378) -- 0:13:06
140000 -- [-57.970] (-58.647) (-57.740) (-57.657) * [-59.684] (-60.409) (-58.801) (-59.972) -- 0:13:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
141000 -- [-58.326] (-58.188) (-57.674) (-59.244) * [-58.237] (-57.935) (-58.000) (-56.823) -- 0:13:05
142000 -- [-57.733] (-57.547) (-59.217) (-58.186) * [-58.567] (-57.466) (-60.191) (-57.614) -- 0:13:05
143000 -- [-57.724] (-57.676) (-58.313) (-59.856) * [-63.496] (-58.090) (-58.435) (-57.037) -- 0:13:05
144000 -- [-56.226] (-58.086) (-60.051) (-56.442) * [-57.600] (-57.436) (-57.222) (-58.588) -- 0:13:04
145000 -- [-57.595] (-57.903) (-57.444) (-57.084) * [-59.105] (-57.309) (-59.045) (-57.807) -- 0:13:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
146000 -- [-57.543] (-58.268) (-56.491) (-58.166) * [-59.312] (-57.169) (-56.896) (-59.952) -- 0:13:03
147000 -- [-58.175] (-59.331) (-58.850) (-60.153) * [-56.667] (-57.616) (-56.895) (-63.575) -- 0:13:03
148000 -- [-56.847] (-58.272) (-57.302) (-57.843) * [-58.195] (-57.634) (-57.163) (-60.982) -- 0:13:02
149000 -- [-59.457] (-56.971) (-58.073) (-56.547) * [-59.959] (-57.962) (-58.368) (-59.111) -- 0:13:02
150000 -- [-58.829] (-64.038) (-57.845) (-56.607) * [-57.066] (-62.714) (-58.870) (-58.161) -- 0:13:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
151000 -- [-58.915] (-56.525) (-57.897) (-60.906) * [-57.976] (-60.320) (-59.531) (-58.313) -- 0:13:01
152000 -- [-61.020] (-57.651) (-58.346) (-60.109) * [-60.692] (-60.964) (-58.616) (-61.233) -- 0:13:01
153000 -- [-61.071] (-57.660) (-56.637) (-59.802) * [-58.106] (-57.947) (-58.055) (-57.426) -- 0:13:00
154000 -- [-59.553] (-59.334) (-56.662) (-57.797) * [-57.301] (-58.544) (-57.195) (-59.253) -- 0:13:00
155000 -- [-59.097] (-58.827) (-57.269) (-63.270) * [-59.761] (-56.379) (-63.786) (-62.400) -- 0:12:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
156000 -- [-57.069] (-58.558) (-57.735) (-62.222) * [-58.850] (-57.872) (-62.038) (-56.440) -- 0:12:59
157000 -- [-58.815] (-56.602) (-58.288) (-56.486) * [-57.407] (-59.250) (-61.474) (-64.831) -- 0:12:58
158000 -- [-57.571] (-57.336) (-56.489) (-60.865) * [-58.817] (-59.969) (-57.248) (-58.763) -- 0:12:58
159000 -- [-57.142] (-57.129) (-57.342) (-57.602) * [-58.539] (-56.801) (-57.673) (-56.361) -- 0:12:57
160000 -- [-57.501] (-58.402) (-59.739) (-60.564) * [-58.053] (-57.524) (-56.925) (-56.572) -- 0:12:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
161000 -- [-59.282] (-59.191) (-58.254) (-58.257) * [-57.454] (-56.595) (-58.325) (-56.477) -- 0:12:56
162000 -- [-57.195] (-57.899) (-58.168) (-60.973) * [-58.507] (-56.477) (-56.609) (-58.312) -- 0:12:50
163000 -- [-57.300] (-58.562) (-58.102) (-59.274) * [-57.215] (-57.215) (-56.566) (-56.619) -- 0:12:50
164000 -- [-57.890] (-57.675) (-57.615) (-56.797) * [-59.236] (-56.630) (-59.465) (-59.722) -- 0:12:49
165000 -- [-57.328] (-59.984) (-56.640) (-59.602) * [-58.459] (-65.338) (-57.363) (-59.890) -- 0:12:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
166000 -- [-60.423] (-59.779) (-58.524) (-62.504) * [-58.800] (-64.729) (-61.350) (-60.507) -- 0:12:48
167000 -- [-59.466] (-57.016) (-58.938) (-58.039) * [-57.101] (-58.443) (-61.362) (-58.630) -- 0:12:48
168000 -- [-62.771] (-61.712) (-56.641) (-60.081) * [-56.972] (-59.115) (-57.004) (-58.540) -- 0:12:47
169000 -- [-57.594] (-67.613) (-57.067) (-59.538) * [-56.705] (-57.267) (-58.138) (-62.043) -- 0:12:47
170000 -- [-57.939] (-60.632) (-57.265) (-57.682) * [-56.479] (-56.518) (-58.159) (-62.052) -- 0:12:46
Average standard deviation of split frequencies: NA (no splits above min. frequency)
171000 -- [-60.016] (-59.191) (-60.804) (-60.975) * [-56.337] (-57.568) (-57.579) (-61.175) -- 0:12:45
172000 -- [-62.258] (-57.784) (-61.197) (-57.780) * [-57.599] (-57.998) (-57.053) (-62.347) -- 0:12:45
173000 -- [-58.083] (-57.046) (-56.655) (-58.719) * [-62.725] (-57.188) (-60.596) (-60.552) -- 0:12:44
174000 -- [-56.957] (-57.470) (-58.236) (-61.036) * [-60.302] (-58.531) (-59.244) (-57.787) -- 0:12:39
175000 -- [-57.373] (-59.791) (-56.522) (-58.313) * [-57.144] (-59.711) (-56.530) (-63.577) -- 0:12:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
176000 -- [-56.468] (-56.938) (-59.263) (-57.328) * [-59.173] (-58.778) (-56.889) (-61.151) -- 0:12:38
177000 -- [-57.917] (-58.129) (-57.352) (-59.816) * [-56.533] (-56.554) (-59.940) (-57.291) -- 0:12:37
178000 -- [-56.983] (-56.730) (-57.425) (-58.545) * [-58.805] (-57.153) (-58.731) (-56.659) -- 0:12:37
179000 -- [-59.912] (-56.965) (-58.194) (-57.936) * [-56.419] (-60.079) (-57.498) (-57.898) -- 0:12:36
180000 -- [-58.147] (-57.420) (-57.391) (-58.972) * [-59.884] (-56.764) (-59.460) (-56.851) -- 0:12:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
181000 -- [-59.944] (-58.544) (-58.264) (-59.572) * [-57.290] (-58.703) (-60.592) (-59.048) -- 0:12:35
182000 -- [-58.770] (-60.043) (-56.623) (-60.237) * [-59.598] (-57.826) (-58.213) (-58.235) -- 0:12:35
183000 -- [-59.537] (-58.630) (-56.197) (-57.421) * [-59.315] (-61.074) (-59.574) (-57.059) -- 0:12:34
184000 -- [-56.920] (-59.173) (-61.740) (-56.662) * [-60.038] (-58.542) (-57.500) (-56.882) -- 0:12:33
185000 -- [-57.668] (-59.285) (-58.309) (-56.912) * [-62.104] (-58.632) (-57.332) (-56.364) -- 0:12:33
Average standard deviation of split frequencies: NA (no splits above min. frequency)
186000 -- [-58.497] (-56.802) (-63.494) (-57.789) * [-61.237] (-57.224) (-56.946) (-57.358) -- 0:12:32
187000 -- [-57.040] (-62.220) (-57.520) (-57.107) * [-61.613] (-57.611) (-57.105) (-60.289) -- 0:12:32
188000 -- [-60.495] (-58.298) (-56.096) (-59.860) * [-57.501] (-57.296) (-59.210) (-56.696) -- 0:12:31
189000 -- [-57.371] (-57.388) (-56.179) (-56.500) * [-57.824] (-59.019) (-58.816) (-58.634) -- 0:12:26
190000 -- [-56.864] (-58.769) (-58.674) (-57.103) * [-59.310] (-61.330) (-57.816) (-57.413) -- 0:12:26
Average standard deviation of split frequencies: NA (no splits above min. frequency)
191000 -- [-56.474] (-56.736) (-58.280) (-58.455) * [-57.869] (-56.751) (-57.188) (-60.033) -- 0:12:25
192000 -- [-58.035] (-57.923) (-60.547) (-60.511) * [-57.188] (-57.714) (-57.772) (-59.132) -- 0:12:24
193000 -- [-59.076] (-57.387) (-57.933) (-59.305) * [-57.153] (-57.374) (-60.910) (-58.045) -- 0:12:24
194000 -- [-57.808] (-57.774) (-57.860) (-57.765) * [-57.796] (-58.205) (-56.976) (-58.082) -- 0:12:23
195000 -- [-57.385] (-57.568) (-56.919) (-57.641) * [-57.392] (-57.261) (-57.551) (-56.949) -- 0:12:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
196000 -- [-56.228] (-60.329) (-56.431) (-59.088) * [-57.764] (-61.702) (-57.829) (-57.346) -- 0:12:22
197000 -- [-57.723] (-60.219) (-58.664) (-57.984) * [-56.774] (-58.037) (-57.249) (-57.961) -- 0:12:21
198000 -- [-59.973] (-60.834) (-60.540) (-60.436) * [-57.220] (-58.582) (-57.081) (-57.475) -- 0:12:21
199000 -- [-58.545] (-57.115) (-57.602) (-65.627) * [-57.362] (-59.291) (-56.847) (-63.940) -- 0:12:20
200000 -- [-57.798] (-56.961) (-59.410) (-66.317) * [-58.164] (-58.338) (-56.695) (-56.282) -- 0:12:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
201000 -- [-56.848] (-58.263) (-58.471) (-60.351) * [-59.305] (-57.890) (-57.295) (-58.701) -- 0:12:19
202000 -- [-57.275] (-57.438) (-57.393) (-58.108) * [-56.756] (-61.282) (-58.197) (-58.342) -- 0:12:18
203000 -- [-61.440] (-57.630) (-57.934) (-59.811) * [-56.122] (-56.983) (-58.047) (-58.977) -- 0:12:18
204000 -- [-60.832] (-57.153) (-57.070) (-58.460) * [-59.844] (-57.820) (-57.327) (-56.520) -- 0:12:17
205000 -- [-56.736] (-63.031) (-58.164) (-57.674) * [-58.922] (-56.323) (-57.857) (-59.799) -- 0:12:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
206000 -- [-60.696] (-60.789) (-59.019) (-62.085) * [-58.344] (-59.819) (-61.282) (-59.999) -- 0:12:16
207000 -- [-56.903] (-60.045) (-57.078) (-59.343) * [-57.231] (-57.264) (-59.338) (-60.858) -- 0:12:15
208000 -- [-61.226] (-57.665) (-59.835) (-60.091) * [-59.613] (-59.529) (-58.308) (-57.340) -- 0:12:14
209000 -- [-57.681] (-56.358) (-57.626) (-58.629) * [-60.476] (-60.127) (-63.321) (-56.411) -- 0:12:14
210000 -- [-57.215] (-56.563) (-60.966) (-59.238) * [-58.344] (-58.842) (-58.712) (-58.806) -- 0:12:13
Average standard deviation of split frequencies: NA (no splits above min. frequency)
211000 -- [-59.945] (-57.873) (-61.882) (-61.229) * [-56.139] (-57.005) (-59.046) (-59.146) -- 0:12:12
212000 -- [-58.684] (-56.815) (-60.245) (-56.595) * [-56.888] (-59.150) (-57.616) (-57.617) -- 0:12:08
213000 -- [-58.381] (-61.541) (-58.258) (-59.015) * [-56.989] (-63.809) (-56.693) (-61.994) -- 0:12:07
214000 -- [-60.848] (-57.810) (-56.436) (-57.559) * [-57.462] (-59.142) (-57.291) (-58.945) -- 0:12:07
215000 -- [-57.853] (-58.056) (-56.591) (-58.881) * [-56.665] (-57.636) (-58.684) (-59.793) -- 0:12:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
216000 -- [-57.807] (-59.340) (-59.651) (-57.598) * [-56.853] (-57.960) (-58.557) (-56.593) -- 0:12:05
217000 -- [-57.210] (-57.196) (-57.682) (-59.117) * [-58.090] (-59.489) (-59.901) (-57.113) -- 0:12:05
218000 -- [-59.113] (-57.488) (-57.648) (-59.194) * [-57.676] (-57.976) (-58.386) (-61.274) -- 0:12:04
219000 -- [-57.630] (-60.726) (-61.455) (-56.631) * [-57.593] (-60.638) (-59.211) (-60.769) -- 0:12:03
220000 -- [-58.483] (-58.363) (-58.910) (-56.440) * [-57.176] (-59.256) (-60.717) (-58.055) -- 0:12:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
221000 -- [-57.549] (-58.251) (-60.185) (-57.759) * [-57.725] (-61.009) (-57.076) (-58.654) -- 0:12:02
222000 -- [-56.969] (-59.833) (-58.065) (-56.357) * [-59.258] (-58.988) (-58.418) (-58.827) -- 0:12:01
223000 -- [-58.236] (-59.208) (-60.318) (-59.063) * [-58.307] (-58.669) (-58.794) (-59.515) -- 0:12:01
224000 -- [-58.210] (-58.530) (-56.527) (-56.698) * [-57.514] (-58.901) (-57.556) (-58.493) -- 0:12:00
225000 -- [-58.236] (-57.111) (-57.975) (-59.771) * [-57.580] (-57.213) (-60.161) (-60.912) -- 0:11:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
226000 -- [-58.317] (-58.332) (-59.011) (-58.388) * [-57.992] (-58.213) (-58.506) (-58.368) -- 0:11:59
227000 -- [-59.072] (-63.411) (-57.888) (-63.574) * [-57.576] (-56.332) (-57.401) (-60.120) -- 0:11:58
228000 -- [-56.417] (-59.498) (-58.736) (-62.496) * [-56.464] (-60.727) (-62.346) (-60.676) -- 0:11:57
229000 -- [-58.145] (-61.819) (-58.192) (-59.603) * [-58.098] (-56.723) (-57.667) (-59.072) -- 0:11:57
230000 -- [-57.982] (-60.490) (-57.675) (-58.561) * [-57.495] (-56.652) (-56.774) (-56.716) -- 0:11:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
231000 -- [-58.315] (-59.462) (-57.662) (-59.473) * [-56.888] (-57.622) (-56.872) (-59.047) -- 0:11:55
232000 -- [-66.001] (-59.768) (-58.777) (-56.637) * [-58.509] (-60.679) (-56.909) (-57.056) -- 0:11:55
233000 -- [-60.003] (-57.893) (-59.742) (-58.347) * [-56.573] (-57.505) (-57.853) (-56.940) -- 0:11:51
234000 -- [-57.703] (-58.009) (-58.183) (-57.653) * [-59.274] (-58.972) (-57.418) (-56.679) -- 0:11:50
235000 -- [-56.716] (-58.332) (-58.081) (-57.689) * [-57.929] (-60.404) (-58.460) (-60.033) -- 0:11:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
236000 -- [-57.900] (-60.070) (-62.671) (-58.618) * [-59.616] (-57.791) (-61.760) (-59.215) -- 0:11:48
237000 -- [-60.625] (-57.104) (-57.851) (-59.497) * [-56.944] (-57.456) (-56.722) (-60.343) -- 0:11:48
238000 -- [-57.337] (-56.808) (-56.519) (-57.970) * [-58.780] (-58.549) (-57.842) (-58.027) -- 0:11:47
239000 -- [-56.537] (-59.082) (-57.371) (-56.642) * [-58.153] (-58.371) (-58.794) (-59.498) -- 0:11:46
240000 -- [-56.627] (-58.442) (-61.346) (-60.756) * [-58.660] (-59.792) (-57.351) (-56.040) -- 0:11:46
Average standard deviation of split frequencies: NA (no splits above min. frequency)
241000 -- [-57.050] (-58.441) (-58.739) (-58.540) * [-58.099] (-57.576) (-57.068) (-56.837) -- 0:11:45
242000 -- [-56.672] (-58.548) (-57.279) (-60.905) * [-58.008] (-57.899) (-57.879) (-59.363) -- 0:11:44
243000 -- [-59.189] (-56.371) (-59.344) (-57.452) * [-59.870] (-59.462) (-57.497) (-57.682) -- 0:11:44
244000 -- [-57.963] (-57.303) (-60.418) (-57.283) * [-57.770] (-58.070) (-60.015) (-60.942) -- 0:11:43
245000 -- [-57.504] (-63.059) (-61.582) (-57.870) * [-56.690] (-56.832) (-59.429) (-57.881) -- 0:11:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
246000 -- [-56.559] (-56.590) (-60.426) (-57.239) * [-57.348] (-57.835) (-58.268) (-56.112) -- 0:11:38
247000 -- [-57.008] (-57.071) (-62.593) (-61.212) * [-56.875] (-57.517) (-58.681) (-57.247) -- 0:11:38
248000 -- [-57.905] (-59.992) (-59.256) (-56.956) * [-60.154] (-58.935) (-58.931) (-58.080) -- 0:11:37
249000 -- [-58.057] (-65.678) (-58.089) (-59.264) * [-60.303] (-58.190) (-58.426) (-56.891) -- 0:11:36
250000 -- [-56.918] (-61.243) (-58.657) (-58.664) * [-57.319] (-58.370) (-61.521) (-58.065) -- 0:11:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
251000 -- [-58.051] (-64.839) (-58.791) (-58.352) * [-56.770] (-58.823) (-57.590) (-59.458) -- 0:11:35
252000 -- [-57.647] (-56.784) (-58.787) (-57.273) * [-56.806] (-57.851) (-58.469) (-61.394) -- 0:11:34
253000 -- [-58.319] (-64.520) (-58.154) (-57.806) * [-57.217] (-59.263) (-58.426) (-58.371) -- 0:11:33
254000 -- [-58.677] (-59.208) (-57.296) (-58.340) * [-56.665] (-63.855) (-57.038) (-60.695) -- 0:11:33
255000 -- [-59.423] (-57.311) (-58.452) (-56.838) * [-58.680] (-62.691) (-57.261) (-56.844) -- 0:11:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
256000 -- [-57.035] (-56.789) (-60.986) (-57.551) * [-57.103] (-60.508) (-57.123) (-57.509) -- 0:11:31
257000 -- [-57.981] (-57.154) (-59.117) (-59.980) * [-58.525] (-58.243) (-57.333) (-57.139) -- 0:11:30
258000 -- [-60.165] (-57.218) (-63.112) (-56.740) * [-58.559] (-57.269) (-57.566) (-57.544) -- 0:11:30
259000 -- [-57.973] (-57.885) (-57.337) (-63.610) * [-59.419] (-57.184) (-61.091) (-58.178) -- 0:11:29
260000 -- [-61.181] (-56.888) (-60.394) (-56.332) * [-60.243] (-57.909) (-60.360) (-58.687) -- 0:11:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
261000 -- [-60.040] (-57.192) (-58.951) (-60.251) * [-58.355] (-60.517) (-60.527) (-56.582) -- 0:11:25
262000 -- [-56.807] (-57.045) (-57.358) (-60.577) * [-57.371] (-58.529) (-57.187) (-57.897) -- 0:11:24
263000 -- [-59.887] (-58.259) (-56.542) (-60.722) * [-57.195] (-58.702) (-58.617) (-58.943) -- 0:11:23
264000 -- [-58.828] (-57.850) (-59.034) (-60.072) * [-57.688] (-58.255) (-57.594) (-59.413) -- 0:11:23
265000 -- [-57.427] (-60.839) (-58.764) (-59.519) * [-59.236] (-62.292) (-58.702) (-57.304) -- 0:11:22
Average standard deviation of split frequencies: NA (no splits above min. frequency)
266000 -- [-57.769] (-58.590) (-57.405) (-56.716) * [-58.605] (-62.311) (-59.356) (-59.917) -- 0:11:21
267000 -- [-57.323] (-56.851) (-59.889) (-57.605) * [-57.236] (-62.914) (-58.280) (-58.259) -- 0:11:20
268000 -- [-57.001] (-57.068) (-60.880) (-59.943) * [-57.870] (-59.731) (-57.226) (-59.645) -- 0:11:20
269000 -- [-56.881] (-58.464) (-59.012) (-58.930) * [-62.956] (-57.424) (-57.073) (-62.199) -- 0:11:19
270000 -- [-56.652] (-57.940) (-57.867) (-59.356) * [-56.680] (-56.683) (-60.632) (-58.224) -- 0:11:18
Average standard deviation of split frequencies: NA (no splits above min. frequency)
271000 -- [-56.963] (-57.376) (-58.167) (-63.149) * [-59.034] (-56.980) (-60.636) (-57.744) -- 0:11:17
272000 -- [-58.158] (-56.247) (-57.441) (-56.436) * [-59.558] (-57.517) (-60.773) (-57.777) -- 0:11:17
273000 -- [-58.640] (-59.353) (-60.014) (-57.859) * [-58.915] (-60.014) (-58.808) (-58.564) -- 0:11:16
274000 -- [-60.150] (-58.021) (-56.699) (-56.927) * [-56.911] (-59.277) (-58.627) (-58.504) -- 0:11:13
275000 -- [-57.618] (-56.156) (-58.213) (-64.851) * [-56.612] (-56.689) (-59.504) (-60.390) -- 0:11:12
Average standard deviation of split frequencies: NA (no splits above min. frequency)
276000 -- [-59.025] (-58.776) (-57.660) (-62.487) * [-56.729] (-59.038) (-57.885) (-58.428) -- 0:11:11
277000 -- [-57.648] (-58.592) (-57.773) (-58.062) * [-57.205] (-59.180) (-59.352) (-57.683) -- 0:11:10
278000 -- [-57.096] (-57.797) (-58.721) (-62.216) * [-57.065] (-58.328) (-58.573) (-65.698) -- 0:11:10
279000 -- [-57.101] (-58.703) (-56.428) (-58.301) * [-57.380] (-58.851) (-58.824) (-58.708) -- 0:11:09
280000 -- [-57.269] (-59.971) (-57.086) (-57.125) * [-59.025] (-56.324) (-59.979) (-59.602) -- 0:11:08
Average standard deviation of split frequencies: NA (no splits above min. frequency)
281000 -- [-57.109] (-59.536) (-63.282) (-57.893) * [-57.251] (-57.048) (-59.812) (-59.000) -- 0:11:07
282000 -- [-59.777] (-58.985) (-58.820) (-59.522) * [-56.725] (-58.204) (-57.664) (-58.125) -- 0:11:07
283000 -- [-58.575] (-59.484) (-58.940) (-57.089) * [-58.936] (-58.367) (-59.622) (-59.144) -- 0:11:06
284000 -- [-57.653] (-59.521) (-58.636) (-58.055) * [-59.632] (-57.301) (-57.026) (-60.447) -- 0:11:05
285000 -- [-57.831] (-57.617) (-57.939) (-57.353) * [-57.988] (-58.196) (-57.539) (-60.767) -- 0:11:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
286000 -- [-58.241] (-60.797) (-58.860) (-60.335) * [-57.611] (-58.427) (-58.091) (-56.989) -- 0:11:04
287000 -- [-59.458] (-57.586) (-59.171) (-58.275) * [-58.870] (-62.745) (-57.059) (-58.455) -- 0:11:03
288000 -- [-58.161] (-58.740) (-58.953) (-59.397) * [-57.593] (-56.991) (-59.632) (-58.034) -- 0:11:02
289000 -- [-57.033] (-57.381) (-59.278) (-59.670) * [-57.568] (-58.183) (-59.724) (-57.412) -- 0:11:01
290000 -- [-56.705] (-57.346) (-59.643) (-57.184) * [-57.993] (-60.308) (-58.815) (-56.701) -- 0:11:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
291000 -- [-58.320] (-57.966) (-57.786) (-56.807) * [-58.082] (-58.447) (-58.287) (-56.624) -- 0:11:00
292000 -- [-58.539] (-59.433) (-58.484) (-58.786) * [-56.930] (-58.384) (-57.993) (-56.665) -- 0:10:59
293000 -- [-57.138] (-59.215) (-58.310) (-60.335) * [-57.610] (-58.750) (-56.723) (-57.167) -- 0:10:56
294000 -- [-59.851] (-57.505) (-58.936) (-58.619) * [-56.903] (-59.427) (-58.728) (-56.908) -- 0:10:55
295000 -- [-57.476] (-56.586) (-57.197) (-60.098) * [-57.817] (-57.737) (-62.281) (-58.429) -- 0:10:54
Average standard deviation of split frequencies: NA (no splits above min. frequency)
296000 -- [-59.355] (-58.107) (-62.344) (-59.437) * [-57.854] (-58.601) (-57.826) (-56.836) -- 0:10:54
297000 -- [-57.317] (-57.127) (-57.193) (-61.103) * [-57.804] (-59.500) (-57.314) (-59.450) -- 0:10:53
298000 -- [-58.288] (-58.059) (-57.739) (-58.736) * [-57.994] (-58.746) (-61.205) (-59.548) -- 0:10:52
299000 -- [-56.430] (-57.343) (-60.056) (-60.586) * [-60.414] (-59.818) (-60.123) (-59.034) -- 0:10:51
300000 -- [-57.868] (-56.937) (-60.059) (-61.511) * [-60.101] (-56.316) (-58.815) (-58.162) -- 0:10:51
Average standard deviation of split frequencies: NA (no splits above min. frequency)
301000 -- [-58.801] (-57.898) (-57.336) (-59.460) * [-58.720] (-57.785) (-57.841) (-57.501) -- 0:10:50
302000 -- [-57.364] (-57.808) (-60.114) (-57.432) * [-60.428] (-57.525) (-57.548) (-58.594) -- 0:10:49
303000 -- [-57.367] (-59.956) (-58.344) (-58.935) * [-59.086] (-56.939) (-58.751) (-60.360) -- 0:10:48
304000 -- [-59.502] (-61.587) (-57.345) (-58.399) * [-56.905] (-56.363) (-56.276) (-58.356) -- 0:10:47
305000 -- [-59.246] (-57.242) (-62.602) (-56.977) * [-58.874] (-57.156) (-58.000) (-59.476) -- 0:10:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
306000 -- [-59.068] (-57.994) (-58.396) (-57.562) * [-58.970] (-57.675) (-57.645) (-58.409) -- 0:10:46
307000 -- [-59.345] (-58.343) (-58.378) (-60.079) * [-58.203] (-59.332) (-59.268) (-57.158) -- 0:10:45
308000 -- [-57.001] (-59.926) (-57.392) (-58.814) * [-56.944] (-57.416) (-59.130) (-58.474) -- 0:10:44
309000 -- [-58.517] (-59.272) (-59.943) (-57.595) * [-59.908] (-56.373) (-59.936) (-57.321) -- 0:10:44
310000 -- [-56.661] (-58.461) (-60.380) (-56.446) * [-59.782] (-56.905) (-60.304) (-56.945) -- 0:10:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
311000 -- [-57.527] (-57.151) (-57.989) (-64.838) * [-57.155] (-57.265) (-58.278) (-57.635) -- 0:10:42
312000 -- [-57.023] (-57.999) (-63.394) (-62.544) * [-57.206] (-60.328) (-58.449) (-59.315) -- 0:10:41
313000 -- [-59.200] (-58.243) (-59.383) (-58.663) * [-56.499] (-57.454) (-58.895) (-56.734) -- 0:10:40
314000 -- [-59.578] (-58.679) (-59.250) (-59.193) * [-58.136] (-58.390) (-57.703) (-57.707) -- 0:10:37
315000 -- [-56.265] (-56.831) (-58.234) (-57.976) * [-56.689] (-57.822) (-57.512) (-57.861) -- 0:10:37
Average standard deviation of split frequencies: NA (no splits above min. frequency)
316000 -- [-56.704] (-59.465) (-58.243) (-56.188) * [-58.340] (-58.705) (-60.186) (-57.280) -- 0:10:36
317000 -- [-58.016] (-57.818) (-59.990) (-59.261) * [-57.866] (-58.622) (-59.377) (-63.348) -- 0:10:35
318000 -- [-63.803] (-59.429) (-62.110) (-58.936) * [-60.778] (-57.339) (-59.769) (-63.609) -- 0:10:34
319000 -- [-61.081] (-58.717) (-56.725) (-59.510) * [-57.494] (-57.431) (-60.428) (-59.406) -- 0:10:34
320000 -- [-62.188] (-58.338) (-58.179) (-58.807) * [-56.260] (-59.107) (-60.802) (-60.526) -- 0:10:33
Average standard deviation of split frequencies: NA (no splits above min. frequency)
321000 -- [-59.212] (-57.942) (-59.296) (-57.597) * [-61.412] (-57.064) (-61.226) (-59.828) -- 0:10:32
322000 -- [-58.228] (-58.820) (-61.623) (-57.788) * [-56.956] (-59.305) (-57.319) (-57.479) -- 0:10:31
323000 -- [-57.762] (-58.877) (-57.484) (-58.446) * [-60.762] (-57.922) (-57.372) (-58.885) -- 0:10:30
324000 -- [-59.484] (-60.024) (-59.222) (-57.815) * [-58.202] (-59.475) (-59.283) (-57.487) -- 0:10:30
325000 -- [-58.062] (-56.509) (-57.704) (-56.770) * [-58.900] (-57.199) (-56.319) (-58.978) -- 0:10:29
Average standard deviation of split frequencies: NA (no splits above min. frequency)
326000 -- [-58.143] (-57.571) (-56.455) (-58.932) * [-59.989] (-58.322) (-56.431) (-58.700) -- 0:10:28
327000 -- [-59.590] (-60.614) (-58.455) (-59.444) * [-56.584] (-62.783) (-56.512) (-58.104) -- 0:10:27
328000 -- [-57.914] (-57.139) (-57.646) (-56.970) * [-56.661] (-59.592) (-63.699) (-59.127) -- 0:10:24
329000 -- [-58.155] (-57.749) (-58.168) (-58.152) * [-58.476] (-58.985) (-56.771) (-64.307) -- 0:10:24
330000 -- [-57.249] (-56.913) (-57.601) (-57.294) * [-60.484] (-60.526) (-57.203) (-60.592) -- 0:10:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
331000 -- [-57.192] (-56.508) (-56.404) (-59.623) * [-57.435] (-59.156) (-59.936) (-59.882) -- 0:10:22
332000 -- [-57.918] (-58.530) (-59.215) (-60.826) * [-60.227] (-58.259) (-59.270) (-58.021) -- 0:10:21
333000 -- [-56.570] (-58.390) (-62.376) (-57.495) * [-57.555] (-59.230) (-58.784) (-56.936) -- 0:10:20
334000 -- [-56.479] (-59.704) (-60.206) (-59.682) * [-60.240] (-60.355) (-57.187) (-58.466) -- 0:10:20
335000 -- [-57.701] (-58.040) (-57.737) (-56.966) * [-56.721] (-61.209) (-58.228) (-63.718) -- 0:10:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
336000 -- [-58.595] (-58.615) (-57.678) (-59.836) * [-61.214] (-60.745) (-58.059) (-61.561) -- 0:10:18
337000 -- [-58.357] (-58.415) (-58.583) (-57.260) * [-59.843] (-56.995) (-58.734) (-58.505) -- 0:10:17
338000 -- [-57.947] (-58.584) (-59.176) (-60.792) * [-56.839] (-57.659) (-58.496) (-57.223) -- 0:10:16
339000 -- [-60.374] (-59.604) (-59.319) (-57.946) * [-58.420] (-59.375) (-59.261) (-56.942) -- 0:10:16
340000 -- [-58.030] (-58.654) (-60.672) (-58.118) * [-57.223] (-62.852) (-57.007) (-59.846) -- 0:10:15
Average standard deviation of split frequencies: NA (no splits above min. frequency)
341000 -- [-57.593] (-60.035) (-57.995) (-59.202) * [-58.376] (-58.973) (-58.154) (-60.678) -- 0:10:14
342000 -- [-56.310] (-58.145) (-59.317) (-57.409) * [-57.834] (-56.855) (-59.567) (-57.795) -- 0:10:13
343000 -- [-59.889] (-58.335) (-61.489) (-56.999) * [-58.423] (-57.197) (-58.385) (-57.913) -- 0:10:12
344000 -- [-58.312] (-61.564) (-56.326) (-62.234) * [-60.707] (-57.064) (-58.293) (-56.802) -- 0:10:10
345000 -- [-57.733] (-57.711) (-57.521) (-59.937) * [-60.126] (-58.405) (-57.053) (-61.427) -- 0:10:09
Average standard deviation of split frequencies: NA (no splits above min. frequency)
346000 -- [-58.511] (-60.986) (-59.273) (-57.622) * [-59.495] (-58.403) (-59.549) (-57.275) -- 0:10:08
347000 -- [-60.456] (-59.160) (-57.068) (-57.270) * [-58.559] (-59.704) (-56.432) (-59.547) -- 0:10:07
348000 -- [-59.023] (-57.430) (-59.837) (-57.503) * [-59.529] (-59.553) (-57.907) (-58.628) -- 0:10:07
349000 -- [-59.442] (-58.332) (-62.612) (-59.797) * [-58.307] (-56.755) (-60.406) (-59.123) -- 0:10:06
350000 -- [-57.104] (-56.788) (-60.934) (-63.890) * [-57.545] (-56.907) (-60.588) (-61.215) -- 0:10:05
Average standard deviation of split frequencies: NA (no splits above min. frequency)
351000 -- [-59.542] (-58.264) (-60.189) (-59.934) * [-61.384] (-56.940) (-57.280) (-67.302) -- 0:10:04
352000 -- [-57.518] (-57.650) (-57.150) (-60.492) * [-58.422] (-57.928) (-58.034) (-63.815) -- 0:10:03
353000 -- [-56.345] (-57.997) (-66.395) (-58.349) * [-57.282] (-63.308) (-57.257) (-60.574) -- 0:10:03
354000 -- [-61.968] (-58.485) (-59.115) (-56.176) * [-57.255] (-66.266) (-60.178) (-58.178) -- 0:10:02
355000 -- [-56.616] (-58.302) (-58.210) (-57.630) * [-57.304] (-59.335) (-59.048) (-59.257) -- 0:10:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
356000 -- [-58.223] (-58.328) (-57.245) (-59.721) * [-56.520] (-60.848) (-56.991) (-62.687) -- 0:10:00
357000 -- [-58.669] (-56.846) (-63.446) (-59.017) * [-57.760] (-57.438) (-58.959) (-58.182) -- 0:09:59
358000 -- [-57.157] (-58.132) (-57.593) (-57.062) * [-57.264] (-60.056) (-57.361) (-59.355) -- 0:09:58
359000 -- [-58.528] (-59.302) (-57.795) (-58.305) * [-56.390] (-60.663) (-58.208) (-57.413) -- 0:09:58
360000 -- [-60.117] (-56.557) (-57.562) (-58.183) * [-59.039] (-59.174) (-60.739) (-58.496) -- 0:09:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
361000 -- [-57.045] (-58.321) (-60.574) (-57.605) * [-57.035] (-57.053) (-62.871) (-57.547) -- 0:09:56
362000 -- [-56.987] (-60.292) (-56.390) (-58.417) * [-59.945] (-58.003) (-57.097) (-58.322) -- 0:09:55
363000 -- [-56.661] (-60.375) (-58.024) (-59.427) * [-56.460] (-56.471) (-58.890) (-57.982) -- 0:09:54
364000 -- [-61.812] (-60.443) (-57.907) (-58.597) * [-63.036] (-59.435) (-56.743) (-59.956) -- 0:09:54
365000 -- [-57.161] (-59.856) (-57.691) (-59.240) * [-62.064] (-59.062) (-56.535) (-61.370) -- 0:09:53
Average standard deviation of split frequencies: NA (no splits above min. frequency)
366000 -- [-60.459] (-57.798) (-59.402) (-56.952) * [-62.464] (-56.939) (-60.843) (-58.362) -- 0:09:52
367000 -- [-60.156] (-59.470) (-57.105) (-60.470) * [-60.631] (-58.643) (-60.465) (-57.792) -- 0:09:51
368000 -- [-58.306] (-61.323) (-56.499) (-58.120) * [-62.067] (-60.661) (-58.031) (-60.333) -- 0:09:50
369000 -- [-58.009] (-58.455) (-58.927) (-59.357) * [-57.095] (-56.875) (-56.892) (-57.775) -- 0:09:49
370000 -- [-56.798] (-57.875) (-59.804) (-59.352) * [-57.395] (-58.203) (-56.532) (-57.429) -- 0:09:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
371000 -- [-57.563] (-57.058) (-59.697) (-58.706) * [-57.095] (-60.105) (-59.151) (-57.404) -- 0:09:48
372000 -- [-60.701] (-59.182) (-57.431) (-56.212) * [-58.572] (-61.880) (-59.465) (-56.651) -- 0:09:47
373000 -- [-59.213] (-59.312) (-57.374) (-57.716) * [-60.316] (-58.270) (-58.144) (-58.601) -- 0:09:46
374000 -- [-57.338] (-59.304) (-59.103) (-56.576) * [-63.062] (-57.395) (-56.789) (-58.292) -- 0:09:45
375000 -- [-57.556] (-59.525) (-63.011) (-58.032) * [-56.870] (-61.163) (-60.404) (-58.639) -- 0:09:45
Average standard deviation of split frequencies: NA (no splits above min. frequency)
376000 -- [-59.237] (-58.068) (-60.769) (-56.916) * [-56.346] (-60.984) (-57.867) (-63.209) -- 0:09:44
377000 -- [-59.517] (-57.876) (-57.867) (-57.325) * [-57.419] (-59.815) (-57.116) (-60.584) -- 0:09:43
378000 -- [-57.748] (-58.494) (-57.912) (-56.883) * [-59.040] (-58.231) (-59.511) (-58.807) -- 0:09:42
379000 -- [-57.056] (-59.610) (-56.759) (-57.307) * [-59.226] (-60.054) (-58.332) (-57.487) -- 0:09:41
380000 -- [-58.209] (-58.046) (-60.221) (-57.285) * [-59.182] (-61.273) (-58.966) (-60.312) -- 0:09:40
Average standard deviation of split frequencies: NA (no splits above min. frequency)
381000 -- [-59.393] (-60.969) (-60.068) (-58.737) * [-57.017] (-57.079) (-60.977) (-61.322) -- 0:09:40
382000 -- [-56.147] (-59.263) (-61.092) (-57.818) * [-57.987] (-56.879) (-58.709) (-58.415) -- 0:09:39
383000 -- [-58.829] (-56.391) (-57.970) (-56.710) * [-57.429] (-62.206) (-62.534) (-56.894) -- 0:09:36
384000 -- [-58.271] (-56.639) (-60.992) (-61.282) * [-57.087] (-59.027) (-59.382) (-59.778) -- 0:09:35
385000 -- [-60.176] (-56.212) (-60.953) (-57.468) * [-58.651] (-56.860) (-58.474) (-56.869) -- 0:09:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
386000 -- [-57.857] (-57.403) (-62.154) (-57.520) * [-57.751] (-59.280) (-60.341) (-58.371) -- 0:09:34
387000 -- [-58.977] (-56.497) (-56.336) (-60.775) * [-57.565] (-57.988) (-57.549) (-59.950) -- 0:09:33
388000 -- [-57.393] (-58.979) (-58.536) (-59.424) * [-57.578] (-57.137) (-57.266) (-59.544) -- 0:09:32
389000 -- [-58.605] (-58.224) (-58.315) (-57.485) * [-57.288] (-57.647) (-58.104) (-58.649) -- 0:09:31
390000 -- [-59.039] (-58.348) (-59.042) (-58.060) * [-57.359] (-60.341) (-56.666) (-57.410) -- 0:09:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
391000 -- [-56.636] (-59.237) (-57.115) (-61.470) * [-58.223] (-58.020) (-58.441) (-59.634) -- 0:09:30
392000 -- [-58.478] (-58.126) (-60.101) (-60.668) * [-61.105] (-60.535) (-57.929) (-57.244) -- 0:09:29
393000 -- [-57.226] (-59.408) (-57.224) (-62.039) * [-59.950] (-58.780) (-61.516) (-57.050) -- 0:09:28
394000 -- [-62.418] (-56.472) (-57.279) (-60.793) * [-58.435] (-57.846) (-58.963) (-57.527) -- 0:09:27
395000 -- [-59.169] (-57.544) (-58.405) (-62.460) * [-57.747] (-57.337) (-58.916) (-58.845) -- 0:09:25
Average standard deviation of split frequencies: NA (no splits above min. frequency)
396000 -- [-59.618] (-58.479) (-56.146) (-57.365) * [-58.839] (-58.556) (-57.206) (-57.011) -- 0:09:24
397000 -- [-56.402] (-58.889) (-56.786) (-61.644) * [-57.782] (-57.911) (-56.962) (-58.405) -- 0:09:23
398000 -- [-56.488] (-60.538) (-58.403) (-57.485) * [-59.708] (-58.032) (-57.766) (-58.974) -- 0:09:22
399000 -- [-58.920] (-58.467) (-61.014) (-57.535) * [-59.999] (-60.927) (-58.939) (-57.245) -- 0:09:21
400000 -- [-56.587] (-58.299) (-58.420) (-58.321) * [-59.050] (-57.001) (-59.004) (-57.692) -- 0:09:21
Average standard deviation of split frequencies: NA (no splits above min. frequency)
401000 -- [-57.191] (-57.587) (-58.565) (-56.421) * [-57.174] (-59.238) (-57.380) (-60.525) -- 0:09:20
402000 -- [-59.298] (-59.166) (-59.795) (-57.946) * [-58.164] (-58.282) (-57.809) (-57.946) -- 0:09:19
403000 -- [-57.147] (-58.839) (-59.105) (-60.575) * [-57.309] (-56.875) (-57.871) (-59.993) -- 0:09:18
404000 -- [-57.183] (-61.860) (-59.600) (-59.998) * [-57.523] (-58.243) (-61.201) (-58.269) -- 0:09:17
405000 -- [-58.840] (-57.918) (-59.819) (-60.144) * [-56.659] (-57.572) (-59.850) (-58.561) -- 0:09:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
406000 -- [-57.895] (-59.987) (-56.621) (-56.672) * [-56.606] (-57.053) (-58.125) (-59.959) -- 0:09:15
407000 -- [-57.499] (-57.812) (-61.863) (-58.173) * [-57.111] (-56.900) (-59.027) (-59.742) -- 0:09:13
408000 -- [-59.790] (-59.273) (-62.966) (-58.009) * [-58.591] (-57.759) (-57.002) (-63.640) -- 0:09:12
409000 -- [-60.073] (-58.728) (-58.813) (-58.489) * [-56.461] (-58.235) (-60.468) (-60.826) -- 0:09:11
410000 -- [-61.156] (-58.389) (-58.292) (-62.180) * [-56.218] (-60.007) (-61.051) (-56.789) -- 0:09:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
411000 -- [-59.003] (-61.752) (-59.493) (-61.501) * [-58.368] (-56.451) (-59.668) (-57.525) -- 0:09:10
412000 -- [-57.801] (-59.476) (-59.916) (-58.127) * [-56.784] (-57.306) (-56.976) (-57.332) -- 0:09:09
413000 -- [-56.939] (-58.844) (-58.007) (-59.757) * [-58.178] (-56.778) (-57.519) (-57.739) -- 0:09:08
414000 -- [-57.532] (-56.307) (-56.889) (-57.726) * [-59.504] (-59.334) (-56.980) (-59.628) -- 0:09:07
415000 -- [-59.293] (-57.129) (-57.448) (-59.422) * [-57.586] (-58.605) (-57.607) (-57.540) -- 0:09:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
416000 -- [-61.584] (-61.226) (-58.560) (-57.260) * [-58.886] (-56.974) (-58.861) (-57.481) -- 0:09:06
417000 -- [-57.859] (-58.324) (-57.081) (-56.754) * [-61.768] (-58.353) (-59.993) (-58.475) -- 0:09:05
418000 -- [-59.381] (-57.653) (-57.483) (-57.737) * [-56.872] (-62.237) (-57.353) (-58.961) -- 0:09:04
419000 -- [-57.210] (-57.321) (-56.549) (-65.498) * [-58.863] (-57.984) (-57.150) (-57.830) -- 0:09:03
420000 -- [-61.359] (-60.533) (-57.135) (-56.939) * [-59.489] (-57.640) (-57.844) (-56.793) -- 0:09:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
421000 -- [-56.603] (-58.684) (-56.953) (-59.094) * [-59.553] (-57.987) (-59.256) (-57.107) -- 0:09:01
422000 -- [-57.950] (-56.088) (-57.356) (-58.923) * [-57.077] (-62.649) (-59.713) (-57.358) -- 0:09:01
423000 -- [-58.212] (-59.671) (-58.410) (-60.715) * [-58.992] (-57.821) (-58.223) (-58.889) -- 0:09:00
424000 -- [-57.354] (-62.376) (-57.914) (-63.755) * [-59.278] (-63.365) (-57.915) (-59.668) -- 0:08:59
425000 -- [-59.674] (-63.792) (-57.769) (-58.426) * [-56.969] (-57.764) (-58.871) (-56.847) -- 0:08:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
426000 -- [-57.785] (-58.688) (-57.287) (-57.321) * [-59.663] (-61.160) (-60.175) (-58.042) -- 0:08:56
427000 -- [-63.689] (-58.649) (-58.062) (-58.325) * [-59.658] (-58.286) (-57.527) (-57.363) -- 0:08:55
428000 -- [-60.683] (-62.203) (-57.365) (-63.475) * [-57.018] (-57.017) (-57.687) (-57.648) -- 0:08:54
429000 -- [-59.388] (-58.311) (-56.827) (-58.220) * [-58.782] (-57.009) (-56.804) (-60.624) -- 0:08:53
430000 -- [-59.715] (-57.450) (-59.955) (-57.464) * [-59.037] (-56.388) (-57.639) (-59.592) -- 0:08:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
431000 -- [-59.920] (-58.643) (-56.561) (-58.431) * [-56.750] (-58.873) (-57.104) (-59.131) -- 0:08:52
432000 -- [-58.760] (-56.900) (-58.718) (-60.764) * [-58.728] (-56.862) (-58.160) (-58.052) -- 0:08:51
433000 -- [-58.159] (-57.560) (-59.503) (-59.622) * [-57.585] (-58.797) (-59.125) (-56.593) -- 0:08:50
434000 -- [-56.494] (-57.697) (-59.344) (-59.064) * [-59.333] (-58.994) (-58.869) (-57.542) -- 0:08:49
435000 -- [-57.221] (-59.319) (-57.876) (-57.105) * [-57.871] (-58.686) (-56.911) (-57.925) -- 0:08:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
436000 -- [-59.620] (-56.494) (-57.573) (-60.411) * [-58.742] (-60.570) (-61.882) (-60.476) -- 0:08:47
437000 -- [-61.355] (-56.847) (-57.742) (-58.017) * [-60.561] (-61.882) (-58.764) (-57.852) -- 0:08:46
438000 -- [-56.442] (-58.198) (-57.871) (-58.675) * [-57.207] (-59.375) (-57.977) (-58.825) -- 0:08:46
439000 -- [-57.602] (-56.740) (-57.609) (-59.173) * [-57.242] (-60.682) (-58.481) (-65.314) -- 0:08:45
440000 -- [-57.194] (-58.794) (-58.419) (-59.009) * [-58.552] (-57.210) (-57.713) (-63.658) -- 0:08:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
441000 -- [-57.698] (-59.528) (-57.435) (-58.523) * [-57.368] (-59.910) (-56.561) (-59.353) -- 0:08:43
442000 -- [-60.594] (-57.257) (-58.478) (-63.623) * [-58.567] (-57.435) (-58.453) (-56.829) -- 0:08:42
443000 -- [-56.907] (-57.845) (-61.787) (-58.325) * [-61.178] (-56.739) (-56.977) (-57.222) -- 0:08:41
444000 -- [-57.156] (-58.638) (-60.766) (-59.803) * [-57.263] (-57.152) (-57.232) (-61.248) -- 0:08:40
445000 -- [-57.065] (-58.697) (-61.443) (-63.486) * [-58.210] (-57.687) (-57.963) (-56.677) -- 0:08:40
Average standard deviation of split frequencies: NA (no splits above min. frequency)
446000 -- [-56.664] (-59.696) (-56.963) (-57.538) * [-61.637] (-56.620) (-60.042) (-59.723) -- 0:08:39
447000 -- [-59.533] (-60.701) (-59.118) (-56.928) * [-60.139] (-57.796) (-60.159) (-57.640) -- 0:08:38
448000 -- [-58.287] (-58.176) (-57.898) (-59.340) * [-60.924] (-56.838) (-58.548) (-57.280) -- 0:08:37
449000 -- [-57.996] (-57.209) (-60.995) (-60.934) * [-58.174] (-60.932) (-57.811) (-56.370) -- 0:08:36
450000 -- [-60.454] (-57.512) (-58.231) (-58.702) * [-57.620] (-57.855) (-56.747) (-61.117) -- 0:08:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
451000 -- [-57.441] (-58.464) (-57.622) (-58.978) * [-57.198] (-59.426) (-57.038) (-58.941) -- 0:08:34
452000 -- [-59.103] (-57.013) (-57.777) (-58.873) * [-57.112] (-57.324) (-57.968) (-56.203) -- 0:08:34
453000 -- [-58.975] (-56.958) (-57.264) (-57.991) * [-57.665] (-58.078) (-56.635) (-57.787) -- 0:08:33
454000 -- [-56.635] (-56.739) (-56.651) (-58.023) * [-58.360] (-58.695) (-60.860) (-57.304) -- 0:08:32
455000 -- [-56.936] (-58.220) (-57.733) (-57.195) * [-64.434] (-63.112) (-58.698) (-57.934) -- 0:08:31
Average standard deviation of split frequencies: NA (no splits above min. frequency)
456000 -- [-57.348] (-57.058) (-63.158) (-61.876) * [-59.901] (-58.721) (-58.012) (-60.163) -- 0:08:30
457000 -- [-57.547] (-56.770) (-63.715) (-57.227) * [-58.593] (-57.550) (-58.949) (-56.708) -- 0:08:29
458000 -- [-57.610] (-59.782) (-57.665) (-58.811) * [-56.286] (-60.093) (-59.250) (-59.964) -- 0:08:27
459000 -- [-57.216] (-57.797) (-59.292) (-57.267) * [-57.133] (-60.055) (-56.634) (-60.012) -- 0:08:26
460000 -- [-57.419] (-58.074) (-61.475) (-59.283) * [-61.329] (-59.352) (-58.642) (-57.002) -- 0:08:25
Average standard deviation of split frequencies: NA (no splits above min. frequency)
461000 -- [-57.490] (-58.514) (-58.264) (-63.180) * [-60.298] (-56.745) (-58.543) (-56.991) -- 0:08:25
462000 -- [-57.372] (-61.301) (-59.492) (-56.875) * [-59.534] (-57.007) (-59.864) (-59.669) -- 0:08:24
463000 -- [-57.205] (-66.529) (-61.634) (-57.897) * [-56.630] (-59.263) (-57.834) (-60.521) -- 0:08:23
464000 -- [-58.593] (-62.923) (-58.564) (-57.446) * [-60.620] (-56.864) (-57.515) (-58.576) -- 0:08:22
465000 -- [-59.572] (-66.295) (-56.146) (-57.773) * [-56.539] (-56.311) (-57.855) (-57.029) -- 0:08:21
Average standard deviation of split frequencies: NA (no splits above min. frequency)
466000 -- [-59.444] (-66.942) (-61.122) (-58.016) * [-58.066] (-56.350) (-59.137) (-58.310) -- 0:08:20
467000 -- [-59.565] (-60.912) (-62.231) (-58.621) * [-56.546] (-59.505) (-61.791) (-57.056) -- 0:08:19
468000 -- [-60.635] (-59.144) (-64.578) (-60.012) * [-57.805] (-57.038) (-62.004) (-56.766) -- 0:08:19
469000 -- [-60.969] (-58.220) (-58.516) (-56.636) * [-61.074] (-58.362) (-58.472) (-57.893) -- 0:08:18
470000 -- [-58.808] (-57.519) (-61.030) (-60.478) * [-56.634] (-57.735) (-59.086) (-61.160) -- 0:08:17
Average standard deviation of split frequencies: NA (no splits above min. frequency)
471000 -- [-57.922] (-57.247) (-58.057) (-57.572) * [-58.082] (-59.469) (-58.552) (-57.031) -- 0:08:16
472000 -- [-56.794] (-56.766) (-59.635) (-58.139) * [-56.802] (-57.917) (-57.321) (-56.703) -- 0:08:14
473000 -- [-58.090] (-57.958) (-61.774) (-59.695) * [-59.683] (-61.960) (-57.504) (-59.463) -- 0:08:13
474000 -- [-57.855] (-59.263) (-59.777) (-57.563) * [-57.028] (-59.553) (-58.297) (-57.764) -- 0:08:12
475000 -- [-57.938] (-57.391) (-60.768) (-60.362) * [-60.513] (-58.076) (-57.550) (-58.781) -- 0:08:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
476000 -- [-57.120] (-57.383) (-56.304) (-58.862) * [-59.564] (-61.238) (-56.150) (-61.201) -- 0:08:10
477000 -- [-57.900] (-58.766) (-57.178) (-57.525) * [-58.943] (-57.295) (-56.766) (-58.047) -- 0:08:10
478000 -- [-59.649] (-57.963) (-59.803) (-57.539) * [-57.870] (-56.797) (-57.980) (-60.063) -- 0:08:09
479000 -- [-60.647] (-57.075) (-58.084) (-58.505) * [-62.139] (-59.965) (-58.043) (-60.480) -- 0:08:08
480000 -- [-57.796] (-60.488) (-58.895) (-56.933) * [-56.781] (-58.848) (-57.111) (-60.281) -- 0:08:07
Average standard deviation of split frequencies: NA (no splits above min. frequency)
481000 -- [-58.335] (-57.368) (-58.299) (-58.505) * [-61.404] (-57.923) (-58.625) (-57.741) -- 0:08:06
482000 -- [-62.813] (-57.297) (-59.864) (-56.913) * [-60.639] (-57.153) (-58.952) (-57.099) -- 0:08:05
483000 -- [-60.373] (-60.079) (-57.685) (-56.229) * [-57.179] (-57.369) (-57.590) (-56.886) -- 0:08:04
484000 -- [-57.173] (-58.025) (-57.366) (-60.181) * [-57.582] (-61.031) (-56.864) (-59.269) -- 0:08:02
485000 -- [-56.943] (-59.786) (-58.109) (-58.557) * [-57.227] (-57.894) (-63.373) (-62.122) -- 0:08:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
486000 -- [-57.741] (-59.896) (-58.287) (-57.696) * [-61.341] (-59.233) (-57.449) (-57.923) -- 0:08:01
487000 -- [-58.678] (-58.030) (-58.229) (-56.790) * [-58.124] (-58.901) (-60.013) (-58.460) -- 0:08:00
488000 -- [-58.164] (-59.026) (-58.669) (-58.404) * [-58.168] (-59.186) (-57.828) (-58.325) -- 0:07:59
489000 -- [-57.295] (-57.092) (-57.870) (-56.764) * [-56.298] (-56.085) (-58.571) (-56.827) -- 0:07:58
490000 -- [-60.698] (-57.738) (-57.059) (-57.937) * [-57.727] (-58.666) (-58.140) (-59.803) -- 0:07:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
491000 -- [-60.957] (-57.223) (-59.041) (-57.622) * [-56.253] (-58.755) (-57.937) (-61.069) -- 0:07:56
492000 -- [-59.508] (-60.651) (-58.402) (-58.224) * [-57.079] (-61.122) (-60.030) (-57.584) -- 0:07:55
493000 -- [-59.795] (-57.613) (-57.613) (-56.756) * [-56.414] (-59.790) (-58.208) (-61.434) -- 0:07:55
494000 -- [-60.389] (-59.070) (-59.510) (-58.320) * [-59.310] (-56.535) (-56.698) (-58.843) -- 0:07:54
495000 -- [-61.797] (-59.305) (-58.558) (-58.493) * [-59.159] (-60.248) (-58.976) (-58.175) -- 0:07:53
Average standard deviation of split frequencies: NA (no splits above min. frequency)
496000 -- [-60.007] (-57.652) (-57.503) (-56.446) * [-61.176] (-56.297) (-58.578) (-58.427) -- 0:07:52
497000 -- [-59.381] (-57.177) (-62.501) (-57.839) * [-57.546] (-60.181) (-61.046) (-57.590) -- 0:07:51
498000 -- [-59.875] (-58.339) (-63.504) (-58.045) * [-56.746] (-57.209) (-61.532) (-57.912) -- 0:07:50
499000 -- [-60.436] (-59.183) (-63.686) (-57.887) * [-60.636] (-57.224) (-60.718) (-57.208) -- 0:07:48
500000 -- [-56.222] (-57.975) (-57.940) (-59.439) * [-56.692] (-60.566) (-60.539) (-59.429) -- 0:07:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
501000 -- [-58.033] (-59.287) (-58.635) (-61.438) * [-56.695] (-62.077) (-57.217) (-57.473) -- 0:07:47
502000 -- [-59.573] (-59.498) (-57.993) (-57.827) * [-56.741] (-58.917) (-56.801) (-60.261) -- 0:07:46
503000 -- [-58.236] (-57.766) (-57.242) (-60.447) * [-57.569] (-57.508) (-58.738) (-57.625) -- 0:07:45
504000 -- [-59.286] (-57.009) (-57.395) (-59.132) * [-56.467] (-58.078) (-57.539) (-56.262) -- 0:07:44
505000 -- [-56.124] (-58.188) (-56.980) (-60.327) * [-59.047] (-58.322) (-57.089) (-59.165) -- 0:07:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
506000 -- [-57.423] (-57.702) (-57.395) (-56.340) * [-58.393] (-64.259) (-59.638) (-59.370) -- 0:07:42
507000 -- [-58.761] (-60.307) (-57.647) (-56.849) * [-60.295] (-63.556) (-60.324) (-57.465) -- 0:07:41
508000 -- [-57.863] (-57.746) (-58.980) (-59.847) * [-59.139] (-57.577) (-59.361) (-57.560) -- 0:07:41
509000 -- [-57.237] (-57.817) (-57.082) (-57.870) * [-62.111] (-59.392) (-58.196) (-56.430) -- 0:07:40
510000 -- [-57.075] (-59.583) (-57.015) (-58.738) * [-60.419] (-58.363) (-58.153) (-57.474) -- 0:07:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
511000 -- [-58.075] (-58.499) (-57.664) (-56.893) * [-56.909] (-61.377) (-57.068) (-56.949) -- 0:07:38
512000 -- [-57.397] (-58.208) (-57.064) (-56.536) * [-58.919] (-58.386) (-59.404) (-56.604) -- 0:07:37
513000 -- [-60.938] (-57.790) (-58.942) (-59.933) * [-58.624] (-56.258) (-59.262) (-60.974) -- 0:07:36
514000 -- [-59.246] (-58.786) (-58.827) (-58.736) * [-57.462] (-57.768) (-62.354) (-57.174) -- 0:07:35
515000 -- [-56.993] (-60.426) (-59.115) (-60.673) * [-57.879] (-57.598) (-58.527) (-57.723) -- 0:07:34
Average standard deviation of split frequencies: NA (no splits above min. frequency)
516000 -- [-59.295] (-57.789) (-57.402) (-62.462) * [-57.535] (-58.123) (-57.556) (-60.684) -- 0:07:33
517000 -- [-56.599] (-57.528) (-59.127) (-58.542) * [-56.611] (-60.124) (-58.577) (-56.572) -- 0:07:33
518000 -- [-57.468] (-59.570) (-59.019) (-60.723) * [-58.283] (-60.153) (-57.396) (-57.993) -- 0:07:32
519000 -- [-57.046] (-57.292) (-56.139) (-56.710) * [-58.834] (-58.145) (-57.928) (-59.194) -- 0:07:31
520000 -- [-57.534] (-60.292) (-56.529) (-57.341) * [-59.450] (-57.259) (-59.590) (-59.848) -- 0:07:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
521000 -- [-57.268] (-58.203) (-57.459) (-56.122) * [-57.205] (-58.831) (-61.392) (-59.550) -- 0:07:29
522000 -- [-56.522] (-56.645) (-57.688) (-57.557) * [-56.520] (-58.710) (-61.256) (-58.104) -- 0:07:28
523000 -- [-57.417] (-58.830) (-57.848) (-57.411) * [-58.518] (-59.141) (-60.337) (-62.926) -- 0:07:27
524000 -- [-57.178] (-60.113) (-59.651) (-57.047) * [-56.865] (-59.339) (-59.751) (-62.444) -- 0:07:26
525000 -- [-57.826] (-57.163) (-57.400) (-59.459) * [-58.872] (-59.703) (-58.223) (-57.439) -- 0:07:26
Average standard deviation of split frequencies: NA (no splits above min. frequency)
526000 -- [-58.598] (-58.268) (-61.169) (-57.307) * [-57.160] (-58.959) (-57.157) (-59.485) -- 0:07:25
527000 -- [-56.743] (-61.463) (-58.167) (-57.614) * [-57.521] (-57.050) (-62.596) (-59.645) -- 0:07:24
528000 -- [-59.459] (-59.739) (-56.432) (-57.981) * [-56.104] (-59.083) (-58.769) (-57.878) -- 0:07:22
529000 -- [-58.249] (-58.957) (-56.894) (-58.693) * [-57.657] (-58.325) (-56.967) (-60.576) -- 0:07:21
530000 -- [-59.366] (-57.467) (-57.425) (-58.169) * [-59.732] (-57.834) (-56.505) (-60.071) -- 0:07:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
531000 -- [-58.644] (-58.043) (-59.407) (-59.235) * [-64.399] (-58.039) (-58.355) (-61.374) -- 0:07:19
532000 -- [-57.574] (-57.275) (-57.368) (-56.820) * [-58.422] (-58.869) (-59.022) (-58.602) -- 0:07:18
533000 -- [-56.560] (-56.913) (-57.382) (-59.127) * [-57.415] (-58.889) (-59.233) (-58.906) -- 0:07:18
534000 -- [-57.484] (-57.866) (-57.257) (-59.847) * [-56.370] (-57.353) (-58.795) (-57.021) -- 0:07:17
535000 -- [-58.201] (-60.332) (-57.610) (-56.336) * [-56.238] (-58.189) (-61.088) (-58.157) -- 0:07:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
536000 -- [-58.374] (-58.423) (-58.248) (-57.362) * [-58.667] (-57.980) (-58.855) (-57.700) -- 0:07:15
537000 -- [-60.313] (-57.926) (-56.651) (-57.384) * [-61.888] (-57.895) (-59.935) (-59.487) -- 0:07:14
538000 -- [-58.499] (-60.642) (-59.803) (-59.294) * [-61.849] (-56.653) (-57.995) (-57.259) -- 0:07:13
539000 -- [-58.753] (-60.263) (-60.288) (-57.207) * [-60.290] (-63.254) (-58.922) (-56.698) -- 0:07:12
540000 -- [-62.495] (-57.864) (-61.108) (-58.639) * [-59.575] (-57.809) (-59.576) (-56.458) -- 0:07:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
541000 -- [-59.758] (-58.118) (-60.005) (-57.156) * [-58.004] (-61.275) (-56.530) (-56.913) -- 0:07:11
542000 -- [-58.101] (-57.624) (-60.288) (-58.603) * [-56.497] (-57.650) (-57.274) (-59.063) -- 0:07:10
543000 -- [-59.647] (-60.813) (-61.202) (-56.430) * [-58.130] (-58.004) (-58.817) (-57.973) -- 0:07:09
544000 -- [-58.070] (-60.407) (-58.458) (-57.959) * [-57.281] (-61.929) (-57.198) (-59.544) -- 0:07:08
545000 -- [-59.227] (-56.785) (-56.929) (-58.445) * [-57.415] (-56.655) (-56.957) (-62.187) -- 0:07:07
Average standard deviation of split frequencies: NA (no splits above min. frequency)
546000 -- [-58.029] (-57.874) (-61.179) (-57.770) * [-57.876] (-57.504) (-60.742) (-57.561) -- 0:07:06
547000 -- [-57.239] (-56.560) (-59.463) (-56.494) * [-58.242] (-57.609) (-56.488) (-58.543) -- 0:07:05
548000 -- [-62.920] (-60.612) (-62.619) (-58.346) * [-57.786] (-60.125) (-56.261) (-57.773) -- 0:07:03
549000 -- [-64.603] (-57.686) (-62.509) (-57.105) * [-57.667] (-56.928) (-56.439) (-58.976) -- 0:07:03
550000 -- [-60.112] (-58.473) (-59.122) (-59.142) * [-57.976] (-57.521) (-61.193) (-57.045) -- 0:07:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
551000 -- [-57.294] (-56.738) (-58.428) (-57.617) * [-57.710] (-57.898) (-60.446) (-57.433) -- 0:07:01
552000 -- [-57.846] (-58.260) (-58.920) (-59.707) * [-57.484] (-64.371) (-56.653) (-62.499) -- 0:07:00
553000 -- [-57.405] (-60.697) (-56.614) (-56.576) * [-56.964] (-59.341) (-57.102) (-58.392) -- 0:06:59
554000 -- [-61.034] (-58.996) (-58.785) (-57.947) * [-56.497] (-57.552) (-57.004) (-57.558) -- 0:06:58
555000 -- [-60.099] (-57.747) (-60.050) (-57.884) * [-57.715] (-56.919) (-56.280) (-60.402) -- 0:06:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
556000 -- [-58.124] (-56.367) (-57.937) (-60.163) * [-57.455] (-57.262) (-63.113) (-63.078) -- 0:06:56
557000 -- [-58.558] (-58.441) (-57.284) (-58.838) * [-57.316] (-57.338) (-60.123) (-57.707) -- 0:06:55
558000 -- [-57.713] (-57.901) (-60.140) (-56.849) * [-58.531] (-58.938) (-59.418) (-62.759) -- 0:06:55
559000 -- [-58.392] (-57.242) (-59.053) (-57.557) * [-57.228] (-61.482) (-57.182) (-57.992) -- 0:06:54
560000 -- [-56.885] (-57.855) (-58.585) (-57.912) * [-59.028] (-59.611) (-60.361) (-58.492) -- 0:06:53
Average standard deviation of split frequencies: NA (no splits above min. frequency)
561000 -- [-58.861] (-58.988) (-56.723) (-57.620) * [-57.013] (-59.399) (-57.826) (-57.769) -- 0:06:52
562000 -- [-58.517] (-57.312) (-62.126) (-57.361) * [-61.417] (-57.194) (-60.538) (-61.037) -- 0:06:51
563000 -- [-57.939] (-56.870) (-59.187) (-57.751) * [-59.046] (-59.674) (-60.555) (-60.266) -- 0:06:50
564000 -- [-62.488] (-60.174) (-58.641) (-58.050) * [-59.183] (-58.404) (-58.602) (-57.046) -- 0:06:48
565000 -- [-58.501] (-57.020) (-56.612) (-58.554) * [-61.836] (-57.666) (-57.036) (-58.459) -- 0:06:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
566000 -- [-57.809] (-57.856) (-58.416) (-62.117) * [-57.739] (-57.193) (-57.634) (-58.062) -- 0:06:47
567000 -- [-62.517] (-58.631) (-60.854) (-61.560) * [-57.557] (-57.703) (-57.628) (-59.708) -- 0:06:46
568000 -- [-63.122] (-57.812) (-57.473) (-63.483) * [-59.396] (-59.424) (-58.203) (-58.162) -- 0:06:45
569000 -- [-58.124] (-63.583) (-56.879) (-61.194) * [-57.659] (-59.036) (-56.985) (-56.482) -- 0:06:44
570000 -- [-57.114] (-58.318) (-58.284) (-59.365) * [-56.750] (-56.869) (-57.916) (-56.695) -- 0:06:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
571000 -- [-57.366] (-59.105) (-57.889) (-59.350) * [-57.048] (-57.926) (-57.806) (-58.315) -- 0:06:42
572000 -- [-58.646] (-57.551) (-58.294) (-58.011) * [-56.586] (-58.680) (-57.716) (-56.934) -- 0:06:41
573000 -- [-56.137] (-61.820) (-58.494) (-58.667) * [-56.974] (-57.625) (-57.556) (-58.023) -- 0:06:40
574000 -- [-57.897] (-58.515) (-59.237) (-63.607) * [-57.975] (-58.019) (-57.770) (-57.037) -- 0:06:40
575000 -- [-56.880] (-67.155) (-59.790) (-58.021) * [-57.599] (-56.874) (-58.982) (-57.217) -- 0:06:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
576000 -- [-58.121] (-56.962) (-60.832) (-59.376) * [-58.354] (-56.662) (-63.297) (-58.898) -- 0:06:38
577000 -- [-58.322] (-56.535) (-57.707) (-58.062) * [-58.083] (-56.844) (-61.841) (-57.586) -- 0:06:37
578000 -- [-56.868] (-60.532) (-59.722) (-60.038) * [-61.551] (-58.834) (-58.976) (-61.862) -- 0:06:36
579000 -- [-59.134] (-59.796) (-57.038) (-59.427) * [-58.940] (-57.695) (-59.016) (-59.040) -- 0:06:35
580000 -- [-57.069] (-57.445) (-57.730) (-61.091) * [-58.262] (-57.925) (-57.368) (-57.299) -- 0:06:34
Average standard deviation of split frequencies: NA (no splits above min. frequency)
581000 -- [-57.448] (-57.281) (-57.516) (-60.771) * [-59.981] (-57.652) (-56.704) (-56.812) -- 0:06:33
582000 -- [-56.014] (-57.867) (-59.623) (-58.033) * [-61.999] (-58.723) (-59.616) (-58.058) -- 0:06:32
583000 -- [-56.861] (-60.334) (-57.408) (-58.357) * [-57.442] (-57.760) (-57.139) (-57.507) -- 0:06:31
584000 -- [-58.311] (-59.361) (-58.405) (-56.851) * [-61.486] (-59.551) (-56.660) (-63.486) -- 0:06:30
585000 -- [-57.257] (-56.524) (-56.642) (-58.135) * [-57.176] (-59.642) (-56.852) (-57.439) -- 0:06:29
Average standard deviation of split frequencies: NA (no splits above min. frequency)
586000 -- [-57.255] (-56.966) (-60.342) (-58.990) * [-59.059] (-59.032) (-58.353) (-57.643) -- 0:06:28
587000 -- [-59.292] (-56.848) (-57.060) (-57.473) * [-57.310] (-58.842) (-56.370) (-58.891) -- 0:06:27
588000 -- [-57.651] (-61.310) (-57.228) (-56.948) * [-58.990] (-60.425) (-56.624) (-60.667) -- 0:06:26
589000 -- [-56.369] (-59.375) (-60.434) (-56.562) * [-57.276] (-58.041) (-57.758) (-62.831) -- 0:06:25
590000 -- [-58.019] (-60.740) (-62.437) (-57.895) * [-57.117] (-59.511) (-58.414) (-59.610) -- 0:06:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
591000 -- [-59.860] (-60.822) (-57.374) (-58.452) * [-57.614] (-56.316) (-57.431) (-57.656) -- 0:06:24
592000 -- [-56.775] (-58.226) (-56.431) (-58.591) * [-59.172] (-57.509) (-57.987) (-60.324) -- 0:06:23
593000 -- [-57.702] (-57.879) (-57.223) (-58.994) * [-56.518] (-56.759) (-57.581) (-57.446) -- 0:06:22
594000 -- [-57.109] (-58.856) (-57.207) (-58.445) * [-57.405] (-57.652) (-59.734) (-57.442) -- 0:06:21
595000 -- [-56.417] (-58.672) (-57.493) (-59.749) * [-57.646] (-61.373) (-61.665) (-59.768) -- 0:06:20
Average standard deviation of split frequencies: NA (no splits above min. frequency)
596000 -- [-57.141] (-58.320) (-58.886) (-57.087) * [-57.952] (-60.240) (-58.589) (-57.574) -- 0:06:19
597000 -- [-58.755] (-57.842) (-59.023) (-56.735) * [-57.613] (-58.624) (-59.218) (-60.612) -- 0:06:18
598000 -- [-57.714] (-60.117) (-58.791) (-57.212) * [-57.147] (-56.743) (-57.879) (-56.606) -- 0:06:17
599000 -- [-57.773] (-56.521) (-58.453) (-57.051) * [-57.081] (-58.632) (-56.338) (-57.471) -- 0:06:16
600000 -- [-61.389] (-57.731) (-59.077) (-59.413) * [-57.851] (-57.714) (-60.835) (-59.336) -- 0:06:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
601000 -- [-57.198] (-59.138) (-57.417) (-57.913) * [-58.644] (-57.695) (-57.563) (-57.439) -- 0:06:15
602000 -- [-57.385] (-57.344) (-60.305) (-57.567) * [-60.727] (-56.276) (-58.396) (-58.741) -- 0:06:14
603000 -- [-57.883] (-58.474) (-58.680) (-59.179) * [-56.163] (-58.315) (-59.340) (-57.246) -- 0:06:13
604000 -- [-57.876] (-58.030) (-57.675) (-58.179) * [-56.353] (-58.182) (-60.215) (-57.222) -- 0:06:12
605000 -- [-59.558] (-58.589) (-56.207) (-56.244) * [-57.354] (-57.569) (-56.872) (-58.316) -- 0:06:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
606000 -- [-61.270] (-60.994) (-57.314) (-59.791) * [-56.870] (-59.718) (-58.225) (-59.937) -- 0:06:10
607000 -- [-58.539] (-57.032) (-62.823) (-57.561) * [-58.860] (-57.171) (-59.629) (-60.773) -- 0:06:09
608000 -- [-59.164] (-57.719) (-58.210) (-59.089) * [-58.006] (-57.235) (-57.492) (-60.729) -- 0:06:08
609000 -- [-57.216] (-57.429) (-56.768) (-58.441) * [-58.517] (-58.708) (-60.095) (-58.850) -- 0:06:07
610000 -- [-58.753] (-58.757) (-57.243) (-58.766) * [-56.294] (-57.724) (-60.632) (-58.261) -- 0:06:06
Average standard deviation of split frequencies: NA (no splits above min. frequency)
611000 -- [-58.748] (-62.007) (-57.267) (-58.857) * [-59.223] (-58.166) (-57.087) (-57.649) -- 0:06:05
612000 -- [-56.919] (-59.279) (-60.307) (-64.955) * [-60.250] (-56.931) (-57.076) (-58.372) -- 0:06:04
613000 -- [-59.566] (-60.860) (-58.601) (-60.150) * [-57.508] (-59.676) (-59.654) (-59.110) -- 0:06:03
614000 -- [-60.161] (-61.149) (-59.405) (-57.824) * [-57.487] (-57.393) (-56.561) (-57.199) -- 0:06:02
615000 -- [-59.004] (-57.815) (-59.547) (-61.821) * [-56.640] (-57.290) (-57.822) (-58.295) -- 0:06:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
616000 -- [-57.833] (-58.677) (-58.938) (-60.966) * [-57.357] (-60.766) (-59.018) (-56.567) -- 0:06:00
617000 -- [-59.816] (-59.300) (-57.574) (-59.175) * [-63.294] (-59.119) (-60.264) (-58.825) -- 0:06:00
618000 -- [-56.652] (-58.465) (-59.722) (-60.558) * [-57.795] (-56.319) (-57.499) (-56.673) -- 0:05:59
619000 -- [-58.914] (-61.682) (-58.311) (-61.292) * [-63.437] (-58.103) (-58.543) (-61.489) -- 0:05:58
620000 -- [-59.614] (-59.080) (-56.583) (-58.031) * [-57.281] (-61.194) (-58.478) (-58.694) -- 0:05:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
621000 -- [-59.036] (-58.728) (-57.483) (-59.623) * [-57.496] (-56.799) (-59.395) (-59.136) -- 0:05:56
622000 -- [-58.929] (-59.742) (-57.521) (-57.805) * [-56.836] (-58.194) (-60.845) (-57.466) -- 0:05:55
623000 -- [-60.702] (-59.429) (-58.264) (-57.920) * [-57.272] (-56.150) (-59.740) (-56.658) -- 0:05:54
624000 -- [-56.920] (-58.209) (-58.009) (-61.049) * [-58.608] (-58.125) (-59.655) (-56.711) -- 0:05:53
625000 -- [-58.288] (-57.933) (-59.211) (-58.484) * [-58.403] (-57.332) (-60.182) (-57.872) -- 0:05:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
626000 -- [-59.879] (-58.363) (-60.093) (-64.192) * [-58.477] (-58.162) (-58.064) (-59.990) -- 0:05:51
627000 -- [-60.473] (-57.232) (-57.041) (-59.234) * [-63.821] (-59.621) (-57.921) (-59.070) -- 0:05:50
628000 -- [-58.536] (-57.569) (-57.359) (-57.042) * [-58.694] (-61.294) (-60.384) (-60.770) -- 0:05:49
629000 -- [-58.159] (-57.504) (-57.857) (-59.273) * [-58.792] (-59.255) (-58.573) (-57.814) -- 0:05:48
630000 -- [-57.681] (-59.625) (-57.653) (-64.540) * [-56.347] (-60.162) (-58.113) (-56.940) -- 0:05:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
631000 -- [-58.305] (-58.066) (-59.175) (-57.706) * [-61.929] (-61.202) (-56.941) (-56.702) -- 0:05:46
632000 -- [-57.043] (-57.122) (-58.782) (-58.301) * [-61.139] (-57.463) (-58.428) (-57.554) -- 0:05:45
633000 -- [-57.410] (-59.561) (-58.146) (-59.116) * [-57.982] (-57.784) (-57.049) (-57.696) -- 0:05:44
634000 -- [-57.913] (-57.414) (-61.663) (-58.911) * [-58.631] (-57.865) (-58.010) (-57.986) -- 0:05:43
635000 -- [-57.532] (-57.947) (-57.477) (-58.263) * [-57.226] (-61.095) (-59.187) (-56.200) -- 0:05:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
636000 -- [-61.319] (-59.216) (-59.609) (-63.238) * [-59.092] (-58.366) (-59.916) (-57.604) -- 0:05:41
637000 -- [-57.426] (-57.999) (-58.129) (-57.746) * [-58.176] (-57.680) (-56.855) (-59.199) -- 0:05:40
638000 -- [-57.562] (-57.557) (-57.938) (-58.549) * [-58.442] (-61.565) (-61.840) (-59.344) -- 0:05:39
639000 -- [-56.491] (-58.549) (-58.899) (-57.955) * [-58.241] (-56.930) (-57.236) (-58.859) -- 0:05:38
640000 -- [-58.274] (-59.800) (-57.896) (-56.521) * [-56.564] (-57.800) (-56.506) (-59.808) -- 0:05:38
Average standard deviation of split frequencies: NA (no splits above min. frequency)
641000 -- [-58.972] (-56.815) (-57.128) (-60.186) * [-56.593] (-58.810) (-58.268) (-57.356) -- 0:05:37
642000 -- [-59.685] (-56.752) (-60.721) (-57.866) * [-58.753] (-57.745) (-58.019) (-57.645) -- 0:05:36
643000 -- [-59.150] (-58.716) (-64.554) (-57.285) * [-58.934] (-60.765) (-59.664) (-56.821) -- 0:05:35
644000 -- [-60.353] (-56.391) (-56.482) (-56.363) * [-62.603] (-59.389) (-59.303) (-57.828) -- 0:05:34
645000 -- [-57.425] (-57.756) (-57.697) (-58.381) * [-56.239] (-59.415) (-58.464) (-57.425) -- 0:05:33
Average standard deviation of split frequencies: NA (no splits above min. frequency)
646000 -- [-58.552] (-60.598) (-59.016) (-62.867) * [-57.580] (-58.527) (-58.646) (-58.342) -- 0:05:32
647000 -- [-59.386] (-57.178) (-57.070) (-58.989) * [-58.840] (-57.432) (-59.312) (-59.188) -- 0:05:31
648000 -- [-58.580] (-58.032) (-59.405) (-57.326) * [-59.549] (-65.945) (-61.282) (-56.483) -- 0:05:30
649000 -- [-61.199] (-58.164) (-57.204) (-58.197) * [-58.432] (-59.396) (-58.905) (-57.186) -- 0:05:29
650000 -- [-58.422] (-60.910) (-57.628) (-57.747) * [-57.759] (-59.479) (-56.753) (-57.825) -- 0:05:29
Average standard deviation of split frequencies: NA (no splits above min. frequency)
651000 -- [-60.262] (-58.371) (-59.376) (-59.227) * [-60.838] (-62.835) (-57.230) (-57.887) -- 0:05:28
652000 -- [-57.798] (-58.318) (-58.085) (-58.257) * [-56.557] (-57.943) (-58.506) (-59.251) -- 0:05:27
653000 -- [-56.696] (-59.875) (-61.524) (-60.649) * [-57.891] (-57.105) (-56.645) (-59.544) -- 0:05:26
654000 -- [-57.863] (-57.030) (-57.761) (-56.571) * [-57.172] (-60.618) (-57.991) (-58.826) -- 0:05:25
655000 -- [-57.943] (-56.432) (-56.901) (-60.638) * [-56.431] (-56.884) (-56.522) (-57.112) -- 0:05:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
656000 -- [-61.218] (-58.692) (-56.939) (-57.022) * [-56.847] (-58.584) (-60.019) (-59.987) -- 0:05:23
657000 -- [-58.211] (-57.708) (-57.043) (-63.805) * [-56.949] (-58.656) (-59.156) (-58.007) -- 0:05:22
658000 -- [-57.378] (-57.910) (-56.466) (-56.949) * [-60.558] (-58.479) (-63.106) (-60.966) -- 0:05:21
659000 -- [-58.229] (-57.103) (-58.664) (-57.414) * [-57.523] (-57.183) (-58.022) (-56.751) -- 0:05:20
660000 -- [-62.690] (-56.385) (-59.228) (-58.838) * [-59.499] (-57.958) (-57.466) (-56.979) -- 0:05:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
661000 -- [-57.320] (-56.633) (-57.211) (-59.975) * [-59.294] (-59.832) (-58.873) (-57.900) -- 0:05:18
662000 -- [-57.806] (-62.892) (-56.316) (-58.126) * [-56.550] (-63.566) (-56.747) (-60.476) -- 0:05:17
663000 -- [-57.700] (-59.429) (-60.317) (-60.463) * [-57.691] (-57.780) (-62.312) (-61.914) -- 0:05:16
664000 -- [-57.295] (-57.994) (-59.275) (-58.795) * [-58.121] (-57.854) (-57.220) (-58.194) -- 0:05:15
665000 -- [-57.414] (-58.119) (-58.505) (-56.728) * [-58.541] (-56.874) (-57.556) (-58.681) -- 0:05:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
666000 -- [-56.873] (-58.432) (-56.914) (-57.520) * [-58.780] (-57.833) (-57.264) (-57.789) -- 0:05:13
667000 -- [-60.110] (-57.582) (-58.455) (-58.292) * [-58.041] (-56.769) (-57.346) (-59.636) -- 0:05:13
668000 -- [-57.780] (-57.061) (-58.394) (-57.141) * [-58.229] (-61.346) (-60.648) (-56.834) -- 0:05:12
669000 -- [-58.357] (-59.263) (-58.356) (-58.982) * [-59.467] (-59.502) (-57.506) (-57.549) -- 0:05:11
670000 -- [-57.545] (-57.478) (-56.920) (-61.343) * [-57.802] (-57.657) (-57.953) (-57.194) -- 0:05:10
Average standard deviation of split frequencies: NA (no splits above min. frequency)
671000 -- [-59.277] (-56.828) (-57.365) (-57.622) * [-58.058] (-56.934) (-57.820) (-58.316) -- 0:05:09
672000 -- [-57.587] (-61.301) (-57.993) (-57.130) * [-56.984] (-57.775) (-56.800) (-58.304) -- 0:05:08
673000 -- [-57.359] (-56.285) (-60.511) (-57.390) * [-62.312] (-56.583) (-57.300) (-56.106) -- 0:05:07
674000 -- [-57.598] (-59.391) (-58.472) (-58.613) * [-56.812] (-56.839) (-56.922) (-57.506) -- 0:05:06
675000 -- [-60.399] (-61.255) (-59.162) (-58.136) * [-57.029] (-57.089) (-57.405) (-58.937) -- 0:05:05
Average standard deviation of split frequencies: NA (no splits above min. frequency)
676000 -- [-57.889] (-59.456) (-56.720) (-57.188) * [-57.681] (-61.282) (-57.953) (-56.894) -- 0:05:04
677000 -- [-59.913] (-56.456) (-57.232) (-59.006) * [-56.861] (-58.168) (-59.891) (-57.016) -- 0:05:03
678000 -- [-57.099] (-59.078) (-57.058) (-60.956) * [-56.636] (-57.134) (-60.750) (-57.691) -- 0:05:03
679000 -- [-57.635] (-56.419) (-58.990) (-59.198) * [-58.674] (-61.716) (-58.238) (-58.478) -- 0:05:02
680000 -- [-56.800] (-58.741) (-59.937) (-63.735) * [-57.934] (-58.179) (-57.832) (-56.417) -- 0:05:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
681000 -- [-58.500] (-57.636) (-58.494) (-60.336) * [-57.942] (-57.181) (-58.815) (-62.661) -- 0:04:59
682000 -- [-58.025] (-59.765) (-60.098) (-62.196) * [-58.912] (-57.298) (-57.261) (-56.928) -- 0:04:58
683000 -- [-57.294] (-58.917) (-62.088) (-57.274) * [-57.209] (-56.527) (-58.910) (-60.586) -- 0:04:57
684000 -- [-59.623] (-58.480) (-56.957) (-57.562) * [-60.775] (-59.249) (-57.483) (-56.688) -- 0:04:57
685000 -- [-58.278] (-57.248) (-58.869) (-61.053) * [-60.097] (-57.605) (-57.091) (-58.235) -- 0:04:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
686000 -- [-59.683] (-60.103) (-58.907) (-59.135) * [-57.110] (-56.428) (-57.532) (-58.654) -- 0:04:55
687000 -- [-57.382] (-57.317) (-59.229) (-59.332) * [-57.389] (-56.984) (-57.830) (-58.679) -- 0:04:54
688000 -- [-56.603] (-59.479) (-63.168) (-58.556) * [-58.485] (-59.777) (-59.398) (-59.509) -- 0:04:53
689000 -- [-57.317] (-61.656) (-56.948) (-57.091) * [-57.306] (-57.649) (-57.779) (-60.101) -- 0:04:52
690000 -- [-61.055] (-61.206) (-58.041) (-59.066) * [-61.941] (-57.516) (-57.972) (-57.732) -- 0:04:51
Average standard deviation of split frequencies: NA (no splits above min. frequency)
691000 -- [-57.244] (-58.911) (-58.903) (-56.768) * [-56.942] (-58.112) (-58.334) (-58.047) -- 0:04:50
692000 -- [-57.308] (-61.007) (-62.829) (-58.132) * [-58.531] (-59.620) (-64.998) (-56.934) -- 0:04:49
693000 -- [-57.946] (-61.134) (-57.733) (-60.549) * [-59.267] (-57.253) (-59.126) (-56.652) -- 0:04:48
694000 -- [-62.471] (-60.977) (-59.128) (-56.940) * [-57.097] (-60.170) (-57.724) (-56.353) -- 0:04:47
695000 -- [-58.058] (-57.548) (-59.592) (-56.746) * [-57.317] (-58.337) (-56.649) (-58.020) -- 0:04:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
696000 -- [-61.138] (-56.812) (-57.497) (-58.560) * [-57.733] (-59.531) (-57.950) (-57.418) -- 0:04:46
697000 -- [-58.630] (-61.001) (-57.840) (-57.658) * [-56.353] (-57.109) (-58.744) (-57.939) -- 0:04:45
698000 -- [-56.584] (-59.125) (-58.211) (-58.416) * [-56.498] (-60.202) (-57.113) (-59.520) -- 0:04:43
699000 -- [-56.374] (-56.912) (-59.676) (-60.779) * [-56.497] (-58.087) (-60.154) (-58.498) -- 0:04:42
700000 -- [-58.496] (-58.621) (-58.738) (-56.500) * [-58.473] (-58.594) (-57.256) (-61.342) -- 0:04:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
701000 -- [-62.124] (-56.994) (-61.721) (-57.650) * [-60.299] (-56.861) (-59.655) (-58.564) -- 0:04:41
702000 -- [-59.121] (-57.118) (-58.808) (-58.815) * [-58.378] (-56.206) (-60.151) (-60.239) -- 0:04:40
703000 -- [-57.000] (-60.816) (-61.305) (-59.537) * [-57.191] (-58.496) (-58.278) (-58.976) -- 0:04:39
704000 -- [-60.092] (-60.879) (-57.946) (-58.790) * [-59.391] (-56.532) (-57.490) (-56.588) -- 0:04:38
705000 -- [-61.968] (-58.476) (-63.026) (-59.954) * [-60.258] (-57.315) (-57.608) (-57.635) -- 0:04:37
Average standard deviation of split frequencies: NA (no splits above min. frequency)
706000 -- [-59.107] (-56.718) (-63.278) (-61.087) * [-60.749] (-59.971) (-58.560) (-57.148) -- 0:04:36
707000 -- [-59.443] (-57.864) (-61.037) (-57.879) * [-63.644] (-58.072) (-58.124) (-58.090) -- 0:04:35
708000 -- [-60.669] (-59.478) (-60.968) (-59.173) * [-59.500] (-57.721) (-60.290) (-57.281) -- 0:04:34
709000 -- [-57.863] (-56.305) (-59.952) (-61.347) * [-59.398] (-58.141) (-57.460) (-56.738) -- 0:04:33
710000 -- [-62.984] (-57.233) (-59.917) (-58.638) * [-58.931] (-56.356) (-57.409) (-58.816) -- 0:04:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
711000 -- [-56.496] (-57.146) (-57.140) (-61.085) * [-57.039] (-59.726) (-58.333) (-59.626) -- 0:04:31
712000 -- [-60.599] (-57.208) (-57.977) (-57.982) * [-59.029] (-60.135) (-60.136) (-59.013) -- 0:04:31
713000 -- [-58.106] (-57.607) (-58.258) (-62.890) * [-57.568] (-61.446) (-56.836) (-57.685) -- 0:04:29
714000 -- [-57.020] (-58.141) (-59.809) (-58.810) * [-59.192] (-59.719) (-56.148) (-58.365) -- 0:04:28
715000 -- [-56.872] (-60.480) (-57.139) (-57.465) * [-56.625] (-59.514) (-58.986) (-62.777) -- 0:04:27
Average standard deviation of split frequencies: NA (no splits above min. frequency)
716000 -- [-56.411] (-56.405) (-60.628) (-56.521) * [-57.246] (-60.212) (-58.453) (-57.331) -- 0:04:26
717000 -- [-60.259] (-57.203) (-57.864) (-57.908) * [-57.783] (-57.456) (-57.249) (-57.919) -- 0:04:26
718000 -- [-57.727] (-58.770) (-57.355) (-58.372) * [-57.841] (-60.495) (-57.042) (-62.367) -- 0:04:25
719000 -- [-56.721] (-60.122) (-59.851) (-56.688) * [-59.514] (-60.342) (-58.319) (-60.271) -- 0:04:24
720000 -- [-57.575] (-61.307) (-57.391) (-64.781) * [-60.665] (-59.226) (-57.097) (-57.310) -- 0:04:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
721000 -- [-61.384] (-59.254) (-59.107) (-57.178) * [-59.428] (-62.091) (-58.099) (-59.525) -- 0:04:22
722000 -- [-57.148] (-56.709) (-59.035) (-57.529) * [-58.875] (-58.339) (-59.097) (-60.383) -- 0:04:21
723000 -- [-57.629] (-59.067) (-57.698) (-59.968) * [-59.487] (-57.390) (-57.805) (-58.724) -- 0:04:20
724000 -- [-58.335] (-57.806) (-56.747) (-60.509) * [-56.947] (-57.641) (-57.262) (-56.618) -- 0:04:19
725000 -- [-56.505] (-56.276) (-61.576) (-59.278) * [-59.605] (-57.016) (-56.895) (-58.653) -- 0:04:18
Average standard deviation of split frequencies: NA (no splits above min. frequency)
726000 -- [-58.900] (-57.045) (-57.252) (-59.334) * [-60.328] (-56.874) (-57.145) (-60.306) -- 0:04:17
727000 -- [-59.880] (-56.708) (-57.557) (-57.845) * [-62.821] (-56.801) (-58.398) (-59.363) -- 0:04:16
728000 -- [-56.709] (-57.273) (-56.486) (-57.767) * [-56.193] (-59.809) (-59.404) (-61.120) -- 0:04:15
729000 -- [-62.272] (-56.980) (-57.739) (-57.194) * [-56.683] (-56.509) (-60.383) (-59.598) -- 0:04:15
730000 -- [-57.386] (-57.163) (-58.583) (-60.855) * [-59.521] (-56.771) (-57.275) (-58.905) -- 0:04:13
Average standard deviation of split frequencies: NA (no splits above min. frequency)
731000 -- [-62.919] (-57.017) (-59.822) (-57.360) * [-56.849] (-57.986) (-62.192) (-58.234) -- 0:04:12
732000 -- [-57.194] (-57.061) (-58.851) (-57.104) * [-57.711] (-60.939) (-59.406) (-57.188) -- 0:04:11
733000 -- [-58.255] (-57.541) (-58.543) (-57.455) * [-57.502] (-59.546) (-57.858) (-57.917) -- 0:04:10
734000 -- [-57.281] (-58.523) (-58.225) (-58.449) * [-58.728] (-60.535) (-57.448) (-57.495) -- 0:04:10
735000 -- [-58.635] (-62.276) (-56.390) (-58.420) * [-60.460] (-63.409) (-58.093) (-57.843) -- 0:04:09
Average standard deviation of split frequencies: NA (no splits above min. frequency)
736000 -- [-58.992] (-64.004) (-59.085) (-60.644) * [-60.215] (-59.641) (-56.757) (-56.360) -- 0:04:08
737000 -- [-62.263] (-58.064) (-59.247) (-61.164) * [-57.176] (-65.065) (-58.921) (-62.503) -- 0:04:07
738000 -- [-58.259] (-56.280) (-56.736) (-58.360) * [-57.141] (-56.872) (-58.670) (-56.821) -- 0:04:06
739000 -- [-56.850] (-57.622) (-59.189) (-59.674) * [-57.828] (-57.162) (-63.541) (-60.020) -- 0:04:05
740000 -- [-60.949] (-57.843) (-56.904) (-57.926) * [-62.984] (-56.934) (-57.152) (-57.030) -- 0:04:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
741000 -- [-58.634] (-57.909) (-56.391) (-58.636) * [-57.811] (-61.088) (-60.367) (-57.523) -- 0:04:03
742000 -- [-56.735] (-57.427) (-60.909) (-60.169) * [-58.157] (-56.970) (-59.613) (-60.063) -- 0:04:02
743000 -- [-59.531] (-58.850) (-57.761) (-59.059) * [-57.231] (-59.484) (-58.247) (-57.308) -- 0:04:01
744000 -- [-58.611] (-58.428) (-56.661) (-57.342) * [-56.973] (-60.534) (-58.059) (-56.082) -- 0:04:00
745000 -- [-60.898] (-57.264) (-58.396) (-61.692) * [-57.220] (-59.644) (-58.731) (-56.403) -- 0:03:59
Average standard deviation of split frequencies: NA (no splits above min. frequency)
746000 -- [-59.634] (-58.336) (-57.633) (-60.691) * [-58.591] (-57.431) (-57.857) (-59.009) -- 0:03:59
747000 -- [-57.839] (-57.598) (-59.544) (-57.752) * [-58.575] (-57.268) (-57.278) (-60.112) -- 0:03:58
748000 -- [-57.143] (-58.743) (-58.128) (-56.971) * [-56.838] (-57.809) (-58.901) (-63.596) -- 0:03:57
749000 -- [-58.964] (-59.949) (-58.689) (-57.491) * [-57.990] (-59.239) (-62.311) (-57.203) -- 0:03:56
750000 -- [-58.796] (-58.790) (-56.731) (-60.179) * [-57.344] (-57.845) (-60.241) (-56.670) -- 0:03:55
Average standard deviation of split frequencies: NA (no splits above min. frequency)
751000 -- [-59.322] (-60.036) (-57.532) (-56.767) * [-56.375] (-58.740) (-59.636) (-57.977) -- 0:03:54
752000 -- [-59.224] (-60.739) (-59.471) (-59.556) * [-59.802] (-59.179) (-58.247) (-60.030) -- 0:03:53
753000 -- [-59.596] (-59.252) (-56.731) (-58.063) * [-60.120] (-57.601) (-56.168) (-56.756) -- 0:03:52
754000 -- [-62.293] (-59.574) (-56.901) (-59.847) * [-57.745] (-57.038) (-58.495) (-56.951) -- 0:03:51
755000 -- [-56.885] (-56.494) (-57.451) (-62.104) * [-56.209] (-56.208) (-56.980) (-61.023) -- 0:03:50
Average standard deviation of split frequencies: NA (no splits above min. frequency)
756000 -- [-58.701] (-57.167) (-57.754) (-59.514) * [-57.400] (-57.771) (-61.280) (-61.419) -- 0:03:49
757000 -- [-60.563] (-60.453) (-56.615) (-58.203) * [-58.248] (-59.450) (-60.586) (-61.465) -- 0:03:48
758000 -- [-58.271] (-60.915) (-57.991) (-58.198) * [-58.841] (-57.036) (-57.569) (-59.554) -- 0:03:47
759000 -- [-59.421] (-65.088) (-58.349) (-56.479) * [-61.475] (-63.011) (-58.157) (-58.917) -- 0:03:46
760000 -- [-58.138] (-60.015) (-59.092) (-60.518) * [-58.119] (-68.116) (-56.548) (-63.879) -- 0:03:45
Average standard deviation of split frequencies: NA (no splits above min. frequency)
761000 -- [-58.103] (-61.477) (-57.940) (-60.227) * [-58.417] (-56.105) (-56.716) (-60.467) -- 0:03:44
762000 -- [-58.675] (-59.027) (-59.375) (-57.907) * [-58.686] (-57.244) (-58.614) (-58.993) -- 0:03:43
763000 -- [-58.199] (-57.000) (-56.726) (-57.738) * [-58.904] (-58.106) (-57.653) (-62.782) -- 0:03:43
764000 -- [-57.538] (-60.891) (-56.973) (-56.732) * [-57.619] (-60.081) (-62.395) (-59.795) -- 0:03:42
765000 -- [-57.353] (-58.570) (-61.682) (-59.156) * [-56.511] (-58.167) (-57.562) (-57.693) -- 0:03:41
Average standard deviation of split frequencies: NA (no splits above min. frequency)
766000 -- [-57.272] (-56.807) (-56.905) (-57.152) * [-60.810] (-59.436) (-57.550) (-58.678) -- 0:03:40
767000 -- [-57.158] (-56.750) (-58.174) (-58.042) * [-56.828] (-59.075) (-60.605) (-59.475) -- 0:03:39
768000 -- [-65.017] (-56.839) (-58.632) (-60.076) * [-59.303] (-57.593) (-59.606) (-60.163) -- 0:03:38
769000 -- [-57.978] (-56.523) (-56.751) (-58.379) * [-58.390] (-59.913) (-63.332) (-57.049) -- 0:03:37
770000 -- [-57.093] (-60.148) (-59.453) (-56.769) * [-60.137] (-59.408) (-59.680) (-56.436) -- 0:03:36
Average standard deviation of split frequencies: NA (no splits above min. frequency)
771000 -- [-56.989] (-57.503) (-58.141) (-57.693) * [-57.941] (-58.785) (-56.758) (-57.562) -- 0:03:35
772000 -- [-56.955] (-61.776) (-56.988) (-57.997) * [-56.909] (-59.055) (-56.824) (-56.997) -- 0:03:34
773000 -- [-57.496] (-57.307) (-58.100) (-57.194) * [-56.575] (-56.429) (-57.079) (-58.806) -- 0:03:33
774000 -- [-58.596] (-56.603) (-57.027) (-57.352) * [-57.082] (-62.244) (-59.362) (-64.618) -- 0:03:32
775000 -- [-59.018] (-57.898) (-60.045) (-56.756) * [-58.325] (-59.345) (-57.127) (-56.914) -- 0:03:31
Average standard deviation of split frequencies: NA (no splits above min. frequency)
776000 -- [-60.596] (-56.774) (-61.308) (-62.026) * [-58.654] (-59.072) (-58.276) (-58.390) -- 0:03:30
777000 -- [-58.192] (-58.557) (-58.478) (-58.864) * [-57.874] (-57.149) (-61.097) (-58.414) -- 0:03:29
778000 -- [-60.582] (-57.867) (-59.307) (-57.228) * [-57.034] (-61.496) (-60.372) (-56.822) -- 0:03:28
779000 -- [-59.297] (-57.367) (-58.872) (-58.191) * [-60.877] (-58.100) (-56.970) (-56.185) -- 0:03:27
780000 -- [-59.290] (-56.203) (-57.620) (-59.018) * [-57.820] (-58.143) (-62.324) (-59.848) -- 0:03:26
Average standard deviation of split frequencies: NA (no splits above min. frequency)
781000 -- [-57.612] (-57.155) (-57.443) (-58.304) * [-58.591] (-59.381) (-58.138) (-57.544) -- 0:03:25
782000 -- [-60.856] (-58.657) (-57.251) (-59.218) * [-57.786] (-57.039) (-58.033) (-56.725) -- 0:03:24
783000 -- [-59.150] (-60.672) (-58.685) (-58.924) * [-57.330] (-58.615) (-57.750) (-57.205) -- 0:03:23
784000 -- [-57.026] (-56.432) (-57.164) (-58.449) * [-57.779] (-57.304) (-61.426) (-57.070) -- 0:03:23
785000 -- [-56.955] (-58.903) (-58.190) (-58.142) * [-61.294] (-58.202) (-57.364) (-57.574) -- 0:03:22
Average standard deviation of split frequencies: NA (no splits above min. frequency)
786000 -- [-58.147] (-58.101) (-58.058) (-57.413) * [-60.569] (-58.262) (-60.489) (-61.831) -- 0:03:21
787000 -- [-57.332] (-60.285) (-59.421) (-62.652) * [-58.368] (-56.714) (-58.625) (-58.171) -- 0:03:20
788000 -- [-59.500] (-58.487) (-58.005) (-59.868) * [-57.475] (-60.025) (-56.863) (-58.389) -- 0:03:19
789000 -- [-59.934] (-58.410) (-58.960) (-57.729) * [-56.835] (-58.529) (-60.124) (-56.679) -- 0:03:18
790000 -- [-60.268] (-56.988) (-58.571) (-58.462) * [-59.905] (-58.092) (-57.093) (-56.329) -- 0:03:17
Average standard deviation of split frequencies: NA (no splits above min. frequency)
791000 -- [-58.047] (-58.392) (-58.014) (-60.238) * [-59.557] (-57.504) (-56.854) (-57.903) -- 0:03:16
792000 -- [-57.854] (-58.137) (-60.707) (-59.798) * [-57.093] (-57.257) (-56.938) (-59.295) -- 0:03:15
793000 -- [-58.531] (-57.458) (-57.184) (-58.391) * [-56.815] (-58.460) (-57.427) (-57.455) -- 0:03:14
794000 -- [-59.790] (-58.239) (-57.495) (-63.763) * [-58.427] (-57.707) (-60.625) (-61.401) -- 0:03:13
795000 -- [-58.076] (-59.664) (-57.340) (-62.007) * [-58.160] (-58.350) (-57.473) (-58.951) -- 0:03:12
Average standard deviation of split frequencies: NA (no splits above min. frequency)
796000 -- [-56.989] (-56.162) (-57.730) (-58.460) * [-59.052] (-60.976) (-58.376) (-56.626) -- 0:03:11
797000 -- [-56.937] (-57.992) (-60.003) (-59.013) * [-57.904] (-61.318) (-56.328) (-57.468) -- 0:03:10
798000 -- [-60.782] (-57.983) (-58.504) (-57.002) * [-58.540] (-56.592) (-57.176) (-58.155) -- 0:03:09
799000 -- [-60.392] (-57.778) (-59.899) (-58.103) * [-57.458] (-57.168) (-58.153) (-57.115) -- 0:03:08
800000 -- [-57.753] (-57.348) (-57.020) (-60.820) * [-59.526] (-57.103) (-56.670) (-64.235) -- 0:03:08
Average standard deviation of split frequencies: NA (no splits above min. frequency)
801000 -- [-58.628] (-57.732) (-56.931) (-58.292) * [-58.065] (-57.457) (-56.999) (-58.066) -- 0:03:07
802000 -- [-57.883] (-56.850) (-56.941) (-57.592) * [-58.722] (-58.873) (-59.171) (-59.175) -- 0:03:06
803000 -- [-60.888] (-56.611) (-56.910) (-61.055) * [-59.683] (-58.398) (-57.464) (-59.636) -- 0:03:05
804000 -- [-57.940] (-58.897) (-58.680) (-60.022) * [-56.732] (-57.856) (-56.838) (-58.513) -- 0:03:04
805000 -- [-60.193] (-58.744) (-56.785) (-59.912) * [-57.500] (-58.041) (-57.998) (-57.680) -- 0:03:03
Average standard deviation of split frequencies: NA (no splits above min. frequency)
806000 -- [-57.379] (-57.191) (-60.217) (-58.203) * [-62.261] (-57.549) (-57.628) (-59.746) -- 0:03:02
807000 -- [-57.137] (-58.658) (-60.101) (-62.265) * [-57.367] (-61.564) (-59.161) (-58.574) -- 0:03:01
808000 -- [-59.407] (-58.560) (-57.833) (-58.832) * [-57.157] (-57.070) (-56.578) (-58.728) -- 0:03:00
809000 -- [-57.736] (-64.159) (-60.659) (-56.743) * [-56.596] (-60.114) (-63.432) (-57.333) -- 0:02:59
810000 -- [-57.943] (-58.519) (-57.490) (-58.170) * [-57.050] (-58.943) (-59.247) (-57.176) -- 0:02:58
Average standard deviation of split frequencies: NA (no splits above min. frequency)
811000 -- [-57.317] (-59.079) (-56.469) (-63.500) * [-57.138] (-58.729) (-56.533) (-57.545) -- 0:02:57
812000 -- [-57.732] (-58.916) (-57.009) (-57.632) * [-56.790] (-59.161) (-58.529) (-60.355) -- 0:02:56
813000 -- [-57.544] (-56.509) (-62.945) (-58.058) * [-59.840] (-58.799) (-57.564) (-57.315) -- 0:02:55
814000 -- [-60.764] (-58.605) (-65.495) (-57.426) * [-57.774] (-58.853) (-58.792) (-57.290) -- 0:02:54
815000 -- [-57.963] (-57.974) (-62.734) (-57.275) * [-57.431] (-59.507) (-56.855) (-59.583) -- 0:02:53
Average standard deviation of split frequencies: NA (no splits above min. frequency)
816000 -- [-56.822] (-57.372) (-59.832) (-56.319) * [-60.547] (-58.219) (-58.028) (-57.116) -- 0:02:52
817000 -- [-60.621] (-60.045) (-57.158) (-56.800) * [-56.680] (-60.429) (-59.983) (-57.260) -- 0:02:52
818000 -- [-60.010] (-61.025) (-57.168) (-57.014) * [-58.012] (-59.704) (-60.963) (-58.918) -- 0:02:51
819000 -- [-57.189] (-56.751) (-57.338) (-57.894) * [-59.676] (-57.357) (-57.575) (-56.571) -- 0:02:50
820000 -- [-59.389] (-57.295) (-57.052) (-61.613) * [-57.172] (-58.117) (-57.718) (-57.163) -- 0:02:49
Average standard deviation of split frequencies: NA (no splits above min. frequency)
821000 -- [-58.274] (-59.986) (-57.798) (-59.703) * [-56.806] (-61.095) (-60.228) (-57.907) -- 0:02:48
822000 -- [-57.496] (-57.157) (-56.852) (-57.893) * [-60.343] (-58.780) (-58.450) (-59.708) -- 0:02:47
823000 -- [-58.138] (-58.058) (-56.081) (-57.081) * [-61.274] (-57.122) (-59.509) (-59.536) -- 0:02:46
824000 -- [-58.121] (-61.785) (-64.017) (-59.538) * [-56.363] (-61.705) (-57.322) (-57.117) -- 0:02:45
825000 -- [-56.934] (-57.153) (-58.348) (-57.497) * [-60.523] (-57.355) (-59.831) (-56.769) -- 0:02:44
Average standard deviation of split frequencies: NA (no splits above min. frequency)
826000 -- [-56.856] (-59.358) (-59.620) (-57.313) * [-56.436] (-59.083) (-56.835) (-56.555) -- 0:02:43
827000 -- [-58.640] (-56.299) (-58.871) (-61.801) * [-56.821] (-57.082) (-58.954) (-64.564) -- 0:02:42
828000 -- [-59.136] (-58.240) (-56.249) (-59.618) * [-57.515] (-56.696) (-58.439) (-57.859) -- 0:02:41
829000 -- [-60.885] (-59.004) (-57.861) (-59.572) * [-58.087] (-56.752) (-57.727) (-58.308) -- 0:02:40
830000 -- [-61.085] (-60.119) (-58.371) (-61.882) * [-57.761] (-57.085) (-57.921) (-60.483) -- 0:02:39
Average standard deviation of split frequencies: NA (no splits above min. frequency)
831000 -- [-60.570] (-58.520) (-58.150) (-58.554) * [-56.832] (-57.982) (-61.648) (-56.338) -- 0:02:38
832000 -- [-60.616] (-57.971) (-59.103) (-57.424) * [-56.677] (-57.930) (-59.020) (-60.305) -- 0:02:37
833000 -- [-60.935] (-59.211) (-58.705) (-58.772) * [-57.590] (-56.748) (-58.546) (-59.156) -- 0:02:36
834000 -- [-57.516] (-57.607) (-58.120) (-59.723) * [-59.042] (-57.591) (-58.342) (-56.651) -- 0:02:36
835000 -- [-57.753] (-58.690) (-59.433) (-59.827) * [-58.746] (-57.780) (-58.068) (-58.909) -- 0:02:35
Average standard deviation of split frequencies: NA (no splits above min. frequency)
836000 -- [-59.917] (-58.124) (-59.389) (-57.283) * [-57.291] (-57.836) (-57.848) (-58.647) -- 0:02:34
837000 -- [-59.133] (-62.318) (-59.785) (-62.511) * [-60.253] (-61.124) (-58.649) (-63.019) -- 0:02:33
838000 -- [-56.955] (-60.398) (-57.880) (-57.904) * [-56.842] (-57.868) (-57.037) (-59.804) -- 0:02:32
839000 -- [-57.756] (-60.752) (-59.079) (-65.337) * [-58.011] (-57.811) (-58.946) (-60.674) -- 0:02:31
840000 -- [-57.886] (-57.566) (-60.256) (-57.469) * [-61.164] (-56.992) (-61.240) (-63.589) -- 0:02:30
Average standard deviation of split frequencies: NA (no splits above min. frequency)
841000 -- [-57.280] (-58.723) (-57.780) (-61.714) * [-59.425] (-56.257) (-56.949) (-57.817) -- 0:02:29
842000 -- [-58.302] (-56.811) (-59.026) (-57.646) * [-58.243] (-59.527) (-63.528) (-57.448) -- 0:02:28
843000 -- [-57.034] (-57.116) (-59.280) (-58.773) * [-59.571] (-57.546) (-60.175) (-58.462) -- 0:02:27
844000 -- [-59.169] (-58.472) (-56.967) (-62.749) * [-57.343] (-58.232) (-57.176) (-57.866) -- 0:02:26
845000 -- [-58.183] (-57.382) (-58.050) (-56.613) * [-59.266] (-59.513) (-59.596) (-57.483) -- 0:02:25
Average standard deviation of split frequencies: NA (no splits above min. frequency)
846000 -- [-59.404] (-56.731) (-58.201) (-57.500) * [-58.612] (-58.561) (-60.421) (-59.295) -- 0:02:24
847000 -- [-61.440] (-60.287) (-60.101) (-60.337) * [-56.912] (-57.737) (-59.194) (-58.295) -- 0:02:23
848000 -- [-59.022] (-62.502) (-57.627) (-59.191) * [-57.062] (-57.265) (-56.671) (-57.495) -- 0:02:23
849000 -- [-62.769] (-61.601) (-57.765) (-57.806) * [-62.885] (-64.792) (-58.859) (-57.854) -- 0:02:22
850000 -- [-57.672] (-57.847) (-59.987) (-58.652) * [-58.153] (-59.598) (-58.848) (-58.845) -- 0:02:21
Average standard deviation of split frequencies: NA (no splits above min. frequency)
851000 -- [-57.954] (-57.894) (-57.582) (-57.040) * [-62.478] (-60.345) (-57.397) (-56.816) -- 0:02:20
852000 -- [-58.423] (-58.019) (-58.399) (-59.018) * [-58.143] (-59.899) (-58.017) (-60.358) -- 0:02:19
853000 -- [-64.275] (-58.050) (-63.077) (-58.185) * [-57.248] (-59.758) (-60.682) (-57.514) -- 0:02:18
854000 -- [-60.839] (-59.569) (-57.879) (-59.447) * [-59.669] (-56.820) (-58.778) (-58.092) -- 0:02:17
855000 -- [-56.165] (-59.296) (-62.958) (-58.458) * [-59.621] (-56.186) (-58.213) (-58.554) -- 0:02:16
Average standard deviation of split frequencies: NA (no splits above min. frequency)
856000 -- [-57.296] (-57.702) (-63.468) (-57.875) * [-60.124] (-59.779) (-57.658) (-59.376) -- 0:02:15
857000 -- [-57.011] (-59.666) (-57.475) (-56.994) * [-57.795] (-57.645) (-57.772) (-59.176) -- 0:02:14
858000 -- [-57.041] (-56.786) (-58.811) (-60.118) * [-56.573] (-59.588) (-60.917) (-56.837) -- 0:02:13
859000 -- [-59.364] (-63.126) (-59.347) (-59.390) * [-59.429] (-57.764) (-58.384) (-57.121) -- 0:02:12
860000 -- [-56.810] (-58.922) (-60.197) (-57.397) * [-59.666] (-60.636) (-59.028) (-57.758) -- 0:02:11
Average standard deviation of split frequencies: NA (no splits above min. frequency)
861000 -- [-59.880] (-57.829) (-56.853) (-58.084) * [-56.509] (-59.435) (-56.142) (-59.054) -- 0:02:10
862000 -- [-58.877] (-58.960) (-58.290) (-58.153) * [-56.738] (-61.144) (-57.704) (-57.162) -- 0:02:09
863000 -- [-57.495] (-58.217) (-62.981) (-59.265) * [-57.921] (-59.252) (-62.332) (-57.109) -- 0:02:08
864000 -- [-56.625] (-57.660) (-57.890) (-58.771) * [-59.119] (-61.171) (-57.259) (-59.187) -- 0:02:07
865000 -- [-56.850] (-60.122) (-59.589) (-57.408) * [-59.071] (-58.366) (-58.499) (-58.455) -- 0:02:07
Average standard deviation of split frequencies: NA (no splits above min. frequency)
866000 -- [-63.363] (-63.291) (-58.663) (-57.180) * [-58.599] (-59.417) (-59.719) (-56.287) -- 0:02:05
867000 -- [-60.164] (-57.215) (-58.407) (-57.243) * [-57.473] (-59.439) (-57.999) (-56.479) -- 0:02:05
868000 -- [-58.986] (-56.383) (-58.230) (-58.970) * [-58.084] (-57.626) (-60.642) (-57.505) -- 0:02:04
869000 -- [-56.464] (-60.281) (-61.513) (-60.260) * [-59.217] (-59.157) (-57.521) (-59.027) -- 0:02:03
870000 -- [-58.957] (-56.871) (-60.287) (-57.426) * [-58.134] (-58.885) (-59.871) (-57.239) -- 0:02:02
Average standard deviation of split frequencies: NA (no splits above min. frequency)
871000 -- [-58.510] (-59.843) (-56.636) (-57.058) * [-56.400] (-60.069) (-57.557) (-60.493) -- 0:02:01
872000 -- [-59.005] (-59.641) (-57.813) (-56.933) * [-57.465] (-60.034) (-57.293) (-59.152) -- 0:02:00
873000 -- [-60.911] (-58.855) (-56.330) (-56.444) * [-56.472] (-58.049) (-57.676) (-58.124) -- 0:01:59
874000 -- [-58.541] (-61.165) (-59.322) (-56.452) * [-60.934] (-56.322) (-59.676) (-59.342) -- 0:01:58
875000 -- [-59.169] (-58.760) (-58.653) (-57.907) * [-57.905] (-60.268) (-61.040) (-60.787) -- 0:01:57
Average standard deviation of split frequencies: NA (no splits above min. frequency)
876000 -- [-58.966] (-57.856) (-56.856) (-58.989) * [-56.559] (-61.163) (-60.293) (-58.836) -- 0:01:56
877000 -- [-57.105] (-67.499) (-58.869) (-59.082) * [-58.930] (-57.527) (-58.592) (-57.785) -- 0:01:55
878000 -- [-57.015] (-58.162) (-57.277) (-59.181) * [-57.291] (-61.450) (-56.515) (-56.929) -- 0:01:54
879000 -- [-58.314] (-59.466) (-58.615) (-61.475) * [-58.732] (-59.619) (-59.408) (-58.338) -- 0:01:53
880000 -- [-57.826] (-57.772) (-56.470) (-56.393) * [-56.332] (-58.694) (-59.912) (-60.845) -- 0:01:52
Average standard deviation of split frequencies: NA (no splits above min. frequency)
881000 -- [-61.288] (-59.288) (-58.736) (-59.254) * [-56.597] (-59.383) (-59.366) (-57.716) -- 0:01:51
882000 -- [-57.625] (-56.483) (-57.677) (-56.359) * [-57.138] (-57.897) (-62.989) (-57.774) -- 0:01:51
883000 -- [-57.509] (-58.011) (-58.029) (-57.670) * [-57.584] (-60.956) (-58.839) (-58.061) -- 0:01:49
884000 -- [-57.487] (-58.350) (-56.973) (-57.423) * [-59.636] (-59.686) (-59.134) (-57.807) -- 0:01:49
885000 -- [-61.011] (-58.751) (-58.173) (-56.468) * [-61.277] (-56.928) (-57.505) (-57.722) -- 0:01:48
Average standard deviation of split frequencies: NA (no splits above min. frequency)
886000 -- [-56.458] (-56.762) (-61.747) (-57.426) * [-57.015] (-57.129) (-60.478) (-58.236) -- 0:01:47
887000 -- [-58.446] (-57.264) (-57.685) (-57.838) * [-63.244] (-58.813) (-58.404) (-57.383) -- 0:01:46
888000 -- [-60.086] (-60.725) (-58.756) (-56.721) * [-57.177] (-59.409) (-56.329) (-62.516) -- 0:01:45
889000 -- [-57.276] (-57.704) (-58.890) (-56.629) * [-59.288] (-57.259) (-57.541) (-56.880) -- 0:01:44
890000 -- [-56.173] (-58.337) (-57.009) (-61.074) * [-57.263] (-58.236) (-57.488) (-59.031) -- 0:01:43
Average standard deviation of split frequencies: NA (no splits above min. frequency)
891000 -- [-60.258] (-58.570) (-59.614) (-58.845) * [-60.484] (-60.644) (-59.415) (-58.299) -- 0:01:42
892000 -- [-64.526] (-60.182) (-59.028) (-57.811) * [-56.989] (-56.837) (-58.305) (-58.776) -- 0:01:41
893000 -- [-60.447] (-57.617) (-59.842) (-58.752) * [-59.267] (-58.982) (-59.266) (-58.120) -- 0:01:40
894000 -- [-57.296] (-58.396) (-58.948) (-56.772) * [-57.026] (-58.314) (-59.186) (-57.029) -- 0:01:39
895000 -- [-57.157] (-60.019) (-61.085) (-59.362) * [-57.907] (-59.533) (-58.033) (-57.763) -- 0:01:38
Average standard deviation of split frequencies: NA (no splits above min. frequency)
896000 -- [-58.531] (-57.093) (-57.994) (-61.971) * [-57.761] (-57.475) (-56.248) (-57.939) -- 0:01:37
897000 -- [-60.350] (-58.056) (-56.581) (-62.830) * [-57.419] (-59.573) (-58.296) (-57.275) -- 0:01:36
898000 -- [-58.437] (-59.157) (-56.212) (-65.112) * [-57.083] (-56.612) (-57.930) (-57.353) -- 0:01:35
899000 -- [-58.087] (-56.964) (-58.956) (-57.235) * [-59.403] (-56.876) (-58.077) (-57.126) -- 0:01:35
900000 -- [-57.403] (-56.949) (-57.381) (-60.460) * [-57.896] (-58.666) (-57.505) (-58.384) -- 0:01:34
Average standard deviation of split frequencies: NA (no splits above min. frequency)
901000 -- [-59.046] (-58.218) (-57.510) (-61.500) * [-57.563] (-57.956) (-58.418) (-59.628) -- 0:01:33
902000 -- [-58.646] (-57.538) (-57.475) (-58.568) * [-60.303] (-57.585) (-59.759) (-56.869) -- 0:01:32
903000 -- [-58.676] (-57.002) (-57.897) (-57.823) * [-56.911] (-58.478) (-58.409) (-57.098) -- 0:01:31
904000 -- [-57.052] (-59.956) (-61.380) (-57.101) * [-57.566] (-58.014) (-58.898) (-58.281) -- 0:01:30
905000 -- [-60.227] (-60.717) (-57.139) (-61.875) * [-58.162] (-59.012) (-60.637) (-60.042) -- 0:01:29
Average standard deviation of split frequencies: NA (no splits above min. frequency)
906000 -- [-56.992] (-57.640) (-60.512) (-56.324) * [-57.221] (-58.241) (-57.030) (-57.101) -- 0:01:28
907000 -- [-56.212] (-58.748) (-59.517) (-58.915) * [-57.204] (-56.801) (-63.071) (-57.052) -- 0:01:27
908000 -- [-58.735] (-57.281) (-61.051) (-59.389) * [-60.548] (-56.846) (-61.394) (-56.598) -- 0:01:26
909000 -- [-58.497] (-59.206) (-56.793) (-57.493) * [-58.257] (-62.684) (-57.167) (-59.826) -- 0:01:25
910000 -- [-61.559] (-57.518) (-57.949) (-61.400) * [-58.442] (-58.078) (-57.054) (-59.500) -- 0:01:24
Average standard deviation of split frequencies: NA (no splits above min. frequency)
911000 -- [-56.648] (-56.964) (-56.797) (-59.854) * [-61.448] (-58.881) (-56.649) (-56.786) -- 0:01:23
912000 -- [-60.397] (-56.542) (-58.652) (-57.984) * [-61.059] (-57.926) (-56.028) (-64.123) -- 0:01:22
913000 -- [-56.993] (-58.007) (-57.125) (-59.601) * [-61.630] (-57.107) (-58.454) (-57.894) -- 0:01:21
914000 -- [-57.645] (-56.716) (-58.506) (-59.017) * [-58.741] (-57.178) (-58.877) (-61.293) -- 0:01:20
915000 -- [-58.977] (-56.191) (-59.259) (-57.777) * [-60.965] (-57.869) (-58.543) (-60.865) -- 0:01:19
Average standard deviation of split frequencies: NA (no splits above min. frequency)
916000 -- [-57.849] (-58.339) (-57.947) (-57.302) * [-56.966] (-60.268) (-56.446) (-58.837) -- 0:01:19
917000 -- [-57.476] (-58.364) (-57.423) (-60.977) * [-56.837] (-56.746) (-57.531) (-63.069) -- 0:01:18
918000 -- [-57.877] (-60.214) (-57.454) (-57.975) * [-57.167] (-57.969) (-57.376) (-58.364) -- 0:01:17
919000 -- [-61.596] (-59.075) (-59.999) (-57.530) * [-57.238] (-58.457) (-58.123) (-57.416) -- 0:01:16
920000 -- [-57.380] (-59.309) (-58.036) (-59.408) * [-56.607] (-57.832) (-57.522) (-57.481) -- 0:01:15
Average standard deviation of split frequencies: NA (no splits above min. frequency)
921000 -- [-57.337] (-57.414) (-57.481) (-58.317) * [-59.958] (-57.003) (-57.857) (-56.907) -- 0:01:14
922000 -- [-59.726] (-58.537) (-57.530) (-59.477) * [-60.279] (-58.409) (-59.122) (-63.566) -- 0:01:13
923000 -- [-56.880] (-58.090) (-60.148) (-62.695) * [-60.425] (-59.987) (-58.080) (-56.811) -- 0:01:12
924000 -- [-58.805] (-57.190) (-58.408) (-61.488) * [-56.997] (-57.190) (-56.117) (-58.112) -- 0:01:11
925000 -- [-61.862] (-57.027) (-58.004) (-60.746) * [-57.674] (-62.390) (-61.211) (-60.310) -- 0:01:10
Average standard deviation of split frequencies: NA (no splits above min. frequency)
926000 -- [-57.556] (-58.756) (-58.655) (-61.127) * [-57.472] (-57.016) (-59.352) (-59.614) -- 0:01:09
927000 -- [-58.642] (-57.008) (-62.694) (-60.198) * [-58.452] (-57.355) (-59.391) (-57.922) -- 0:01:08
928000 -- [-57.645] (-61.325) (-58.800) (-56.319) * [-59.403] (-56.688) (-61.373) (-58.214) -- 0:01:07
929000 -- [-57.955] (-57.454) (-58.153) (-57.560) * [-61.289] (-60.031) (-57.169) (-60.568) -- 0:01:06
930000 -- [-57.513] (-58.124) (-57.242) (-56.790) * [-58.231] (-58.196) (-57.956) (-59.128) -- 0:01:05
Average standard deviation of split frequencies: NA (no splits above min. frequency)
931000 -- [-58.327] (-57.532) (-57.618) (-57.962) * [-57.918] (-57.886) (-56.352) (-59.046) -- 0:01:04
932000 -- [-57.413] (-56.739) (-57.989) (-59.968) * [-57.488] (-59.597) (-57.511) (-57.472) -- 0:01:03
933000 -- [-59.905] (-56.687) (-58.391) (-58.969) * [-57.994] (-59.199) (-56.084) (-57.161) -- 0:01:03
934000 -- [-60.776] (-57.104) (-60.147) (-60.231) * [-58.896] (-58.661) (-59.516) (-56.592) -- 0:01:02
935000 -- [-58.054] (-58.462) (-57.307) (-58.302) * [-59.595] (-59.495) (-59.801) (-56.736) -- 0:01:01
Average standard deviation of split frequencies: NA (no splits above min. frequency)
936000 -- [-60.402] (-61.724) (-59.660) (-59.105) * [-57.124] (-61.488) (-57.501) (-56.645) -- 0:01:00
937000 -- [-61.036] (-57.132) (-57.457) (-58.236) * [-57.258] (-57.383) (-57.606) (-57.161) -- 0:00:59
938000 -- [-56.644] (-59.782) (-57.870) (-57.359) * [-58.172] (-57.637) (-60.121) (-61.222) -- 0:00:58
939000 -- [-56.746] (-59.280) (-57.578) (-59.041) * [-57.421] (-58.322) (-57.665) (-57.726) -- 0:00:57
940000 -- [-59.911] (-57.782) (-63.022) (-56.978) * [-56.270] (-57.105) (-57.203) (-58.946) -- 0:00:56
Average standard deviation of split frequencies: NA (no splits above min. frequency)
941000 -- [-59.148] (-56.833) (-62.006) (-56.601) * [-57.256] (-56.608) (-56.712) (-57.953) -- 0:00:55
942000 -- [-58.116] (-59.443) (-59.270) (-56.870) * [-59.638] (-59.947) (-56.239) (-59.815) -- 0:00:54
943000 -- [-60.313] (-58.091) (-57.379) (-58.302) * [-58.239] (-60.599) (-59.090) (-58.574) -- 0:00:53
944000 -- [-60.914] (-57.566) (-56.983) (-57.131) * [-57.304] (-60.615) (-59.233) (-63.506) -- 0:00:52
945000 -- [-58.571] (-59.283) (-59.344) (-57.470) * [-59.176] (-58.162) (-59.223) (-59.587) -- 0:00:51
Average standard deviation of split frequencies: NA (no splits above min. frequency)
946000 -- [-57.300] (-57.548) (-57.808) (-57.823) * [-58.069] (-57.682) (-58.547) (-59.061) -- 0:00:50
947000 -- [-58.759] (-63.023) (-57.116) (-59.031) * [-58.181] (-60.478) (-57.090) (-56.595) -- 0:00:49
948000 -- [-58.784] (-57.257) (-57.641) (-57.786) * [-59.777] (-62.381) (-61.766) (-57.200) -- 0:00:48
949000 -- [-57.943] (-62.301) (-56.674) (-62.472) * [-58.215] (-57.876) (-59.189) (-57.321) -- 0:00:47
950000 -- [-58.691] (-61.217) (-56.654) (-57.384) * [-58.180] (-60.700) (-58.671) (-57.758) -- 0:00:47
Average standard deviation of split frequencies: NA (no splits above min. frequency)
951000 -- [-59.400] (-58.823) (-58.661) (-57.936) * [-57.340] (-57.841) (-62.095) (-57.218) -- 0:00:46
952000 -- [-60.248] (-60.413) (-58.083) (-56.990) * [-57.840] (-60.775) (-58.124) (-60.116) -- 0:00:45
953000 -- [-57.735] (-62.986) (-58.198) (-60.475) * [-58.322] (-57.259) (-58.511) (-59.865) -- 0:00:44
954000 -- [-56.718] (-63.024) (-57.472) (-57.837) * [-57.009] (-57.951) (-58.862) (-58.503) -- 0:00:43
955000 -- [-58.069] (-58.133) (-58.580) (-59.110) * [-60.076] (-57.415) (-58.926) (-61.325) -- 0:00:42
Average standard deviation of split frequencies: NA (no splits above min. frequency)
956000 -- [-57.076] (-56.474) (-56.806) (-59.423) * [-59.599] (-59.119) (-58.624) (-58.213) -- 0:00:41
957000 -- [-57.571] (-63.148) (-62.994) (-63.948) * [-57.263] (-60.612) (-57.786) (-58.953) -- 0:00:40
958000 -- [-58.953] (-56.673) (-60.684) (-58.100) * [-57.185] (-59.345) (-58.883) (-58.258) -- 0:00:39
959000 -- [-57.159] (-58.358) (-57.173) (-58.352) * [-59.497] (-59.072) (-56.964) (-59.036) -- 0:00:38
960000 -- [-61.588] (-59.601) (-57.412) (-58.904) * [-60.202] (-58.163) (-58.261) (-57.472) -- 0:00:37
Average standard deviation of split frequencies: NA (no splits above min. frequency)
961000 -- [-57.788] (-57.771) (-59.990) (-60.485) * [-59.123] (-56.804) (-56.529) (-56.520) -- 0:00:36
962000 -- [-58.448] (-57.686) (-59.534) (-57.966) * [-56.654] (-57.422) (-58.645) (-60.917) -- 0:00:35
963000 -- [-57.572] (-58.708) (-57.279) (-57.298) * [-57.471] (-60.881) (-58.668) (-57.978) -- 0:00:34
964000 -- [-57.077] (-56.919) (-60.053) (-59.121) * [-58.151] (-58.878) (-56.149) (-57.377) -- 0:00:33
965000 -- [-58.596] (-56.159) (-58.197) (-59.560) * [-56.490] (-57.491) (-56.946) (-59.172) -- 0:00:32
Average standard deviation of split frequencies: NA (no splits above min. frequency)
966000 -- [-57.945] (-60.428) (-58.055) (-58.164) * [-57.211] (-57.910) (-57.057) (-57.952) -- 0:00:31
967000 -- [-56.895] (-57.063) (-56.308) (-58.428) * [-57.000] (-59.071) (-58.005) (-58.147) -- 0:00:31
968000 -- [-56.852] (-56.393) (-57.741) (-62.161) * [-59.923] (-59.913) (-60.727) (-59.899) -- 0:00:30
969000 -- [-57.119] (-56.985) (-57.118) (-57.927) * [-57.196] (-57.699) (-58.848) (-63.088) -- 0:00:29
970000 -- [-58.263] (-59.165) (-57.106) (-58.834) * [-56.732] (-57.561) (-57.937) (-64.233) -- 0:00:28
Average standard deviation of split frequencies: NA (no splits above min. frequency)
971000 -- [-56.955] (-57.415) (-59.419) (-58.627) * [-56.534] (-59.270) (-58.193) (-64.784) -- 0:00:27
972000 -- [-58.112] (-57.743) (-60.535) (-57.853) * [-58.688] (-60.737) (-57.689) (-60.361) -- 0:00:26
973000 -- [-56.690] (-57.154) (-59.137) (-58.906) * [-60.059] (-58.196) (-57.563) (-59.561) -- 0:00:25
974000 -- [-58.620] (-58.744) (-56.532) (-58.863) * [-57.666] (-57.295) (-58.153) (-57.174) -- 0:00:24
975000 -- [-58.218] (-59.187) (-58.652) (-57.625) * [-58.885] (-58.216) (-58.017) (-57.576) -- 0:00:23
Average standard deviation of split frequencies: NA (no splits above min. frequency)
976000 -- [-59.107] (-57.488) (-56.931) (-59.068) * [-57.580] (-61.526) (-60.568) (-60.622) -- 0:00:22
977000 -- [-60.533] (-58.559) (-59.831) (-57.117) * [-59.125] (-61.392) (-57.753) (-60.761) -- 0:00:21
978000 -- [-59.246] (-59.546) (-59.632) (-57.427) * [-57.168] (-59.163) (-56.431) (-58.457) -- 0:00:20
979000 -- [-57.916] (-58.328) (-56.733) (-59.348) * [-61.292] (-60.081) (-57.365) (-58.287) -- 0:00:19
980000 -- [-57.023] (-56.557) (-59.087) (-57.273) * [-57.969] (-57.188) (-58.977) (-59.982) -- 0:00:18
Average standard deviation of split frequencies: NA (no splits above min. frequency)
981000 -- [-60.185] (-57.618) (-62.165) (-57.843) * [-56.913] (-60.458) (-61.317) (-59.525) -- 0:00:17
982000 -- [-57.052] (-57.807) (-59.364) (-57.322) * [-63.216] (-57.829) (-56.833) (-60.941) -- 0:00:16
983000 -- [-59.174] (-57.558) (-57.405) (-57.812) * [-59.520] (-62.104) (-57.263) (-58.932) -- 0:00:15
984000 -- [-60.464] (-58.051) (-57.070) (-59.420) * [-56.646] (-59.640) (-56.976) (-57.966) -- 0:00:15
985000 -- [-62.124] (-57.196) (-59.058) (-57.218) * [-56.809] (-59.345) (-56.464) (-57.340) -- 0:00:14
Average standard deviation of split frequencies: NA (no splits above min. frequency)
986000 -- [-56.402] (-59.078) (-57.498) (-59.102) * [-58.268] (-58.198) (-57.123) (-57.926) -- 0:00:13
987000 -- [-58.069] (-60.714) (-61.732) (-58.610) * [-58.386] (-58.331) (-61.091) (-59.062) -- 0:00:12
988000 -- [-59.237] (-58.326) (-57.382) (-58.095) * [-61.456] (-57.104) (-56.800) (-57.604) -- 0:00:11
989000 -- [-59.388] (-57.591) (-56.471) (-56.954) * [-60.667] (-59.358) (-57.688) (-57.548) -- 0:00:10
990000 -- [-58.645] (-59.311) (-63.926) (-57.413) * [-58.124] (-57.989) (-61.565) (-60.990) -- 0:00:09
Average standard deviation of split frequencies: NA (no splits above min. frequency)
991000 -- [-57.665] (-57.368) (-57.151) (-61.713) * [-61.441] (-58.000) (-60.031) (-59.386) -- 0:00:08
992000 -- [-57.201] (-61.038) (-59.397) (-57.753) * [-58.311] (-59.596) (-59.085) (-58.232) -- 0:00:07
993000 -- [-56.233] (-58.772) (-59.716) (-59.646) * [-56.452] (-59.103) (-58.587) (-57.349) -- 0:00:06
994000 -- [-57.736] (-57.570) (-61.498) (-58.363) * [-58.077] (-62.994) (-57.822) (-60.755) -- 0:00:05
995000 -- [-56.562] (-61.026) (-56.907) (-59.186) * [-56.590] (-66.430) (-57.610) (-57.476) -- 0:00:04
Average standard deviation of split frequencies: NA (no splits above min. frequency)
996000 -- [-60.240] (-60.491) (-57.077) (-58.781) * [-56.697] (-59.282) (-57.399) (-57.185) -- 0:00:03
997000 -- [-58.481] (-57.755) (-56.718) (-58.665) * [-57.031] (-58.360) (-59.910) (-57.583) -- 0:00:02
998000 -- [-58.537] (-58.821) (-58.042) (-56.390) * [-60.195] (-56.559) (-59.491) (-61.964) -- 0:00:01
999000 -- [-56.625] (-58.958) (-58.391) (-56.880) * [-59.026] (-57.468) (-58.573) (-56.330) -- 0:00:00
1000000 -- [-58.039] (-57.237) (-61.823) (-58.181) * [-58.884] (-57.374) (-61.703) (-60.624) -- 0:00:00
Average standard deviation of split frequencies: NA (no splits above min. frequency)
Analysis completed in 15 mins 41 seconds
Analysis used 940.78 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -56.00
Likelihood of best state for "cold" chain of run 2 was -56.03
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
76.3 % ( 78 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
72.4 % ( 71 %) Dirichlet(Pi{all})
69.9 % ( 49 %) Slider(Pi{all})
81.2 % ( 63 %) Multiplier(Alpha{1,2})
80.5 % ( 64 %) Multiplier(Alpha{3})
49.9 % ( 35 %) Slider(Pinvar{all})
98.6 % (100 %) ExtSPR(Tau{all},V{all})
98.3 % ( 98 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
97.9 % ( 99 %) ParsSPR(Tau{all},V{all})
27.8 % ( 31 %) Multiplier(V{all})
96.5 % (100 %) Nodeslider(V{all})
41.3 % ( 22 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
76.7 % ( 69 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
71.7 % ( 67 %) Dirichlet(Pi{all})
69.7 % ( 56 %) Slider(Pi{all})
82.2 % ( 63 %) Multiplier(Alpha{1,2})
80.6 % ( 65 %) Multiplier(Alpha{3})
46.4 % ( 34 %) Slider(Pinvar{all})
98.6 % ( 96 %) ExtSPR(Tau{all},V{all})
98.2 % (100 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
98.0 % ( 97 %) ParsSPR(Tau{all},V{all})
27.9 % ( 28 %) Multiplier(V{all})
96.5 % ( 99 %) Nodeslider(V{all})
41.2 % ( 22 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.00 0.00 0.00
2 | 166475 0.02 0.00
3 | 166778 167107 0.09
4 | 166684 166187 166769
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.00 0.00 0.00
2 | 166658 0.02 0.00
3 | 167223 166613 0.10
4 | 166094 166530 166882
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/mrbayes_input.nex.run1.p and /data/mrbayes_input.nex.run2.p
Writing summary statistics to file /data/mrbayes_input.nex.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -57.53
| 1 2 1 |
|2 1 2 |
| 12 2 1 1 21*2 2 2 1 |
| 2 1 2 2 1 2 2 1 1 2 |
| 2 *2 2 1 2 2 1 2 2 2 2|
| 1 12 1 111 2 2 2 2 1 * 1|
| 2 21 2 2 1 2 1 2 1 12 22 2 |
|1 2 * 21 2 2 2 1 11 1 11 2 |
| 2 2 1 * 2 12 1 1 |
| * 1 1 21 1 2 1 |
| 2 1 1 2 1 1 1 |
| 1 |
| 1 1 |
| 1 |
| 2 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -59.64
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -57.74 -60.41
2 -57.62 -60.20
--------------------------------------
TOTAL -57.68 -60.31
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.877972 97.891491 0.000627 28.782770 5.651709 928.87 1128.25 1.000
r(A<->C){all} 0.202226 0.026583 0.000189 0.552190 0.162774 29.50 40.76 1.022
r(A<->G){all} 0.164630 0.020893 0.000488 0.461344 0.120540 31.74 46.33 1.020
r(A<->T){all} 0.147346 0.017306 0.000057 0.431180 0.110690 48.00 58.11 1.001
r(C<->G){all} 0.167912 0.017779 0.000117 0.429082 0.139758 55.41 55.49 1.003
r(C<->T){all} 0.140141 0.013802 0.000049 0.373700 0.110089 33.88 67.01 1.012
r(G<->T){all} 0.177744 0.019863 0.000089 0.440148 0.148968 34.81 48.02 1.001
pi(A){all} 0.260840 0.004186 0.143030 0.389377 0.257229 468.36 506.89 1.002
pi(C){all} 0.173135 0.002964 0.076301 0.287067 0.167078 439.51 458.33 1.000
pi(G){all} 0.197072 0.003417 0.084709 0.310040 0.192110 360.17 440.47 1.001
pi(T){all} 0.368953 0.004761 0.235987 0.505433 0.368024 336.53 420.47 1.003
alpha{1,2} 0.862579 0.879673 0.000281 2.676464 0.558751 707.32 728.87 1.001
alpha{3} 1.017819 1.121501 0.000494 3.134893 0.693597 578.22 643.04 1.000
pinvar{all} 0.949103 0.010779 0.818718 0.999991 0.978564 194.86 233.88 1.003
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/mrbayes_input.nex.run1.t" and "/data/mrbayes_input.nex.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/mrbayes_input.nex.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/mrbayes_input.nex.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a parameter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C52
2 -- C65
3 -- C10
4 -- C67
5 -- C68
6 -- C9
7 -- C14
8 -- C73
9 -- C72
10 -- C17
11 -- C74
12 -- C59
13 -- C75
14 -- C16
15 -- C21
16 -- C80
17 -- C79
18 -- C24
19 -- C81
20 -- C82
21 -- C23
22 -- C28
23 -- C58
24 -- C87
25 -- C86
26 -- C31
27 -- C88
28 -- C89
29 -- C30
30 -- C35
31 -- C94
32 -- C93
33 -- C38
34 -- C3
35 -- C95
36 -- C96
37 -- C37
38 -- C42
39 -- C101
40 -- C100
41 -- C45
42 -- C102
43 -- C103
44 -- C44
45 -- C60
46 -- C49
47 -- C108
48 -- C107
49 -- C1
50 -- C109
51 -- C110
52 -- C51
53 -- C56
54 -- C115
55 -- C114
56 -- C61
57 -- C8
58 -- C116
59 -- C117
60 -- C4
61 -- C64
62 -- C6
63 -- C123
64 -- C122
65 -- C12
66 -- C124
67 -- C2
68 -- C125
69 -- C15
70 -- C18
71 -- C69
72 -- C131
73 -- C130
74 -- C20
75 -- C132
76 -- C133
77 -- C25
78 -- C7
79 -- C77
80 -- C29
81 -- C139
82 -- C138
83 -- C83
84 -- C140
85 -- C32
86 -- C142
87 -- C85
88 -- C33
89 -- C66
90 -- C147
Key to taxon bipartitions (saved to file "/data/mrbayes_input.nex.parts"):
ID -- Partition
--------------------------------------------------------------------------------
1 -- .**********************************************************************
2 -- .*.....................................................................
3 -- ..*....................................................................
4 -- ...*...................................................................
5 -- ....*..................................................................
6 -- .....*.................................................................
7 -- ......*................................................................
8 -- .......*...............................................................
9 -- ........*..............................................................
10 -- .........*.............................................................
11 -- ..........*............................................................
12 -- ...........*...........................................................
13 -- ............*..........................................................
14 -- .............*.........................................................
15 -- ..............*........................................................
16 -- ...............*.......................................................
17 -- ................*......................................................
18 -- .................*.....................................................
19 -- ..................*....................................................
20 -- ...................*...................................................
21 -- ....................*..................................................
22 -- .....................*.................................................
23 -- ......................*................................................
24 -- .......................*...............................................
25 -- ........................*..............................................
26 -- .........................*.............................................
27 -- ..........................*............................................
28 -- ...........................*...........................................
29 -- ............................*..........................................
30 -- .............................*.........................................
31 -- ..............................*........................................
32 -- ...............................*.......................................
33 -- ................................*......................................
34 -- .................................*.....................................
35 -- ..................................*....................................
36 -- ...................................*...................................
37 -- ....................................*..................................
38 -- .....................................*.................................
39 -- ......................................*................................
40 -- .......................................*...............................
41 -- ........................................*..............................
42 -- .........................................*.............................
43 -- ..........................................*............................
44 -- ...........................................*...........................
45 -- ............................................*..........................
46 -- .............................................*.........................
47 -- ..............................................*........................
48 -- ...............................................*.......................
49 -- ................................................*......................
50 -- .................................................*.....................
51 -- ..................................................*....................
52 -- ...................................................*...................
53 -- ....................................................*..................
54 -- .....................................................*.................
55 -- ......................................................*................
56 -- .......................................................*...............
57 -- ........................................................*..............
58 -- .........................................................*.............
59 -- ..........................................................*............
60 -- ...........................................................*...........
61 -- ............................................................*..........
62 -- .............................................................*.........
63 -- ..............................................................*........
64 -- ...............................................................*.......
65 -- ................................................................*......
66 -- .................................................................*.....
67 -- ..................................................................*....
68 -- ...................................................................*...
69 -- ....................................................................*..
70 -- .....................................................................*.
71 -- ......................................................................*
72 -- .......................................................................
73 -- .......................................................................
74 -- .......................................................................
75 -- .......................................................................
76 -- .......................................................................
77 -- .......................................................................
78 -- .......................................................................
79 -- .......................................................................
80 -- .......................................................................
81 -- .......................................................................
82 -- .......................................................................
83 -- .......................................................................
84 -- .......................................................................
85 -- .......................................................................
86 -- .......................................................................
87 -- .......................................................................
88 -- .......................................................................
89 -- .......................................................................
90 -- .......................................................................
--------------------------------------------------------------------------------
ID -- Partition (continued)
--------------------------------------------------------------------------------
1 -- *******************
2 -- ...................
3 -- ...................
4 -- ...................
5 -- ...................
6 -- ...................
7 -- ...................
8 -- ...................
9 -- ...................
10 -- ...................
11 -- ...................
12 -- ...................
13 -- ...................
14 -- ...................
15 -- ...................
16 -- ...................
17 -- ...................
18 -- ...................
19 -- ...................
20 -- ...................
21 -- ...................
22 -- ...................
23 -- ...................
24 -- ...................
25 -- ...................
26 -- ...................
27 -- ...................
28 -- ...................
29 -- ...................
30 -- ...................
31 -- ...................
32 -- ...................
33 -- ...................
34 -- ...................
35 -- ...................
36 -- ...................
37 -- ...................
38 -- ...................
39 -- ...................
40 -- ...................
41 -- ...................
42 -- ...................
43 -- ...................
44 -- ...................
45 -- ...................
46 -- ...................
47 -- ...................
48 -- ...................
49 -- ...................
50 -- ...................
51 -- ...................
52 -- ...................
53 -- ...................
54 -- ...................
55 -- ...................
56 -- ...................
57 -- ...................
58 -- ...................
59 -- ...................
60 -- ...................
61 -- ...................
62 -- ...................
63 -- ...................
64 -- ...................
65 -- ...................
66 -- ...................
67 -- ...................
68 -- ...................
69 -- ...................
70 -- ...................
71 -- ...................
72 -- *..................
73 -- .*.................
74 -- ..*................
75 -- ...*...............
76 -- ....*..............
77 -- .....*.............
78 -- ......*............
79 -- .......*...........
80 -- ........*..........
81 -- .........*.........
82 -- ..........*........
83 -- ...........*.......
84 -- ............*......
85 -- .............*.....
86 -- ..............*....
87 -- ...............*...
88 -- ................*..
89 -- .................*.
90 -- ..................*
--------------------------------------------------------------------------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/mrbayes_input.nex.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/mrbayes_input.nex.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.049115 0.007816 0.000001 0.212157 0.016730 1.000 2
length{all}[2] 0.052787 0.009311 0.000000 0.235182 0.018479 1.000 2
length{all}[3] 0.047853 0.008375 0.000000 0.205689 0.016150 1.000 2
length{all}[4] 0.052113 0.009397 0.000000 0.216447 0.018969 1.000 2
length{all}[5] 0.050657 0.009183 0.000001 0.204564 0.017965 1.000 2
length{all}[6] 0.047433 0.007295 0.000001 0.192630 0.016600 1.000 2
length{all}[7] 0.049791 0.008035 0.000000 0.211012 0.017810 1.000 2
length{all}[8] 0.050934 0.009841 0.000000 0.215493 0.016532 1.000 2
length{all}[9] 0.049891 0.008788 0.000001 0.211516 0.016589 1.000 2
length{all}[10] 0.049156 0.008435 0.000000 0.202693 0.017181 1.000 2
length{all}[11] 0.048060 0.008537 0.000000 0.206802 0.017249 1.000 2
length{all}[12] 0.049114 0.008962 0.000000 0.208995 0.016430 1.000 2
length{all}[13] 0.049060 0.008678 0.000001 0.197224 0.018459 1.000 2
length{all}[14] 0.051089 0.007945 0.000000 0.221791 0.018116 1.000 2
length{all}[15] 0.049486 0.008354 0.000001 0.207326 0.017368 1.000 2
length{all}[16] 0.047592 0.006728 0.000000 0.191674 0.017372 1.000 2
length{all}[17] 0.051276 0.011729 0.000000 0.207924 0.017115 1.000 2
length{all}[18] 0.049203 0.007982 0.000000 0.209952 0.016520 1.003 2
length{all}[19] 0.051280 0.007961 0.000000 0.208986 0.018580 1.000 2
length{all}[20] 0.048093 0.008382 0.000001 0.206213 0.015848 1.000 2
length{all}[21] 0.049166 0.008160 0.000000 0.219655 0.016494 1.002 2
length{all}[22] 0.050648 0.009172 0.000001 0.211146 0.016594 1.003 2
length{all}[23] 0.053398 0.010733 0.000000 0.214469 0.018051 1.000 2
length{all}[24] 0.049150 0.007540 0.000000 0.213565 0.017068 1.000 2
length{all}[25] 0.046681 0.008579 0.000001 0.182538 0.015703 1.000 2
length{all}[26] 0.050838 0.008424 0.000001 0.211584 0.017675 1.001 2
length{all}[27] 0.055045 0.010268 0.000000 0.229716 0.019901 1.000 2
length{all}[28] 0.047024 0.007173 0.000000 0.194193 0.016395 1.000 2
length{all}[29] 0.051935 0.008731 0.000000 0.215362 0.017734 1.000 2
length{all}[30] 0.053946 0.011269 0.000001 0.224399 0.018593 1.004 2
length{all}[31] 0.047667 0.007987 0.000000 0.205321 0.016862 1.000 2
length{all}[32] 0.049481 0.009067 0.000001 0.212814 0.016607 1.000 2
length{all}[33] 0.048789 0.008032 0.000000 0.199416 0.016740 1.000 2
length{all}[34] 0.050604 0.009230 0.000000 0.210146 0.016265 1.000 2
length{all}[35] 0.051369 0.007578 0.000000 0.218194 0.017577 1.000 2
length{all}[36] 0.048701 0.007707 0.000001 0.210445 0.016509 1.001 2
length{all}[37] 0.048936 0.008228 0.000001 0.207699 0.017273 1.000 2
length{all}[38] 0.049773 0.007931 0.000001 0.211130 0.016610 1.000 2
length{all}[39] 0.051674 0.012829 0.000000 0.209622 0.016269 1.000 2
length{all}[40] 0.046558 0.006884 0.000000 0.191184 0.015538 1.000 2
length{all}[41] 0.048695 0.009414 0.000000 0.189341 0.016202 1.000 2
length{all}[42] 0.048534 0.009232 0.000001 0.203827 0.016860 1.000 2
length{all}[43] 0.049270 0.007329 0.000000 0.196554 0.019180 1.000 2
length{all}[44] 0.052896 0.010995 0.000000 0.211065 0.017623 1.000 2
length{all}[45] 0.049809 0.008233 0.000001 0.201854 0.017758 1.000 2
length{all}[46] 0.051352 0.009253 0.000000 0.228342 0.017111 1.000 2
length{all}[47] 0.053787 0.009672 0.000000 0.231974 0.018396 1.001 2
length{all}[48] 0.049061 0.007556 0.000000 0.205571 0.017387 1.000 2
length{all}[49] 0.050225 0.008286 0.000000 0.201554 0.018139 1.000 2
length{all}[50] 0.053717 0.011556 0.000000 0.233127 0.016361 1.000 2
length{all}[51] 0.049105 0.009496 0.000001 0.197911 0.015577 1.000 2
length{all}[52] 0.052460 0.010949 0.000001 0.221195 0.016835 1.001 2
length{all}[53] 0.047137 0.007560 0.000000 0.201135 0.016474 1.000 2
length{all}[54] 0.050686 0.008043 0.000000 0.211639 0.017468 1.000 2
length{all}[55] 0.054866 0.010757 0.000000 0.230648 0.017975 1.000 2
length{all}[56] 0.050939 0.008926 0.000000 0.212986 0.017056 1.001 2
length{all}[57] 0.050603 0.007870 0.000000 0.209147 0.017801 1.000 2
length{all}[58] 0.052069 0.009921 0.000000 0.216427 0.017183 1.000 2
length{all}[59] 0.049233 0.008549 0.000001 0.198744 0.017488 1.000 2
length{all}[60] 0.051844 0.011075 0.000000 0.211225 0.016586 1.000 2
length{all}[61] 0.049269 0.007815 0.000000 0.204229 0.017421 1.001 2
length{all}[62] 0.051940 0.009663 0.000000 0.222701 0.016982 1.000 2
length{all}[63] 0.046691 0.007783 0.000001 0.194311 0.015241 1.000 2
length{all}[64] 0.049757 0.008769 0.000000 0.204575 0.017064 1.000 2
length{all}[65] 0.049613 0.008233 0.000000 0.202078 0.016479 1.000 2
length{all}[66] 0.049640 0.007658 0.000001 0.205367 0.017743 1.000 2
length{all}[67] 0.051615 0.009410 0.000000 0.221162 0.016774 1.000 2
length{all}[68] 0.050202 0.008243 0.000001 0.207156 0.018577 1.000 2
length{all}[69] 0.049954 0.007998 0.000001 0.218373 0.017491 1.000 2
length{all}[70] 0.051053 0.008171 0.000000 0.213452 0.017996 1.003 2
length{all}[71] 0.049076 0.009499 0.000000 0.199763 0.016184 1.001 2
length{all}[72] 0.047459 0.006332 0.000000 0.195821 0.017941 1.002 2
length{all}[73] 0.051599 0.008835 0.000000 0.211436 0.018091 1.002 2
length{all}[74] 0.050146 0.008286 0.000000 0.214260 0.017933 1.000 2
length{all}[75] 0.054051 0.010704 0.000001 0.219945 0.018036 1.000 2
length{all}[76] 0.044695 0.006298 0.000001 0.182885 0.016145 1.000 2
length{all}[77] 0.049285 0.008930 0.000001 0.201363 0.017081 1.000 2
length{all}[78] 0.050446 0.009000 0.000000 0.205243 0.016214 1.000 2
length{all}[79] 0.051645 0.009803 0.000001 0.211150 0.017720 1.000 2
length{all}[80] 0.048355 0.007744 0.000000 0.194370 0.016957 1.000 2
length{all}[81] 0.053946 0.010226 0.000000 0.218013 0.019399 1.001 2
length{all}[82] 0.048852 0.007630 0.000000 0.196562 0.016824 1.001 2
length{all}[83] 0.051690 0.008609 0.000001 0.215101 0.017871 1.001 2
length{all}[84] 0.048473 0.008076 0.000000 0.196676 0.016232 1.000 2
length{all}[85] 0.052212 0.008701 0.000000 0.218148 0.018636 1.000 2
length{all}[86] 0.050316 0.007926 0.000000 0.212378 0.016687 1.000 2
length{all}[87] 0.050583 0.008706 0.000001 0.227724 0.017020 1.002 2
length{all}[88] 0.048690 0.009499 0.000000 0.197332 0.016739 1.000 2
length{all}[89] 0.052724 0.011639 0.000001 0.213220 0.019513 1.000 2
length{all}[90] 0.048744 0.007652 0.000000 0.203314 0.018065 1.000 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = -nan
Maximum standard deviation of split frequencies = 0.000000
Average PSRF for parameter values (excluding NA and >10.0) = 1.000
Maximum PSRF for parameter values = 1.004
Clade credibility values:
/--------------------------------------------------------------------- C52 (1)
|
|--------------------------------------------------------------------- C65 (2)
|
|--------------------------------------------------------------------- C10 (3)
|
|--------------------------------------------------------------------- C67 (4)
|
|--------------------------------------------------------------------- C68 (5)
|
|--------------------------------------------------------------------- C9 (6)
|
|--------------------------------------------------------------------- C14 (7)
|
|--------------------------------------------------------------------- C73 (8)
|
|--------------------------------------------------------------------- C72 (9)
|
|--------------------------------------------------------------------- C17 (10)
|
|--------------------------------------------------------------------- C74 (11)
|
|--------------------------------------------------------------------- C59 (12)
|
|--------------------------------------------------------------------- C75 (13)
|
|--------------------------------------------------------------------- C16 (14)
|
|--------------------------------------------------------------------- C21 (15)
|
|--------------------------------------------------------------------- C80 (16)
|
|--------------------------------------------------------------------- C79 (17)
|
|--------------------------------------------------------------------- C24 (18)
|
|--------------------------------------------------------------------- C81 (19)
|
|--------------------------------------------------------------------- C82 (20)
|
|--------------------------------------------------------------------- C23 (21)
|
|--------------------------------------------------------------------- C28 (22)
|
|--------------------------------------------------------------------- C58 (23)
|
|--------------------------------------------------------------------- C87 (24)
|
|--------------------------------------------------------------------- C86 (25)
|
|--------------------------------------------------------------------- C31 (26)
|
|--------------------------------------------------------------------- C88 (27)
|
|--------------------------------------------------------------------- C89 (28)
|
|--------------------------------------------------------------------- C30 (29)
|
|--------------------------------------------------------------------- C35 (30)
|
|--------------------------------------------------------------------- C94 (31)
|
|--------------------------------------------------------------------- C93 (32)
|
|--------------------------------------------------------------------- C38 (33)
|
|--------------------------------------------------------------------- C3 (34)
|
|--------------------------------------------------------------------- C95 (35)
|
|--------------------------------------------------------------------- C96 (36)
|
|--------------------------------------------------------------------- C37 (37)
|
|--------------------------------------------------------------------- C42 (38)
|
|--------------------------------------------------------------------- C101 (39)
|
|--------------------------------------------------------------------- C100 (40)
|
|--------------------------------------------------------------------- C45 (41)
|
|--------------------------------------------------------------------- C102 (42)
|
|--------------------------------------------------------------------- C103 (43)
|
|--------------------------------------------------------------------- C44 (44)
|
|--------------------------------------------------------------------- C60 (45)
+
|--------------------------------------------------------------------- C49 (46)
|
|--------------------------------------------------------------------- C108 (47)
|
|--------------------------------------------------------------------- C107 (48)
|
|--------------------------------------------------------------------- C1 (49)
|
|--------------------------------------------------------------------- C109 (50)
|
|--------------------------------------------------------------------- C110 (51)
|
|--------------------------------------------------------------------- C51 (52)
|
|--------------------------------------------------------------------- C56 (53)
|
|--------------------------------------------------------------------- C115 (54)
|
|--------------------------------------------------------------------- C114 (55)
|
|--------------------------------------------------------------------- C61 (56)
|
|--------------------------------------------------------------------- C8 (57)
|
|--------------------------------------------------------------------- C116 (58)
|
|--------------------------------------------------------------------- C117 (59)
|
|--------------------------------------------------------------------- C4 (60)
|
|--------------------------------------------------------------------- C64 (61)
|
|--------------------------------------------------------------------- C6 (62)
|
|--------------------------------------------------------------------- C123 (63)
|
|--------------------------------------------------------------------- C122 (64)
|
|--------------------------------------------------------------------- C12 (65)
|
|--------------------------------------------------------------------- C124 (66)
|
|--------------------------------------------------------------------- C2 (67)
|
|--------------------------------------------------------------------- C125 (68)
|
|--------------------------------------------------------------------- C15 (69)
|
|--------------------------------------------------------------------- C18 (70)
|
|--------------------------------------------------------------------- C69 (71)
|
|--------------------------------------------------------------------- C131 (72)
|
|--------------------------------------------------------------------- C130 (73)
|
|--------------------------------------------------------------------- C20 (74)
|
|--------------------------------------------------------------------- C132 (75)
|
|--------------------------------------------------------------------- C133 (76)
|
|--------------------------------------------------------------------- C25 (77)
|
|--------------------------------------------------------------------- C7 (78)
|
|--------------------------------------------------------------------- C77 (79)
|
|--------------------------------------------------------------------- C29 (80)
|
|--------------------------------------------------------------------- C139 (81)
|
|--------------------------------------------------------------------- C138 (82)
|
|--------------------------------------------------------------------- C83 (83)
|
|--------------------------------------------------------------------- C140 (84)
|
|--------------------------------------------------------------------- C32 (85)
|
|--------------------------------------------------------------------- C142 (86)
|
|--------------------------------------------------------------------- C85 (87)
|
|--------------------------------------------------------------------- C33 (88)
|
|--------------------------------------------------------------------- C66 (89)
|
\--------------------------------------------------------------------- C147 (90)
Phylogram (based on average branch lengths):
/----------------------------------------------------------- C52 (1)
|
|----------------------------------------------------------------- C65 (2)
|
|--------------------------------------------------------- C10 (3)
|
|------------------------------------------------------------------- C67 (4)
|
|--------------------------------------------------------------- C68 (5)
|
|---------------------------------------------------------- C9 (6)
|
|--------------------------------------------------------------- C14 (7)
|
|---------------------------------------------------------- C73 (8)
|
|---------------------------------------------------------- C72 (9)
|
|------------------------------------------------------------ C17 (10)
|
|------------------------------------------------------------- C74 (11)
|
|---------------------------------------------------------- C59 (12)
|
|----------------------------------------------------------------- C75 (13)
|
|---------------------------------------------------------------- C16 (14)
|
|------------------------------------------------------------- C21 (15)
|
|------------------------------------------------------------- C80 (16)
|
|------------------------------------------------------------ C79 (17)
|
|---------------------------------------------------------- C24 (18)
|
|----------------------------------------------------------------- C81 (19)
|
|-------------------------------------------------------- C82 (20)
|
|---------------------------------------------------------- C23 (21)
|
|---------------------------------------------------------- C28 (22)
|
|--------------------------------------------------------------- C58 (23)
|
|------------------------------------------------------------ C87 (24)
|
|------------------------------------------------------- C86 (25)
|
|-------------------------------------------------------------- C31 (26)
|
|---------------------------------------------------------------------- C88 (27)
|
|---------------------------------------------------------- C89 (28)
|
|-------------------------------------------------------------- C30 (29)
|
|----------------------------------------------------------------- C35 (30)
|
|----------------------------------------------------------- C94 (31)
|
|---------------------------------------------------------- C93 (32)
|
|----------------------------------------------------------- C38 (33)
|
|--------------------------------------------------------- C3 (34)
|
|-------------------------------------------------------------- C95 (35)
|
|---------------------------------------------------------- C96 (36)
|
|------------------------------------------------------------- C37 (37)
|
|---------------------------------------------------------- C42 (38)
|
|--------------------------------------------------------- C101 (39)
|
|------------------------------------------------------- C100 (40)
|
|--------------------------------------------------------- C45 (41)
|
|----------------------------------------------------------- C102 (42)
|
|------------------------------------------------------------------- C103 (43)
|
|-------------------------------------------------------------- C44 (44)
|
|-------------------------------------------------------------- C60 (45)
+
|------------------------------------------------------------ C49 (46)
|
|----------------------------------------------------------------- C108 (47)
|
|------------------------------------------------------------- C107 (48)
|
|---------------------------------------------------------------- C1 (49)
|
|---------------------------------------------------------- C109 (50)
|
|------------------------------------------------------- C110 (51)
|
|----------------------------------------------------------- C51 (52)
|
|---------------------------------------------------------- C56 (53)
|
|------------------------------------------------------------- C115 (54)
|
|--------------------------------------------------------------- C114 (55)
|
|------------------------------------------------------------ C61 (56)
|
|--------------------------------------------------------------- C8 (57)
|
|------------------------------------------------------------ C116 (58)
|
|-------------------------------------------------------------- C117 (59)
|
|---------------------------------------------------------- C4 (60)
|
|------------------------------------------------------------- C64 (61)
|
|------------------------------------------------------------ C6 (62)
|
|------------------------------------------------------ C123 (63)
|
|------------------------------------------------------------ C122 (64)
|
|---------------------------------------------------------- C12 (65)
|
|-------------------------------------------------------------- C124 (66)
|
|----------------------------------------------------------- C2 (67)
|
|----------------------------------------------------------------- C125 (68)
|
|-------------------------------------------------------------- C15 (69)
|
|--------------------------------------------------------------- C18 (70)
|
|--------------------------------------------------------- C69 (71)
|
|--------------------------------------------------------------- C131 (72)
|
|---------------------------------------------------------------- C130 (73)
|
|--------------------------------------------------------------- C20 (74)
|
|--------------------------------------------------------------- C132 (75)
|
|--------------------------------------------------------- C133 (76)
|
|------------------------------------------------------------ C25 (77)
|
|--------------------------------------------------------- C7 (78)
|
|-------------------------------------------------------------- C77 (79)
|
|------------------------------------------------------------ C29 (80)
|
|-------------------------------------------------------------------- C139 (81)
|
|----------------------------------------------------------- C138 (82)
|
|--------------------------------------------------------------- C83 (83)
|
|--------------------------------------------------------- C140 (84)
|
|------------------------------------------------------------------ C32 (85)
|
|----------------------------------------------------------- C142 (86)
|
|------------------------------------------------------------ C85 (87)
|
|----------------------------------------------------------- C33 (88)
|
|--------------------------------------------------------------------- C66 (89)
|
\---------------------------------------------------------------- C147 (90)
|----------------| 0.005 expected changes per site
Calculating tree probabilities...
Credible sets of trees (3002 trees sampled):
50 % credible set contains 1501 trees
90 % credible set contains 2702 trees
95 % credible set contains 2852 trees
99 % credible set contains 2972 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
Running FUBAR...
[2J[H /HYPHY 2.3.14.20190214beta(MP) for Linux on x86_64\
***************** TYPES OF STANDARD ANALYSES *****************
(1) Selection Analyses
(2) Evolutionary Hypothesis Testing
(3) Relative evolutionary rate inference
(4) Coevolutionary analysis
(5) Basic Analyses
(6) Codon Selection Analyses
(7) Compartmentalization
(8) Data File Tools
(9) Miscellaneous
(10) Model Comparison
(11) Kernel Analysis Tools
(12) Molecular Clock
(13) Phylogeny Reconstruction
(14) Positive Selection
(15) Recombination
(16) Selection/Recombination
(17) Relative Rate
(18) Relative Ratio
(19) Substitution Rates
Please select type of analyses you want to list (or press ENTER to process custom batch file):[2J[H***************** FILES IN 'Selection Analyses' *****************
(1) [MEME] Test for episodic site-level selection using MEME (Mixed Effects Model of Evolution).
(2) [FEL] Test for pervasive site-level selection using FEL (Fixed Effects Likelihood).
(3) [SLAC] Test for pervasive site-level selection using SLAC (Single Likelihood Ancestor Counting).
(4) [FUBAR] Test for pervasive site-level selection using FUBAR (Fast Unconstrained Bayesian AppRoximation for inferring selection).
(5) [BUSTED] Test for episodic gene-wide selection using BUSTED (Branch-site Unrestricted Statistical Test of Episodic Diversification).
(6) [aBSREL] Test for lineage-specific evolution using the branch-site method aBS-REL (Adaptive Branch-Site Random Effects Likelihood).
(7) [RELAX] Test for relaxation of selection pressure along a specified set of test branches using RELAX (a random effects test of selection relaxation).
Please select the analysis you would like to perform (or press ENTER to return to the list of analysis types):
Analysis Description
--------------------
Perform a Fast Unbiased AppRoximate Bayesian (FUBAR) analysis of a
coding sequence alignment to determine whether some sites have been
subject to pervasive purifying or diversifying selection. v2.1
introduces two more methods for estimating the posterior distribution of
grid weights: collapsed Gibbs MCMC (faster) and 0-th order Variation
Bayes approximation (fastest). Please note that a FUBAR analysis
generates a cache and a results JSON file in the same directory as
directory as the original alignment. HyPhy needs to have write
privileges to this directory. For example if the original file is in
/home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there
will also exist FUBAR-generated files
/home/sergei/FUBAR/data/pol.nex.FUBAR.json,
/home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also provide
checkpointing so that a partially completed analysis can be restarted.
- __Requirements__: in-frame codon alignment (possibly partitioned) and a phylogenetic tree
(one per partition)
- __Citation__: FUBAR: a fast, unconstrained bayesian approximation for inferring
selection (2013), Mol Biol Evol. 30(5):1196-205
- __Written by__: Sergei L Kosakovsky Pond
- __Contact Information__: spond@temple.edu
- __Analysis Version__: 2.1
####Choose Genetic Code
1. [**Universal**] Universal code. (Genebank transl_table=1).
2. [**Vertebrate mtDNA**] Vertebrate mitochondrial DNA code. (Genebank transl_table=2).
3. [**Yeast mtDNA**] Yeast mitochondrial DNA code. (Genebank transl_table=3).
4. [**Mold/Protozoan mtDNA**] Mold, Protozoan and Coelenterate mitochondrial DNA and the Mycloplasma/Spiroplasma code. (Genebank transl_table=4).
5. [**Invertebrate mtDNA**] Invertebrate mitochondrial DNA code. (Genebank transl_table=5).
6. [**Ciliate Nuclear**] Ciliate, Dasycladacean and Hexamita Nuclear code. (Genebank transl_table=6).
7. [**Echinoderm mtDNA**] Echinoderm mitochondrial DNA code. (Genebank transl_table=9).
8. [**Euplotid Nuclear**] Euplotid Nuclear code. (Genebank transl_table=10).
9. [**Alt. Yeast Nuclear**] Alternative Yeast Nuclear code. (Genebank transl_table=12).
10. [**Ascidian mtDNA**] Ascidian mitochondrial DNA code. (Genebank transl_table=13).
11. [**Flatworm mtDNA**] Flatworm mitochondrial DNA code. (Genebank transl_table=14).
12. [**Blepharisma Nuclear**] Blepharisma Nuclear code. (Genebank transl_table=15).
13. [**Chlorophycean mtDNA**] Chlorophycean Mitochondrial Code (transl_table=16).
14. [**Trematode mtDNA**] Trematode Mitochondrial Code (transl_table=21).
15. [**Scenedesmus obliquus mtDNA**] Scenedesmus obliquus mitochondrial Code (transl_table=22).
16. [**Thraustochytrium mtDNA**] Thraustochytrium Mitochondrial Code (transl_table=23).
17. [**Pterobranchia mtDNA**] Pterobranchia Mitochondrial Code (transl_table=24).
18. [**SR1 and Gracilibacteria**] Candidate Division SR1 and Gracilibacteria Code (transl_table=25).
19. [**Pachysolen Nuclear**] Pachysolen tannophilus Nuclear Code (transl_table=26).
>Please choose an option (or press q to cancel selection):
>Select a coding sequence alignment file (`/usr/local/lib/hyphy/TemplateBatchFiles/SelectionAnalyses/`)
>A tree was found in the data file: `(C52,C65,C10,C67,C68,C9,C14,C73,C72,C17,C74,C59,C75,C16,C21,C80,C79,C24,C81,C82,C23,C28,C58,C87,C86,C31,C88,C89,C30,C35,C94,C93,C38,C3,C95,C96,C37,C42,C101,C100,C45,C102,C103,C44,C60,C49,C108,C107,C1,C109,C110,C51,C56,C115,C114,C61,C8,C116,C117,C4,C64,C6,C123,C122,C12,C124,C2,C125,C15,C18,C69,C131,C130,C20,C132,C133,C25,C7,C77,C29,C139,C138,C83,C140,C32,C142,C85,C33,C66,C147)`
>Would you like to use it (y/n)?
>Loaded a multiple sequence alignment with **90** sequences, **14** codons, and **1** partitions from `/data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/results/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1.fna`
> FUBAR will write cache and result files to _/data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/results/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1.fna.FUBAR.cache_ and _/data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/results/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1.fna.FUBAR.json_, respectively
> Number of grid points per dimension (total number is D^2) (permissible range = [5,50], default value = 20, integer):
####Posterior estimation method
1. [**Metropolis-Hastings**] Full Metropolis-Hastings MCMC algorithm (slowest, original 2013 paper implementation)
2. [**Collapsed Gibbs**] Collapsed Gibbs sampler (intermediate speed)
3. [**Variational Bayes**] 0-th order Variational Bayes approximations (fastest, recommended default)
>Please choose an option (or press q to cancel selection):> The concentration parameter of the Dirichlet prior (permissible range = [0.001,1], default value = 0.5):
### Obtaining branch lengths and nucleotide substitution biases under the nucleotide GTR model
* Log(L) = -55.99, AIC-c = 313.25 (98 estimated parameters)
* Tree length (expected substitutions/site) for partition 1 : 0.000
### Computing the phylogenetic likelihood function on the grid
* Determining appropriate tree scaling based on the best score from a 20 x 20 rate grid
* Best scaling achieved for
* synonymous rate = 0.000
* non-synonymous rate = 0.000
* Computing conditional site likelihoods on a 20 x 20 rate grid
### Running an iterative zeroth order variational Bayes procedure to estimate the posterior mean of rate weights
* Using the following settings
* Dirichlet alpha : 0.5
### Tabulating site-level results
----
## FUBAR inferred no sites under subject to positive selection at posterior probability >= 0.9
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.15 sec, SCORE=1000, Nseq=90, Len=14
Abu_Dhabi_UAE_30_2014_nsp11_VIPR_ALG4_727377806_13410_13451_1_2014_04_19_UAE_Human_MERS2 SKDSNFLNESGVLL
Abu_Dhabi_UAE_30_2014_nsp11_VIPR_ALG4_727377806_13410_13451_1_2014_04_19_UAE_Human_MERS9 SKDSNFLNESGVLL
Abu_Dhabi_UAE_30_2014_nsp11_VIPR_ALG4_727377806_13410_13451_1_2014_04_19_UAE_Human_MERS8 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS0 SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS1 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS6 SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS5 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS0 SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS7 SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS8 SKDSNFLNESGVLL
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS4 SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS3 SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS2 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS7 SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS4 SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS5 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS6 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS1 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS0 SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS9 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS4 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS1 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS2 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS3 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS8 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS7 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS6 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS1 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS8 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS9 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS0 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS5 SKDSNFLNESGVLL
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS4 SKDSNFLNESGVLL
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS3 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS8 SKDSNFLNESGVLL
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS5 SKDSNFLNESGVLL
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS6 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS7 SKDSNFLNESGVLL
Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS2 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS01 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS00 SKDSNFLNESGVLL
Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS5 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS02 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS03 SKDSNFLNESGVLL
Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS4 SKDSNFLNESGVLL
Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS9 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS08 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS07 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS09 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS10 SKDSNFLNESGVLL
Abu_Dhabi_UAE_30_2014_nsp11_VIPR_ALG4_727377806_13410_13451_1_2014_04_19_UAE_Human_MERS1 SKDSNFLNESGVLL
Abu_Dhabi_UAE_30_2014_nsp11_VIPR_ALG4_727377806_13410_13451_1_2014_04_19_UAE_Human_MERS6 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS15 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS14 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS16 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS17 SKDSNFLNESGVLL
Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS4 SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS23 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS22 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS2 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS24 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS25 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS5 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS8 SKDSNFLNESGVLL
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS9 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS31 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS30 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS0 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS32 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS33 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS5 SKDSNFLNESGVLL
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS7 SKDSNFLNESGVLL
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS9 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS39 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS38 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS3 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS40 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS2 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS42 SKDSNFLNESGVLL
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS5 SKDSNFLNESGVLL
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS3 SKDSNFLNESGVLL
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS47 SKDSNFLNESGVLL
**************
>Hu_Jeddah_KSA_C21271_2015_nsp11_VIPR_ALG4_972903326_13388_13429_1_2015_02_22_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_2345_2015_nsp11_VIPR_ALG4_823104955_13388_13429_1_2015_01_21_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_1_2013_nsp11_VIPR_ALG4_597503887_13196_13237_1_2013_11_06_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_19_2013_nsp11_VIPR_ALG4_540362698_13401_13442_1_2013_05_23_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_2_2013_nsp11_VIPR_ALG4_511261292_13405_13446_1_2013_04_21_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jordan_N3_2012_nsp11_VIPR_ALG4_469569406_13364_13405_1_2012_04_Jordan_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Bisha_1_2012_nsp11_VIPR_ALG4_540362614_13364_13405_1_2012_06_19_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_014_1_2015_nsp11_VIPR_ALG4_923094880_13394_13435_1_2015_05_31_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_UAE_D1164_10_2014_nsp11_VIPR_ALG4_752855055_13132_13173_1_2014_06_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_035_2_2015_nsp11_VIPR_ALG4_923094916_13394_13435_1_2015_06_18_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_Qatar_2_2014_nsp11_VIPR_ALG4_615796117_13409_13450_1_2014_02_16_Qatar_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_UAE_D1209_2014_nsp11_VIPR_ALG4_752855115_13132_13173_1_NA_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_168_2_2015_nsp11_VIPR_ALG4_923094940_13394_13435_1_2015_06_24_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >ChinaGD01_nsp11_VIPR_ALG4_828177939_13404_13445_1_2015_05_27_China_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KSA_CAMEL_376_nsp11_VIPR_ALG4_620988567_13410_13451_1_2013_11_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KSA_CAMEL_378_nsp11_VIPR_ALG4_620988534_13410_13451_1_2013_11_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_UAE_D1339_2_2014_nsp11_VIPR_ALG4_752855091_13132_13173_1_2014_06_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >England_3_2013_nsp11_VIPR_ALG4_746873507_13370_13411_1_2013_02_10_UK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_Jeddah_human_1_nsp11_VIPR_ALG4_570348515_13404_13445_1_2013_11_05_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_Jeddah_Camel_1_nsp11_VIPR_ALG4_570348503_13404_13445_1_2013_11_08_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >FRA_UAE_nsp11_VIPR_ALG4_562738363_13292_13333_1_2013_05_07_France_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_KOR_KNIH_002_05_2015_nsp11_VIPR_ALG4_829021051_13410_13451_1_2015_05_20_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_KOR_Seoul_050_1_2015_nsp11_VIPR_ALG4_1024848816_13410_13451_1_2015_06_11_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >England_Qatar_2012_nsp11_VIPR_ALG4_453061242_13410_13451_1_2012_09_19_UK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hafr_Al_Batin_2_2013_nsp11_VIPR_ALG4_582986847_13359_13400_1_2013_08_05_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_KOR_Seoul_169_2015_nsp11_VIPR_ALG4_1024848876_13410_13451_1_2015_06_26_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_KOR_Seoul_162_1_2015_nsp11_VIPR_ALG4_1024848864_13410_13451_1_2015_06_22_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_France_FRA2_130569_2013_IS_HTS_nsp11_VIPR_ALG4_732559248_13275_13316_1_2013_05_07_France_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Makkah_C9355_KSA_Makkah_2014_04_15_nsp11_VIPR_ALG4_674305012_13373_13414_1_2014_04_15_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >MERS_CoV_KOR_Seoul_177_3_2015_nsp11_VIPR_ALG4_1024848888_13410_13451_1_2015_07_03_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_France_UAE_FRA1_1627_2013_BAL_Sanger_nsp11_VIPR_ALG4_732559230_12862_12903_1_2013_04_26_France_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Hufuf_KSA_9158_2015_nsp11_VIPR_ALG4_972903350_13388_13429_1_2015_03_27_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_14_2013_nsp11_VIPR_ALG4_582986859_13359_13400_1_2013_08_15_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_1_2012_nsp11_VIPR_ALG4_540362577_13370_13411_1_2012_10_23_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_2014KSA_683_KSA_2014_nsp11_VIPR_ALG4_674305024_13302_13343_1_2014_04_22_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Jeddah_KSA_C20843_2015_nsp11_VIPR_ALG4_972903314_13388_13429_1_2015_02_09_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Najran_KSA_C20915_2015_nsp11_VIPR_ALG4_972903430_13274_13315_1_2015_02_13_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Taif_1_2013_nsp11_VIPR_ALG4_582986883_13359_13400_1_2013_06_12_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Hu_Riyadh_KSA_2466_2015_nsp11_VIPR_ALG4_823104977_13388_13429_1_2015_01_26_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D36_2014_nsp11_VIPR_ALG4_922057921_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_17_2013_nsp11_VIPR_ALG4_540362791_13405_13446_1_2013_05_15_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_18_2013_nsp11_VIPR_ALG4_540362810_13410_13451_1_2013_05_23_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_3_2013_nsp11_VIPR_ALG4_511261316_13361_13402_1_2013_04_22_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Jeddah_C10306_KSA_2014_04_20_nsp11_VIPR_ALG4_674305000_13304_13345_1_2014_04_21_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D48_2014_nsp11_VIPR_ALG4_922058017_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KFU_HKU_13_nsp11_VIPR_ALG4_612348149_13398_13439_1_2013_12_30_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >Camel_UAE_D1243_12_2014_nsp11_VIPR_ALG4_752855103_13132_13173_1_2014_06_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_Jd175_2015_nsp11_VIPR_ALG4_922058329_13410_13451_1_2015_02_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_Jd199_2015_nsp11_VIPR_ALG4_922058341_13410_13451_1_2015_02_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >D2731_3_14_nsp11_VIPR_ALG4_959463834_13395_13436_1_NA_UAE_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_Jd7_2015_nsp11_VIPR_ALG4_922058269_13410_13451_1_2015_01_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >KOREA_Seoul_168_1_2015_nsp11_VIPR_ALG4_923094928_13394_13435_1_2015_06_21_SK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >England_1_nsp11_VIPR_ALG4_426205766_13409_13450_1_2012_09_11_UK_Human_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG >camel_Jeddah_Jd90_2015_nsp11_VIPR_ALG4_922058317_13410_13451_1_2015_01_SA_Camel_MERS TCTAAAGATTCCAATTTTTTAAACGAGTCCGGGGTTCTATTG
>Hu_Jeddah_KSA_C21271_2015_nsp11_VIPR_ALG4_972903326_13388_13429_1_2015_02_22_SA_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_2345_2015_nsp11_VIPR_ALG4_823104955_13388_13429_1_2015_01_21_SA_Human_MERS SKDSNFLNESGVLL >Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS SKDSNFLNESGVLL >Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS SKDSNFLNESGVLL >Jeddah_1_2013_nsp11_VIPR_ALG4_597503887_13196_13237_1_2013_11_06_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_19_2013_nsp11_VIPR_ALG4_540362698_13401_13442_1_2013_05_23_SA_Human_MERS SKDSNFLNESGVLL >Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS SKDSNFLNESGVLL >Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_2_2013_nsp11_VIPR_ALG4_511261292_13405_13446_1_2013_04_21_SA_Human_MERS SKDSNFLNESGVLL >Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS SKDSNFLNESGVLL >Jordan_N3_2012_nsp11_VIPR_ALG4_469569406_13364_13405_1_2012_04_Jordan_Human_MERS SKDSNFLNESGVLL >Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS SKDSNFLNESGVLL >Bisha_1_2012_nsp11_VIPR_ALG4_540362614_13364_13405_1_2012_06_19_SA_Human_MERS SKDSNFLNESGVLL >KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS SKDSNFLNESGVLL >KOREA_Seoul_014_1_2015_nsp11_VIPR_ALG4_923094880_13394_13435_1_2015_05_31_SK_Human_MERS SKDSNFLNESGVLL >Camel_UAE_D1164_10_2014_nsp11_VIPR_ALG4_752855055_13132_13173_1_2014_06_UAE_Camel_MERS SKDSNFLNESGVLL >KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS SKDSNFLNESGVLL >KOREA_Seoul_035_2_2015_nsp11_VIPR_ALG4_923094916_13394_13435_1_2015_06_18_SK_Human_MERS SKDSNFLNESGVLL >Camel_Qatar_2_2014_nsp11_VIPR_ALG4_615796117_13409_13450_1_2014_02_16_Qatar_Camel_MERS SKDSNFLNESGVLL >Camel_UAE_D1209_2014_nsp11_VIPR_ALG4_752855115_13132_13173_1_NA_UAE_Camel_MERS SKDSNFLNESGVLL >KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS SKDSNFLNESGVLL >KOREA_Seoul_168_2_2015_nsp11_VIPR_ALG4_923094940_13394_13435_1_2015_06_24_SK_Human_MERS SKDSNFLNESGVLL >ChinaGD01_nsp11_VIPR_ALG4_828177939_13404_13445_1_2015_05_27_China_Human_MERS SKDSNFLNESGVLL >KSA_CAMEL_376_nsp11_VIPR_ALG4_620988567_13410_13451_1_2013_11_SA_Camel_MERS SKDSNFLNESGVLL >KSA_CAMEL_378_nsp11_VIPR_ALG4_620988534_13410_13451_1_2013_11_SA_Camel_MERS SKDSNFLNESGVLL >Camel_UAE_D1339_2_2014_nsp11_VIPR_ALG4_752855091_13132_13173_1_2014_06_UAE_Camel_MERS SKDSNFLNESGVLL >England_3_2013_nsp11_VIPR_ALG4_746873507_13370_13411_1_2013_02_10_UK_Human_MERS SKDSNFLNESGVLL >MERS_CoV_Jeddah_human_1_nsp11_VIPR_ALG4_570348515_13404_13445_1_2013_11_05_SA_Human_MERS SKDSNFLNESGVLL >MERS_CoV_Jeddah_Camel_1_nsp11_VIPR_ALG4_570348503_13404_13445_1_2013_11_08_SA_Camel_MERS SKDSNFLNESGVLL >FRA_UAE_nsp11_VIPR_ALG4_562738363_13292_13333_1_2013_05_07_France_Human_MERS SKDSNFLNESGVLL >MERS_CoV_KOR_KNIH_002_05_2015_nsp11_VIPR_ALG4_829021051_13410_13451_1_2015_05_20_SK_Human_MERS SKDSNFLNESGVLL >MERS_CoV_KOR_Seoul_050_1_2015_nsp11_VIPR_ALG4_1024848816_13410_13451_1_2015_06_11_SK_Human_MERS SKDSNFLNESGVLL >England_Qatar_2012_nsp11_VIPR_ALG4_453061242_13410_13451_1_2012_09_19_UK_Human_MERS SKDSNFLNESGVLL >Hafr_Al_Batin_2_2013_nsp11_VIPR_ALG4_582986847_13359_13400_1_2013_08_05_SA_Human_MERS SKDSNFLNESGVLL >MERS_CoV_KOR_Seoul_169_2015_nsp11_VIPR_ALG4_1024848876_13410_13451_1_2015_06_26_SK_Human_MERS SKDSNFLNESGVLL >MERS_CoV_KOR_Seoul_162_1_2015_nsp11_VIPR_ALG4_1024848864_13410_13451_1_2015_06_22_SK_Human_MERS SKDSNFLNESGVLL >Hu_France_FRA2_130569_2013_IS_HTS_nsp11_VIPR_ALG4_732559248_13275_13316_1_2013_05_07_France_Human_MERS SKDSNFLNESGVLL >Makkah_C9355_KSA_Makkah_2014_04_15_nsp11_VIPR_ALG4_674305012_13373_13414_1_2014_04_15_SA_Human_MERS SKDSNFLNESGVLL >MERS_CoV_KOR_Seoul_177_3_2015_nsp11_VIPR_ALG4_1024848888_13410_13451_1_2015_07_03_SK_Human_MERS SKDSNFLNESGVLL >Hu_France_UAE_FRA1_1627_2013_BAL_Sanger_nsp11_VIPR_ALG4_732559230_12862_12903_1_2013_04_26_France_Human_MERS SKDSNFLNESGVLL >Hu_Hufuf_KSA_9158_2015_nsp11_VIPR_ALG4_972903350_13388_13429_1_2015_03_27_SA_Human_MERS SKDSNFLNESGVLL >Riyadh_14_2013_nsp11_VIPR_ALG4_582986859_13359_13400_1_2013_08_15_SA_Human_MERS SKDSNFLNESGVLL >Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS SKDSNFLNESGVLL >Riyadh_1_2012_nsp11_VIPR_ALG4_540362577_13370_13411_1_2012_10_23_SA_Human_MERS SKDSNFLNESGVLL >Riyadh_2014KSA_683_KSA_2014_nsp11_VIPR_ALG4_674305024_13302_13343_1_2014_04_22_SA_Human_MERS SKDSNFLNESGVLL >Hu_Jeddah_KSA_C20843_2015_nsp11_VIPR_ALG4_972903314_13388_13429_1_2015_02_09_SA_Human_MERS SKDSNFLNESGVLL >Hu_Najran_KSA_C20915_2015_nsp11_VIPR_ALG4_972903430_13274_13315_1_2015_02_13_SA_Human_MERS SKDSNFLNESGVLL >Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS SKDSNFLNESGVLL >Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS SKDSNFLNESGVLL >Taif_1_2013_nsp11_VIPR_ALG4_582986883_13359_13400_1_2013_06_12_SA_Human_MERS SKDSNFLNESGVLL >Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS SKDSNFLNESGVLL >Hu_Riyadh_KSA_2466_2015_nsp11_VIPR_ALG4_823104977_13388_13429_1_2015_01_26_SA_Human_MERS SKDSNFLNESGVLL >Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D36_2014_nsp11_VIPR_ALG4_922057921_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Al_Hasa_17_2013_nsp11_VIPR_ALG4_540362791_13405_13446_1_2013_05_15_SA_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Al_Hasa_18_2013_nsp11_VIPR_ALG4_540362810_13410_13451_1_2013_05_23_SA_Human_MERS SKDSNFLNESGVLL >Al_Hasa_3_2013_nsp11_VIPR_ALG4_511261316_13361_13402_1_2013_04_22_SA_Human_MERS SKDSNFLNESGVLL >Jeddah_C10306_KSA_2014_04_20_nsp11_VIPR_ALG4_674305000_13304_13345_1_2014_04_21_SA_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D48_2014_nsp11_VIPR_ALG4_922058017_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS SKDSNFLNESGVLL >Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS SKDSNFLNESGVLL >KFU_HKU_13_nsp11_VIPR_ALG4_612348149_13398_13439_1_2013_12_30_SA_Camel_MERS SKDSNFLNESGVLL >Camel_UAE_D1243_12_2014_nsp11_VIPR_ALG4_752855103_13132_13173_1_2014_06_UAE_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_Jd175_2015_nsp11_VIPR_ALG4_922058329_13410_13451_1_2015_02_SA_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_Jd199_2015_nsp11_VIPR_ALG4_922058341_13410_13451_1_2015_02_SA_Camel_MERS SKDSNFLNESGVLL >KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS SKDSNFLNESGVLL >D2731_3_14_nsp11_VIPR_ALG4_959463834_13395_13436_1_NA_UAE_Camel_MERS SKDSNFLNESGVLL >camel_Jeddah_Jd7_2015_nsp11_VIPR_ALG4_922058269_13410_13451_1_2015_01_SA_Camel_MERS SKDSNFLNESGVLL >KOREA_Seoul_168_1_2015_nsp11_VIPR_ALG4_923094928_13394_13435_1_2015_06_21_SK_Human_MERS SKDSNFLNESGVLL >England_1_nsp11_VIPR_ALG4_426205766_13409_13450_1_2012_09_11_UK_Human_MERS SKDSNFLNESGVLL >camel_Jeddah_Jd90_2015_nsp11_VIPR_ALG4_922058317_13410_13451_1_2015_01_SA_Camel_MERS SKDSNFLNESGVLL
Reading sequence file /data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/fasta/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1 Found 90 sequences of length 42 Alignment looks like a valid DNA alignment. Estimated diversity is (pairwise deletion - ignoring missing/ambig): 0.0% Found 0 informative sites. Writing alignment of informative sites to: Phi.inf.sites Writing list of informative sites to: Phi.inf.list Calculating all pairwise incompatibilities... 100.0% Using a window size of 80 with k as 1 Too few informative sites to use normal approximation. Try doing a permutation test or increasing alignment length Can also try decreasing windowsize.
#NEXUS
[ID: 5374269164]
begin taxa;
dimensions ntax=90;
taxlabels
Hu_Jeddah_KSA_C21271_2015_nsp11_VIPR_ALG4_972903326_13388_13429_1_2015_02_22_SA_Human_MERS
Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS
Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS
Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS
Jeddah_1_2013_nsp11_VIPR_ALG4_597503887_13196_13237_1_2013_11_06_SA_Human_MERS
Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS
Al_Hasa_19_2013_nsp11_VIPR_ALG4_540362698_13401_13442_1_2013_05_23_SA_Human_MERS
Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS
Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS
Al_Hasa_2_2013_nsp11_VIPR_ALG4_511261292_13405_13446_1_2013_04_21_SA_Human_MERS
Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS
Hu_Riyadh_KSA_2345_2015_nsp11_VIPR_ALG4_823104955_13388_13429_1_2015_01_21_SA_Human_MERS
Jordan_N3_2012_nsp11_VIPR_ALG4_469569406_13364_13405_1_2012_04_Jordan_Human_MERS
Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS
Bisha_1_2012_nsp11_VIPR_ALG4_540362614_13364_13405_1_2012_06_19_SA_Human_MERS
KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS
KOREA_Seoul_014_1_2015_nsp11_VIPR_ALG4_923094880_13394_13435_1_2015_05_31_SK_Human_MERS
Camel_UAE_D1164_10_2014_nsp11_VIPR_ALG4_752855055_13132_13173_1_2014_06_UAE_Camel_MERS
KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS
KOREA_Seoul_035_2_2015_nsp11_VIPR_ALG4_923094916_13394_13435_1_2015_06_18_SK_Human_MERS
Camel_Qatar_2_2014_nsp11_VIPR_ALG4_615796117_13409_13450_1_2014_02_16_Qatar_Camel_MERS
Camel_UAE_D1209_2014_nsp11_VIPR_ALG4_752855115_13132_13173_1_NA_UAE_Camel_MERS
Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS
KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS
KOREA_Seoul_168_2_2015_nsp11_VIPR_ALG4_923094940_13394_13435_1_2015_06_24_SK_Human_MERS
ChinaGD01_nsp11_VIPR_ALG4_828177939_13404_13445_1_2015_05_27_China_Human_MERS
KSA_CAMEL_376_nsp11_VIPR_ALG4_620988567_13410_13451_1_2013_11_SA_Camel_MERS
KSA_CAMEL_378_nsp11_VIPR_ALG4_620988534_13410_13451_1_2013_11_SA_Camel_MERS
Camel_UAE_D1339_2_2014_nsp11_VIPR_ALG4_752855091_13132_13173_1_2014_06_UAE_Camel_MERS
England_3_2013_nsp11_VIPR_ALG4_746873507_13370_13411_1_2013_02_10_UK_Human_MERS
MERS_CoV_Jeddah_human_1_nsp11_VIPR_ALG4_570348515_13404_13445_1_2013_11_05_SA_Human_MERS
MERS_CoV_Jeddah_Camel_1_nsp11_VIPR_ALG4_570348503_13404_13445_1_2013_11_08_SA_Camel_MERS
FRA_UAE_nsp11_VIPR_ALG4_562738363_13292_13333_1_2013_05_07_France_Human_MERS
Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS
MERS_CoV_KOR_KNIH_002_05_2015_nsp11_VIPR_ALG4_829021051_13410_13451_1_2015_05_20_SK_Human_MERS
MERS_CoV_KOR_Seoul_050_1_2015_nsp11_VIPR_ALG4_1024848816_13410_13451_1_2015_06_11_SK_Human_MERS
England_Qatar_2012_nsp11_VIPR_ALG4_453061242_13410_13451_1_2012_09_19_UK_Human_MERS
Hafr_Al_Batin_2_2013_nsp11_VIPR_ALG4_582986847_13359_13400_1_2013_08_05_SA_Human_MERS
MERS_CoV_KOR_Seoul_169_2015_nsp11_VIPR_ALG4_1024848876_13410_13451_1_2015_06_26_SK_Human_MERS
MERS_CoV_KOR_Seoul_162_1_2015_nsp11_VIPR_ALG4_1024848864_13410_13451_1_2015_06_22_SK_Human_MERS
Hu_France_FRA2_130569_2013_IS_HTS_nsp11_VIPR_ALG4_732559248_13275_13316_1_2013_05_07_France_Human_MERS
Makkah_C9355_KSA_Makkah_2014_04_15_nsp11_VIPR_ALG4_674305012_13373_13414_1_2014_04_15_SA_Human_MERS
MERS_CoV_KOR_Seoul_177_3_2015_nsp11_VIPR_ALG4_1024848888_13410_13451_1_2015_07_03_SK_Human_MERS
Hu_France_UAE_FRA1_1627_2013_BAL_Sanger_nsp11_VIPR_ALG4_732559230_12862_12903_1_2013_04_26_France_Human_MERS
Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS
Hu_Hufuf_KSA_9158_2015_nsp11_VIPR_ALG4_972903350_13388_13429_1_2015_03_27_SA_Human_MERS
Riyadh_14_2013_nsp11_VIPR_ALG4_582986859_13359_13400_1_2013_08_15_SA_Human_MERS
Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS
Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS
Riyadh_1_2012_nsp11_VIPR_ALG4_540362577_13370_13411_1_2012_10_23_SA_Human_MERS
Riyadh_2014KSA_683_KSA_2014_nsp11_VIPR_ALG4_674305024_13302_13343_1_2014_04_22_SA_Human_MERS
Hu_Jeddah_KSA_C20843_2015_nsp11_VIPR_ALG4_972903314_13388_13429_1_2015_02_09_SA_Human_MERS
Hu_Najran_KSA_C20915_2015_nsp11_VIPR_ALG4_972903430_13274_13315_1_2015_02_13_SA_Human_MERS
Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS
Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS
Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS
Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS
Taif_1_2013_nsp11_VIPR_ALG4_582986883_13359_13400_1_2013_06_12_SA_Human_MERS
Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS
Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS
Hu_Riyadh_KSA_2466_2015_nsp11_VIPR_ALG4_823104977_13388_13429_1_2015_01_26_SA_Human_MERS
Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS
camel_Jeddah_D36_2014_nsp11_VIPR_ALG4_922057921_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS
Al_Hasa_17_2013_nsp11_VIPR_ALG4_540362791_13405_13446_1_2013_05_15_SA_Human_MERS
camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS
Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS
camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS
Al_Hasa_18_2013_nsp11_VIPR_ALG4_540362810_13410_13451_1_2013_05_23_SA_Human_MERS
Al_Hasa_3_2013_nsp11_VIPR_ALG4_511261316_13361_13402_1_2013_04_22_SA_Human_MERS
Jeddah_C10306_KSA_2014_04_20_nsp11_VIPR_ALG4_674305000_13304_13345_1_2014_04_21_SA_Human_MERS
camel_Jeddah_D48_2014_nsp11_VIPR_ALG4_922058017_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS
Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS
camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS
camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS
Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS
Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS
KFU_HKU_13_nsp11_VIPR_ALG4_612348149_13398_13439_1_2013_12_30_SA_Camel_MERS
Camel_UAE_D1243_12_2014_nsp11_VIPR_ALG4_752855103_13132_13173_1_2014_06_UAE_Camel_MERS
camel_Jeddah_Jd175_2015_nsp11_VIPR_ALG4_922058329_13410_13451_1_2015_02_SA_Camel_MERS
camel_Jeddah_Jd199_2015_nsp11_VIPR_ALG4_922058341_13410_13451_1_2015_02_SA_Camel_MERS
KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS
camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS
D2731_3_14_nsp11_VIPR_ALG4_959463834_13395_13436_1_NA_UAE_Camel_MERS
camel_Jeddah_Jd7_2015_nsp11_VIPR_ALG4_922058269_13410_13451_1_2015_01_SA_Camel_MERS
KOREA_Seoul_168_1_2015_nsp11_VIPR_ALG4_923094928_13394_13435_1_2015_06_21_SK_Human_MERS
England_1_nsp11_VIPR_ALG4_426205766_13409_13450_1_2012_09_11_UK_Human_MERS
Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS
camel_Jeddah_Jd90_2015_nsp11_VIPR_ALG4_922058317_13410_13451_1_2015_01_SA_Camel_MERS
;
end;
begin trees;
translate
1 Hu_Jeddah_KSA_C21271_2015_nsp11_VIPR_ALG4_972903326_13388_13429_1_2015_02_22_SA_Human_MERS,
2 Hu_Riyadh_KSA_3181_2015_nsp11_VIPR_ALG4_972903374_13388_13429_1_2015_02_15_SA_Human_MERS,
3 Al_Hasa_15_2013_nsp11_VIPR_ALG4_540362777_13361_13402_1_2013_05_11_SA_Human_MERS,
4 Indiana_USA_1_SA_2014_nsp11_VIPR_ALG4_633896550_13410_13451_1_2014_04_30_USA_Human_MERS,
5 Jeddah_1_2013_nsp11_VIPR_ALG4_597503887_13196_13237_1_2013_11_06_SA_Human_MERS,
6 Al_Hasa_12_2013_nsp11_VIPR_ALG4_540362657_13369_13410_1_2013_05_07_SA_Human_MERS,
7 Al_Hasa_19_2013_nsp11_VIPR_ALG4_540362698_13401_13442_1_2013_05_23_SA_Human_MERS,
8 Jeddah_C9055_KSA_2014_04_14_nsp11_VIPR_ALG4_674304988_13373_13414_1_2014_04_14_SA_Human_MERS,
9 Jeddah_C7770_KSA_2014_04_07_nsp11_VIPR_ALG4_674304964_13373_13414_1_2014_04_07_SA_Human_MERS,
10 Al_Hasa_2_2013_nsp11_VIPR_ALG4_511261292_13405_13446_1_2013_04_21_SA_Human_MERS,
11 Jeddah_C8826_KSA_2014_04_12_nsp11_VIPR_ALG4_674304976_13373_13414_1_2014_04_12_SA_Human_MERS,
12 Hu_Riyadh_KSA_2345_2015_nsp11_VIPR_ALG4_823104955_13388_13429_1_2015_01_21_SA_Human_MERS,
13 Jordan_N3_2012_nsp11_VIPR_ALG4_469569406_13364_13405_1_2012_04_Jordan_Human_MERS,
14 Al_Hasa_21_2013_nsp11_VIPR_ALG4_540362712_13368_13409_1_2013_05_30_SA_Human_MERS,
15 Bisha_1_2012_nsp11_VIPR_ALG4_540362614_13364_13405_1_2012_06_19_SA_Human_MERS,
16 KOREA_Seoul_014_2_2015_nsp11_VIPR_ALG4_923094892_13394_13435_1_2015_06_13_SK_Human_MERS,
17 KOREA_Seoul_014_1_2015_nsp11_VIPR_ALG4_923094880_13394_13435_1_2015_05_31_SK_Human_MERS,
18 Camel_UAE_D1164_10_2014_nsp11_VIPR_ALG4_752855055_13132_13173_1_2014_06_UAE_Camel_MERS,
19 KOREA_Seoul_035_1_2015_nsp11_VIPR_ALG4_923094904_13394_13435_1_2015_06_03_SK_Human_MERS,
20 KOREA_Seoul_035_2_2015_nsp11_VIPR_ALG4_923094916_13394_13435_1_2015_06_18_SK_Human_MERS,
21 Camel_Qatar_2_2014_nsp11_VIPR_ALG4_615796117_13409_13450_1_2014_02_16_Qatar_Camel_MERS,
22 Camel_UAE_D1209_2014_nsp11_VIPR_ALG4_752855115_13132_13173_1_NA_UAE_Camel_MERS,
23 Hu_Oman_2285_2013_nsp11_VIPR_ALG4_836600669_13410_13451_1_2013_10_28_Oman_Human_MERS,
24 KSA_CAMEL_363_nsp11_VIPR_ALG4_620988556_13410_13451_1_2013_11_SA_Camel_MERS,
25 KOREA_Seoul_168_2_2015_nsp11_VIPR_ALG4_923094940_13394_13435_1_2015_06_24_SK_Human_MERS,
26 ChinaGD01_nsp11_VIPR_ALG4_828177939_13404_13445_1_2015_05_27_China_Human_MERS,
27 KSA_CAMEL_376_nsp11_VIPR_ALG4_620988567_13410_13451_1_2013_11_SA_Camel_MERS,
28 KSA_CAMEL_378_nsp11_VIPR_ALG4_620988534_13410_13451_1_2013_11_SA_Camel_MERS,
29 Camel_UAE_D1339_2_2014_nsp11_VIPR_ALG4_752855091_13132_13173_1_2014_06_UAE_Camel_MERS,
30 England_3_2013_nsp11_VIPR_ALG4_746873507_13370_13411_1_2013_02_10_UK_Human_MERS,
31 MERS_CoV_Jeddah_human_1_nsp11_VIPR_ALG4_570348515_13404_13445_1_2013_11_05_SA_Human_MERS,
32 MERS_CoV_Jeddah_Camel_1_nsp11_VIPR_ALG4_570348503_13404_13445_1_2013_11_08_SA_Camel_MERS,
33 FRA_UAE_nsp11_VIPR_ALG4_562738363_13292_13333_1_2013_05_07_France_Human_MERS,
34 Abu_Dhabi_UAE_18_2014_nsp11_VIPR_ALG4_727377780_13410_13451_1_2014_04_10_UAE_Human_MERS,
35 MERS_CoV_KOR_KNIH_002_05_2015_nsp11_VIPR_ALG4_829021051_13410_13451_1_2015_05_20_SK_Human_MERS,
36 MERS_CoV_KOR_Seoul_050_1_2015_nsp11_VIPR_ALG4_1024848816_13410_13451_1_2015_06_11_SK_Human_MERS,
37 England_Qatar_2012_nsp11_VIPR_ALG4_453061242_13410_13451_1_2012_09_19_UK_Human_MERS,
38 Hafr_Al_Batin_2_2013_nsp11_VIPR_ALG4_582986847_13359_13400_1_2013_08_05_SA_Human_MERS,
39 MERS_CoV_KOR_Seoul_169_2015_nsp11_VIPR_ALG4_1024848876_13410_13451_1_2015_06_26_SK_Human_MERS,
40 MERS_CoV_KOR_Seoul_162_1_2015_nsp11_VIPR_ALG4_1024848864_13410_13451_1_2015_06_22_SK_Human_MERS,
41 Hu_France_FRA2_130569_2013_IS_HTS_nsp11_VIPR_ALG4_732559248_13275_13316_1_2013_05_07_France_Human_MERS,
42 Makkah_C9355_KSA_Makkah_2014_04_15_nsp11_VIPR_ALG4_674305012_13373_13414_1_2014_04_15_SA_Human_MERS,
43 MERS_CoV_KOR_Seoul_177_3_2015_nsp11_VIPR_ALG4_1024848888_13410_13451_1_2015_07_03_SK_Human_MERS,
44 Hu_France_UAE_FRA1_1627_2013_BAL_Sanger_nsp11_VIPR_ALG4_732559230_12862_12903_1_2013_04_26_France_Human_MERS,
45 Hu_Riyadh_KSA_2343_2015_nsp11_VIPR_ALG4_823104966_13388_13429_1_2015_01_21_SA_Human_MERS,
46 Hu_Hufuf_KSA_9158_2015_nsp11_VIPR_ALG4_972903350_13388_13429_1_2015_03_27_SA_Human_MERS,
47 Riyadh_14_2013_nsp11_VIPR_ALG4_582986859_13359_13400_1_2013_08_15_SA_Human_MERS,
48 Qatar4_nsp11_VIPR_ALG4_567322255_13396_13437_1_2013_10_17_Qatar_Human_MERS,
49 Abu_Dhabi_UAE_16_2014_nsp11_VIPR_ALG4_727377793_13410_13451_1_2014_04_10_UAE_Human_MERS,
50 Riyadh_1_2012_nsp11_VIPR_ALG4_540362577_13370_13411_1_2012_10_23_SA_Human_MERS,
51 Riyadh_2014KSA_683_KSA_2014_nsp11_VIPR_ALG4_674305024_13302_13343_1_2014_04_22_SA_Human_MERS,
52 Hu_Jeddah_KSA_C20843_2015_nsp11_VIPR_ALG4_972903314_13388_13429_1_2015_02_09_SA_Human_MERS,
53 Hu_Najran_KSA_C20915_2015_nsp11_VIPR_ALG4_972903430_13274_13315_1_2015_02_13_SA_Human_MERS,
54 Riyadh_9_2013_nsp11_VIPR_ALG4_582986811_13359_13400_1_2013_07_17_SA_Human_MERS,
55 Riyadh_5_2013_nsp11_VIPR_ALG4_582986871_13359_13400_1_2013_07_02_SA_Human_MERS,
56 Hu_Riyadh_KSA_2049_2015_nsp11_VIPR_ALG4_823104996_13388_13429_1_2015_01_06_SA_Human_MERS,
57 Abu_Dhabi_UAE_9_2013_nsp11_VIPR_ALG4_727377845_13410_13451_1_2013_11_15_UAE_Human_MERS,
58 Taif_1_2013_nsp11_VIPR_ALG4_582986883_13359_13400_1_2013_06_12_SA_Human_MERS,
59 Wadi_Ad_Dawasir_1_2013_nsp11_VIPR_ALG4_582986835_13359_13400_1_2013_06_12_SA_Human_MERS,
60 Abu_Dhabi_UAE_26_2014_nsp11_VIPR_ALG4_727377858_13410_13451_1_2014_04_13_UAE_Human_MERS,
61 Hu_Riyadh_KSA_2466_2015_nsp11_VIPR_ALG4_823104977_13388_13429_1_2015_01_26_SA_Human_MERS,
62 Abu_Dhabi_UAE_8_2014_nsp11_VIPR_ALG4_727377767_13410_13451_1_2014_04_07_UAE_Human_MERS,
63 camel_Jeddah_D36_2014_nsp11_VIPR_ALG4_922057921_13410_13451_1_2014_12_SA_Camel_MERS,
64 camel_Jeddah_D35_2014_nsp11_VIPR_ALG4_922057909_13410_13451_1_2014_12_SA_Camel_MERS,
65 Al_Hasa_17_2013_nsp11_VIPR_ALG4_540362791_13405_13446_1_2013_05_15_SA_Human_MERS,
66 camel_Jeddah_D38_b_2014_nsp11_VIPR_ALG4_922057933_13410_13451_1_2014_12_SA_Camel_MERS,
67 Abu_Dhabi_Gayathi_UAE_2_2014_nsp11_VIPR_ALG4_727377819_13410_13451_1_2014_03_07_UAE_Human_MERS,
68 camel_Jeddah_D40_2014_nsp11_VIPR_ALG4_922057945_13410_13451_1_2014_12_SA_Camel_MERS,
69 Al_Hasa_18_2013_nsp11_VIPR_ALG4_540362810_13410_13451_1_2013_05_23_SA_Human_MERS,
70 Al_Hasa_3_2013_nsp11_VIPR_ALG4_511261316_13361_13402_1_2013_04_22_SA_Human_MERS,
71 Jeddah_C10306_KSA_2014_04_20_nsp11_VIPR_ALG4_674305000_13304_13345_1_2014_04_21_SA_Human_MERS,
72 camel_Jeddah_D48_2014_nsp11_VIPR_ALG4_922058017_13410_13451_1_2014_12_SA_Camel_MERS,
73 camel_Jeddah_D47_2014_nsp11_VIPR_ALG4_922058005_13410_13451_1_2014_12_SA_Camel_MERS,
74 Al_Hasa_4_2013_nsp11_VIPR_ALG4_511261280_13374_13415_1_2013_05_01_SA_Human_MERS,
75 camel_Jeddah_D49_2014_nsp11_VIPR_ALG4_922058029_13410_13451_1_2014_12_SA_Camel_MERS,
76 camel_Jeddah_D50_b_2014_nsp11_VIPR_ALG4_922058041_13410_13451_1_2014_12_SA_Camel_MERS,
77 Camel_UAE_D1164_14_2014_nsp11_VIPR_ALG4_752855079_13132_13173_1_2014_06_UAE_Camel_MERS,
78 Abu_Dhabi_UAE_33_2014_nsp11_VIPR_ALG4_727377832_13410_13451_1_2014_04_17_UAE_Human_MERS,
79 KFU_HKU_13_nsp11_VIPR_ALG4_612348149_13398_13439_1_2013_12_30_SA_Camel_MERS,
80 Camel_UAE_D1243_12_2014_nsp11_VIPR_ALG4_752855103_13132_13173_1_2014_06_UAE_Camel_MERS,
81 camel_Jeddah_Jd175_2015_nsp11_VIPR_ALG4_922058329_13410_13451_1_2015_02_SA_Camel_MERS,
82 camel_Jeddah_Jd199_2015_nsp11_VIPR_ALG4_922058341_13410_13451_1_2015_02_SA_Camel_MERS,
83 KOREA_Seoul_163_1_2015_nsp11_VIPR_ALG4_923094868_13394_13435_1_2015_06_19_SK_Human_MERS,
84 camel_Jeddah_Jd1_b_2015_nsp11_VIPR_ALG4_922058233_13410_13451_1_2015_01_SA_Camel_MERS,
85 D2731_3_14_nsp11_VIPR_ALG4_959463834_13395_13436_1_NA_UAE_Camel_MERS,
86 camel_Jeddah_Jd7_2015_nsp11_VIPR_ALG4_922058269_13410_13451_1_2015_01_SA_Camel_MERS,
87 KOREA_Seoul_168_1_2015_nsp11_VIPR_ALG4_923094928_13394_13435_1_2015_06_21_SK_Human_MERS,
88 England_1_nsp11_VIPR_ALG4_426205766_13409_13450_1_2012_09_11_UK_Human_MERS,
89 Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS,
90 camel_Jeddah_Jd90_2015_nsp11_VIPR_ALG4_922058317_13410_13451_1_2015_01_SA_Camel_MERS
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:1.672979e-02,2:1.847950e-02,3:1.614990e-02,4:1.896928e-02,5:1.796492e-02,6:1.659990e-02,7:1.780985e-02,8:1.653216e-02,9:1.658875e-02,10:1.718134e-02,11:1.724934e-02,12:1.642984e-02,13:1.845854e-02,14:1.811609e-02,15:1.736760e-02,16:1.737158e-02,17:1.711511e-02,18:1.652027e-02,19:1.857993e-02,20:1.584827e-02,21:1.649421e-02,22:1.659352e-02,23:1.805148e-02,24:1.706815e-02,25:1.570343e-02,26:1.767452e-02,27:1.990148e-02,28:1.639473e-02,29:1.773408e-02,30:1.859334e-02,31:1.686184e-02,32:1.660715e-02,33:1.673986e-02,34:1.626504e-02,35:1.757692e-02,36:1.650863e-02,37:1.727346e-02,38:1.661048e-02,39:1.626877e-02,40:1.553816e-02,41:1.620209e-02,42:1.685989e-02,43:1.918014e-02,44:1.762288e-02,45:1.775761e-02,46:1.711126e-02,47:1.839611e-02,48:1.738701e-02,49:1.813866e-02,50:1.636055e-02,51:1.557659e-02,52:1.683474e-02,53:1.647416e-02,54:1.746808e-02,55:1.797511e-02,56:1.705603e-02,57:1.780059e-02,58:1.718275e-02,59:1.748835e-02,60:1.658608e-02,61:1.742118e-02,62:1.698193e-02,63:1.524052e-02,64:1.706365e-02,65:1.647883e-02,66:1.774264e-02,67:1.677392e-02,68:1.857664e-02,69:1.749101e-02,70:1.799572e-02,71:1.618443e-02,72:1.794137e-02,73:1.809093e-02,74:1.793340e-02,75:1.803630e-02,76:1.614543e-02,77:1.708149e-02,78:1.621382e-02,79:1.771981e-02,80:1.695689e-02,81:1.939881e-02,82:1.682363e-02,83:1.787094e-02,84:1.623155e-02,85:1.863554e-02,86:1.668661e-02,87:1.702006e-02,88:1.673854e-02,89:1.951338e-02,90:1.806494e-02);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:1.672979e-02,2:1.847950e-02,3:1.614990e-02,4:1.896928e-02,5:1.796492e-02,6:1.659990e-02,7:1.780985e-02,8:1.653216e-02,9:1.658875e-02,10:1.718134e-02,11:1.724934e-02,12:1.642984e-02,13:1.845854e-02,14:1.811609e-02,15:1.736760e-02,16:1.737158e-02,17:1.711511e-02,18:1.652027e-02,19:1.857993e-02,20:1.584827e-02,21:1.649421e-02,22:1.659352e-02,23:1.805148e-02,24:1.706815e-02,25:1.570343e-02,26:1.767452e-02,27:1.990148e-02,28:1.639473e-02,29:1.773408e-02,30:1.859334e-02,31:1.686184e-02,32:1.660715e-02,33:1.673986e-02,34:1.626504e-02,35:1.757692e-02,36:1.650863e-02,37:1.727346e-02,38:1.661048e-02,39:1.626877e-02,40:1.553816e-02,41:1.620209e-02,42:1.685989e-02,43:1.918014e-02,44:1.762288e-02,45:1.775761e-02,46:1.711126e-02,47:1.839611e-02,48:1.738701e-02,49:1.813866e-02,50:1.636055e-02,51:1.557659e-02,52:1.683474e-02,53:1.647416e-02,54:1.746808e-02,55:1.797511e-02,56:1.705603e-02,57:1.780059e-02,58:1.718275e-02,59:1.748835e-02,60:1.658608e-02,61:1.742118e-02,62:1.698193e-02,63:1.524052e-02,64:1.706365e-02,65:1.647883e-02,66:1.774264e-02,67:1.677392e-02,68:1.857664e-02,69:1.749101e-02,70:1.799572e-02,71:1.618443e-02,72:1.794137e-02,73:1.809093e-02,74:1.793340e-02,75:1.803630e-02,76:1.614543e-02,77:1.708149e-02,78:1.621382e-02,79:1.771981e-02,80:1.695689e-02,81:1.939881e-02,82:1.682363e-02,83:1.787094e-02,84:1.623155e-02,85:1.863554e-02,86:1.668661e-02,87:1.702006e-02,88:1.673854e-02,89:1.951338e-02,90:1.806494e-02);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -57.64 -60.60
2 -57.64 -60.10
--------------------------------------
TOTAL -57.64 -60.38
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.807984 90.333854 0.000164 28.764700 5.735977 967.45 1028.50 1.000
r(A<->C){all} 0.165654 0.021068 0.000064 0.455182 0.123415 125.04 149.37 1.000
r(A<->G){all} 0.170900 0.018980 0.000083 0.433835 0.136099 124.89 132.60 1.000
r(A<->T){all} 0.151770 0.015273 0.000071 0.388614 0.125407 63.31 106.76 1.000
r(C<->G){all} 0.165822 0.018151 0.000039 0.444862 0.132736 116.46 122.07 1.006
r(C<->T){all} 0.167028 0.017793 0.000033 0.426189 0.139534 82.30 94.54 1.010
r(G<->T){all} 0.178825 0.022848 0.000025 0.478007 0.137987 126.63 141.55 1.000
pi(A){all} 0.259969 0.003852 0.143177 0.381620 0.257616 626.84 639.65 1.000
pi(C){all} 0.173732 0.002799 0.072980 0.272028 0.170368 413.96 587.62 1.000
pi(G){all} 0.195107 0.003215 0.092837 0.311387 0.190615 547.99 604.85 1.000
pi(T){all} 0.371192 0.004718 0.234261 0.500150 0.371798 617.62 637.33 1.000
alpha{1,2} 0.907621 1.022300 0.000028 2.861831 0.567431 772.01 782.94 1.002
alpha{3} 0.952881 0.921427 0.000589 2.884986 0.670476 562.48 798.47 1.001
pinvar{all} 0.938101 0.019642 0.757651 0.999936 0.977153 118.08 122.32 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
[2J[H /HYPHY 2.3.14.20190214beta(MP) for Linux on x86_64\ ***************** TYPES OF STANDARD ANALYSES ***************** (1) Selection Analyses (2) Evolutionary Hypothesis Testing (3) Relative evolutionary rate inference (4) Coevolutionary analysis (5) Basic Analyses (6) Codon Selection Analyses (7) Compartmentalization (8) Data File Tools (9) Miscellaneous (10) Model Comparison (11) Kernel Analysis Tools (12) Molecular Clock (13) Phylogeny Reconstruction (14) Positive Selection (15) Recombination (16) Selection/Recombination (17) Relative Rate (18) Relative Ratio (19) Substitution Rates Please select type of analyses you want to list (or press ENTER to process custom batch file):[2J[H***************** FILES IN 'Selection Analyses' ***************** (1) [MEME] Test for episodic site-level selection using MEME (Mixed Effects Model of Evolution). (2) [FEL] Test for pervasive site-level selection using FEL (Fixed Effects Likelihood). (3) [SLAC] Test for pervasive site-level selection using SLAC (Single Likelihood Ancestor Counting). (4) [FUBAR] Test for pervasive site-level selection using FUBAR (Fast Unconstrained Bayesian AppRoximation for inferring selection). (5) [BUSTED] Test for episodic gene-wide selection using BUSTED (Branch-site Unrestricted Statistical Test of Episodic Diversification). (6) [aBSREL] Test for lineage-specific evolution using the branch-site method aBS-REL (Adaptive Branch-Site Random Effects Likelihood). (7) [RELAX] Test for relaxation of selection pressure along a specified set of test branches using RELAX (a random effects test of selection relaxation). Please select the analysis you would like to perform (or press ENTER to return to the list of analysis types): Analysis Description -------------------- Perform a Fast Unbiased AppRoximate Bayesian (FUBAR) analysis of a coding sequence alignment to determine whether some sites have been subject to pervasive purifying or diversifying selection. v2.1 introduces two more methods for estimating the posterior distribution of grid weights: collapsed Gibbs MCMC (faster) and 0-th order Variation Bayes approximation (fastest). Please note that a FUBAR analysis generates a cache and a results JSON file in the same directory as directory as the original alignment. HyPhy needs to have write privileges to this directory. For example if the original file is in /home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there will also exist FUBAR-generated files /home/sergei/FUBAR/data/pol.nex.FUBAR.json, /home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also provide checkpointing so that a partially completed analysis can be restarted. - __Requirements__: in-frame codon alignment (possibly partitioned) and a phylogenetic tree (one per partition) - __Citation__: FUBAR: a fast, unconstrained bayesian approximation for inferring selection (2013), Mol Biol Evol. 30(5):1196-205 - __Written by__: Sergei L Kosakovsky Pond - __Contact Information__: spond@temple.edu - __Analysis Version__: 2.1 ####Choose Genetic Code 1. [**Universal**] Universal code. (Genebank transl_table=1). 2. [**Vertebrate mtDNA**] Vertebrate mitochondrial DNA code. (Genebank transl_table=2). 3. [**Yeast mtDNA**] Yeast mitochondrial DNA code. (Genebank transl_table=3). 4. [**Mold/Protozoan mtDNA**] Mold, Protozoan and Coelenterate mitochondrial DNA and the Mycloplasma/Spiroplasma code. (Genebank transl_table=4). 5. [**Invertebrate mtDNA**] Invertebrate mitochondrial DNA code. (Genebank transl_table=5). 6. [**Ciliate Nuclear**] Ciliate, Dasycladacean and Hexamita Nuclear code. (Genebank transl_table=6). 7. [**Echinoderm mtDNA**] Echinoderm mitochondrial DNA code. (Genebank transl_table=9). 8. [**Euplotid Nuclear**] Euplotid Nuclear code. (Genebank transl_table=10). 9. [**Alt. Yeast Nuclear**] Alternative Yeast Nuclear code. (Genebank transl_table=12). 10. [**Ascidian mtDNA**] Ascidian mitochondrial DNA code. (Genebank transl_table=13). 11. [**Flatworm mtDNA**] Flatworm mitochondrial DNA code. (Genebank transl_table=14). 12. [**Blepharisma Nuclear**] Blepharisma Nuclear code. (Genebank transl_table=15). 13. [**Chlorophycean mtDNA**] Chlorophycean Mitochondrial Code (transl_table=16). 14. [**Trematode mtDNA**] Trematode Mitochondrial Code (transl_table=21). 15. [**Scenedesmus obliquus mtDNA**] Scenedesmus obliquus mitochondrial Code (transl_table=22). 16. [**Thraustochytrium mtDNA**] Thraustochytrium Mitochondrial Code (transl_table=23). 17. [**Pterobranchia mtDNA**] Pterobranchia Mitochondrial Code (transl_table=24). 18. [**SR1 and Gracilibacteria**] Candidate Division SR1 and Gracilibacteria Code (transl_table=25). 19. [**Pachysolen Nuclear**] Pachysolen tannophilus Nuclear Code (transl_table=26). >Please choose an option (or press q to cancel selection): >Select a coding sequence alignment file (`/usr/local/lib/hyphy/TemplateBatchFiles/SelectionAnalyses/`) >A tree was found in the data file: `(C52,C65,C10,C67,C68,C9,C14,C73,C72,C17,C74,C59,C75,C16,C21,C80,C79,C24,C81,C82,C23,C28,C58,C87,C86,C31,C88,C89,C30,C35,C94,C93,C38,C3,C95,C96,C37,C42,C101,C100,C45,C102,C103,C44,C60,C49,C108,C107,C1,C109,C110,C51,C56,C115,C114,C61,C8,C116,C117,C4,C64,C6,C123,C122,C12,C124,C2,C125,C15,C18,C69,C131,C130,C20,C132,C133,C25,C7,C77,C29,C139,C138,C83,C140,C32,C142,C85,C33,C66,C147)` >Would you like to use it (y/n)? >Loaded a multiple sequence alignment with **90** sequences, **14** codons, and **1** partitions from `/data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/results/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1.fna` > FUBAR will write cache and result files to _/data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/results/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1.fna.FUBAR.cache_ and _/data//pss_subsets/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result/original_alignment/fubar/results/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1/Hu_Riyadh_KSA_4050_2015_nsp11_VIPR_ALG4_828436888_13407_13448_1_2015_03_01_SA_Human_MERS.result.1.fna.FUBAR.json_, respectively > Number of grid points per dimension (total number is D^2) (permissible range = [5,50], default value = 20, integer): ####Posterior estimation method 1. [**Metropolis-Hastings**] Full Metropolis-Hastings MCMC algorithm (slowest, original 2013 paper implementation) 2. [**Collapsed Gibbs**] Collapsed Gibbs sampler (intermediate speed) 3. [**Variational Bayes**] 0-th order Variational Bayes approximations (fastest, recommended default) >Please choose an option (or press q to cancel selection):> The concentration parameter of the Dirichlet prior (permissible range = [0.001,1], default value = 0.5): ### Obtaining branch lengths and nucleotide substitution biases under the nucleotide GTR model * Log(L) = -55.99, AIC-c = 313.25 (98 estimated parameters) * Tree length (expected substitutions/site) for partition 1 : 0.000 ### Computing the phylogenetic likelihood function on the grid * Determining appropriate tree scaling based on the best score from a 20 x 20 rate grid * Best scaling achieved for * synonymous rate = 0.000 * non-synonymous rate = 0.000 * Computing conditional site likelihoods on a 20 x 20 rate grid ### Running an iterative zeroth order variational Bayes procedure to estimate the posterior mean of rate weights * Using the following settings * Dirichlet alpha : 0.5 ### Tabulating site-level results ---- ## FUBAR inferred no sites under subject to positive selection at posterior probability >= 0.9
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken # ### General parameters ### # # The maximum number of sequences to use for the master file sequence_limit=90 # The random seed random_seed=3976763 # ### Alignment ### # # The alignment method: clustalw, muscle, kalign, t_coffee, or amap align_method=muscle # Minimum support value for amino acid positions in the alignment tcoffee_min_score=3 # ### MrBayes ### # # Number of iterations in MrBayes mrbayes_generations=1000000 # MrBayes burnin mrbayes_burnin=2500 # ### FUBAR ### # # The maximum number of sequences to be used by FUBAR. #fubar_sequence_limit=90 # The number of FUBAR runs #fubar_runs=1 # ### codeML ### # # The maximum number of sequences to be used by CodeML codeml_sequence_limit=30 # The number of CodeML runs codeml_runs=1 # The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'. codeml_models=1 2 7 8 # ### OmegaMap ### # # The maximum number of sequences to use in OmegaMap omegamap_sequence_limit=90 # The number of OmegaMap runs omegamap_runs=1 # The number of OmegaMap iterations omegamap_iterations=2500
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
