--- EXPERIMENT NOTES
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken
#
### General parameters ###
#
# The maximum number of sequences to use for the master file
sequence_limit=90
# The random seed
random_seed=3976763
#
### Alignment ###
#
# The alignment method: clustalw, muscle, kalign, t_coffee, or amap
align_method=muscle
# Minimum support value for amino acid positions in the alignment
tcoffee_min_score=3
#
### MrBayes ###
#
# Number of iterations in MrBayes
mrbayes_generations=1000000
# MrBayes burnin
mrbayes_burnin=2500
#
### FUBAR ###
#
# The maximum number of sequences to be used by FUBAR.
fubar_sequence_limit=90
# The number of FUBAR runs
fubar_runs=1
#
### codeML ###
#
# The maximum number of sequences to be used by CodeML
codeml_sequence_limit=30
# The number of CodeML runs
codeml_runs=1
# The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'.
codeml_models=1 2 7 8
#
### OmegaMap ###
#
# The maximum number of sequences to use in OmegaMap
omegamap_sequence_limit=90
# The number of OmegaMap runs
omegamap_runs=1
# The number of OmegaMap iterations
omegamap_iterations=2500
--- EXPERIMENT PROPERTIES
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -72.05 -74.47
2 -72.07 -74.78
--------------------------------------
TOTAL -72.06 -74.64
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 9.060323 101.864467 0.000003 29.013160 5.884873 1017.15 1233.78 1.000
r(A<->C){all} 0.165592 0.018922 0.000266 0.435340 0.129797 215.70 219.74 1.000
r(A<->G){all} 0.161673 0.017703 0.000015 0.425335 0.129403 138.29 143.64 1.000
r(A<->T){all} 0.156101 0.019405 0.000030 0.447208 0.113951 113.26 258.98 1.004
r(C<->G){all} 0.171670 0.019629 0.000149 0.451438 0.139285 205.80 218.84 1.000
r(C<->T){all} 0.184021 0.023248 0.000064 0.491020 0.143781 135.99 183.63 1.009
r(G<->T){all} 0.160944 0.018572 0.000031 0.441283 0.123745 90.75 126.98 1.000
pi(A){all} 0.253509 0.003285 0.147406 0.369375 0.251334 774.36 809.19 1.000
pi(C){all} 0.218975 0.002935 0.119419 0.325882 0.216659 1040.30 1051.19 1.000
pi(G){all} 0.291540 0.003828 0.169117 0.407766 0.290671 826.83 936.90 1.002
pi(T){all} 0.235976 0.003257 0.132748 0.352200 0.231704 1005.26 1005.69 1.001
alpha{1,2} 0.919965 0.987703 0.000221 2.845420 0.599634 1068.82 1144.92 1.000
alpha{3} 0.938031 0.953241 0.000064 2.806031 0.636980 998.71 1025.89 1.000
pinvar{all} 0.937445 0.021866 0.636041 0.999970 0.981684 86.72 155.66 1.013
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
--- CODEML SUMMARY
-- Starting log on Fri Oct 21 22:38:33 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.05 sec, SCORE=1000, Nseq=4, Len=17
C1 STDQAYLNGQGALVQLD
C2 STDQAYLNGQGALVQLD
C3 STDQAYLNGQGALVQLD
C4 STDQAYLNGQGALVQLD
*****************
-- Starting log on Fri Oct 21 22:39:02 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=4, Len=17
C1 STDQAYLNGQGALVQLD
C2 STDQAYLNGQGALVQLD
C3 STDQAYLNGQGALVQLD
C4 STDQAYLNGQGALVQLD
*****************
-- Starting log on Fri Oct 21 22:38:33 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.05 sec, SCORE=1000, Nseq=4, Len=17
C1 STDQAYLNGQGALVQLD
C2 STDQAYLNGQGALVQLD
C3 STDQAYLNGQGALVQLD
C4 STDQAYLNGQGALVQLD
*****************
-- Starting log on Fri Oct 21 22:48:11 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/gapped_alignment/fubar,HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1--
MrBayes v3.2.6 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/mrbayes_input.nex"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 4 taxa and 51 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1666392498
Setting output file names to "/data/mrbayes_input.nex.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called 'first_pos'
Defining charset called 'second_pos'
Defining charset called 'third_pos'
Defining partition called 'by_codon'
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 743589307
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 8330645367
Seed = 691855883
Swapseed = 1666392498
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Active parameters:
Partition(s)
Parameters 1 2 3
---------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
---------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:GammaDir(1.0,0.1000,1.0,1.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.00 % Dirichlet(Revmat{all})
1.00 % Slider(Revmat{all})
1.00 % Dirichlet(Pi{all})
1.00 % Slider(Pi{all})
2.00 % Multiplier(Alpha{1,2})
2.00 % Multiplier(Alpha{3})
2.00 % Slider(Pinvar{all})
10.00 % ExtSPR(Tau{all},V{all})
10.00 % NNI(Tau{all},V{all})
10.00 % ParsSPR(Tau{all},V{all})
40.00 % Multiplier(V{all})
14.00 % Nodeslider(V{all})
6.00 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -75.590765 -- 13.556448
Chain 2 -- -75.590765 -- 13.556448
Chain 3 -- -75.590765 -- 13.556448
Chain 4 -- -75.590765 -- 13.556448
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -75.590765 -- 13.556448
Chain 2 -- -75.590765 -- 13.556448
Chain 3 -- -75.590765 -- 13.556448
Chain 4 -- -75.590765 -- 13.556448
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-75.591] (-75.591) (-75.591) (-75.591) * [-75.591] (-75.591) (-75.591) (-75.591)
1000 -- (-72.245) (-72.117) [-75.488] (-74.036) * (-73.702) [-71.286] (-73.320) (-72.445) -- 0:00:00
2000 -- (-72.111) (-72.851) (-74.121) [-75.635] * [-70.780] (-76.395) (-74.036) (-72.766) -- 0:00:00
3000 -- (-72.844) (-71.541) (-84.083) [-72.821] * [-71.337] (-71.607) (-76.421) (-75.261) -- 0:00:00
4000 -- (-75.536) (-73.231) (-73.765) [-71.585] * (-72.378) (-76.795) (-74.615) [-72.140] -- 0:00:00
5000 -- [-73.963] (-78.800) (-77.292) (-74.863) * (-72.390) (-74.501) (-73.450) [-73.741] -- 0:00:00
Average standard deviation of split frequencies: 0.104757
6000 -- (-74.255) (-72.297) [-71.550] (-73.853) * (-75.340) [-72.130] (-77.265) (-75.093) -- 0:00:00
7000 -- (-72.505) (-73.109) [-71.612] (-73.636) * (-70.807) [-71.390] (-72.644) (-71.811) -- 0:00:00
8000 -- (-72.030) (-75.437) [-73.185] (-75.952) * (-78.012) (-76.447) (-73.437) [-72.111] -- 0:00:00
9000 -- (-72.814) (-75.553) [-73.143] (-71.964) * [-79.415] (-85.178) (-73.985) (-71.306) -- 0:00:00
10000 -- (-72.939) [-71.876] (-74.885) (-72.259) * (-79.227) (-76.163) (-74.679) [-71.102] -- 0:00:00
Average standard deviation of split frequencies: 0.206239
11000 -- (-73.979) [-71.456] (-73.404) (-71.423) * (-83.384) (-75.631) [-72.577] (-73.637) -- 0:01:29
12000 -- (-74.560) [-72.283] (-74.724) (-71.739) * (-72.068) (-76.173) (-72.887) [-72.676] -- 0:01:22
13000 -- (-73.484) [-74.607] (-73.939) (-71.142) * (-74.679) (-74.879) (-72.232) [-71.072] -- 0:01:15
14000 -- (-73.657) [-74.004] (-75.988) (-71.944) * (-72.913) (-72.962) [-72.596] (-74.299) -- 0:01:10
15000 -- (-75.226) [-72.480] (-75.890) (-72.186) * (-71.395) (-72.462) [-74.319] (-73.981) -- 0:01:05
Average standard deviation of split frequencies: 0.058926
16000 -- (-78.047) [-77.694] (-72.963) (-72.302) * (-73.641) (-70.856) (-71.974) [-73.591] -- 0:01:01
17000 -- (-74.753) [-72.919] (-73.152) (-73.219) * (-72.874) (-72.967) [-72.466] (-73.377) -- 0:00:57
18000 -- (-73.197) [-76.564] (-73.372) (-71.629) * (-71.462) (-71.659) [-72.009] (-77.411) -- 0:00:54
19000 -- (-72.753) [-72.058] (-74.352) (-74.687) * (-73.829) (-73.018) [-71.626] (-74.255) -- 0:00:51
20000 -- (-74.974) [-70.551] (-73.113) (-74.244) * (-72.645) (-72.103) [-72.257] (-73.382) -- 0:00:49
Average standard deviation of split frequencies: 0.045620
21000 -- (-73.913) [-71.871] (-72.520) (-76.023) * (-73.086) (-72.508) [-74.281] (-73.437) -- 0:00:46
22000 -- (-74.625) [-73.871] (-70.980) (-73.276) * (-74.178) (-71.522) (-75.940) [-76.279] -- 0:00:44
23000 -- (-77.233) [-71.409] (-71.799) (-73.970) * (-72.933) (-73.153) [-71.931] (-73.889) -- 0:01:24
24000 -- (-74.367) [-73.502] (-71.708) (-72.470) * (-72.740) (-71.124) [-73.035] (-74.575) -- 0:01:21
25000 -- (-76.234) [-75.406] (-72.190) (-71.293) * (-77.473) (-72.125) (-74.473) [-74.046] -- 0:01:18
Average standard deviation of split frequencies: 0.024175
26000 -- (-75.012) [-73.434] (-71.860) (-71.552) * (-73.830) (-76.853) (-74.139) [-73.075] -- 0:01:14
27000 -- (-77.350) [-74.689] (-75.513) (-76.047) * (-77.573) (-71.562) (-75.820) [-73.664] -- 0:01:12
28000 -- (-75.094) [-71.122] (-74.528) (-71.491) * (-72.483) [-72.706] (-76.989) (-70.996) -- 0:01:09
29000 -- (-79.696) [-71.210] (-73.827) (-75.459) * (-78.618) (-76.189) (-73.319) [-71.268] -- 0:01:06
30000 -- (-80.964) [-73.541] (-73.241) (-73.905) * (-73.794) (-73.049) (-73.274) [-73.291] -- 0:01:04
Average standard deviation of split frequencies: 0.040992
31000 -- (-79.421) [-73.375] (-73.624) (-74.215) * (-74.435) (-77.109) (-76.203) [-71.981] -- 0:01:02
32000 -- (-74.670) [-71.427] (-74.138) (-71.933) * (-73.032) (-73.497) (-73.568) [-73.166] -- 0:01:00
33000 -- (-75.311) [-73.762] (-72.300) (-72.610) * (-74.522) (-75.121) (-72.103) [-71.589] -- 0:00:58
34000 -- (-75.177) [-70.764] (-73.196) (-74.644) * (-71.906) (-77.095) (-74.393) [-72.270] -- 0:00:56
35000 -- (-72.970) (-72.255) (-72.123) [-73.559] * (-75.274) (-72.494) (-71.952) [-71.283] -- 0:00:55
Average standard deviation of split frequencies: 0.052378
36000 -- (-71.706) [-72.425] (-70.903) (-73.125) * (-70.751) (-70.916) (-70.897) [-73.114] -- 0:01:20
37000 -- (-71.872) [-71.092] (-71.495) (-71.601) * (-71.259) (-71.397) (-72.277) [-71.186] -- 0:01:18
38000 -- (-71.381) [-71.336] (-71.037) (-77.007) * (-72.033) (-73.028) (-72.694) [-70.714] -- 0:01:15
39000 -- (-73.630) [-71.894] (-72.854) (-71.813) * (-76.352) (-72.306) (-71.357) [-70.774] -- 0:01:13
40000 -- (-71.510) [-72.738] (-74.691) (-73.545) * (-77.643) (-71.538) (-72.409) [-71.203] -- 0:01:12
Average standard deviation of split frequencies: 0.054096
41000 -- (-71.668) (-70.784) (-73.961) [-70.710] * (-72.703) (-72.288) (-74.833) [-72.426] -- 0:01:10
42000 -- (-71.484) [-74.131] (-72.411) (-72.762) * (-71.571) (-73.985) (-74.482) [-72.276] -- 0:01:08
43000 -- (-73.010) [-73.348] (-72.825) (-71.904) * (-75.363) (-71.936) (-72.554) [-72.396] -- 0:01:06
44000 -- (-72.399) [-71.099] (-71.477) (-73.885) * (-76.227) (-71.897) (-71.357) [-72.322] -- 0:01:05
45000 -- [-70.964] (-76.467) (-72.030) (-72.343) * (-72.648) (-71.856) (-72.050) [-72.221] -- 0:01:03
Average standard deviation of split frequencies: 0.054656
46000 -- (-72.706) [-72.097] (-72.033) (-72.183) * (-71.950) (-73.121) (-76.467) [-70.732] -- 0:01:02
47000 -- (-71.860) [-74.447] (-72.338) (-74.173) * (-71.650) (-74.814) [-75.628] (-71.687) -- 0:01:00
48000 -- (-74.263) [-72.203] (-73.909) (-72.357) * (-72.955) (-76.416) (-70.633) [-72.624] -- 0:01:19
49000 -- (-75.574) [-74.414] (-72.787) (-72.581) * (-72.227) (-76.299) (-71.692) [-72.074] -- 0:01:17
50000 -- (-76.078) [-72.758] (-71.398) (-70.509) * (-72.731) (-76.317) (-74.801) [-70.605] -- 0:01:16
Average standard deviation of split frequencies: 0.031013
51000 -- (-70.457) [-71.492] (-71.747) (-70.760) * (-79.389) (-83.126) (-71.633) [-72.002] -- 0:01:14
52000 -- (-72.435) [-72.231] (-71.900) (-71.779) * (-75.773) (-72.181) (-72.363) [-72.241] -- 0:01:12
53000 -- (-74.705) [-71.228] (-71.928) (-70.733) * (-71.560) (-72.722) (-72.431) [-73.349] -- 0:01:11
54000 -- (-72.792) [-73.931] (-73.598) (-72.804) * (-73.139) (-73.720) (-71.336) [-72.039] -- 0:01:10
55000 -- (-73.101) [-72.617] (-71.990) (-75.024) * (-71.021) (-74.972) (-71.876) [-71.914] -- 0:01:08
Average standard deviation of split frequencies: 0.039284
56000 -- (-72.575) [-70.827] (-73.725) (-72.812) * (-72.597) (-73.244) (-71.715) [-71.287] -- 0:01:07
57000 -- (-71.836) [-72.594] (-73.793) (-71.032) * (-76.084) (-73.186) (-72.293) [-71.039] -- 0:01:06
58000 -- (-72.645) [-70.799] (-75.837) (-74.835) * (-70.780) (-70.869) (-72.368) [-74.074] -- 0:01:04
59000 -- (-71.366) [-73.660] (-73.202) (-71.214) * (-71.760) (-72.076) (-71.321) [-74.006] -- 0:01:03
60000 -- (-71.473) [-75.972] (-74.399) (-73.222) * (-72.581) (-72.963) (-72.251) [-72.314] -- 0:01:18
Average standard deviation of split frequencies: 0.051803
61000 -- (-71.911) (-73.291) [-74.279] (-75.123) * (-70.521) (-72.658) (-71.557) [-70.736] -- 0:01:16
62000 -- (-72.384) [-73.323] (-73.253) (-70.542) * (-73.362) (-71.826) (-73.554) [-71.906] -- 0:01:15
63000 -- (-73.220) [-73.555] (-74.243) (-73.644) * (-71.401) [-70.963] (-73.197) (-75.292) -- 0:01:14
64000 -- (-72.366) [-72.560] (-73.109) (-71.591) * (-77.754) (-72.247) (-73.963) [-72.604] -- 0:01:13
65000 -- (-77.866) [-72.725] (-74.668) (-71.429) * (-75.076) (-72.089) (-71.786) [-72.627] -- 0:01:11
Average standard deviation of split frequencies: 0.057140
66000 -- (-73.661) [-73.910] (-75.839) (-75.557) * (-72.356) [-72.473] (-72.312) (-76.324) -- 0:01:10
67000 -- (-71.894) [-72.470] (-79.525) (-75.697) * (-71.796) (-72.210) (-76.119) [-72.076] -- 0:01:09
68000 -- (-71.732) (-76.292) (-72.798) [-72.400] * (-72.344) (-71.570) (-73.283) [-70.696] -- 0:01:08
69000 -- (-73.336) [-74.838] (-71.091) (-75.288) * (-73.656) (-72.472) (-71.846) [-75.870] -- 0:01:07
70000 -- (-74.756) [-71.385] (-76.577) (-74.063) * (-72.189) (-74.412) (-75.281) [-73.785] -- 0:01:06
Average standard deviation of split frequencies: 0.048919
71000 -- (-73.456) (-72.441) [-71.959] (-71.624) * (-71.261) (-73.832) (-72.031) [-71.305] -- 0:01:05
72000 -- (-73.516) [-73.447] (-72.378) (-74.131) * (-77.371) (-75.274) (-76.154) [-72.738] -- 0:01:17
73000 -- (-71.291) [-70.809] (-74.828) (-71.138) * (-73.159) (-75.662) (-79.480) [-70.955] -- 0:01:16
74000 -- (-70.758) [-74.456] (-73.952) (-73.142) * (-73.416) (-71.611) (-73.672) [-71.093] -- 0:01:15
75000 -- (-73.696) [-72.680] (-76.465) (-75.262) * (-72.174) (-73.356) (-71.060) [-71.668] -- 0:01:14
Average standard deviation of split frequencies: 0.049622
76000 -- (-72.683) (-71.203) (-72.633) [-71.740] * (-71.933) (-72.612) (-76.191) [-75.002] -- 0:01:12
77000 -- (-72.398) (-70.614) [-75.484] (-74.889) * (-72.374) (-74.428) (-71.370) [-71.589] -- 0:01:11
78000 -- (-73.369) (-73.192) (-72.619) [-70.720] * (-71.719) (-76.562) (-73.445) [-73.938] -- 0:01:10
79000 -- (-73.573) [-72.443] (-74.283) (-71.980) * (-72.251) (-70.895) (-72.799) [-70.845] -- 0:01:09
80000 -- [-72.455] (-71.440) (-76.051) (-73.926) * [-71.330] (-73.252) (-72.483) (-78.766) -- 0:01:09
Average standard deviation of split frequencies: 0.046751
81000 -- (-76.100) [-71.179] (-74.973) (-74.611) * (-73.054) (-71.837) (-76.022) [-73.286] -- 0:01:08
82000 -- (-73.365) (-72.561) [-71.953] (-74.843) * (-74.445) (-73.984) (-77.393) [-71.587] -- 0:01:07
83000 -- (-72.922) (-71.895) [-70.676] (-72.949) * (-72.505) (-74.075) (-73.101) [-71.910] -- 0:01:06
84000 -- [-73.801] (-72.219) (-70.880) (-77.459) * (-71.075) (-77.082) (-72.180) [-74.084] -- 0:01:16
85000 -- (-74.655) (-71.775) (-71.533) [-73.814] * (-71.451) (-73.114) (-72.710) [-75.308] -- 0:01:15
Average standard deviation of split frequencies: 0.043852
86000 -- (-72.144) [-73.952] (-71.304) (-71.747) * (-72.032) (-73.886) (-72.891) [-76.446] -- 0:01:14
87000 -- (-77.107) (-72.970) (-72.238) [-73.798] * (-71.304) [-72.220] (-71.150) (-75.590) -- 0:01:13
88000 -- (-78.276) [-78.495] (-71.935) (-70.961) * (-72.022) (-72.887) (-73.701) [-71.020] -- 0:01:12
89000 -- [-73.961] (-72.552) (-73.157) (-71.604) * (-75.000) (-71.807) (-72.945) [-71.863] -- 0:01:11
90000 -- (-73.184) (-72.952) [-74.111] (-71.827) * (-72.465) (-72.193) (-75.095) [-71.459] -- 0:01:10
Average standard deviation of split frequencies: 0.041595
91000 -- (-73.161) (-76.286) (-72.067) [-74.455] * (-74.197) (-71.292) (-71.124) [-76.492] -- 0:01:09
92000 -- (-74.747) (-72.202) (-72.653) [-72.595] * (-71.896) (-74.536) (-76.003) [-75.487] -- 0:01:09
93000 -- (-73.984) (-72.573) [-72.356] (-71.828) * (-72.865) [-72.244] (-70.650) (-73.145) -- 0:01:08
94000 -- (-72.760) (-71.838) [-71.434] (-74.977) * (-73.629) (-70.619) (-72.401) [-73.154] -- 0:01:07
95000 -- (-72.416) (-77.903) [-71.894] (-78.884) * [-71.927] (-71.852) (-71.800) (-74.737) -- 0:01:06
Average standard deviation of split frequencies: 0.036010
96000 -- (-71.857) (-73.819) [-74.060] (-74.609) * (-73.391) (-74.382) (-75.496) [-73.458] -- 0:01:05
97000 -- [-73.639] (-75.641) (-75.356) (-73.195) * (-71.178) (-72.054) (-71.644) [-71.374] -- 0:01:14
98000 -- (-74.337) [-72.344] (-73.002) (-74.055) * (-71.293) (-71.280) (-72.275) [-71.545] -- 0:01:13
99000 -- (-74.475) [-71.918] (-72.552) (-71.496) * (-73.789) (-76.132) (-74.013) [-71.284] -- 0:01:12
100000 -- [-71.278] (-73.078) (-75.267) (-72.008) * (-72.855) (-70.789) (-74.559) [-73.388] -- 0:01:12
Average standard deviation of split frequencies: 0.037463
101000 -- [-73.503] (-72.245) (-72.757) (-71.417) * (-73.899) (-73.805) (-71.902) [-75.936] -- 0:01:11
102000 -- (-73.012) [-73.853] (-71.904) (-73.701) * (-75.261) (-77.052) (-73.833) [-71.111] -- 0:01:10
103000 -- (-72.151) (-73.203) [-73.603] (-72.360) * (-71.311) (-71.594) (-72.547) [-73.110] -- 0:01:09
104000 -- [-73.501] (-71.724) (-71.895) (-72.436) * (-75.622) (-72.567) (-73.310) [-72.051] -- 0:01:08
105000 -- [-71.152] (-73.308) (-74.450) (-74.436) * (-72.123) (-72.259) (-74.580) [-72.809] -- 0:01:08
Average standard deviation of split frequencies: 0.026683
106000 -- [-74.156] (-73.100) (-77.664) (-73.564) * (-71.093) (-71.042) (-73.036) [-72.500] -- 0:01:07
107000 -- (-71.719) (-72.440) (-73.857) [-78.364] * (-71.051) (-72.849) (-72.674) [-77.244] -- 0:01:06
108000 -- [-72.305] (-72.216) (-73.450) (-72.137) * [-71.701] (-73.641) (-73.611) (-74.535) -- 0:01:06
109000 -- (-72.667) (-72.304) [-73.237] (-71.401) * (-73.253) (-72.050) (-72.279) [-71.495] -- 0:01:13
110000 -- [-71.488] (-71.788) (-71.111) (-71.620) * (-71.949) [-72.922] (-72.192) (-72.694) -- 0:01:12
Average standard deviation of split frequencies: 0.025558
111000 -- (-76.257) (-72.001) [-73.733] (-73.931) * (-72.524) [-72.392] (-73.482) (-78.834) -- 0:01:12
112000 -- (-74.435) [-73.417] (-76.266) (-74.519) * (-76.630) [-72.463] (-73.992) (-71.431) -- 0:01:11
113000 -- (-72.023) (-71.932) (-75.672) [-72.735] * (-74.966) (-71.268) [-72.963] (-71.884) -- 0:01:10
114000 -- (-72.454) (-72.674) [-74.186] (-74.504) * (-74.656) (-73.409) [-71.713] (-71.515) -- 0:01:09
115000 -- [-72.404] (-71.615) (-72.022) (-72.173) * (-76.323) [-73.848] (-72.123) (-71.634) -- 0:01:09
Average standard deviation of split frequencies: 0.018965
116000 -- [-72.771] (-71.419) (-74.396) (-71.727) * (-71.868) [-73.810] (-71.976) (-71.350) -- 0:01:08
117000 -- (-73.106) (-73.535) (-71.740) [-71.131] * [-72.492] (-74.788) (-73.488) (-72.305) -- 0:01:07
118000 -- (-71.308) [-72.764] (-72.326) (-74.876) * (-74.730) (-77.055) (-72.158) [-72.294] -- 0:01:07
119000 -- (-72.448) (-73.296) (-72.608) [-72.393] * (-71.062) (-74.891) [-74.712] (-74.094) -- 0:01:06
120000 -- (-75.766) (-76.455) (-72.566) [-73.957] * (-72.244) (-73.142) (-73.965) [-71.956] -- 0:01:06
Average standard deviation of split frequencies: 0.007813
121000 -- [-71.205] (-76.982) (-72.054) (-75.568) * (-71.127) (-76.280) (-72.873) [-72.913] -- 0:01:12
122000 -- [-72.873] (-76.283) (-71.484) (-78.204) * [-71.765] (-70.633) (-75.439) (-76.513) -- 0:01:11
123000 -- (-75.999) (-72.513) [-71.335] (-71.052) * (-72.880) (-71.736) (-75.650) [-73.804] -- 0:01:11
124000 -- [-72.501] (-74.627) (-74.085) (-71.769) * [-71.968] (-71.127) (-75.782) (-76.931) -- 0:01:10
125000 -- (-70.941) (-71.966) [-73.780] (-71.100) * (-72.434) (-73.572) [-71.265] (-75.286) -- 0:01:10
Average standard deviation of split frequencies: 0.009977
126000 -- (-72.911) (-73.172) [-72.477] (-71.495) * (-72.012) (-71.854) [-71.918] (-71.180) -- 0:01:09
127000 -- (-72.600) [-71.902] (-71.205) (-71.277) * [-70.749] (-70.833) (-71.161) (-71.431) -- 0:01:08
128000 -- (-71.716) (-71.603) (-72.925) [-71.528] * [-72.485] (-71.951) (-73.075) (-70.954) -- 0:01:08
129000 -- (-74.038) [-74.907] (-75.747) (-74.630) * [-70.944] (-72.696) (-72.159) (-73.945) -- 0:01:07
130000 -- (-72.283) (-71.404) (-74.892) [-72.415] * (-73.433) (-73.730) [-71.966] (-73.602) -- 0:01:06
Average standard deviation of split frequencies: 0.009621
131000 -- (-70.973) [-73.458] (-75.521) (-75.464) * (-74.205) [-72.273] (-71.727) (-81.055) -- 0:01:06
132000 -- [-77.051] (-72.266) (-72.450) (-74.901) * (-71.353) (-71.698) (-72.113) [-71.396] -- 0:01:05
133000 -- [-75.138] (-72.398) (-74.793) (-75.040) * (-73.232) [-72.509] (-75.788) (-70.589) -- 0:01:05
134000 -- (-71.602) (-72.101) (-71.300) [-73.773] * (-71.953) [-71.076] (-78.845) (-72.234) -- 0:01:11
135000 -- (-74.352) (-76.550) [-71.012] (-72.729) * [-73.463] (-72.876) (-74.873) (-75.009) -- 0:01:10
Average standard deviation of split frequencies: 0.018486
136000 -- (-71.030) [-76.068] (-71.460) (-72.421) * (-75.362) (-76.176) (-75.242) [-71.691] -- 0:01:09
137000 -- (-75.157) (-77.258) [-72.789] (-71.801) * (-76.074) [-71.309] (-71.834) (-71.221) -- 0:01:09
138000 -- (-72.315) (-73.896) (-72.245) [-75.325] * (-73.529) (-74.483) (-75.744) [-71.254] -- 0:01:08
139000 -- [-71.532] (-74.160) (-71.092) (-74.481) * [-74.499] (-76.515) (-74.837) (-72.245) -- 0:01:08
140000 -- (-73.596) [-72.755] (-73.669) (-72.461) * (-74.171) (-79.677) [-72.736] (-73.237) -- 0:01:07
Average standard deviation of split frequencies: 0.013405
141000 -- (-73.635) (-75.922) [-73.168] (-72.534) * (-74.396) [-72.445] (-71.467) (-72.023) -- 0:01:07
142000 -- (-71.434) [-71.909] (-72.627) (-72.700) * [-71.890] (-73.809) (-71.703) (-73.544) -- 0:01:06
143000 -- (-72.955) [-71.029] (-72.412) (-73.102) * [-74.687] (-72.038) (-72.685) (-71.181) -- 0:01:05
144000 -- (-73.070) (-71.505) [-73.039] (-72.462) * (-74.695) [-71.491] (-71.935) (-71.278) -- 0:01:05
145000 -- (-79.312) [-71.459] (-72.230) (-73.999) * [-71.915] (-76.093) (-77.141) (-77.856) -- 0:01:04
Average standard deviation of split frequencies: 0.015068
146000 -- (-75.844) (-71.710) [-77.188] (-73.828) * (-73.322) (-71.807) [-72.557] (-76.855) -- 0:01:10
147000 -- (-70.505) (-71.635) (-73.984) [-70.518] * (-73.926) (-73.494) [-73.137] (-71.817) -- 0:01:09
148000 -- (-72.524) (-76.098) [-70.758] (-75.403) * (-71.789) (-72.301) [-71.047] (-72.884) -- 0:01:09
149000 -- (-72.209) (-72.553) [-70.746] (-72.424) * [-72.191] (-71.840) (-71.658) (-70.659) -- 0:01:08
150000 -- [-74.605] (-72.118) (-74.232) (-72.128) * (-71.933) (-75.565) (-74.825) [-70.795] -- 0:01:08
Average standard deviation of split frequencies: 0.016687
151000 -- [-72.780] (-72.898) (-71.644) (-71.428) * (-74.481) [-71.888] (-72.643) (-74.570) -- 0:01:07
152000 -- [-73.401] (-72.182) (-70.967) (-71.504) * (-71.944) (-72.593) (-71.559) [-71.740] -- 0:01:06
153000 -- (-71.523) [-72.232] (-72.599) (-71.715) * (-72.861) (-73.469) (-71.895) [-76.525] -- 0:01:06
154000 -- (-71.943) (-71.547) [-72.180] (-71.272) * (-71.013) (-73.498) (-71.466) [-72.613] -- 0:01:05
155000 -- (-72.049) [-73.064] (-73.857) (-73.672) * (-71.347) (-73.219) [-72.671] (-72.185) -- 0:01:05
Average standard deviation of split frequencies: 0.024175
156000 -- (-74.620) [-72.218] (-73.753) (-73.068) * (-72.787) [-75.458] (-75.280) (-77.163) -- 0:01:04
157000 -- (-74.528) [-72.116] (-76.518) (-72.224) * (-75.403) (-71.769) [-73.626] (-72.032) -- 0:01:04
158000 -- (-73.050) [-77.083] (-77.432) (-73.719) * [-71.680] (-72.590) (-72.784) (-75.374) -- 0:01:03
159000 -- (-70.709) [-71.795] (-74.462) (-71.649) * (-72.712) (-72.866) (-72.898) [-72.402] -- 0:01:08
160000 -- (-71.353) [-75.806] (-73.739) (-71.829) * (-72.623) [-73.087] (-72.287) (-72.017) -- 0:01:08
Average standard deviation of split frequencies: 0.027384
161000 -- (-72.598) (-74.977) [-72.450] (-71.824) * (-74.606) (-71.950) [-72.843] (-72.014) -- 0:01:07
162000 -- (-75.745) [-72.302] (-74.583) (-76.188) * [-71.936] (-74.718) (-74.035) (-72.468) -- 0:01:07
163000 -- (-72.570) [-75.271] (-72.302) (-71.900) * [-70.705] (-72.129) (-75.554) (-73.801) -- 0:01:06
164000 -- [-72.221] (-74.071) (-72.402) (-71.250) * (-72.692) (-74.092) [-75.288] (-72.464) -- 0:01:06
165000 -- [-74.624] (-80.209) (-72.402) (-71.052) * (-71.493) [-71.938] (-73.835) (-72.627) -- 0:01:05
Average standard deviation of split frequencies: 0.022718
166000 -- (-71.544) (-72.161) [-72.232] (-74.154) * [-73.998] (-71.876) (-72.765) (-72.084) -- 0:01:05
167000 -- (-71.177) [-72.550] (-73.478) (-73.826) * (-74.273) (-72.035) [-76.262] (-73.712) -- 0:01:04
168000 -- (-72.194) (-73.183) [-72.111] (-71.734) * (-74.998) [-73.291] (-72.703) (-71.606) -- 0:01:04
169000 -- (-70.664) [-71.257] (-74.276) (-76.030) * (-75.376) (-74.566) (-71.411) [-71.529] -- 0:01:03
170000 -- (-74.849) (-72.589) (-70.696) [-76.265] * (-74.640) [-72.541] (-72.556) (-74.583) -- 0:01:03
Average standard deviation of split frequencies: 0.029463
171000 -- (-74.197) (-73.502) (-72.315) [-72.343] * (-73.395) [-71.168] (-75.763) (-71.411) -- 0:01:07
172000 -- (-72.394) (-71.252) (-73.001) [-73.773] * (-71.875) (-72.500) (-73.910) [-71.457] -- 0:01:07
173000 -- [-71.934] (-72.947) (-75.881) (-72.334) * (-74.017) (-72.769) [-72.003] (-74.334) -- 0:01:06
174000 -- (-74.133) (-74.092) (-73.187) [-73.842] * (-73.890) [-73.545] (-72.161) (-79.033) -- 0:01:06
175000 -- (-73.702) (-71.574) (-72.930) [-71.307] * [-71.188] (-73.992) (-72.296) (-76.835) -- 0:01:06
Average standard deviation of split frequencies: 0.030356
176000 -- [-72.996] (-76.516) (-75.903) (-73.847) * (-72.054) [-71.145] (-73.950) (-74.844) -- 0:01:05
177000 -- (-73.904) (-71.043) [-75.349] (-71.080) * (-71.484) (-74.395) [-71.459] (-72.171) -- 0:01:05
178000 -- (-71.835) (-71.759) [-73.248] (-75.902) * (-73.496) (-72.927) [-71.369] (-74.419) -- 0:01:04
179000 -- [-71.683] (-72.423) (-71.594) (-76.628) * [-71.330] (-72.109) (-72.598) (-77.578) -- 0:01:04
180000 -- (-72.884) [-70.905] (-75.351) (-72.118) * (-71.684) [-72.049] (-70.599) (-77.307) -- 0:01:03
Average standard deviation of split frequencies: 0.026093
181000 -- [-70.943] (-71.448) (-76.512) (-72.288) * (-73.104) (-73.309) [-71.220] (-74.032) -- 0:01:03
182000 -- (-72.588) (-72.935) (-71.672) [-70.915] * (-72.560) (-72.514) (-73.469) [-71.992] -- 0:01:02
183000 -- (-71.197) (-71.677) (-71.462) [-71.081] * (-71.547) (-72.041) [-71.569] (-72.312) -- 0:01:02
184000 -- (-72.316) (-71.390) [-71.948] (-73.284) * (-72.637) (-75.453) (-71.212) [-72.055] -- 0:01:06
185000 -- (-72.384) (-71.268) [-73.568] (-71.169) * (-76.360) (-71.178) [-71.926] (-72.958) -- 0:01:06
Average standard deviation of split frequencies: 0.030413
186000 -- (-73.332) [-72.657] (-74.570) (-74.183) * (-72.953) [-71.642] (-71.092) (-74.820) -- 0:01:05
187000 -- (-70.985) (-74.720) (-73.259) [-73.052] * (-71.732) [-73.392] (-72.116) (-72.249) -- 0:01:05
188000 -- (-71.463) (-71.973) [-73.144] (-73.622) * (-73.967) (-73.513) [-71.780] (-74.274) -- 0:01:04
189000 -- (-73.282) [-73.965] (-71.800) (-77.060) * (-72.390) [-73.615] (-73.290) (-72.425) -- 0:01:04
190000 -- (-71.557) (-76.548) [-73.139] (-76.644) * [-73.988] (-74.209) (-74.482) (-71.186) -- 0:01:03
Average standard deviation of split frequencies: 0.031317
191000 -- [-71.900] (-74.730) (-72.835) (-74.404) * [-74.585] (-71.979) (-77.760) (-72.128) -- 0:01:03
192000 -- (-72.221) (-71.955) (-74.880) [-71.885] * (-71.403) [-71.787] (-73.666) (-71.749) -- 0:01:03
193000 -- [-72.412] (-72.122) (-74.061) (-75.653) * (-72.216) (-72.108) [-75.070] (-76.244) -- 0:01:02
194000 -- (-71.330) (-73.180) [-72.098] (-72.186) * (-72.967) (-74.478) [-72.265] (-74.334) -- 0:01:02
195000 -- (-71.737) [-70.759] (-75.051) (-76.387) * (-73.615) (-71.551) (-72.994) [-76.952] -- 0:01:01
Average standard deviation of split frequencies: 0.027258
196000 -- [-72.765] (-73.957) (-78.276) (-80.222) * (-75.695) [-73.106] (-72.515) (-73.872) -- 0:01:05
197000 -- [-70.768] (-75.204) (-71.546) (-72.658) * (-76.349) (-73.557) (-72.112) [-71.564] -- 0:01:05
198000 -- (-72.841) [-72.095] (-71.565) (-74.878) * (-73.761) (-73.744) [-71.659] (-73.342) -- 0:01:04
199000 -- [-72.313] (-73.174) (-73.537) (-74.407) * (-76.470) [-73.539] (-71.420) (-75.253) -- 0:01:04
200000 -- (-71.396) (-71.243) [-70.612] (-70.729) * (-70.613) [-72.095] (-71.745) (-73.308) -- 0:01:04
Average standard deviation of split frequencies: 0.029756
201000 -- (-71.354) (-72.789) [-71.733] (-71.075) * (-71.085) [-73.014] (-71.541) (-74.947) -- 0:01:03
202000 -- (-75.306) [-73.953] (-71.717) (-72.528) * (-78.117) (-74.064) (-72.818) [-71.819] -- 0:01:03
203000 -- [-71.818] (-79.914) (-72.965) (-71.665) * (-71.831) (-72.841) [-71.114] (-74.498) -- 0:01:02
204000 -- [-72.705] (-72.428) (-72.502) (-73.657) * [-75.046] (-71.325) (-73.203) (-73.925) -- 0:01:02
205000 -- (-71.560) (-71.417) [-70.682] (-74.205) * (-71.438) (-71.624) (-72.993) [-73.588] -- 0:01:02
Average standard deviation of split frequencies: 0.032037
206000 -- (-73.388) (-71.583) (-76.695) [-72.908] * (-73.960) (-72.419) (-70.862) [-71.576] -- 0:01:01
207000 -- (-72.754) (-73.801) (-71.314) [-75.214] * (-73.271) [-75.574] (-71.746) (-71.324) -- 0:01:01
208000 -- (-71.942) (-71.857) [-70.881] (-74.240) * (-70.864) (-73.672) [-73.764] (-72.622) -- 0:01:00
209000 -- (-71.790) [-71.007] (-74.932) (-71.131) * (-72.219) (-78.496) [-73.170] (-71.756) -- 0:01:04
210000 -- (-73.396) (-73.931) [-75.766] (-73.810) * (-73.439) [-73.307] (-75.388) (-71.177) -- 0:01:03
Average standard deviation of split frequencies: 0.031328
211000 -- (-71.447) [-70.898] (-71.166) (-73.631) * (-72.331) (-76.254) (-76.084) [-72.049] -- 0:01:03
212000 -- [-71.709] (-72.296) (-71.867) (-74.785) * [-72.052] (-76.666) (-71.891) (-73.930) -- 0:01:03
213000 -- (-74.276) (-71.628) [-71.645] (-72.547) * (-71.063) (-71.425) [-72.482] (-74.520) -- 0:01:02
214000 -- (-72.283) (-72.541) (-72.918) [-73.335] * (-70.723) (-71.974) [-71.435] (-72.272) -- 0:01:02
215000 -- [-73.614] (-72.311) (-72.736) (-72.304) * (-72.264) (-72.055) [-72.341] (-72.402) -- 0:01:02
Average standard deviation of split frequencies: 0.029099
216000 -- (-77.886) [-71.252] (-71.383) (-71.374) * (-79.910) (-76.104) [-71.259] (-73.759) -- 0:01:01
217000 -- (-72.693) [-71.110] (-75.150) (-70.585) * (-72.271) (-72.285) [-72.368] (-73.724) -- 0:01:01
218000 -- [-73.153] (-74.618) (-73.048) (-71.877) * (-73.141) [-70.741] (-74.998) (-71.717) -- 0:01:00
219000 -- (-73.889) (-72.515) [-74.535] (-81.205) * (-71.538) [-70.924] (-71.498) (-70.732) -- 0:01:00
220000 -- [-72.011] (-73.147) (-73.535) (-75.147) * (-74.238) [-73.681] (-73.351) (-73.332) -- 0:01:00
Average standard deviation of split frequencies: 0.027059
221000 -- (-72.072) [-73.315] (-70.732) (-79.174) * (-71.664) (-74.310) (-77.347) [-73.299] -- 0:01:03
222000 -- [-73.529] (-76.931) (-74.080) (-72.985) * (-75.001) (-73.500) (-73.132) [-73.315] -- 0:01:03
223000 -- (-75.719) [-73.046] (-79.610) (-73.014) * [-70.524] (-74.252) (-73.045) (-74.524) -- 0:01:02
224000 -- (-72.016) [-71.886] (-74.229) (-71.817) * (-72.232) (-73.166) (-71.245) [-72.229] -- 0:01:02
225000 -- (-73.718) [-71.983] (-72.063) (-71.370) * [-71.129] (-73.705) (-71.869) (-74.599) -- 0:01:02
Average standard deviation of split frequencies: 0.026421
226000 -- [-71.757] (-72.261) (-73.365) (-71.575) * (-71.747) [-72.646] (-75.383) (-80.401) -- 0:01:01
227000 -- (-71.602) [-73.495] (-71.264) (-73.311) * (-73.053) [-73.162] (-73.858) (-77.249) -- 0:01:01
228000 -- (-70.836) (-73.326) [-71.556] (-72.899) * (-74.769) (-72.774) [-71.402] (-77.065) -- 0:01:00
229000 -- (-72.620) (-72.337) (-74.379) [-72.950] * (-73.243) (-77.098) (-72.709) [-71.554] -- 0:01:00
230000 -- (-70.786) (-76.709) (-72.464) [-74.404] * (-72.171) (-70.670) (-72.206) [-73.836] -- 0:01:00
Average standard deviation of split frequencies: 0.025886
231000 -- (-72.713) (-74.222) [-71.712] (-71.784) * (-75.331) (-72.683) (-72.280) [-73.597] -- 0:00:59
232000 -- (-73.173) (-72.156) [-73.336] (-76.505) * [-70.950] (-73.105) (-72.704) (-77.097) -- 0:00:59
233000 -- (-71.896) [-72.632] (-71.934) (-74.103) * (-71.647) [-76.247] (-72.390) (-74.226) -- 0:00:59
234000 -- (-70.791) (-74.531) [-71.349] (-72.692) * [-72.441] (-71.521) (-75.383) (-75.141) -- 0:01:02
235000 -- [-73.136] (-73.642) (-72.489) (-71.057) * (-71.915) (-71.211) (-73.974) [-73.262] -- 0:01:01
Average standard deviation of split frequencies: 0.026633
236000 -- (-72.520) (-72.692) [-74.038] (-71.421) * (-73.902) (-73.334) [-72.445] (-73.829) -- 0:01:01
237000 -- [-71.561] (-74.576) (-71.974) (-72.664) * [-71.169] (-74.427) (-73.260) (-74.747) -- 0:01:01
238000 -- (-74.577) [-74.490] (-73.775) (-73.378) * [-72.258] (-72.027) (-73.755) (-76.132) -- 0:01:00
239000 -- (-72.107) (-72.454) (-74.277) [-72.953] * [-71.323] (-73.555) (-71.239) (-73.388) -- 0:01:00
240000 -- (-74.497) [-71.856] (-72.917) (-74.401) * [-70.785] (-74.159) (-74.893) (-74.999) -- 0:01:00
Average standard deviation of split frequencies: 0.033952
241000 -- (-74.074) (-74.648) (-75.099) [-74.049] * (-72.351) [-76.484] (-74.345) (-79.370) -- 0:00:59
242000 -- (-79.654) [-72.355] (-72.364) (-73.550) * (-71.732) [-72.752] (-71.911) (-71.005) -- 0:00:59
243000 -- [-73.616] (-71.507) (-72.520) (-76.459) * (-74.205) (-71.556) [-71.767] (-72.225) -- 0:00:59
244000 -- (-72.501) [-72.439] (-71.833) (-71.992) * [-73.281] (-72.823) (-71.362) (-76.002) -- 0:00:58
245000 -- (-73.273) [-71.476] (-72.469) (-72.041) * (-70.563) (-72.137) [-72.194] (-72.901) -- 0:00:58
Average standard deviation of split frequencies: 0.034493
246000 -- (-71.567) (-71.406) [-72.284] (-73.352) * (-72.199) [-71.866] (-71.860) (-73.983) -- 0:01:01
247000 -- [-72.825] (-72.272) (-71.920) (-72.427) * (-76.537) (-72.381) (-71.024) [-74.112] -- 0:01:00
248000 -- (-71.355) (-72.815) [-73.742] (-73.588) * [-71.245] (-71.675) (-75.021) (-72.477) -- 0:01:00
249000 -- (-70.668) [-70.709] (-73.474) (-73.195) * (-75.389) [-73.063] (-75.721) (-76.539) -- 0:01:00
250000 -- [-72.150] (-73.150) (-73.363) (-73.064) * [-71.406] (-73.020) (-75.807) (-74.150) -- 0:01:00
Average standard deviation of split frequencies: 0.037612
251000 -- (-76.432) [-73.176] (-74.365) (-71.446) * [-72.152] (-78.631) (-72.163) (-80.940) -- 0:00:59
252000 -- (-79.701) [-70.824] (-72.086) (-71.257) * (-76.236) [-72.289] (-71.190) (-70.964) -- 0:00:59
253000 -- (-83.327) (-72.882) (-72.169) [-72.095] * [-74.189] (-78.969) (-72.408) (-72.201) -- 0:00:59
254000 -- (-75.933) (-72.255) (-71.057) [-71.236] * [-72.198] (-72.849) (-74.181) (-72.475) -- 0:00:58
255000 -- (-76.635) (-72.947) [-70.772] (-72.910) * [-76.391] (-72.624) (-74.019) (-71.287) -- 0:00:58
Average standard deviation of split frequencies: 0.034373
256000 -- (-73.720) [-72.070] (-72.080) (-71.606) * (-71.661) [-70.694] (-77.976) (-75.202) -- 0:00:58
257000 -- (-75.529) (-73.030) [-71.511] (-73.552) * (-73.201) [-73.637] (-78.589) (-71.982) -- 0:00:57
258000 -- (-71.421) [-74.551] (-70.705) (-75.383) * (-75.979) (-72.139) [-72.825] (-75.125) -- 0:00:57
259000 -- [-70.946] (-73.054) (-73.471) (-72.833) * (-73.742) (-70.845) (-71.810) [-75.348] -- 0:01:00
260000 -- (-72.299) (-73.342) [-71.705] (-73.045) * (-71.892) [-72.172] (-71.905) (-73.706) -- 0:00:59
Average standard deviation of split frequencies: 0.034964
261000 -- (-76.658) (-72.870) [-75.479] (-71.378) * [-73.627] (-72.907) (-72.779) (-72.572) -- 0:00:59
262000 -- (-71.405) (-72.952) (-72.716) [-72.375] * (-74.026) (-74.452) [-72.317] (-72.642) -- 0:00:59
263000 -- (-74.922) (-72.744) (-72.373) [-71.625] * (-73.666) [-71.066] (-71.190) (-72.268) -- 0:00:58
264000 -- (-74.550) (-74.029) [-70.784] (-72.564) * (-73.009) [-73.375] (-70.603) (-71.788) -- 0:00:58
265000 -- (-73.251) (-75.995) [-73.473] (-71.680) * (-73.997) (-76.129) (-73.129) [-71.799] -- 0:00:58
Average standard deviation of split frequencies: 0.036625
266000 -- [-71.396] (-71.725) (-71.193) (-73.549) * [-73.046] (-72.800) (-76.855) (-72.678) -- 0:00:57
267000 -- [-71.361] (-75.510) (-74.095) (-72.773) * (-73.639) (-73.746) (-73.449) [-72.298] -- 0:00:57
268000 -- (-71.216) (-72.314) (-72.120) [-70.512] * (-82.356) (-72.398) (-73.178) [-71.460] -- 0:00:57
269000 -- [-71.431] (-73.044) (-72.812) (-72.242) * (-73.091) (-74.243) [-73.063] (-71.602) -- 0:00:57
270000 -- [-73.020] (-74.976) (-72.288) (-78.006) * (-75.057) [-70.584] (-71.847) (-73.010) -- 0:00:56
Average standard deviation of split frequencies: 0.030188
271000 -- (-77.512) (-76.672) [-72.758] (-71.318) * [-73.499] (-71.061) (-73.282) (-70.783) -- 0:00:59
272000 -- (-72.959) (-76.092) [-71.864] (-71.357) * (-73.196) (-73.547) [-78.627] (-73.497) -- 0:00:58
273000 -- (-72.586) (-72.355) [-71.402] (-76.421) * [-73.024] (-74.558) (-72.247) (-73.944) -- 0:00:58
274000 -- (-71.537) (-72.176) [-73.231] (-72.582) * (-75.276) (-72.975) [-72.178] (-72.226) -- 0:00:58
275000 -- (-72.228) [-70.958] (-75.900) (-71.779) * (-73.628) (-70.826) [-73.887] (-72.964) -- 0:00:58
Average standard deviation of split frequencies: 0.029605
276000 -- (-73.453) (-72.238) [-75.778] (-76.621) * [-71.684] (-71.165) (-72.779) (-76.269) -- 0:00:57
277000 -- [-71.595] (-71.090) (-73.999) (-74.568) * [-72.025] (-71.619) (-72.373) (-74.062) -- 0:00:57
278000 -- (-72.277) [-71.442] (-71.911) (-72.056) * (-74.192) (-72.586) (-75.107) [-73.059] -- 0:00:57
279000 -- (-71.742) (-73.002) (-71.083) [-71.325] * (-71.575) (-74.373) [-72.407] (-70.927) -- 0:00:56
280000 -- [-72.487] (-73.686) (-72.868) (-71.923) * (-72.009) (-72.141) [-74.887] (-74.109) -- 0:00:56
Average standard deviation of split frequencies: 0.032472
281000 -- (-73.638) (-71.057) (-72.201) [-73.450] * (-72.155) (-74.123) [-71.338] (-74.719) -- 0:00:56
282000 -- (-71.407) (-70.759) [-73.153] (-72.292) * (-71.368) (-70.985) [-72.523] (-73.682) -- 0:00:56
283000 -- [-72.631] (-73.742) (-74.492) (-72.200) * (-71.470) (-73.445) [-72.436] (-72.203) -- 0:00:58
284000 -- (-70.943) (-73.697) (-72.935) [-71.012] * (-73.566) [-73.267] (-71.495) (-73.006) -- 0:00:57
285000 -- (-75.129) (-72.723) (-73.262) [-75.061] * (-72.413) (-73.456) [-72.331] (-72.360) -- 0:00:57
Average standard deviation of split frequencies: 0.030768
286000 -- [-70.797] (-71.337) (-73.801) (-75.454) * (-74.780) (-71.178) [-72.228] (-70.674) -- 0:00:57
287000 -- (-70.565) [-72.402] (-77.866) (-74.165) * (-73.606) (-73.418) [-74.521] (-71.183) -- 0:00:57
288000 -- [-74.439] (-73.037) (-72.673) (-74.536) * [-74.162] (-73.348) (-73.011) (-76.132) -- 0:00:56
289000 -- (-74.258) (-74.095) [-73.807] (-71.180) * [-73.290] (-72.639) (-73.168) (-71.314) -- 0:00:56
290000 -- (-71.830) [-73.941] (-75.449) (-70.819) * (-73.113) (-70.750) [-71.559] (-72.683) -- 0:00:56
Average standard deviation of split frequencies: 0.028111
291000 -- (-70.894) (-71.473) [-73.475] (-74.932) * [-73.876] (-74.603) (-73.194) (-71.601) -- 0:00:56
292000 -- [-70.924] (-71.010) (-73.224) (-70.964) * (-73.938) (-71.158) [-71.417] (-73.797) -- 0:00:55
293000 -- (-70.893) (-71.657) (-73.788) [-71.048] * (-72.909) [-73.259] (-74.557) (-75.656) -- 0:00:55
294000 -- (-74.460) (-74.670) (-72.777) [-74.230] * [-72.011] (-72.049) (-74.824) (-76.210) -- 0:00:55
295000 -- (-71.517) [-73.223] (-72.401) (-75.333) * (-71.145) [-74.278] (-73.317) (-72.231) -- 0:00:57
Average standard deviation of split frequencies: 0.024420
296000 -- [-73.633] (-76.027) (-71.016) (-70.578) * (-71.816) [-71.432] (-71.482) (-80.414) -- 0:00:57
297000 -- (-71.611) (-75.274) (-70.882) [-72.151] * [-72.026] (-73.461) (-74.643) (-75.005) -- 0:00:56
298000 -- (-71.600) (-74.530) (-73.010) [-74.287] * (-72.981) (-70.874) (-72.329) [-74.332] -- 0:00:56
299000 -- [-72.329] (-72.776) (-71.237) (-75.240) * [-71.821] (-70.940) (-71.874) (-73.512) -- 0:00:56
300000 -- [-72.758] (-72.706) (-72.739) (-71.627) * (-73.339) (-74.792) (-71.406) [-71.914] -- 0:00:56
Average standard deviation of split frequencies: 0.026131
301000 -- (-72.211) (-72.654) (-72.315) [-73.292] * [-71.836] (-73.936) (-73.830) (-71.847) -- 0:00:55
302000 -- (-72.443) (-72.053) (-73.337) [-71.583] * (-74.258) [-72.146] (-73.545) (-71.726) -- 0:00:55
303000 -- [-71.348] (-73.703) (-76.000) (-73.307) * (-72.440) [-72.537] (-75.320) (-73.189) -- 0:00:55
304000 -- (-72.720) [-74.317] (-71.017) (-74.264) * (-76.321) (-75.129) [-72.426] (-72.845) -- 0:00:54
305000 -- [-72.500] (-73.902) (-71.922) (-71.266) * [-71.526] (-73.774) (-73.865) (-71.545) -- 0:00:54
Average standard deviation of split frequencies: 0.023622
306000 -- [-73.143] (-72.103) (-73.105) (-73.514) * (-71.568) [-71.204] (-71.004) (-74.926) -- 0:00:54
307000 -- (-74.947) (-72.759) (-73.246) [-75.370] * (-71.955) (-72.791) [-70.636] (-73.503) -- 0:00:54
308000 -- (-74.955) (-71.099) [-74.854] (-73.615) * (-71.884) (-70.921) (-71.214) [-74.507] -- 0:00:56
309000 -- (-71.977) [-75.252] (-71.939) (-71.223) * (-72.784) (-72.665) (-72.007) [-71.165] -- 0:00:55
310000 -- [-73.607] (-74.793) (-71.624) (-72.475) * (-71.490) (-71.307) (-72.096) [-73.167] -- 0:00:55
Average standard deviation of split frequencies: 0.020232
311000 -- (-73.370) (-75.960) [-78.661] (-71.384) * (-72.868) [-73.639] (-75.029) (-76.076) -- 0:00:55
312000 -- (-74.138) (-74.280) [-75.202] (-71.419) * (-72.770) [-71.725] (-70.734) (-79.101) -- 0:00:55
313000 -- (-72.439) (-73.517) [-72.671] (-73.086) * [-73.097] (-74.951) (-75.576) (-76.918) -- 0:00:54
314000 -- (-74.826) (-76.482) (-76.287) [-71.667] * (-74.937) (-78.123) [-71.359] (-74.607) -- 0:00:54
315000 -- (-78.293) (-72.054) [-72.692] (-72.511) * (-71.044) (-75.878) [-73.028] (-71.506) -- 0:00:54
Average standard deviation of split frequencies: 0.023869
316000 -- (-71.836) (-70.733) (-72.798) [-72.879] * [-73.383] (-72.024) (-70.949) (-71.751) -- 0:00:54
317000 -- (-71.629) (-72.201) [-72.240] (-74.319) * [-75.124] (-74.191) (-71.650) (-73.644) -- 0:00:53
318000 -- (-71.416) (-72.872) (-71.536) [-72.624] * (-75.153) (-71.579) (-78.354) [-73.860] -- 0:00:53
319000 -- [-76.008] (-72.907) (-75.108) (-71.566) * (-74.514) (-71.450) (-74.215) [-76.184] -- 0:00:53
320000 -- (-73.894) (-72.639) [-71.840] (-74.576) * [-71.253] (-71.558) (-73.004) (-75.144) -- 0:00:55
Average standard deviation of split frequencies: 0.022541
321000 -- (-73.245) (-72.465) [-71.852] (-72.665) * (-72.025) [-71.964] (-70.451) (-72.435) -- 0:00:54
322000 -- [-71.337] (-74.938) (-70.850) (-77.595) * (-71.475) (-71.678) [-71.565] (-72.678) -- 0:00:54
323000 -- (-73.310) (-73.625) [-73.235] (-74.725) * (-71.938) (-70.735) (-71.191) [-72.451] -- 0:00:54
324000 -- (-71.471) [-73.698] (-74.789) (-73.545) * [-74.283] (-72.299) (-72.192) (-72.716) -- 0:00:54
325000 -- (-71.854) [-73.372] (-78.135) (-73.212) * (-74.140) [-75.910] (-71.038) (-72.134) -- 0:00:54
Average standard deviation of split frequencies: 0.025064
326000 -- [-72.298] (-72.041) (-74.243) (-71.411) * (-72.387) (-74.063) [-71.466] (-72.185) -- 0:00:53
327000 -- (-71.325) [-72.098] (-80.884) (-71.154) * (-73.945) [-75.329] (-73.350) (-73.528) -- 0:00:53
328000 -- (-77.121) (-71.856) (-75.731) [-73.830] * [-71.331] (-71.220) (-71.845) (-73.428) -- 0:00:53
329000 -- (-74.507) (-73.459) (-71.129) [-71.905] * [-72.661] (-72.681) (-72.219) (-72.849) -- 0:00:53
330000 -- (-75.544) (-75.110) (-74.813) [-71.519] * (-72.296) [-71.426] (-72.729) (-73.172) -- 0:00:52
Average standard deviation of split frequencies: 0.025661
331000 -- (-71.766) (-71.700) (-71.709) [-71.099] * (-74.449) [-72.365] (-71.350) (-71.753) -- 0:00:52
332000 -- (-71.517) (-74.629) (-75.667) [-71.848] * (-70.976) [-73.245] (-72.133) (-73.936) -- 0:00:52
333000 -- (-70.707) (-71.764) (-75.810) [-72.746] * (-72.477) (-71.156) [-72.480] (-72.848) -- 0:00:54
334000 -- (-72.567) (-73.214) [-71.395] (-72.292) * (-73.669) (-73.231) [-72.546] (-71.774) -- 0:00:53
335000 -- (-73.141) (-73.017) (-72.061) [-76.043] * (-74.288) (-73.225) [-73.173] (-70.474) -- 0:00:53
Average standard deviation of split frequencies: 0.026189
336000 -- (-73.882) (-76.923) (-71.624) [-74.006] * [-73.771] (-72.909) (-76.503) (-71.461) -- 0:00:53
337000 -- (-71.216) (-74.434) (-71.604) [-71.830] * (-72.570) [-71.087] (-72.060) (-71.769) -- 0:00:53
338000 -- (-71.302) (-72.436) (-73.078) [-71.439] * (-73.687) [-73.059] (-72.012) (-71.716) -- 0:00:52
339000 -- (-72.614) (-75.284) (-73.811) [-71.033] * (-73.749) (-72.803) [-77.204] (-72.456) -- 0:00:52
340000 -- (-76.240) (-73.537) (-71.524) [-72.762] * (-74.144) [-70.952] (-71.867) (-75.446) -- 0:00:52
Average standard deviation of split frequencies: 0.029520
341000 -- (-76.808) (-71.636) [-75.053] (-72.693) * (-77.009) [-72.459] (-71.840) (-71.271) -- 0:00:52
342000 -- (-72.965) (-71.238) [-77.744] (-74.206) * (-71.562) (-71.204) [-73.091] (-71.795) -- 0:00:51
343000 -- (-72.093) [-71.155] (-74.691) (-72.931) * [-73.529] (-70.733) (-73.012) (-71.070) -- 0:00:51
344000 -- [-72.354] (-72.103) (-71.618) (-71.691) * (-74.408) (-75.760) [-72.838] (-74.505) -- 0:00:51
345000 -- (-71.344) [-73.365] (-73.754) (-71.198) * (-72.417) [-72.913] (-73.846) (-71.701) -- 0:00:53
Average standard deviation of split frequencies: 0.030882
346000 -- (-71.813) (-73.709) [-71.734] (-74.057) * (-73.843) [-71.776] (-72.397) (-71.783) -- 0:00:52
347000 -- (-71.973) [-72.776] (-73.133) (-76.820) * (-73.447) [-73.577] (-72.174) (-75.158) -- 0:00:52
348000 -- (-71.303) (-74.142) [-73.664] (-71.924) * (-73.428) [-71.218] (-71.406) (-74.225) -- 0:00:52
349000 -- (-73.026) (-74.592) (-72.483) [-74.573] * (-79.665) (-73.584) [-74.410] (-74.991) -- 0:00:52
350000 -- (-72.630) (-70.649) (-73.573) [-71.297] * [-72.618] (-73.137) (-73.278) (-73.302) -- 0:00:52
Average standard deviation of split frequencies: 0.026886
351000 -- (-72.649) (-73.642) (-73.813) [-73.280] * (-72.383) [-73.043] (-72.300) (-73.319) -- 0:00:51
352000 -- (-72.725) [-72.054] (-73.271) (-72.408) * (-73.370) [-73.582] (-71.192) (-74.680) -- 0:00:51
353000 -- (-72.449) [-73.849] (-72.754) (-73.937) * (-73.577) (-71.366) (-73.089) [-71.554] -- 0:00:51
354000 -- (-71.510) (-75.264) [-71.868] (-72.271) * (-71.547) [-72.023] (-79.296) (-73.544) -- 0:00:51
355000 -- [-75.235] (-72.645) (-71.807) (-72.139) * (-76.232) (-75.654) (-75.224) [-71.189] -- 0:00:50
Average standard deviation of split frequencies: 0.025601
356000 -- [-71.633] (-72.737) (-71.563) (-75.583) * (-74.914) (-73.885) (-73.824) [-72.672] -- 0:00:50
357000 -- (-77.060) (-71.196) (-71.802) [-71.069] * (-77.446) (-73.376) [-72.408] (-71.185) -- 0:00:52
358000 -- (-75.482) (-72.516) [-71.568] (-77.082) * (-78.366) (-73.049) [-72.956] (-71.254) -- 0:00:52
359000 -- [-76.554] (-71.808) (-74.036) (-73.313) * [-73.453] (-74.974) (-76.182) (-77.405) -- 0:00:51
360000 -- [-72.777] (-74.207) (-73.639) (-73.465) * [-74.585] (-75.466) (-76.905) (-78.698) -- 0:00:51
Average standard deviation of split frequencies: 0.027012
361000 -- (-71.982) (-71.164) (-70.712) [-73.323] * [-72.390] (-74.530) (-75.726) (-72.104) -- 0:00:51
362000 -- (-75.010) (-71.835) [-73.638] (-71.044) * (-73.277) (-71.968) [-71.654] (-72.671) -- 0:00:51
363000 -- (-71.234) (-73.067) [-72.362] (-72.005) * (-72.472) [-71.921] (-71.570) (-72.898) -- 0:00:50
364000 -- (-77.844) (-71.393) [-71.255] (-75.357) * (-72.000) [-71.896] (-71.633) (-72.677) -- 0:00:50
365000 -- (-80.156) (-74.638) [-73.973] (-78.057) * (-72.095) (-72.758) [-72.170] (-71.605) -- 0:00:50
Average standard deviation of split frequencies: 0.025760
366000 -- (-74.260) [-73.895] (-71.634) (-73.042) * (-71.550) (-73.303) [-70.871] (-74.629) -- 0:00:50
367000 -- [-75.207] (-78.801) (-70.842) (-72.693) * [-71.013] (-72.524) (-73.434) (-74.020) -- 0:00:50
368000 -- (-73.412) [-72.584] (-72.993) (-71.958) * [-72.737] (-71.835) (-70.978) (-72.162) -- 0:00:49
369000 -- (-72.396) (-72.275) (-73.108) [-72.433] * [-74.348] (-73.540) (-71.379) (-75.406) -- 0:00:49
370000 -- (-74.402) [-71.438] (-72.954) (-73.386) * (-71.710) (-74.510) [-73.265] (-76.690) -- 0:00:51
Average standard deviation of split frequencies: 0.027979
371000 -- [-73.143] (-75.855) (-71.437) (-70.932) * [-71.755] (-77.545) (-73.010) (-77.292) -- 0:00:50
372000 -- (-74.638) (-71.771) (-73.398) [-73.405] * (-73.430) [-79.080] (-72.367) (-74.310) -- 0:00:50
373000 -- (-71.613) (-72.063) (-71.801) [-72.595] * (-71.082) (-72.601) (-73.820) [-71.136] -- 0:00:50
374000 -- (-75.984) [-70.484] (-71.367) (-73.901) * (-78.290) [-71.786] (-73.875) (-72.290) -- 0:00:50
375000 -- (-71.465) [-71.035] (-73.310) (-74.147) * (-73.313) [-73.556] (-74.222) (-71.156) -- 0:00:50
Average standard deviation of split frequencies: 0.029254
376000 -- [-72.509] (-73.379) (-73.465) (-72.423) * (-71.428) [-71.812] (-72.959) (-73.008) -- 0:00:49
377000 -- (-72.530) [-71.174] (-70.677) (-72.639) * (-75.993) (-72.111) [-72.416] (-70.962) -- 0:00:49
378000 -- (-70.695) [-73.296] (-72.872) (-72.140) * [-73.105] (-70.636) (-71.086) (-73.363) -- 0:00:49
379000 -- (-72.491) (-75.220) [-72.003] (-74.460) * (-72.749) [-72.234] (-71.224) (-73.616) -- 0:00:49
380000 -- (-72.664) [-74.111] (-72.623) (-74.595) * (-71.246) (-74.016) [-72.135] (-72.181) -- 0:00:48
Average standard deviation of split frequencies: 0.032198
381000 -- (-73.549) (-73.768) (-72.843) [-71.612] * [-72.542] (-74.169) (-70.476) (-71.202) -- 0:00:48
382000 -- [-72.636] (-74.414) (-71.395) (-71.614) * (-71.575) [-75.920] (-72.482) (-71.743) -- 0:00:48
383000 -- (-71.535) [-74.690] (-75.943) (-72.774) * (-72.891) (-73.748) [-73.875] (-77.387) -- 0:00:49
384000 -- (-70.953) (-75.361) (-73.103) [-70.615] * (-70.949) [-71.824] (-73.049) (-71.679) -- 0:00:49
385000 -- (-74.806) (-73.565) (-75.058) [-71.366] * (-74.280) (-75.673) [-73.215] (-73.509) -- 0:00:49
Average standard deviation of split frequencies: 0.030124
386000 -- [-72.569] (-73.952) (-72.678) (-71.619) * (-70.929) [-73.686] (-72.485) (-72.875) -- 0:00:49
387000 -- (-75.044) (-71.599) (-73.454) [-71.941] * (-72.029) [-72.575] (-71.113) (-72.456) -- 0:00:49
388000 -- (-74.270) (-73.663) (-74.381) [-70.637] * (-73.465) (-73.446) (-73.475) [-73.833] -- 0:00:48
389000 -- (-71.523) [-71.398] (-71.686) (-71.515) * [-74.716] (-71.944) (-72.826) (-73.380) -- 0:00:48
390000 -- (-71.356) [-73.080] (-71.722) (-70.484) * (-72.835) (-71.405) (-74.994) [-71.126] -- 0:00:48
Average standard deviation of split frequencies: 0.030569
391000 -- (-70.855) (-72.652) [-71.937] (-70.973) * (-71.310) (-73.123) [-75.353] (-72.804) -- 0:00:48
392000 -- (-73.471) (-71.866) (-71.637) [-73.612] * [-72.122] (-71.504) (-71.920) (-71.667) -- 0:00:48
393000 -- (-75.784) (-73.025) (-72.197) [-71.918] * (-78.554) (-74.950) [-73.099] (-73.441) -- 0:00:47
394000 -- (-74.328) (-72.121) [-72.636] (-75.432) * (-71.886) (-75.133) [-71.369] (-71.489) -- 0:00:47
395000 -- [-73.106] (-72.807) (-70.972) (-76.374) * (-71.480) [-73.168] (-77.353) (-73.459) -- 0:00:49
Average standard deviation of split frequencies: 0.030157
396000 -- (-71.552) (-71.478) (-77.125) [-73.426] * (-72.634) [-72.418] (-73.370) (-73.126) -- 0:00:48
397000 -- (-71.612) [-73.375] (-79.278) (-71.069) * (-73.025) [-74.240] (-71.209) (-74.506) -- 0:00:48
398000 -- (-75.921) [-75.821] (-71.887) (-75.005) * (-72.290) (-80.386) (-71.362) [-74.905] -- 0:00:48
399000 -- (-75.363) (-71.688) [-73.928] (-74.728) * [-71.123] (-73.347) (-73.287) (-74.845) -- 0:00:48
400000 -- (-74.722) (-73.953) [-73.190] (-71.184) * [-72.380] (-72.286) (-72.779) (-71.621) -- 0:00:48
Average standard deviation of split frequencies: 0.032159
401000 -- (-74.136) (-72.458) (-72.879) [-71.997] * (-76.061) [-75.279] (-71.121) (-71.953) -- 0:00:47
402000 -- (-73.327) (-71.143) (-71.102) [-73.909] * (-72.676) [-74.502] (-72.286) (-71.674) -- 0:00:47
403000 -- (-72.781) (-72.032) [-73.893] (-72.008) * (-72.786) [-78.137] (-74.434) (-76.308) -- 0:00:47
404000 -- [-73.517] (-74.460) (-72.005) (-70.537) * (-72.343) (-75.508) [-71.172] (-72.329) -- 0:00:47
405000 -- (-77.469) [-72.337] (-73.793) (-72.351) * (-73.950) [-73.072] (-72.358) (-73.154) -- 0:00:47
Average standard deviation of split frequencies: 0.030188
406000 -- (-72.323) [-73.926] (-73.319) (-72.878) * (-73.248) (-73.530) (-72.657) [-71.241] -- 0:00:46
407000 -- (-72.499) (-70.887) (-72.262) [-71.603] * (-72.091) (-74.946) [-72.314] (-72.754) -- 0:00:48
408000 -- (-71.699) (-71.935) (-71.195) [-72.057] * (-72.693) (-76.184) (-76.474) [-71.225] -- 0:00:47
409000 -- (-74.507) [-71.717] (-76.042) (-71.285) * (-74.839) (-75.665) (-74.488) [-71.370] -- 0:00:47
410000 -- (-70.919) (-72.532) [-72.385] (-74.399) * [-74.145] (-71.949) (-74.653) (-71.337) -- 0:00:47
Average standard deviation of split frequencies: 0.030611
411000 -- (-73.445) [-71.844] (-76.263) (-72.490) * [-71.525] (-74.316) (-71.152) (-73.304) -- 0:00:47
412000 -- (-71.264) (-72.243) [-71.265] (-72.889) * [-73.909] (-78.906) (-74.142) (-74.484) -- 0:00:47
413000 -- (-72.373) [-74.059] (-76.897) (-73.355) * (-72.392) [-71.677] (-74.074) (-72.875) -- 0:00:46
414000 -- (-71.917) (-72.175) [-71.780] (-71.346) * [-70.477] (-72.196) (-73.484) (-71.737) -- 0:00:46
415000 -- [-71.803] (-72.881) (-71.193) (-73.826) * (-72.735) (-72.004) [-72.953] (-71.405) -- 0:00:46
Average standard deviation of split frequencies: 0.027196
416000 -- (-72.154) [-75.318] (-72.545) (-76.560) * (-72.373) (-74.532) [-71.930] (-72.216) -- 0:00:46
417000 -- (-72.052) [-73.036] (-74.220) (-72.267) * (-73.502) [-76.713] (-73.738) (-71.701) -- 0:00:46
418000 -- (-71.462) (-73.986) [-75.771] (-71.435) * (-76.459) [-71.124] (-76.548) (-70.945) -- 0:00:45
419000 -- [-74.156] (-71.701) (-71.095) (-72.085) * [-71.849] (-71.790) (-73.045) (-73.873) -- 0:00:45
420000 -- (-77.357) (-71.568) [-71.642] (-73.117) * (-71.273) (-73.064) [-70.669] (-71.845) -- 0:00:46
Average standard deviation of split frequencies: 0.028389
421000 -- (-72.794) (-72.500) [-73.057] (-74.488) * (-73.669) (-71.097) [-71.863] (-72.271) -- 0:00:46
422000 -- (-75.412) [-75.469] (-71.574) (-76.115) * (-76.575) (-73.398) (-73.488) [-72.760] -- 0:00:46
423000 -- [-75.402] (-72.848) (-74.406) (-70.708) * (-75.367) (-72.565) [-74.389] (-72.568) -- 0:00:46
424000 -- (-73.710) (-72.851) [-74.675] (-71.587) * (-74.783) (-73.074) [-76.854] (-73.868) -- 0:00:46
425000 -- [-74.322] (-73.205) (-71.325) (-71.919) * (-74.726) (-75.260) [-72.461] (-72.237) -- 0:00:46
Average standard deviation of split frequencies: 0.025820
426000 -- (-77.452) [-74.732] (-73.791) (-73.327) * [-71.073] (-74.460) (-75.580) (-71.507) -- 0:00:45
427000 -- (-71.422) (-79.355) [-76.282] (-71.947) * [-72.325] (-71.565) (-71.908) (-71.465) -- 0:00:45
428000 -- (-70.656) (-75.658) [-72.209] (-74.242) * [-75.108] (-73.191) (-72.761) (-71.757) -- 0:00:45
429000 -- (-72.074) (-72.578) [-70.850] (-75.874) * (-73.101) (-72.487) (-70.589) [-72.481] -- 0:00:45
430000 -- (-74.926) (-75.181) [-73.360] (-72.216) * [-72.336] (-76.397) (-71.722) (-73.909) -- 0:00:46
Average standard deviation of split frequencies: 0.024811
431000 -- (-73.320) (-75.651) (-71.564) [-72.349] * (-73.423) (-72.083) [-70.874] (-74.620) -- 0:00:46
432000 -- (-74.013) (-76.664) (-71.432) [-72.735] * (-73.590) (-73.694) (-77.148) [-73.863] -- 0:00:46
433000 -- (-73.281) (-73.555) (-74.320) [-75.712] * (-71.651) [-71.112] (-77.185) (-74.299) -- 0:00:45
434000 -- (-82.356) (-72.183) [-75.318] (-71.004) * (-71.345) (-72.804) [-71.744] (-71.973) -- 0:00:45
435000 -- (-72.490) [-71.190] (-72.130) (-71.351) * (-73.488) [-74.597] (-77.423) (-75.305) -- 0:00:45
Average standard deviation of split frequencies: 0.021624
436000 -- (-72.459) (-72.448) [-73.545] (-72.049) * [-74.327] (-71.866) (-73.486) (-72.038) -- 0:00:45
437000 -- [-73.245] (-71.679) (-73.149) (-72.119) * [-73.482] (-72.339) (-73.097) (-72.574) -- 0:00:45
438000 -- (-72.250) (-73.536) (-72.227) [-72.554] * (-73.326) (-77.858) (-71.595) [-72.788] -- 0:00:44
439000 -- (-70.724) (-72.334) [-70.566] (-74.222) * (-73.793) [-70.982] (-75.181) (-71.837) -- 0:00:44
440000 -- (-73.712) [-75.683] (-74.615) (-73.131) * (-74.857) (-71.791) (-72.294) [-71.283] -- 0:00:44
Average standard deviation of split frequencies: 0.019969
441000 -- [-74.461] (-72.518) (-74.391) (-71.886) * [-72.286] (-71.028) (-74.705) (-72.406) -- 0:00:44
442000 -- (-71.572) (-72.943) (-72.907) [-71.556] * (-73.424) [-73.094] (-72.452) (-72.414) -- 0:00:45
443000 -- [-71.656] (-74.949) (-71.458) (-72.086) * [-73.445] (-77.526) (-72.335) (-73.531) -- 0:00:45
444000 -- [-71.784] (-75.937) (-71.441) (-72.470) * (-71.270) (-73.481) [-72.289] (-74.332) -- 0:00:45
445000 -- (-72.138) (-77.187) [-71.251] (-73.511) * (-71.505) (-72.220) (-70.772) [-73.706] -- 0:00:44
Average standard deviation of split frequencies: 0.021139
446000 -- (-72.942) (-70.571) [-72.619] (-75.974) * [-71.614] (-75.238) (-72.780) (-75.050) -- 0:00:44
447000 -- (-71.747) [-73.185] (-71.938) (-71.635) * (-75.717) [-70.989] (-71.271) (-76.985) -- 0:00:44
448000 -- [-70.839] (-71.662) (-73.365) (-71.571) * (-76.198) (-74.590) (-71.685) [-74.343] -- 0:00:44
449000 -- (-72.295) (-71.144) [-73.477] (-73.755) * (-75.022) (-71.962) [-73.745] (-71.143) -- 0:00:44
450000 -- [-72.564] (-71.012) (-71.148) (-73.952) * (-77.444) [-70.771] (-70.775) (-74.066) -- 0:00:44
Average standard deviation of split frequencies: 0.021618
451000 -- (-74.704) (-75.798) (-73.061) [-71.532] * (-77.588) (-71.017) (-72.306) [-71.308] -- 0:00:43
452000 -- (-71.943) (-72.232) [-71.581] (-73.206) * (-74.668) (-72.217) (-70.944) [-73.325] -- 0:00:43
453000 -- (-74.362) (-73.228) (-72.745) [-71.858] * [-71.789] (-70.537) (-72.492) (-72.119) -- 0:00:43
454000 -- (-72.222) (-73.119) [-74.663] (-72.660) * (-72.773) [-73.296] (-75.772) (-79.367) -- 0:00:43
455000 -- [-71.173] (-72.805) (-77.978) (-71.508) * (-71.352) (-72.767) (-73.354) [-71.617] -- 0:00:44
Average standard deviation of split frequencies: 0.024811
456000 -- (-71.610) (-71.715) (-71.680) [-71.712] * (-74.167) (-71.594) (-72.723) [-71.913] -- 0:00:44
457000 -- (-76.599) (-70.833) [-75.017] (-73.880) * (-73.332) (-72.061) [-74.515] (-74.307) -- 0:00:43
458000 -- (-71.200) [-70.903] (-72.645) (-74.520) * (-71.394) (-73.151) [-71.846] (-73.527) -- 0:00:43
459000 -- (-72.835) [-71.643] (-72.160) (-78.393) * (-73.186) (-74.014) [-72.248] (-74.258) -- 0:00:43
460000 -- (-71.876) (-73.530) (-70.924) [-74.500] * [-77.455] (-75.029) (-74.300) (-71.905) -- 0:00:43
Average standard deviation of split frequencies: 0.025242
461000 -- (-73.271) (-73.265) [-72.176] (-72.321) * (-71.954) (-72.137) [-71.481] (-74.411) -- 0:00:43
462000 -- (-75.703) (-78.422) [-71.817] (-75.429) * [-73.761] (-72.064) (-73.313) (-72.164) -- 0:00:43
463000 -- [-73.903] (-72.004) (-73.340) (-75.158) * [-71.663] (-74.094) (-76.670) (-72.866) -- 0:00:42
464000 -- (-72.806) (-72.855) (-72.126) [-75.552] * [-71.314] (-70.916) (-75.067) (-71.965) -- 0:00:42
465000 -- (-74.066) [-72.655] (-70.781) (-73.115) * [-71.851] (-72.854) (-71.276) (-71.695) -- 0:00:42
Average standard deviation of split frequencies: 0.026302
466000 -- [-73.256] (-73.291) (-73.071) (-73.694) * [-73.197] (-74.924) (-75.310) (-76.478) -- 0:00:42
467000 -- [-73.216] (-72.412) (-71.017) (-71.938) * (-71.601) [-71.299] (-72.968) (-74.408) -- 0:00:43
468000 -- [-75.399] (-71.834) (-78.446) (-71.741) * (-71.315) (-79.652) (-72.935) [-72.810] -- 0:00:43
469000 -- (-72.714) (-71.045) [-73.405] (-73.600) * (-72.039) (-75.543) (-73.694) [-72.041] -- 0:00:43
470000 -- [-71.231] (-70.641) (-75.831) (-72.693) * [-73.455] (-71.291) (-72.586) (-74.069) -- 0:00:42
Average standard deviation of split frequencies: 0.027376
471000 -- [-73.979] (-72.446) (-75.096) (-74.450) * [-74.271] (-70.957) (-75.122) (-71.795) -- 0:00:42
472000 -- [-71.785] (-71.910) (-71.562) (-71.163) * [-76.070] (-74.134) (-71.892) (-71.743) -- 0:00:42
473000 -- [-70.969] (-73.424) (-74.522) (-73.942) * (-71.990) (-71.224) [-71.860] (-78.797) -- 0:00:42
474000 -- [-71.745] (-71.698) (-73.920) (-71.867) * (-75.839) (-75.048) (-71.831) [-74.091] -- 0:00:42
475000 -- [-75.221] (-73.324) (-76.071) (-71.557) * (-74.218) (-72.779) [-72.253] (-71.444) -- 0:00:42
Average standard deviation of split frequencies: 0.027069
476000 -- (-70.797) (-75.277) (-74.085) [-72.889] * (-72.166) (-73.175) (-73.134) [-74.547] -- 0:00:41
477000 -- [-74.062] (-74.393) (-72.920) (-72.257) * (-73.398) (-72.703) (-71.106) [-70.805] -- 0:00:41
478000 -- [-70.712] (-72.396) (-76.288) (-73.517) * (-73.750) (-71.711) [-71.386] (-71.622) -- 0:00:41
479000 -- (-74.084) (-71.735) (-73.672) [-70.931] * (-72.201) [-71.551] (-73.238) (-70.795) -- 0:00:42
480000 -- [-73.194] (-71.543) (-74.396) (-73.097) * (-72.263) [-73.182] (-73.038) (-75.490) -- 0:00:42
Average standard deviation of split frequencies: 0.023538
481000 -- (-71.637) (-72.289) (-74.373) [-72.145] * (-72.979) [-73.090] (-77.314) (-72.363) -- 0:00:42
482000 -- [-72.870] (-72.949) (-72.887) (-71.352) * (-76.833) (-72.686) (-75.340) [-72.265] -- 0:00:41
483000 -- (-73.024) [-72.705] (-72.271) (-70.757) * (-71.946) [-73.882] (-72.508) (-72.665) -- 0:00:41
484000 -- (-75.402) [-71.940] (-74.130) (-72.642) * (-72.180) [-72.283] (-74.993) (-73.827) -- 0:00:41
485000 -- [-75.456] (-72.224) (-76.281) (-79.264) * [-75.211] (-73.715) (-71.749) (-71.531) -- 0:00:41
Average standard deviation of split frequencies: 0.022633
486000 -- (-70.945) (-70.533) [-73.845] (-72.738) * (-72.519) [-72.538] (-71.037) (-73.910) -- 0:00:41
487000 -- (-76.052) (-70.512) (-73.477) [-71.013] * (-71.040) (-73.470) (-72.926) [-72.323] -- 0:00:41
488000 -- (-73.325) (-72.321) [-71.049] (-71.526) * (-70.997) (-70.632) [-71.496] (-70.913) -- 0:00:40
489000 -- (-75.657) (-75.003) (-75.377) [-71.594] * [-72.888] (-73.135) (-72.648) (-75.623) -- 0:00:40
490000 -- (-80.159) (-70.744) [-74.779] (-71.532) * (-74.867) (-75.830) [-73.187] (-71.449) -- 0:00:40
Average standard deviation of split frequencies: 0.023058
491000 -- [-73.913] (-74.179) (-73.194) (-73.076) * (-71.881) (-71.722) (-74.838) [-72.490] -- 0:00:40
492000 -- (-74.789) (-74.840) (-77.553) [-72.773] * (-73.915) [-74.677] (-74.190) (-79.186) -- 0:00:41
493000 -- (-71.407) (-71.632) [-72.414] (-72.450) * (-71.861) (-87.256) [-71.508] (-73.939) -- 0:00:41
494000 -- [-71.529] (-74.785) (-74.936) (-72.213) * [-70.882] (-79.161) (-71.611) (-75.292) -- 0:00:40
495000 -- [-72.107] (-72.062) (-75.767) (-80.019) * (-71.233) [-73.760] (-79.066) (-72.098) -- 0:00:40
Average standard deviation of split frequencies: 0.022810
496000 -- (-71.141) (-71.283) (-71.781) [-74.230] * (-72.593) [-71.561] (-78.278) (-72.981) -- 0:00:40
497000 -- (-73.992) (-72.314) (-71.740) [-72.992] * (-79.199) (-72.311) [-72.399] (-73.347) -- 0:00:40
498000 -- (-73.354) (-72.232) (-80.351) [-72.972] * (-73.920) (-78.724) [-70.599] (-71.858) -- 0:00:40
499000 -- (-73.230) [-73.149] (-75.962) (-73.584) * (-73.099) (-70.660) [-73.255] (-75.134) -- 0:00:40
500000 -- [-72.927] (-72.762) (-77.085) (-74.297) * (-71.219) (-73.319) [-72.904] (-71.187) -- 0:00:40
Average standard deviation of split frequencies: 0.020714
501000 -- (-76.005) (-72.687) [-71.378] (-73.026) * (-72.305) [-72.237] (-72.691) (-73.092) -- 0:00:39
502000 -- (-71.369) [-71.797] (-72.514) (-75.780) * (-71.068) (-75.661) [-74.071] (-71.083) -- 0:00:39
503000 -- (-72.288) (-70.908) [-72.302] (-72.098) * (-73.678) [-73.112] (-77.207) (-71.534) -- 0:00:39
504000 -- (-78.611) (-72.616) [-72.508] (-74.546) * [-71.404] (-71.123) (-73.315) (-72.910) -- 0:00:40
505000 -- (-78.417) (-74.906) [-72.781] (-74.516) * (-71.508) (-71.793) (-74.022) [-71.223] -- 0:00:40
Average standard deviation of split frequencies: 0.019254
506000 -- (-72.017) (-72.522) (-71.673) [-72.777] * (-72.561) (-70.987) [-76.384] (-74.599) -- 0:00:40
507000 -- (-73.658) (-72.025) [-71.479] (-72.703) * (-73.424) (-73.236) [-78.837] (-77.346) -- 0:00:39
508000 -- [-72.246] (-78.152) (-71.332) (-72.036) * (-72.646) [-72.089] (-76.445) (-77.358) -- 0:00:39
509000 -- (-72.435) (-71.948) (-71.307) [-71.969] * (-72.441) [-72.213] (-73.937) (-72.641) -- 0:00:39
510000 -- (-72.393) (-74.366) [-74.608] (-76.229) * [-71.608] (-71.997) (-74.767) (-74.595) -- 0:00:39
Average standard deviation of split frequencies: 0.019078
511000 -- (-72.454) [-71.132] (-73.614) (-75.044) * (-71.626) [-72.426] (-74.621) (-72.428) -- 0:00:39
512000 -- (-73.523) (-76.815) (-73.240) [-71.588] * (-72.326) (-72.516) [-72.611] (-71.986) -- 0:00:39
513000 -- (-71.643) (-73.004) [-71.164] (-72.706) * (-71.213) (-74.409) (-71.981) [-70.921] -- 0:00:38
514000 -- (-72.784) (-74.176) [-71.421] (-78.263) * (-76.725) (-71.090) (-78.919) [-71.182] -- 0:00:38
515000 -- [-74.078] (-71.092) (-72.026) (-76.325) * (-73.428) [-74.624] (-72.401) (-75.621) -- 0:00:38
Average standard deviation of split frequencies: 0.018271
516000 -- (-72.521) (-73.511) [-73.307] (-72.301) * (-71.889) [-73.859] (-71.616) (-72.137) -- 0:00:38
517000 -- [-72.017] (-72.646) (-71.486) (-71.742) * (-71.526) (-73.305) [-71.755] (-71.597) -- 0:00:39
518000 -- (-73.951) (-75.079) [-71.842] (-72.219) * (-71.753) (-78.824) [-73.013] (-80.011) -- 0:00:39
519000 -- (-71.019) [-72.025] (-70.899) (-73.094) * (-74.494) [-73.374] (-73.648) (-72.698) -- 0:00:38
520000 -- [-76.073] (-72.704) (-71.420) (-75.946) * (-71.938) [-74.189] (-71.709) (-70.971) -- 0:00:38
Average standard deviation of split frequencies: 0.018711
521000 -- (-75.435) (-71.318) (-72.077) [-72.488] * (-73.536) (-72.819) (-73.205) [-72.610] -- 0:00:38
522000 -- (-71.167) (-76.872) (-71.984) [-73.724] * (-71.429) (-71.834) [-73.433] (-70.517) -- 0:00:38
523000 -- [-72.535] (-80.854) (-71.452) (-75.245) * [-73.304] (-71.171) (-73.923) (-71.538) -- 0:00:38
524000 -- (-72.605) (-73.611) [-71.674] (-70.933) * (-75.218) (-72.181) [-75.160] (-75.961) -- 0:00:38
525000 -- [-72.734] (-72.209) (-71.545) (-71.546) * (-76.813) (-72.364) [-72.278] (-74.355) -- 0:00:38
Average standard deviation of split frequencies: 0.016132
526000 -- [-71.756] (-75.286) (-72.754) (-72.031) * (-72.615) [-73.281] (-72.031) (-71.466) -- 0:00:37
527000 -- (-72.324) (-72.549) (-74.406) [-74.564] * (-72.813) (-72.400) [-71.815] (-73.091) -- 0:00:37
528000 -- [-71.527] (-76.644) (-73.093) (-71.893) * [-71.042] (-74.837) (-70.990) (-72.847) -- 0:00:37
529000 -- (-75.723) [-72.349] (-73.565) (-74.158) * (-73.937) (-74.660) (-78.289) [-72.850] -- 0:00:38
530000 -- [-70.927] (-74.731) (-73.624) (-75.971) * (-73.592) [-74.037] (-72.670) (-71.143) -- 0:00:38
Average standard deviation of split frequencies: 0.015398
531000 -- (-73.944) [-71.715] (-72.640) (-71.934) * [-71.181] (-70.962) (-77.484) (-72.900) -- 0:00:37
532000 -- (-73.905) (-81.366) [-71.448] (-74.787) * (-75.272) [-70.736] (-73.520) (-74.774) -- 0:00:37
533000 -- (-71.631) (-74.110) [-81.683] (-75.520) * [-74.516] (-72.778) (-72.212) (-73.069) -- 0:00:37
534000 -- (-72.300) (-72.126) (-81.700) [-76.801] * (-72.874) (-73.306) [-72.564] (-71.361) -- 0:00:37
535000 -- (-72.408) (-74.632) (-73.318) [-72.862] * [-70.997] (-74.068) (-73.655) (-73.531) -- 0:00:37
Average standard deviation of split frequencies: 0.015831
536000 -- (-73.239) (-78.253) (-72.942) [-70.628] * (-73.190) (-74.436) [-73.441] (-74.922) -- 0:00:37
537000 -- (-73.623) (-72.669) (-71.625) [-71.068] * [-71.050] (-73.563) (-74.639) (-72.039) -- 0:00:37
538000 -- (-73.268) (-75.925) (-72.515) [-71.140] * (-71.045) [-72.166] (-74.866) (-71.896) -- 0:00:36
539000 -- [-72.821] (-77.973) (-71.782) (-72.756) * (-75.235) (-71.851) (-73.370) [-72.524] -- 0:00:36
540000 -- (-71.367) (-73.245) [-74.076] (-78.121) * (-72.539) [-72.784] (-72.430) (-71.114) -- 0:00:36
Average standard deviation of split frequencies: 0.014532
541000 -- (-72.936) [-73.350] (-73.713) (-71.404) * (-71.406) (-76.008) [-73.032] (-72.014) -- 0:00:36
542000 -- (-72.136) (-73.654) [-71.928] (-74.292) * [-71.107] (-73.557) (-72.464) (-71.142) -- 0:00:37
543000 -- (-71.359) (-73.336) (-72.501) [-72.066] * (-75.896) (-72.683) (-72.912) [-74.818] -- 0:00:37
544000 -- (-70.675) [-71.837] (-73.513) (-75.037) * [-71.963] (-71.680) (-74.774) (-75.399) -- 0:00:36
545000 -- (-74.781) [-71.144] (-74.998) (-74.324) * [-80.562] (-75.267) (-71.378) (-76.298) -- 0:00:36
Average standard deviation of split frequencies: 0.016116
546000 -- (-75.151) (-71.724) (-73.030) [-72.411] * (-70.826) (-72.636) (-76.627) [-72.994] -- 0:00:36
547000 -- (-73.733) [-73.930] (-76.907) (-72.634) * [-73.158] (-72.038) (-73.757) (-72.386) -- 0:00:36
548000 -- (-79.755) [-70.819] (-74.119) (-72.825) * (-73.250) [-71.267] (-72.107) (-73.371) -- 0:00:36
549000 -- [-73.169] (-73.025) (-76.901) (-71.472) * (-72.252) (-76.034) [-75.395] (-72.661) -- 0:00:36
550000 -- (-72.253) (-72.689) (-76.125) [-70.949] * (-80.400) [-70.679] (-70.908) (-74.997) -- 0:00:36
Average standard deviation of split frequencies: 0.017692
551000 -- [-73.484] (-73.155) (-73.756) (-73.121) * (-71.809) (-72.249) [-72.709] (-72.053) -- 0:00:35
552000 -- (-72.942) (-72.008) [-71.191] (-72.151) * [-71.924] (-71.087) (-72.053) (-71.163) -- 0:00:35
553000 -- (-76.390) [-71.606] (-71.810) (-73.674) * [-72.796] (-73.794) (-77.269) (-77.116) -- 0:00:35
554000 -- (-72.389) [-71.889] (-74.333) (-73.396) * [-75.039] (-73.003) (-73.186) (-72.367) -- 0:00:36
555000 -- (-72.223) (-73.888) (-70.781) [-73.897] * [-71.043] (-71.980) (-70.795) (-76.642) -- 0:00:36
Average standard deviation of split frequencies: 0.018087
556000 -- (-73.346) (-72.456) (-73.676) [-73.765] * (-72.179) (-76.505) (-72.072) [-77.919] -- 0:00:35
557000 -- (-73.413) [-72.717] (-71.437) (-73.750) * (-72.771) (-74.104) (-73.331) [-72.197] -- 0:00:35
558000 -- [-70.856] (-73.372) (-73.114) (-71.482) * (-73.031) (-73.093) [-73.364] (-72.482) -- 0:00:35
559000 -- [-72.666] (-72.547) (-71.968) (-71.247) * (-74.909) (-73.682) (-72.527) [-71.844] -- 0:00:35
560000 -- (-74.728) (-72.949) (-72.237) [-70.817] * (-71.550) (-72.872) (-70.863) [-72.401] -- 0:00:35
Average standard deviation of split frequencies: 0.016255
561000 -- [-71.533] (-73.544) (-72.280) (-72.212) * (-72.682) [-73.000] (-72.354) (-72.935) -- 0:00:35
562000 -- (-73.847) (-71.215) (-78.053) [-74.336] * [-73.671] (-71.922) (-72.181) (-73.199) -- 0:00:35
563000 -- (-74.823) [-72.128] (-77.623) (-71.862) * [-73.201] (-75.439) (-71.526) (-75.310) -- 0:00:34
564000 -- [-73.248] (-70.815) (-74.373) (-72.192) * [-72.604] (-71.184) (-75.058) (-73.186) -- 0:00:34
565000 -- [-78.309] (-74.061) (-73.357) (-73.032) * (-72.248) [-73.652] (-75.890) (-74.109) -- 0:00:34
Average standard deviation of split frequencies: 0.014992
566000 -- (-71.626) (-71.581) (-71.932) [-71.969] * [-71.934] (-74.478) (-71.433) (-75.810) -- 0:00:35
567000 -- (-72.688) (-74.137) (-79.315) [-75.728] * (-73.339) (-71.785) (-72.290) [-71.264] -- 0:00:35
568000 -- (-70.746) (-74.671) [-72.791] (-72.811) * (-73.759) [-71.317] (-74.057) (-73.229) -- 0:00:34
569000 -- (-73.289) (-73.402) (-76.017) [-71.503] * (-70.638) (-74.546) (-71.822) [-70.872] -- 0:00:34
570000 -- [-72.043] (-73.371) (-71.727) (-74.909) * (-73.826) [-70.907] (-76.036) (-76.615) -- 0:00:34
Average standard deviation of split frequencies: 0.015420
571000 -- (-75.133) [-70.919] (-70.745) (-71.644) * (-73.762) [-71.350] (-72.552) (-73.694) -- 0:00:34
572000 -- (-71.921) (-73.960) [-73.238] (-71.042) * (-75.067) [-73.749] (-72.723) (-72.990) -- 0:00:34
573000 -- (-74.598) (-73.405) (-71.787) [-71.225] * [-72.729] (-71.347) (-71.698) (-73.773) -- 0:00:34
574000 -- (-75.365) (-72.897) [-70.862] (-72.335) * (-71.366) [-71.084] (-72.999) (-71.590) -- 0:00:34
575000 -- (-78.308) (-72.108) [-72.000] (-83.290) * [-73.791] (-74.546) (-73.120) (-73.802) -- 0:00:34
Average standard deviation of split frequencies: 0.015277
576000 -- (-72.430) (-73.156) (-70.987) [-73.131] * (-72.148) (-71.233) [-71.299] (-72.587) -- 0:00:33
577000 -- [-71.772] (-72.324) (-74.837) (-73.619) * [-70.908] (-72.520) (-73.590) (-75.404) -- 0:00:33
578000 -- (-75.133) (-73.761) (-72.676) [-71.205] * (-71.951) (-72.419) (-73.045) [-74.290] -- 0:00:33
579000 -- (-79.897) [-71.387] (-74.550) (-73.195) * (-74.642) (-71.588) [-74.421] (-72.463) -- 0:00:34
580000 -- [-70.648] (-72.092) (-71.167) (-73.630) * (-73.154) (-76.850) (-71.192) [-75.568] -- 0:00:34
Average standard deviation of split frequencies: 0.016237
581000 -- (-71.247) (-70.915) [-71.772] (-71.722) * (-74.313) [-72.446] (-73.214) (-72.444) -- 0:00:33
582000 -- (-74.047) [-73.114] (-72.585) (-71.326) * (-72.357) (-74.172) [-73.322] (-77.325) -- 0:00:33
583000 -- [-72.450] (-74.118) (-72.327) (-75.498) * (-75.682) (-76.039) [-74.007] (-72.386) -- 0:00:33
584000 -- (-71.413) (-71.119) [-71.582] (-73.276) * (-73.133) (-71.314) (-72.265) [-71.854] -- 0:00:33
585000 -- (-70.714) (-71.189) (-73.605) [-71.528] * (-71.385) [-73.255] (-77.847) (-72.524) -- 0:00:33
Average standard deviation of split frequencies: 0.016089
586000 -- (-71.257) (-70.620) [-74.348] (-74.711) * (-72.354) (-73.676) [-71.607] (-73.028) -- 0:00:33
587000 -- (-73.044) [-71.019] (-72.097) (-72.610) * (-72.666) (-72.884) [-74.355] (-71.757) -- 0:00:33
588000 -- (-74.899) [-71.240] (-71.178) (-78.317) * (-72.962) (-73.299) [-74.640] (-73.595) -- 0:00:32
589000 -- (-75.402) (-72.639) (-73.750) [-73.961] * (-73.837) (-73.280) [-74.741] (-74.991) -- 0:00:32
590000 -- (-81.147) (-71.263) [-70.952] (-72.631) * [-72.886] (-74.426) (-73.145) (-75.547) -- 0:00:32
Average standard deviation of split frequencies: 0.017558
591000 -- [-77.315] (-72.330) (-74.893) (-73.651) * (-73.394) (-72.638) [-71.530] (-72.415) -- 0:00:33
592000 -- (-75.481) [-72.427] (-72.086) (-73.125) * (-74.210) [-76.893] (-71.851) (-72.330) -- 0:00:33
593000 -- [-71.493] (-75.676) (-71.619) (-72.514) * (-71.233) (-73.631) [-74.550] (-71.408) -- 0:00:32
594000 -- (-73.276) (-72.130) (-71.357) [-74.039] * [-74.056] (-70.453) (-73.310) (-72.241) -- 0:00:32
595000 -- (-74.816) (-73.378) [-71.565] (-71.059) * [-72.125] (-70.748) (-71.161) (-70.913) -- 0:00:32
Average standard deviation of split frequencies: 0.016874
596000 -- (-74.589) (-73.243) (-73.784) [-73.466] * (-71.844) [-72.669] (-74.641) (-71.761) -- 0:00:32
597000 -- [-73.462] (-74.228) (-72.950) (-71.400) * (-73.383) [-72.936] (-72.016) (-73.184) -- 0:00:32
598000 -- (-74.883) [-71.451] (-71.164) (-73.082) * [-72.742] (-71.357) (-72.947) (-72.929) -- 0:00:32
599000 -- (-73.741) [-75.405] (-72.176) (-70.997) * (-74.851) (-72.074) (-73.799) [-71.679] -- 0:00:32
600000 -- (-72.887) (-70.969) [-72.457] (-71.861) * (-72.409) [-73.675] (-71.323) (-72.152) -- 0:00:32
Average standard deviation of split frequencies: 0.017789
601000 -- [-72.585] (-72.382) (-75.744) (-73.675) * (-72.188) (-74.714) (-72.278) [-71.667] -- 0:00:31
602000 -- (-73.046) (-71.433) (-72.437) [-73.200] * [-73.583] (-80.455) (-72.513) (-77.891) -- 0:00:31
603000 -- (-74.355) (-75.523) [-73.001] (-71.312) * (-73.083) [-72.078] (-73.346) (-77.337) -- 0:00:32
604000 -- (-72.818) [-76.550] (-70.927) (-71.996) * (-73.583) (-71.369) [-76.587] (-72.147) -- 0:00:32
605000 -- [-71.119] (-71.288) (-71.510) (-75.795) * (-70.948) (-70.754) (-72.409) [-76.312] -- 0:00:31
Average standard deviation of split frequencies: 0.018669
606000 -- [-72.287] (-74.924) (-71.170) (-72.092) * [-72.624] (-73.155) (-75.832) (-72.035) -- 0:00:31
607000 -- (-72.973) [-74.071] (-72.283) (-74.223) * (-75.664) (-74.708) (-71.855) [-72.029] -- 0:00:31
608000 -- (-74.236) [-71.082] (-72.685) (-72.745) * (-71.556) (-74.369) [-71.132] (-73.514) -- 0:00:31
609000 -- (-74.349) (-72.843) [-73.091] (-75.040) * (-71.820) (-72.887) [-73.460] (-74.480) -- 0:00:31
610000 -- [-72.291] (-73.756) (-72.206) (-73.500) * (-71.838) (-71.171) [-72.673] (-72.759) -- 0:00:31
Average standard deviation of split frequencies: 0.017498
611000 -- (-71.174) (-72.302) [-73.461] (-74.788) * [-72.955] (-71.232) (-72.953) (-72.260) -- 0:00:31
612000 -- [-71.740] (-71.703) (-72.487) (-73.934) * [-72.387] (-72.567) (-71.830) (-71.089) -- 0:00:31
613000 -- (-73.185) [-72.465] (-71.745) (-74.070) * [-71.597] (-73.854) (-71.259) (-71.040) -- 0:00:30
614000 -- (-73.130) (-71.127) [-73.314] (-74.522) * [-73.687] (-73.693) (-71.692) (-76.147) -- 0:00:30
615000 -- [-70.878] (-74.438) (-76.201) (-74.553) * (-72.242) (-75.476) [-71.466] (-72.654) -- 0:00:30
Average standard deviation of split frequencies: 0.016836
616000 -- (-72.821) (-73.341) [-71.979] (-74.233) * (-72.627) (-72.092) (-73.147) [-73.746] -- 0:00:31
617000 -- (-72.956) (-70.719) (-74.202) [-73.526] * (-71.516) (-73.469) (-72.185) [-73.544] -- 0:00:31
618000 -- (-72.328) (-74.446) (-72.510) [-71.616] * (-72.725) [-72.465] (-71.785) (-72.547) -- 0:00:30
619000 -- (-75.223) [-73.571] (-71.965) (-73.317) * (-75.289) (-73.076) [-74.767] (-73.190) -- 0:00:30
620000 -- (-74.644) [-74.471] (-75.082) (-78.638) * (-73.517) (-75.273) (-72.872) [-72.711] -- 0:00:30
Average standard deviation of split frequencies: 0.016709
621000 -- (-71.522) (-74.735) [-74.354] (-75.175) * (-72.175) (-79.584) (-73.467) [-72.158] -- 0:00:30
622000 -- (-73.422) (-71.744) (-76.440) [-73.313] * [-71.476] (-71.234) (-74.127) (-74.295) -- 0:00:30
623000 -- (-72.809) [-74.007] (-73.866) (-76.986) * (-71.016) (-72.382) [-74.158] (-71.260) -- 0:00:30
624000 -- (-73.136) (-75.195) (-71.372) [-71.732] * (-72.142) (-71.116) (-73.237) [-71.855] -- 0:00:30
625000 -- [-72.018] (-71.670) (-71.059) (-74.982) * (-71.618) [-73.182] (-71.569) (-73.911) -- 0:00:30
Average standard deviation of split frequencies: 0.017069
626000 -- (-71.741) (-77.547) [-76.735] (-72.858) * (-72.639) [-73.603] (-73.539) (-72.151) -- 0:00:29
627000 -- (-73.582) [-71.562] (-73.777) (-76.017) * [-71.830] (-71.450) (-72.535) (-72.472) -- 0:00:29
628000 -- (-72.315) (-75.408) (-74.327) [-71.680] * (-71.473) (-72.523) (-71.852) [-75.086] -- 0:00:30
629000 -- (-73.942) (-76.724) (-73.685) [-71.956] * (-71.688) [-73.362] (-73.203) (-72.830) -- 0:00:30
630000 -- (-72.048) (-72.484) (-75.400) [-71.490] * (-77.683) (-73.271) [-72.158] (-74.322) -- 0:00:29
Average standard deviation of split frequencies: 0.015448
631000 -- (-72.382) (-72.780) [-71.746] (-72.359) * (-73.847) [-72.045] (-71.718) (-78.187) -- 0:00:29
632000 -- [-74.160] (-74.743) (-71.581) (-72.391) * (-73.560) [-72.757] (-76.203) (-75.875) -- 0:00:29
633000 -- (-70.799) [-71.976] (-75.748) (-73.357) * [-71.640] (-72.479) (-74.358) (-76.330) -- 0:00:29
634000 -- (-70.843) [-72.868] (-73.640) (-75.641) * (-74.697) [-73.330] (-71.984) (-76.118) -- 0:00:29
635000 -- [-72.522] (-71.829) (-72.880) (-71.288) * [-72.010] (-71.820) (-73.766) (-71.357) -- 0:00:29
Average standard deviation of split frequencies: 0.015812
636000 -- [-72.954] (-72.456) (-71.647) (-71.751) * (-72.210) (-72.758) [-71.719] (-72.758) -- 0:00:29
637000 -- [-73.617] (-71.263) (-74.020) (-71.139) * [-73.550] (-76.013) (-71.954) (-73.955) -- 0:00:29
638000 -- (-76.660) (-72.398) (-71.054) [-71.037] * (-74.034) [-75.042] (-73.580) (-73.845) -- 0:00:28
639000 -- (-74.803) [-73.570] (-71.477) (-74.504) * (-73.324) [-74.369] (-71.178) (-72.985) -- 0:00:28
640000 -- (-72.033) (-74.598) (-73.296) [-70.552] * (-75.546) (-74.537) [-71.505] (-70.837) -- 0:00:28
Average standard deviation of split frequencies: 0.014716
641000 -- (-72.133) (-74.448) (-71.604) [-70.843] * (-73.736) (-72.734) (-70.853) [-73.688] -- 0:00:29
642000 -- (-74.297) (-72.183) [-71.082] (-74.989) * [-72.097] (-71.354) (-71.317) (-72.931) -- 0:00:28
643000 -- [-78.144] (-74.460) (-74.165) (-74.757) * (-72.043) (-71.980) [-72.525] (-73.887) -- 0:00:28
644000 -- [-72.668] (-74.350) (-71.068) (-74.048) * (-70.643) [-71.222] (-73.054) (-72.943) -- 0:00:28
645000 -- (-74.665) [-74.040] (-78.632) (-71.227) * [-71.888] (-73.196) (-74.781) (-74.654) -- 0:00:28
Average standard deviation of split frequencies: 0.015081
646000 -- (-70.796) (-73.977) (-71.780) [-71.330] * (-74.269) (-71.538) (-71.575) [-72.214] -- 0:00:28
647000 -- [-71.757] (-74.720) (-72.600) (-73.804) * (-72.050) (-72.477) (-72.687) [-70.686] -- 0:00:28
648000 -- (-73.466) (-71.051) [-71.994] (-73.955) * (-72.192) (-72.710) (-72.243) [-71.941] -- 0:00:28
649000 -- (-77.462) (-71.933) [-71.795] (-72.716) * (-72.380) (-71.859) (-74.234) [-71.365] -- 0:00:28
650000 -- [-71.824] (-76.430) (-74.764) (-76.495) * (-74.053) (-74.166) (-74.737) [-71.252] -- 0:00:28
Average standard deviation of split frequencies: 0.015456
651000 -- (-71.017) (-73.371) [-75.693] (-71.776) * [-71.580] (-71.528) (-71.974) (-72.075) -- 0:00:27
652000 -- [-72.709] (-74.884) (-75.437) (-71.675) * [-71.142] (-73.522) (-71.787) (-71.200) -- 0:00:27
653000 -- [-73.779] (-73.334) (-71.076) (-72.874) * (-72.204) [-72.462] (-71.915) (-71.687) -- 0:00:28
654000 -- (-72.291) (-75.457) (-71.764) [-74.151] * [-75.686] (-72.717) (-77.624) (-71.796) -- 0:00:28
655000 -- (-75.129) (-71.963) (-72.083) [-72.832] * [-73.902] (-76.152) (-72.183) (-72.013) -- 0:00:27
Average standard deviation of split frequencies: 0.015809
656000 -- [-74.880] (-74.764) (-71.444) (-76.268) * [-71.530] (-74.169) (-73.061) (-71.512) -- 0:00:27
657000 -- (-73.375) (-73.368) [-72.038] (-73.718) * (-71.822) (-73.999) (-71.176) [-70.890] -- 0:00:27
658000 -- [-72.386] (-71.632) (-74.018) (-70.763) * (-72.564) (-73.151) (-74.905) [-72.902] -- 0:00:27
659000 -- (-74.282) (-72.814) (-73.384) [-71.340] * (-74.112) (-72.786) (-73.307) [-72.117] -- 0:00:27
660000 -- (-72.015) (-72.559) [-70.971] (-76.954) * [-72.700] (-75.428) (-73.121) (-71.519) -- 0:00:27
Average standard deviation of split frequencies: 0.017600
661000 -- (-72.118) [-71.374] (-74.834) (-73.285) * (-75.741) (-73.177) [-73.036] (-71.389) -- 0:00:27
662000 -- (-71.888) (-71.328) (-71.695) [-70.862] * (-71.982) [-71.708] (-71.786) (-72.113) -- 0:00:27
663000 -- (-72.309) (-71.938) [-71.268] (-71.514) * (-72.171) (-72.254) (-71.809) [-74.713] -- 0:00:26
664000 -- [-73.212] (-72.775) (-73.015) (-72.929) * [-74.494] (-71.361) (-75.439) (-72.495) -- 0:00:26
665000 -- (-73.649) [-71.434] (-72.739) (-73.069) * [-71.590] (-76.204) (-72.765) (-71.720) -- 0:00:26
Average standard deviation of split frequencies: 0.016988
666000 -- [-73.056] (-75.702) (-72.602) (-72.438) * [-72.641] (-71.871) (-73.340) (-72.112) -- 0:00:27
667000 -- (-72.331) (-72.825) (-73.505) [-75.650] * (-73.153) [-72.076] (-73.881) (-73.048) -- 0:00:26
668000 -- (-73.773) (-74.024) (-72.885) [-71.818] * (-77.374) [-73.137] (-74.936) (-71.207) -- 0:00:26
669000 -- (-71.643) (-75.350) [-72.266] (-72.554) * (-74.219) (-74.579) [-73.085] (-74.655) -- 0:00:26
670000 -- (-72.406) (-73.573) [-72.327] (-74.478) * (-71.259) [-71.111] (-75.061) (-76.523) -- 0:00:26
Average standard deviation of split frequencies: 0.016401
671000 -- [-74.046] (-71.527) (-72.612) (-70.979) * (-76.545) [-71.803] (-77.567) (-74.945) -- 0:00:26
672000 -- (-72.345) [-71.945] (-72.902) (-72.910) * [-71.996] (-72.112) (-73.298) (-73.882) -- 0:00:26
673000 -- [-73.222] (-74.818) (-73.281) (-71.825) * (-72.222) [-76.033] (-73.570) (-73.585) -- 0:00:26
674000 -- [-72.609] (-74.498) (-76.802) (-72.287) * (-72.663) (-74.205) (-73.183) [-72.643] -- 0:00:26
675000 -- [-72.311] (-72.753) (-72.975) (-73.945) * (-72.167) (-72.612) (-75.058) [-72.179] -- 0:00:26
Average standard deviation of split frequencies: 0.015806
676000 -- [-73.277] (-71.860) (-71.382) (-72.481) * (-71.559) (-74.903) (-72.871) [-71.817] -- 0:00:25
677000 -- [-72.712] (-77.752) (-71.395) (-75.544) * (-73.362) (-72.009) [-72.455] (-74.337) -- 0:00:25
678000 -- [-70.967] (-71.564) (-72.976) (-71.076) * [-72.656] (-73.170) (-77.635) (-74.329) -- 0:00:26
679000 -- (-71.219) (-73.907) [-70.858] (-76.397) * (-79.454) [-71.579] (-73.373) (-77.333) -- 0:00:26
680000 -- (-70.906) (-73.107) [-73.320] (-73.281) * (-72.504) (-74.755) [-70.994] (-70.526) -- 0:00:25
Average standard deviation of split frequencies: 0.013851
681000 -- (-71.953) (-74.007) (-72.994) [-71.093] * (-73.815) (-75.499) [-72.137] (-73.223) -- 0:00:25
682000 -- (-75.623) [-71.716] (-71.917) (-75.945) * (-71.832) [-72.360] (-71.225) (-72.565) -- 0:00:25
683000 -- (-71.281) [-71.916] (-73.316) (-71.944) * (-71.973) [-71.007] (-73.432) (-71.503) -- 0:00:25
684000 -- (-77.571) (-72.535) (-71.358) [-71.559] * (-71.739) [-70.722] (-71.413) (-75.718) -- 0:00:25
685000 -- (-71.728) (-71.906) (-71.862) [-71.478] * (-73.664) (-71.847) (-72.196) [-70.866] -- 0:00:25
Average standard deviation of split frequencies: 0.014660
686000 -- (-76.411) [-73.157] (-73.189) (-72.301) * (-71.195) [-70.529] (-73.552) (-75.547) -- 0:00:25
687000 -- (-76.587) [-78.822] (-73.484) (-73.762) * [-74.017] (-76.828) (-71.692) (-71.984) -- 0:00:25
688000 -- (-72.453) (-75.026) (-73.814) [-74.781] * (-74.640) (-72.454) (-72.555) [-72.894] -- 0:00:24
689000 -- [-76.523] (-71.092) (-75.767) (-72.331) * (-73.047) (-75.787) (-71.439) [-71.490] -- 0:00:24
690000 -- (-72.327) (-74.933) [-72.420] (-73.974) * (-70.786) [-74.500] (-71.690) (-76.966) -- 0:00:25
Average standard deviation of split frequencies: 0.015016
691000 -- [-74.172] (-73.639) (-73.346) (-72.020) * [-71.616] (-72.143) (-75.089) (-76.621) -- 0:00:25
692000 -- [-75.966] (-71.884) (-71.988) (-74.802) * (-72.532) (-71.277) (-73.576) [-73.176] -- 0:00:24
693000 -- [-70.880] (-72.993) (-74.197) (-74.007) * [-71.399] (-72.077) (-72.631) (-70.777) -- 0:00:24
694000 -- (-70.577) [-71.882] (-73.766) (-73.623) * (-71.288) (-73.371) [-74.160] (-72.083) -- 0:00:24
695000 -- (-72.742) (-75.495) (-73.208) [-73.655] * [-71.494] (-74.328) (-72.396) (-73.772) -- 0:00:24
Average standard deviation of split frequencies: 0.016707
696000 -- (-73.626) (-76.297) (-72.705) [-74.408] * (-72.167) (-72.546) [-73.286] (-72.458) -- 0:00:24
697000 -- (-73.917) (-76.178) (-73.287) [-71.319] * (-71.139) (-70.479) (-71.006) [-75.165] -- 0:00:24
698000 -- [-75.333] (-71.168) (-74.941) (-71.270) * [-76.420] (-70.988) (-75.895) (-74.000) -- 0:00:24
699000 -- (-76.832) (-72.255) (-77.432) [-72.330] * [-72.547] (-72.080) (-73.504) (-71.175) -- 0:00:24
700000 -- (-70.994) [-70.969] (-71.689) (-71.447) * (-72.522) (-71.844) (-72.993) [-71.842] -- 0:00:24
Average standard deviation of split frequencies: 0.015699
701000 -- (-72.622) (-77.525) [-72.321] (-72.946) * (-73.785) (-71.831) (-71.800) [-71.862] -- 0:00:23
702000 -- [-74.572] (-76.472) (-74.164) (-72.684) * [-73.022] (-72.727) (-73.363) (-71.431) -- 0:00:23
703000 -- [-73.245] (-73.349) (-74.976) (-78.582) * (-73.847) (-72.848) [-71.169] (-73.322) -- 0:00:24
704000 -- [-71.194] (-73.231) (-74.263) (-73.951) * (-74.354) [-71.752] (-71.831) (-71.514) -- 0:00:23
705000 -- (-71.340) (-72.150) [-71.760] (-72.559) * (-74.273) (-74.107) [-71.896] (-72.635) -- 0:00:23
Average standard deviation of split frequencies: 0.016025
706000 -- (-72.256) (-73.037) (-73.942) [-72.549] * [-73.346] (-71.735) (-72.185) (-72.160) -- 0:00:23
707000 -- (-72.143) (-72.225) (-73.297) [-72.703] * (-71.398) (-74.907) (-73.646) [-71.103] -- 0:00:23
708000 -- (-72.313) (-75.935) (-71.197) [-74.448] * [-72.938] (-73.521) (-72.885) (-74.133) -- 0:00:23
709000 -- (-74.530) (-78.046) [-72.655] (-73.183) * (-71.765) (-73.513) (-70.570) [-71.009] -- 0:00:23
710000 -- [-74.779] (-74.847) (-72.071) (-73.180) * (-70.767) [-73.378] (-73.530) (-72.489) -- 0:00:23
Average standard deviation of split frequencies: 0.014151
711000 -- (-72.702) [-71.044] (-74.258) (-74.330) * [-71.694] (-70.646) (-74.035) (-71.511) -- 0:00:23
712000 -- (-72.958) [-79.362] (-71.733) (-73.496) * (-71.599) [-75.880] (-72.428) (-76.844) -- 0:00:23
713000 -- [-71.048] (-78.356) (-71.889) (-71.566) * (-72.816) [-72.713] (-72.283) (-74.587) -- 0:00:22
714000 -- [-71.114] (-72.251) (-72.746) (-72.346) * (-74.133) (-71.649) [-73.368] (-74.872) -- 0:00:22
715000 -- [-75.159] (-73.960) (-73.130) (-73.735) * (-71.121) (-74.962) (-76.004) [-72.670] -- 0:00:23
Average standard deviation of split frequencies: 0.013607
716000 -- (-78.224) (-74.809) [-73.224] (-78.122) * [-72.689] (-72.050) (-74.665) (-72.379) -- 0:00:23
717000 -- (-73.565) (-73.469) [-75.852] (-71.769) * (-72.994) (-80.003) [-73.704] (-70.792) -- 0:00:22
718000 -- (-73.196) (-73.918) (-73.089) [-71.526] * (-71.517) [-71.461] (-70.944) (-72.069) -- 0:00:22
719000 -- (-75.021) (-75.380) (-70.945) [-72.696] * (-72.710) [-73.720] (-74.439) (-75.943) -- 0:00:22
720000 -- (-70.846) [-72.340] (-71.945) (-74.092) * (-73.748) [-71.065] (-70.496) (-73.168) -- 0:00:22
Average standard deviation of split frequencies: 0.013519
721000 -- (-72.661) (-72.710) [-78.246] (-74.148) * (-74.569) (-71.673) (-70.574) [-71.640] -- 0:00:22
722000 -- (-75.074) (-71.592) (-74.418) [-71.197] * (-72.635) [-71.904] (-72.859) (-71.426) -- 0:00:22
723000 -- (-72.513) (-73.481) (-71.747) [-71.649] * (-71.116) (-74.543) [-75.242] (-71.629) -- 0:00:22
724000 -- (-75.011) (-73.280) (-73.495) [-73.027] * [-73.292] (-71.157) (-73.254) (-73.068) -- 0:00:22
725000 -- [-73.253] (-73.910) (-78.339) (-74.674) * [-71.512] (-72.134) (-79.111) (-72.970) -- 0:00:22
Average standard deviation of split frequencies: 0.014718
726000 -- (-74.716) (-73.270) [-72.530] (-74.882) * [-72.446] (-72.392) (-73.832) (-74.169) -- 0:00:21
727000 -- (-73.321) (-74.881) [-73.524] (-72.373) * (-73.292) (-73.827) [-75.820] (-77.117) -- 0:00:21
728000 -- (-74.123) [-71.573] (-72.511) (-74.186) * [-72.771] (-72.700) (-76.382) (-75.240) -- 0:00:22
729000 -- [-70.875] (-72.046) (-71.748) (-72.924) * [-72.694] (-71.810) (-71.606) (-75.470) -- 0:00:21
730000 -- (-75.891) (-72.626) (-71.671) [-71.446] * (-71.634) (-75.206) [-72.410] (-72.911) -- 0:00:21
Average standard deviation of split frequencies: 0.012043
731000 -- [-71.441] (-71.446) (-73.240) (-74.526) * [-71.247] (-72.779) (-71.951) (-73.628) -- 0:00:21
732000 -- (-74.031) (-71.474) [-71.728] (-71.079) * (-71.977) (-73.734) (-72.620) [-71.975] -- 0:00:21
733000 -- (-71.728) [-72.160] (-74.655) (-71.214) * (-74.638) (-73.642) (-75.110) [-71.555] -- 0:00:21
734000 -- [-72.094] (-76.021) (-71.586) (-73.243) * (-71.600) [-75.036] (-74.524) (-71.935) -- 0:00:21
735000 -- (-73.282) [-75.728] (-71.248) (-72.079) * (-71.215) (-74.219) [-72.468] (-71.501) -- 0:00:21
Average standard deviation of split frequencies: 0.011529
736000 -- (-73.018) (-73.421) [-72.847] (-73.437) * [-70.859] (-72.893) (-73.290) (-76.534) -- 0:00:21
737000 -- (-71.044) (-73.469) [-71.519] (-73.613) * (-71.841) (-71.922) (-72.906) [-73.776] -- 0:00:21
738000 -- (-75.260) (-71.013) [-72.248] (-71.063) * [-72.257] (-72.183) (-71.532) (-72.732) -- 0:00:20
739000 -- (-72.800) (-73.977) [-74.703] (-75.998) * (-72.056) (-70.560) [-71.286] (-72.584) -- 0:00:20
740000 -- (-70.850) (-72.214) [-72.532] (-76.942) * (-73.298) [-72.443] (-73.692) (-74.177) -- 0:00:21
Average standard deviation of split frequencies: 0.010608
741000 -- (-70.971) (-76.685) [-71.677] (-73.726) * (-72.211) (-71.825) (-70.796) [-71.673] -- 0:00:20
742000 -- (-74.916) (-71.357) [-74.330] (-75.769) * (-71.819) (-73.864) (-71.629) [-72.574] -- 0:00:20
743000 -- (-74.018) (-73.542) [-74.377] (-72.991) * (-72.445) (-72.943) (-73.277) [-72.767] -- 0:00:20
744000 -- [-71.783] (-73.648) (-71.439) (-72.187) * (-74.445) (-71.067) [-73.653] (-72.736) -- 0:00:20
745000 -- [-73.151] (-71.517) (-73.602) (-72.507) * (-73.961) (-73.459) (-73.365) [-73.727] -- 0:00:20
Average standard deviation of split frequencies: 0.010111
746000 -- (-75.602) (-71.553) [-71.561] (-72.132) * (-70.609) (-73.203) (-72.591) [-76.749] -- 0:00:20
747000 -- (-75.852) [-71.163] (-79.431) (-72.081) * (-71.973) (-72.186) (-79.320) [-72.654] -- 0:00:20
748000 -- (-73.305) [-74.058] (-71.208) (-71.582) * (-75.223) (-71.677) (-71.861) [-71.681] -- 0:00:20
749000 -- [-71.643] (-71.734) (-73.453) (-74.850) * [-81.551] (-71.641) (-76.632) (-73.136) -- 0:00:20
750000 -- (-72.981) [-71.595] (-74.360) (-75.009) * (-72.392) (-74.589) [-73.802] (-75.455) -- 0:00:20
Average standard deviation of split frequencies: 0.010048
751000 -- (-73.407) [-72.294] (-71.441) (-76.486) * (-73.593) (-72.374) [-73.312] (-74.295) -- 0:00:19
752000 -- (-71.075) (-74.048) [-73.041] (-75.737) * (-72.030) (-71.191) [-73.578] (-72.234) -- 0:00:19
753000 -- (-76.146) [-71.308] (-72.367) (-76.614) * (-72.573) (-74.047) [-71.384] (-71.514) -- 0:00:20
754000 -- (-71.278) (-75.065) [-73.669] (-73.653) * (-72.675) (-80.271) [-71.595] (-72.009) -- 0:00:19
755000 -- [-72.184] (-74.707) (-71.918) (-73.668) * (-78.102) (-73.654) [-72.095] (-72.675) -- 0:00:19
Average standard deviation of split frequencies: 0.010393
756000 -- (-72.263) (-71.777) [-73.421] (-76.357) * [-72.432] (-72.947) (-77.913) (-72.778) -- 0:00:19
757000 -- (-75.751) [-72.563] (-73.616) (-71.636) * (-76.129) (-71.991) [-71.349] (-71.968) -- 0:00:19
758000 -- (-77.587) [-74.819] (-72.710) (-72.015) * [-73.880] (-72.542) (-76.908) (-72.221) -- 0:00:19
759000 -- (-71.295) (-71.924) [-71.282] (-71.289) * (-71.425) (-74.857) (-72.822) [-74.247] -- 0:00:19
760000 -- [-71.619] (-73.924) (-74.295) (-71.479) * (-74.007) (-75.142) (-72.657) [-73.199] -- 0:00:19
Average standard deviation of split frequencies: 0.009502
761000 -- [-76.497] (-71.925) (-75.200) (-71.433) * (-71.277) (-73.892) [-71.482] (-72.101) -- 0:00:19
762000 -- (-73.607) (-72.011) (-71.360) [-70.683] * (-71.104) (-73.434) [-77.404] (-71.756) -- 0:00:19
763000 -- (-71.693) [-71.615] (-77.651) (-74.282) * (-72.526) [-75.651] (-71.424) (-74.756) -- 0:00:18
764000 -- (-75.044) [-72.263] (-72.602) (-71.892) * (-71.995) (-72.431) [-72.976] (-75.281) -- 0:00:18
765000 -- (-72.011) [-74.778] (-73.125) (-73.274) * (-71.620) (-71.056) (-73.195) [-73.849] -- 0:00:19
Average standard deviation of split frequencies: 0.009026
766000 -- (-73.027) (-73.048) [-71.973] (-75.274) * (-72.585) (-73.125) (-72.445) [-72.584] -- 0:00:18
767000 -- (-74.590) (-74.468) (-75.139) [-70.491] * [-74.498] (-75.464) (-72.073) (-71.401) -- 0:00:18
768000 -- (-71.965) [-73.910] (-75.712) (-71.741) * (-72.713) (-74.203) [-74.017] (-72.515) -- 0:00:18
769000 -- [-73.066] (-75.410) (-77.026) (-71.105) * (-70.708) (-73.457) [-73.053] (-75.339) -- 0:00:18
770000 -- (-72.341) (-71.296) [-72.337] (-73.083) * (-74.347) [-71.437] (-70.867) (-74.246) -- 0:00:18
Average standard deviation of split frequencies: 0.011010
771000 -- (-72.019) (-72.944) [-71.726] (-71.864) * (-71.509) (-70.566) [-71.211] (-75.412) -- 0:00:18
772000 -- (-72.426) (-73.760) [-72.524] (-72.835) * (-73.632) (-73.597) (-71.695) [-71.331] -- 0:00:18
773000 -- [-73.377] (-76.094) (-76.267) (-71.800) * (-73.139) [-71.878] (-75.708) (-71.773) -- 0:00:18
774000 -- (-72.786) (-72.210) (-75.255) [-74.938] * [-72.549] (-71.391) (-72.600) (-72.073) -- 0:00:18
775000 -- (-72.300) (-71.380) (-71.449) [-72.277] * [-71.894] (-71.337) (-72.112) (-76.511) -- 0:00:18
Average standard deviation of split frequencies: 0.010530
776000 -- (-71.936) (-72.527) [-75.430] (-77.771) * (-73.303) (-73.346) [-71.677] (-71.280) -- 0:00:17
777000 -- [-75.463] (-74.188) (-75.828) (-75.078) * (-73.867) (-73.017) [-71.084] (-72.706) -- 0:00:17
778000 -- (-71.028) (-71.240) (-77.702) [-74.089] * (-71.024) (-71.579) (-70.957) [-74.023] -- 0:00:17
779000 -- [-71.966] (-72.088) (-75.834) (-71.993) * (-71.491) (-72.868) (-73.014) [-71.779] -- 0:00:17
780000 -- [-71.457] (-74.857) (-76.832) (-73.131) * [-71.241] (-76.357) (-71.611) (-75.551) -- 0:00:17
Average standard deviation of split frequencies: 0.010869
781000 -- (-79.070) [-71.348] (-75.285) (-71.993) * [-70.697] (-76.894) (-71.674) (-74.076) -- 0:00:17
782000 -- (-71.345) [-70.949] (-73.128) (-74.929) * (-71.854) [-72.015] (-72.245) (-72.522) -- 0:00:17
783000 -- (-75.755) (-73.942) [-72.013] (-73.708) * (-78.161) (-72.425) [-71.007] (-73.276) -- 0:00:17
784000 -- [-72.220] (-71.587) (-72.876) (-71.665) * (-72.466) (-75.188) [-71.942] (-71.511) -- 0:00:17
785000 -- (-72.757) (-71.519) (-73.078) [-73.092] * [-73.512] (-70.921) (-70.767) (-75.943) -- 0:00:17
Average standard deviation of split frequencies: 0.011195
786000 -- (-75.113) [-74.984] (-73.351) (-72.241) * (-76.765) [-71.610] (-72.718) (-72.086) -- 0:00:17
787000 -- (-72.475) [-71.874] (-72.359) (-72.111) * (-72.296) (-72.398) [-71.637] (-71.770) -- 0:00:17
788000 -- (-71.605) (-70.715) [-71.378] (-74.839) * (-72.281) [-73.714] (-72.709) (-70.969) -- 0:00:16
789000 -- (-75.019) (-71.626) (-72.544) [-72.600] * [-72.723] (-70.630) (-73.809) (-71.977) -- 0:00:16
790000 -- (-72.144) [-71.205] (-75.965) (-71.749) * (-74.493) (-74.965) (-72.442) [-74.893] -- 0:00:17
Average standard deviation of split frequencies: 0.011527
791000 -- (-71.709) (-74.297) (-71.207) [-76.146] * (-71.986) [-74.212] (-74.451) (-73.722) -- 0:00:16
792000 -- (-74.756) (-74.416) (-71.528) [-72.284] * [-77.273] (-71.416) (-74.675) (-74.447) -- 0:00:16
793000 -- (-73.277) (-72.879) [-71.344] (-71.692) * (-73.488) (-74.462) (-73.503) [-72.355] -- 0:00:16
794000 -- (-74.191) (-71.442) [-72.083] (-75.417) * (-71.488) (-71.469) (-73.330) [-71.574] -- 0:00:16
795000 -- (-72.570) (-70.936) (-77.618) [-72.943] * (-71.309) (-75.834) (-74.834) [-73.409] -- 0:00:16
Average standard deviation of split frequencies: 0.011450
796000 -- [-71.121] (-79.697) (-75.152) (-73.991) * [-71.270] (-73.060) (-71.977) (-71.331) -- 0:00:16
797000 -- (-72.289) (-73.195) (-75.045) [-73.918] * [-70.908] (-72.898) (-71.480) (-76.161) -- 0:00:16
798000 -- (-75.093) (-74.257) [-71.532] (-74.365) * (-71.916) (-77.479) [-72.534] (-73.832) -- 0:00:16
799000 -- (-70.839) (-71.212) [-73.677] (-70.799) * (-71.225) (-74.160) [-71.525] (-73.210) -- 0:00:16
800000 -- (-72.716) (-71.920) [-74.685] (-71.849) * (-72.727) [-74.662] (-75.672) (-75.592) -- 0:00:16
Average standard deviation of split frequencies: 0.012560
801000 -- [-71.237] (-72.376) (-74.096) (-72.449) * (-71.811) (-71.401) [-76.189] (-71.267) -- 0:00:15
802000 -- (-72.337) (-71.724) [-73.549] (-73.774) * (-74.109) (-72.203) (-73.335) [-71.652] -- 0:00:15
803000 -- [-71.066] (-75.442) (-73.807) (-71.537) * (-75.275) (-77.876) (-72.611) [-71.094] -- 0:00:15
804000 -- (-71.515) (-71.954) [-73.379] (-73.092) * (-75.627) [-74.822] (-79.251) (-76.912) -- 0:00:15
805000 -- (-74.952) (-72.881) (-71.907) [-73.332] * (-77.588) [-73.337] (-73.763) (-72.455) -- 0:00:15
Average standard deviation of split frequencies: 0.012477
806000 -- (-73.381) [-71.812] (-77.440) (-72.012) * (-72.593) [-71.062] (-75.251) (-77.871) -- 0:00:15
807000 -- (-75.208) [-78.612] (-72.160) (-72.263) * (-72.070) (-73.110) (-75.695) [-74.344] -- 0:00:15
808000 -- (-75.988) [-74.157] (-72.334) (-72.343) * (-71.121) (-71.049) (-73.574) [-71.326] -- 0:00:15
809000 -- [-76.572] (-72.211) (-73.779) (-72.614) * (-73.349) [-71.817] (-72.639) (-75.762) -- 0:00:15
810000 -- (-71.298) [-73.992] (-71.822) (-71.563) * [-70.612] (-76.254) (-72.056) (-72.455) -- 0:00:15
Average standard deviation of split frequencies: 0.011242
811000 -- [-71.617] (-72.731) (-71.693) (-72.967) * (-73.979) [-71.488] (-72.946) (-72.970) -- 0:00:15
812000 -- [-70.772] (-71.223) (-72.447) (-74.366) * (-75.819) (-73.909) (-73.346) [-72.002] -- 0:00:15
813000 -- [-73.037] (-74.752) (-71.345) (-72.975) * (-75.837) (-71.211) [-71.336] (-72.016) -- 0:00:14
814000 -- (-75.709) (-74.866) [-72.778] (-72.608) * (-73.823) [-72.254] (-71.977) (-73.885) -- 0:00:15
815000 -- [-75.319] (-72.305) (-73.386) (-74.643) * (-78.224) (-71.705) (-73.115) [-71.213] -- 0:00:14
Average standard deviation of split frequencies: 0.010399
816000 -- (-71.397) (-73.214) [-72.633] (-73.944) * (-74.634) (-74.281) (-73.765) [-73.937] -- 0:00:14
817000 -- (-70.812) (-74.607) [-71.998] (-70.940) * (-71.280) (-76.472) (-73.545) [-71.251] -- 0:00:14
818000 -- (-73.383) (-71.984) (-75.523) [-70.981] * (-71.419) (-79.418) [-72.977] (-76.019) -- 0:00:14
819000 -- (-73.128) [-70.939] (-73.375) (-71.564) * (-71.103) [-72.580] (-72.844) (-71.972) -- 0:00:14
820000 -- (-73.695) [-71.871] (-71.333) (-72.046) * [-70.664] (-72.165) (-72.014) (-71.082) -- 0:00:14
Average standard deviation of split frequencies: 0.010722
821000 -- (-74.255) (-72.219) (-71.344) [-72.061] * (-74.460) (-71.320) (-70.829) [-70.719] -- 0:00:14
822000 -- (-71.125) (-70.850) [-71.116] (-73.221) * (-71.529) (-76.410) (-70.866) [-72.005] -- 0:00:14
823000 -- (-73.851) (-71.615) (-72.203) [-73.796] * (-73.789) [-74.251] (-70.690) (-73.705) -- 0:00:14
824000 -- (-72.021) (-75.538) [-72.577] (-76.033) * [-74.001] (-72.483) (-73.320) (-71.788) -- 0:00:14
825000 -- (-72.122) [-75.346] (-72.973) (-74.514) * (-71.516) [-74.627] (-73.948) (-72.775) -- 0:00:14
Average standard deviation of split frequencies: 0.011414
826000 -- [-72.071] (-71.966) (-72.483) (-71.253) * (-70.610) (-73.233) (-72.631) [-70.826] -- 0:00:13
827000 -- (-71.500) [-73.783] (-73.833) (-72.776) * (-72.126) (-71.889) (-73.514) [-71.686] -- 0:00:14
828000 -- (-73.198) (-72.059) [-75.654] (-72.958) * (-71.328) (-71.957) [-72.547] (-73.845) -- 0:00:13
829000 -- [-72.694] (-71.300) (-72.741) (-72.967) * (-75.657) (-73.224) [-71.455] (-74.377) -- 0:00:13
830000 -- (-75.085) [-70.735] (-72.244) (-77.951) * (-71.930) [-71.021] (-75.634) (-71.843) -- 0:00:13
Average standard deviation of split frequencies: 0.009837
831000 -- [-74.153] (-70.708) (-74.129) (-73.281) * (-72.474) [-73.558] (-76.787) (-70.869) -- 0:00:13
832000 -- (-73.322) (-73.585) (-73.741) [-72.168] * (-72.477) [-70.919] (-73.246) (-72.797) -- 0:00:13
833000 -- (-74.180) (-72.140) (-73.915) [-72.918] * [-73.293] (-73.012) (-72.500) (-75.754) -- 0:00:13
834000 -- [-71.786] (-73.839) (-71.090) (-71.699) * (-73.368) (-72.559) (-77.436) [-72.219] -- 0:00:13
835000 -- [-74.065] (-71.279) (-73.737) (-73.478) * (-73.162) (-75.656) (-73.742) [-71.551] -- 0:00:13
Average standard deviation of split frequencies: 0.010526
836000 -- (-71.712) [-72.200] (-72.321) (-73.283) * [-75.465] (-75.343) (-74.685) (-72.699) -- 0:00:13
837000 -- (-74.305) [-71.557] (-70.709) (-74.248) * (-72.466) (-71.173) [-71.525] (-71.882) -- 0:00:13
838000 -- (-76.233) (-72.498) (-71.376) [-75.018] * (-70.954) (-71.811) [-71.487] (-70.905) -- 0:00:12
839000 -- (-80.558) (-71.032) [-71.403] (-75.316) * [-70.683] (-72.748) (-75.045) (-70.926) -- 0:00:13
840000 -- (-71.837) (-72.250) (-71.820) [-70.920] * [-73.189] (-74.241) (-74.525) (-74.382) -- 0:00:12
Average standard deviation of split frequencies: 0.009720
841000 -- (-72.298) [-74.481] (-71.020) (-71.946) * [-71.761] (-74.841) (-71.130) (-74.540) -- 0:00:12
842000 -- (-71.167) (-74.355) (-72.425) [-72.809] * [-73.968] (-74.718) (-74.473) (-71.812) -- 0:00:12
843000 -- [-74.058] (-73.035) (-72.879) (-72.983) * [-72.089] (-73.505) (-78.195) (-75.840) -- 0:00:12
844000 -- (-72.470) (-72.853) [-71.479] (-72.343) * [-73.301] (-70.947) (-72.021) (-73.904) -- 0:00:12
845000 -- (-74.145) (-72.811) (-76.766) [-70.452] * [-72.952] (-71.020) (-72.347) (-71.408) -- 0:00:12
Average standard deviation of split frequencies: 0.010401
846000 -- (-72.075) [-75.925] (-74.375) (-72.378) * [-74.683] (-74.066) (-74.898) (-73.829) -- 0:00:12
847000 -- (-74.539) [-72.370] (-73.912) (-73.244) * [-71.045] (-70.810) (-75.903) (-73.336) -- 0:00:12
848000 -- [-72.105] (-72.546) (-73.473) (-76.671) * [-71.177] (-72.472) (-76.367) (-74.367) -- 0:00:12
849000 -- [-76.100] (-72.404) (-71.178) (-71.772) * (-72.333) [-72.701] (-71.975) (-71.560) -- 0:00:12
850000 -- (-72.728) (-72.394) [-72.207] (-73.174) * [-71.938] (-72.913) (-72.421) (-73.546) -- 0:00:12
Average standard deviation of split frequencies: 0.009236
851000 -- (-71.689) (-75.023) [-71.850] (-73.019) * (-72.946) (-75.012) [-74.120] (-71.534) -- 0:00:12
852000 -- (-71.821) [-71.553] (-72.724) (-73.519) * (-75.018) [-73.963] (-71.593) (-73.912) -- 0:00:11
853000 -- (-71.310) [-72.644] (-72.762) (-72.080) * (-71.333) [-74.591] (-72.234) (-71.168) -- 0:00:11
854000 -- (-72.605) [-72.187] (-77.746) (-75.955) * [-73.567] (-71.870) (-72.441) (-75.883) -- 0:00:11
855000 -- (-71.277) (-72.525) (-71.332) [-71.653] * (-72.298) (-75.911) [-71.279] (-72.293) -- 0:00:11
Average standard deviation of split frequencies: 0.010280
856000 -- [-72.017] (-73.695) (-78.081) (-71.198) * (-74.751) [-73.813] (-73.358) (-75.504) -- 0:00:11
857000 -- [-71.635] (-72.595) (-75.326) (-71.402) * [-71.110] (-73.484) (-74.283) (-75.567) -- 0:00:11
858000 -- (-74.255) [-71.318] (-72.739) (-72.457) * (-72.395) (-74.331) (-74.527) [-71.259] -- 0:00:11
859000 -- [-71.961] (-72.307) (-73.272) (-73.712) * (-72.202) (-74.306) (-72.087) [-72.777] -- 0:00:11
860000 -- [-75.865] (-70.828) (-72.009) (-70.754) * (-76.068) [-71.606] (-74.565) (-70.983) -- 0:00:11
Average standard deviation of split frequencies: 0.010589
861000 -- (-73.845) (-72.559) (-74.785) [-73.941] * (-73.100) (-73.301) [-73.798] (-74.113) -- 0:00:11
862000 -- (-73.738) [-71.479] (-72.729) (-72.193) * (-72.150) (-71.825) [-72.541] (-76.208) -- 0:00:11
863000 -- (-74.820) [-74.864] (-73.579) (-70.672) * (-77.010) [-73.836] (-73.542) (-73.839) -- 0:00:10
864000 -- [-72.335] (-78.192) (-72.471) (-80.142) * (-72.768) (-73.631) (-73.277) [-73.508] -- 0:00:11
865000 -- (-77.701) (-72.281) (-71.584) [-76.367] * (-73.591) (-74.664) [-72.327] (-73.453) -- 0:00:10
Average standard deviation of split frequencies: 0.009435
866000 -- (-75.916) (-74.635) [-77.957] (-72.456) * (-72.977) (-76.270) (-73.904) [-73.205] -- 0:00:10
867000 -- (-73.017) [-73.642] (-75.735) (-76.978) * [-73.224] (-71.096) (-73.490) (-74.270) -- 0:00:10
868000 -- (-73.613) (-71.738) (-74.588) [-72.806] * [-72.227] (-70.960) (-71.553) (-73.913) -- 0:00:10
869000 -- (-72.723) (-71.935) (-71.468) [-71.760] * (-74.864) (-71.571) (-74.054) [-71.282] -- 0:00:10
870000 -- [-73.216] (-72.281) (-70.603) (-72.295) * [-73.454] (-72.633) (-75.354) (-73.577) -- 0:00:10
Average standard deviation of split frequencies: 0.010107
871000 -- (-74.821) (-73.451) [-71.335] (-70.877) * [-77.071] (-73.001) (-76.251) (-74.087) -- 0:00:10
872000 -- (-80.651) [-74.926] (-71.445) (-73.188) * (-71.157) (-75.097) [-72.249] (-72.653) -- 0:00:10
873000 -- (-72.889) (-72.000) (-71.181) [-73.431] * (-73.126) (-72.343) [-71.441] (-72.807) -- 0:00:10
874000 -- (-74.451) (-72.831) [-70.712] (-72.835) * (-71.875) (-75.040) [-74.133] (-73.656) -- 0:00:10
875000 -- [-72.423] (-77.814) (-75.106) (-74.045) * (-72.023) (-73.485) [-71.634] (-73.736) -- 0:00:10
Average standard deviation of split frequencies: 0.010404
876000 -- (-74.517) [-71.407] (-72.483) (-70.848) * (-71.285) (-76.712) [-72.418] (-74.643) -- 0:00:10
877000 -- (-72.645) (-75.125) (-72.161) [-71.554] * (-71.916) (-73.026) [-71.806] (-72.299) -- 0:00:09
878000 -- (-73.849) (-75.028) [-72.082] (-72.341) * (-73.391) (-71.571) [-70.898] (-70.949) -- 0:00:09
879000 -- (-70.379) (-75.114) (-73.815) [-73.180] * (-73.895) (-74.748) [-72.647] (-72.369) -- 0:00:09
880000 -- (-74.862) [-72.512] (-72.553) (-73.824) * (-76.231) (-72.079) (-77.915) [-72.892] -- 0:00:09
Average standard deviation of split frequencies: 0.009992
881000 -- (-72.891) (-72.604) (-71.629) [-70.995] * (-72.100) [-71.538] (-71.795) (-72.581) -- 0:00:09
882000 -- (-74.530) (-71.275) (-71.807) [-70.581] * (-73.916) [-74.553] (-71.802) (-71.236) -- 0:00:09
883000 -- (-73.136) (-74.294) (-75.967) [-73.276] * [-70.934] (-74.247) (-70.562) (-76.529) -- 0:00:09
884000 -- [-71.589] (-74.263) (-72.396) (-76.462) * (-70.589) (-77.303) (-71.239) [-71.682] -- 0:00:09
885000 -- (-72.331) (-72.097) [-72.637] (-71.773) * [-71.801] (-72.071) (-76.942) (-71.712) -- 0:00:09
Average standard deviation of split frequencies: 0.010641
886000 -- (-72.053) (-72.505) (-71.863) [-71.687] * [-70.494] (-73.217) (-72.573) (-71.327) -- 0:00:09
887000 -- (-74.752) (-71.664) (-73.681) [-70.848] * (-71.735) [-73.386] (-78.989) (-71.625) -- 0:00:09
888000 -- (-75.670) (-72.096) [-72.517] (-71.466) * (-72.009) (-72.863) (-78.768) [-72.660] -- 0:00:09
889000 -- (-73.988) (-74.015) [-71.104] (-73.933) * (-70.668) (-73.288) [-75.692] (-72.518) -- 0:00:08
890000 -- (-72.108) (-72.947) (-73.759) [-72.937] * (-75.098) [-73.309] (-80.412) (-73.837) -- 0:00:08
Average standard deviation of split frequencies: 0.009880
891000 -- [-72.858] (-71.488) (-75.069) (-73.607) * (-73.062) (-71.899) [-74.417] (-71.606) -- 0:00:08
892000 -- (-73.477) (-73.721) (-71.810) [-71.623] * (-78.936) (-74.361) (-73.590) [-71.661] -- 0:00:08
893000 -- [-71.616] (-72.737) (-71.316) (-70.436) * (-75.308) [-71.609] (-73.327) (-71.521) -- 0:00:08
894000 -- (-73.174) (-77.779) (-71.266) [-71.836] * (-72.721) (-73.707) [-70.618] (-70.916) -- 0:00:08
895000 -- [-70.885] (-71.844) (-72.439) (-72.737) * (-71.843) (-72.630) [-71.558] (-72.487) -- 0:00:08
Average standard deviation of split frequencies: 0.008769
896000 -- [-72.330] (-74.434) (-71.789) (-73.674) * (-72.225) (-71.411) [-72.437] (-72.459) -- 0:00:08
897000 -- (-73.790) (-74.981) (-73.208) [-75.453] * (-72.443) [-73.255] (-73.649) (-71.925) -- 0:00:08
898000 -- [-78.357] (-74.326) (-71.006) (-72.156) * (-77.598) (-73.076) (-74.001) [-74.094] -- 0:00:08
899000 -- [-72.525] (-73.687) (-74.650) (-72.913) * (-75.074) [-73.645] (-74.622) (-74.001) -- 0:00:08
900000 -- [-71.952] (-71.564) (-76.150) (-74.159) * (-72.608) (-70.642) [-73.016] (-70.977) -- 0:00:08
Average standard deviation of split frequencies: 0.009770
901000 -- (-72.551) (-72.758) [-73.820] (-71.936) * [-74.232] (-72.387) (-71.482) (-76.175) -- 0:00:08
902000 -- (-70.805) [-74.329] (-71.808) (-73.835) * (-72.630) (-71.540) (-73.752) [-72.136] -- 0:00:07
903000 -- (-71.815) [-70.658] (-71.248) (-73.783) * (-73.328) (-71.160) (-74.687) [-70.922] -- 0:00:07
904000 -- (-72.075) (-72.893) (-71.549) [-74.278] * [-72.320] (-71.338) (-71.136) (-74.258) -- 0:00:07
905000 -- (-73.580) (-75.195) (-71.144) [-71.409] * [-72.421] (-74.940) (-76.804) (-71.979) -- 0:00:07
Average standard deviation of split frequencies: 0.008672
906000 -- [-71.028] (-73.826) (-71.164) (-70.760) * (-74.438) (-71.868) [-72.344] (-73.433) -- 0:00:07
907000 -- [-72.115] (-72.320) (-72.272) (-71.014) * (-73.568) (-71.630) (-73.073) [-74.569] -- 0:00:07
908000 -- (-76.719) (-70.745) [-71.247] (-72.190) * (-71.936) [-72.807] (-73.869) (-72.473) -- 0:00:07
909000 -- (-74.678) (-71.802) [-71.743] (-73.643) * (-72.097) (-74.587) [-74.151] (-71.110) -- 0:00:07
910000 -- (-72.780) [-74.879] (-71.110) (-73.041) * (-71.791) (-75.830) (-75.742) [-73.264] -- 0:00:07
Average standard deviation of split frequencies: 0.009318
911000 -- [-73.037] (-73.602) (-71.251) (-74.258) * (-75.677) (-74.353) (-73.247) [-77.469] -- 0:00:07
912000 -- (-72.777) [-74.762] (-77.286) (-79.845) * (-74.275) [-72.068] (-73.889) (-72.024) -- 0:00:07
913000 -- (-73.646) (-74.577) [-77.875] (-72.597) * (-74.199) (-71.840) [-75.069] (-74.161) -- 0:00:07
914000 -- [-73.076] (-72.190) (-73.779) (-75.744) * (-72.117) [-73.786] (-75.020) (-71.839) -- 0:00:06
915000 -- (-71.529) [-71.665] (-71.598) (-72.149) * [-72.718] (-73.085) (-77.379) (-73.403) -- 0:00:06
Average standard deviation of split frequencies: 0.009606
916000 -- (-71.640) [-73.623] (-71.291) (-72.537) * (-71.485) (-74.812) (-72.135) [-71.817] -- 0:00:06
917000 -- (-72.115) [-72.295] (-71.223) (-72.106) * (-74.143) (-71.455) (-73.256) [-73.663] -- 0:00:06
918000 -- (-71.402) (-73.596) [-72.281] (-72.626) * (-71.366) (-76.272) (-71.150) [-70.812] -- 0:00:06
919000 -- [-70.510] (-72.515) (-74.893) (-72.510) * [-71.822] (-75.647) (-71.548) (-72.436) -- 0:00:06
920000 -- (-71.316) [-71.369] (-70.922) (-75.082) * (-73.067) (-76.035) [-71.323] (-71.833) -- 0:00:06
Average standard deviation of split frequencies: 0.010923
921000 -- (-73.273) [-72.802] (-72.340) (-71.087) * [-74.790] (-79.483) (-75.915) (-71.074) -- 0:00:06
922000 -- (-72.239) (-72.047) [-70.592] (-72.189) * (-72.317) (-74.972) [-74.007] (-74.515) -- 0:00:06
923000 -- (-71.545) (-72.629) [-72.156] (-71.438) * [-75.947] (-72.895) (-72.175) (-80.639) -- 0:00:06
924000 -- (-72.408) (-71.120) [-72.767] (-73.957) * (-71.279) (-71.670) (-74.789) [-71.819] -- 0:00:06
925000 -- (-73.936) [-71.895] (-73.722) (-74.770) * (-70.993) [-71.256] (-75.427) (-72.577) -- 0:00:06
Average standard deviation of split frequencies: 0.010182
926000 -- (-72.284) [-73.935] (-72.799) (-72.759) * (-72.293) [-71.019] (-72.231) (-75.412) -- 0:00:05
927000 -- (-72.019) (-71.896) [-71.888] (-74.472) * (-73.688) [-74.873] (-71.918) (-71.610) -- 0:00:05
928000 -- (-70.892) (-72.563) (-71.717) [-74.104] * (-73.972) (-73.184) (-75.164) [-72.136] -- 0:00:05
929000 -- (-71.694) (-72.320) [-72.955] (-74.604) * (-72.342) (-71.736) (-74.850) [-71.718] -- 0:00:05
930000 -- (-73.063) (-72.310) (-76.141) [-72.283] * (-75.807) [-71.445] (-71.961) (-75.400) -- 0:00:05
Average standard deviation of split frequencies: 0.009455
931000 -- [-72.342] (-74.417) (-71.592) (-71.879) * [-71.706] (-76.778) (-78.125) (-71.163) -- 0:00:05
932000 -- (-74.784) (-71.053) [-73.989] (-71.477) * (-78.193) [-77.671] (-73.090) (-74.240) -- 0:00:05
933000 -- (-70.663) (-71.241) (-73.970) [-76.349] * (-72.751) (-74.907) (-72.606) [-71.234] -- 0:00:05
934000 -- (-72.221) [-71.819] (-74.586) (-72.299) * [-71.894] (-72.681) (-72.215) (-74.319) -- 0:00:05
935000 -- [-71.658] (-71.887) (-74.434) (-73.789) * (-72.664) [-72.145] (-73.406) (-78.136) -- 0:00:05
Average standard deviation of split frequencies: 0.010073
936000 -- (-74.016) (-71.822) [-72.951] (-71.539) * (-71.292) (-72.764) [-73.090] (-73.802) -- 0:00:05
937000 -- [-73.172] (-74.604) (-77.689) (-73.490) * [-71.421] (-73.020) (-71.653) (-71.797) -- 0:00:05
938000 -- (-71.508) [-74.198] (-74.207) (-71.322) * (-72.854) (-73.702) (-75.230) [-71.545] -- 0:00:05
939000 -- (-73.242) (-72.844) [-71.917] (-74.232) * (-71.087) [-71.564] (-71.436) (-71.353) -- 0:00:04
940000 -- [-73.306] (-72.622) (-73.944) (-73.217) * [-71.416] (-72.374) (-71.356) (-74.541) -- 0:00:04
Average standard deviation of split frequencies: 0.009689
941000 -- (-72.327) (-72.064) (-72.957) [-74.199] * (-74.493) (-71.319) [-76.455] (-73.011) -- 0:00:04
942000 -- (-75.508) [-70.686] (-71.827) (-73.844) * (-71.649) (-73.814) [-73.355] (-70.849) -- 0:00:04
943000 -- (-72.702) (-72.646) [-74.355] (-76.622) * (-73.697) (-72.248) (-73.009) [-74.587] -- 0:00:04
944000 -- [-72.148] (-72.606) (-71.618) (-71.632) * (-71.161) (-71.350) [-71.619] (-72.143) -- 0:00:04
945000 -- (-72.616) [-76.252] (-73.187) (-74.512) * (-71.492) (-73.741) [-71.093] (-74.832) -- 0:00:04
Average standard deviation of split frequencies: 0.007973
946000 -- (-72.643) (-72.693) [-71.659] (-72.805) * (-75.218) (-72.790) [-71.354] (-81.564) -- 0:00:04
947000 -- (-73.743) [-78.266] (-74.976) (-71.761) * [-71.712] (-73.958) (-70.841) (-72.307) -- 0:00:04
948000 -- (-78.246) [-73.005] (-71.465) (-72.760) * [-71.785] (-70.836) (-71.239) (-72.828) -- 0:00:04
949000 -- (-73.188) (-73.082) (-73.116) [-71.408] * (-73.428) (-75.959) [-73.919] (-74.870) -- 0:00:04
950000 -- (-74.397) (-73.231) [-75.880] (-72.514) * [-72.472] (-81.706) (-73.562) (-74.512) -- 0:00:04
Average standard deviation of split frequencies: 0.008595
951000 -- (-72.961) (-74.788) (-70.988) [-74.986] * (-73.636) (-77.226) [-73.387] (-72.818) -- 0:00:03
952000 -- (-73.729) [-74.989] (-73.027) (-73.142) * [-72.176] (-70.811) (-71.710) (-72.680) -- 0:00:03
953000 -- (-73.314) [-74.442] (-72.161) (-71.722) * (-72.570) (-71.968) [-71.218] (-75.744) -- 0:00:03
954000 -- (-71.082) (-76.928) (-71.396) [-70.876] * (-71.596) [-73.779] (-72.202) (-73.714) -- 0:00:03
955000 -- (-70.957) [-71.867] (-71.365) (-70.956) * (-74.013) (-74.494) [-71.896] (-71.067) -- 0:00:03
Average standard deviation of split frequencies: 0.009533
956000 -- (-71.868) [-72.347] (-72.513) (-70.975) * (-76.699) (-71.975) (-70.977) [-70.832] -- 0:00:03
957000 -- [-71.495] (-72.535) (-74.406) (-71.546) * [-71.322] (-72.034) (-71.742) (-75.553) -- 0:00:03
958000 -- (-74.489) (-71.354) (-73.065) [-73.853] * (-72.055) (-74.116) (-73.750) [-74.222] -- 0:00:03
959000 -- (-71.419) [-71.530] (-76.262) (-75.941) * [-75.784] (-74.922) (-71.926) (-71.742) -- 0:00:03
960000 -- [-73.530] (-73.079) (-75.755) (-72.205) * (-73.057) (-74.506) [-71.201] (-71.686) -- 0:00:03
Average standard deviation of split frequencies: 0.008833
961000 -- [-73.499] (-72.701) (-71.858) (-71.868) * (-74.531) [-73.871] (-71.497) (-71.846) -- 0:00:03
962000 -- (-73.333) [-73.442] (-73.312) (-72.228) * [-71.715] (-71.863) (-72.526) (-71.537) -- 0:00:03
963000 -- (-73.376) (-72.352) (-70.564) [-75.352] * (-72.916) [-72.081] (-71.774) (-72.400) -- 0:00:02
964000 -- (-72.416) (-73.973) (-76.137) [-71.977] * (-72.427) (-73.625) (-73.244) [-71.778] -- 0:00:02
965000 -- (-74.133) (-72.666) [-72.079] (-74.168) * (-74.717) (-75.750) (-75.180) [-71.763] -- 0:00:02
Average standard deviation of split frequencies: 0.008784
966000 -- (-72.317) [-73.071] (-74.467) (-72.109) * (-75.485) (-72.841) (-74.039) [-72.702] -- 0:00:02
967000 -- (-72.726) (-72.088) [-71.121] (-74.967) * (-76.190) (-71.240) [-72.503] (-70.999) -- 0:00:02
968000 -- (-72.017) (-73.509) [-73.636] (-74.081) * (-71.029) (-71.609) (-73.616) [-71.877] -- 0:00:02
969000 -- (-80.311) (-73.345) (-71.773) [-72.264] * (-72.367) [-77.099] (-71.707) (-70.951) -- 0:00:02
970000 -- [-70.770] (-73.948) (-77.226) (-73.158) * (-73.010) (-76.161) [-72.258] (-71.250) -- 0:00:02
Average standard deviation of split frequencies: 0.009065
971000 -- (-74.698) (-72.507) (-73.256) [-75.347] * (-78.826) (-79.319) (-71.906) [-70.726] -- 0:00:02
972000 -- (-72.713) (-74.892) [-71.304] (-71.232) * (-77.133) (-71.560) (-72.858) [-72.022] -- 0:00:02
973000 -- [-74.004] (-71.810) (-73.050) (-71.283) * (-71.739) (-70.979) (-71.124) [-72.077] -- 0:00:02
974000 -- [-73.419] (-75.302) (-71.127) (-73.354) * (-73.327) [-70.981] (-72.970) (-72.329) -- 0:00:02
975000 -- (-71.793) (-78.213) (-71.866) [-72.538] * [-72.039] (-72.201) (-71.349) (-75.127) -- 0:00:02
Average standard deviation of split frequencies: 0.008050
976000 -- (-71.370) (-72.919) (-76.107) [-71.204] * (-72.854) (-71.812) (-73.214) [-71.008] -- 0:00:01
977000 -- (-73.701) (-72.528) (-72.274) [-71.925] * (-72.208) (-71.840) (-72.798) [-74.680] -- 0:00:01
978000 -- (-70.825) (-74.183) (-71.889) [-72.109] * (-71.663) (-72.313) (-73.856) [-71.999] -- 0:00:01
979000 -- (-72.733) (-74.213) (-72.723) [-71.049] * (-72.461) (-72.024) [-74.142] (-72.425) -- 0:00:01
980000 -- (-72.345) (-79.378) (-76.026) [-71.117] * (-72.194) (-73.566) [-71.582] (-80.295) -- 0:00:01
Average standard deviation of split frequencies: 0.007691
981000 -- (-71.543) (-74.465) (-70.655) [-71.005] * (-77.090) (-72.745) (-75.738) [-73.316] -- 0:00:01
982000 -- (-72.004) [-72.889] (-71.574) (-72.531) * (-71.281) (-72.430) [-72.213] (-72.314) -- 0:00:01
983000 -- (-72.275) [-72.678] (-76.184) (-72.235) * (-72.627) (-71.473) [-73.700] (-73.662) -- 0:00:01
984000 -- (-73.214) [-73.115] (-79.692) (-75.594) * [-73.609] (-72.462) (-75.281) (-72.650) -- 0:00:01
985000 -- (-76.950) [-71.937] (-74.418) (-75.627) * (-76.775) [-73.809] (-73.693) (-72.025) -- 0:00:01
Average standard deviation of split frequencies: 0.008606
986000 -- (-72.907) (-71.442) (-72.851) [-73.170] * (-73.414) (-73.180) (-70.591) [-71.069] -- 0:00:01
987000 -- (-72.325) (-73.024) (-72.490) [-74.117] * [-70.801] (-71.429) (-72.437) (-73.690) -- 0:00:01
988000 -- [-71.799] (-72.758) (-72.919) (-72.903) * [-72.118] (-72.552) (-71.072) (-72.175) -- 0:00:00
989000 -- (-71.328) [-73.604] (-73.028) (-73.288) * [-72.030] (-71.581) (-73.228) (-76.093) -- 0:00:00
990000 -- (-73.540) [-72.550] (-74.592) (-72.759) * [-71.833] (-71.057) (-72.066) (-72.518) -- 0:00:00
Average standard deviation of split frequencies: 0.007931
991000 -- (-71.709) (-73.928) (-72.219) [-72.154] * (-75.577) [-72.205] (-70.865) (-71.246) -- 0:00:00
992000 -- (-71.736) (-73.667) [-72.230] (-71.773) * (-72.126) [-73.837] (-72.644) (-72.479) -- 0:00:00
993000 -- (-72.146) (-75.395) [-72.815] (-73.159) * (-73.262) (-71.243) [-74.592] (-71.685) -- 0:00:00
994000 -- (-72.333) (-70.849) [-71.436] (-73.522) * (-71.848) [-72.803] (-73.676) (-71.597) -- 0:00:00
995000 -- (-75.434) [-72.147] (-71.224) (-71.877) * [-72.549] (-76.224) (-71.617) (-71.886) -- 0:00:00
Average standard deviation of split frequencies: 0.006942
996000 -- (-75.184) (-73.043) (-71.198) [-73.926] * [-73.176] (-74.247) (-72.098) (-72.462) -- 0:00:00
997000 -- (-75.201) (-75.438) (-71.998) [-72.262] * [-70.990] (-71.047) (-71.429) (-74.332) -- 0:00:00
998000 -- (-72.961) [-71.135] (-72.632) (-81.756) * (-75.283) [-72.681] (-72.622) (-72.269) -- 0:00:00
999000 -- (-71.810) (-74.692) [-74.756] (-73.694) * [-72.867] (-71.724) (-71.581) (-73.339) -- 0:00:00
1000000 -- (-73.374) (-71.991) [-74.487] (-71.776) * (-76.310) [-71.953] (-72.360) (-74.087) -- 0:00:00
Average standard deviation of split frequencies: 0.006281
Analysis completed in 1 mins 21 seconds
Analysis used 80.77 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -70.38
Likelihood of best state for "cold" chain of run 2 was -70.38
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
76.0 % ( 61 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
69.9 % ( 62 %) Dirichlet(Pi{all})
66.3 % ( 50 %) Slider(Pi{all})
79.9 % ( 55 %) Multiplier(Alpha{1,2})
78.5 % ( 53 %) Multiplier(Alpha{3})
47.3 % ( 26 %) Slider(Pinvar{all})
98.8 % (100 %) ExtSPR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
73.9 % ( 73 %) ParsSPR(Tau{all},V{all})
31.2 % ( 22 %) Multiplier(V{all})
97.1 % ( 97 %) Nodeslider(V{all})
39.9 % ( 24 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
74.9 % ( 72 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
69.1 % ( 65 %) Dirichlet(Pi{all})
67.5 % ( 48 %) Slider(Pi{all})
79.8 % ( 54 %) Multiplier(Alpha{1,2})
78.7 % ( 58 %) Multiplier(Alpha{3})
46.8 % ( 30 %) Slider(Pinvar{all})
98.8 % ( 98 %) ExtSPR(Tau{all},V{all})
99.9 % (100 %) NNI(Tau{all},V{all})
73.7 % ( 70 %) ParsSPR(Tau{all},V{all})
31.2 % ( 29 %) Multiplier(V{all})
97.1 % ( 95 %) Nodeslider(V{all})
40.0 % ( 25 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.61 0.42 0.29
2 | 166485 0.75 0.57
3 | 166625 166485 0.79
4 | 166816 166644 166945
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.62 0.42 0.30
2 | 166732 0.75 0.57
3 | 165879 167166 0.80
4 | 166360 166900 166963
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/mrbayes_input.nex.run1.p and /data/mrbayes_input.nex.run2.p
Writing summary statistics to file /data/mrbayes_input.nex.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -72.08
| 1 2 1 |
| 1 1 |
| 11 11 1 1 211 1 2 2 1|
|1 1 1 *1 2 2 2 2 2 1 2 221 |
| 22 2 12 1 22 1 1 2 2 1 1 2 2 |
| * 12 2 1 * 1 11 |
| * 2 2 1 1 21 2 |
| 2 2 1 1 22 * 1 2 2 1 12 2 2 1 |
| 2 1 1 2 2 22 1 1 21 2 1 2 11 |
|2 2 1 2 1 2 2 1 2|
| 1 1 2 2 |
| 1 |
| 2 2 |
| |
| 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -73.85
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -72.02 -75.29
2 -72.09 -75.39
--------------------------------------
TOTAL -72.06 -75.34
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 8.654953 92.972027 0.000017 27.318220 5.539524 939.71 945.15 1.000
r(A<->C){all} 0.182964 0.021598 0.000021 0.472574 0.147333 160.81 198.42 1.000
r(A<->G){all} 0.160267 0.020298 0.000016 0.455646 0.119926 58.77 128.03 1.002
r(A<->T){all} 0.163747 0.019798 0.000023 0.451914 0.127304 206.99 261.24 1.000
r(C<->G){all} 0.161678 0.018259 0.000072 0.428784 0.131810 89.84 112.72 1.006
r(C<->T){all} 0.176098 0.021802 0.000004 0.472366 0.136865 215.03 256.32 1.002
r(G<->T){all} 0.155246 0.019042 0.000017 0.442831 0.117118 123.02 134.32 1.007
pi(A){all} 0.254366 0.003272 0.142579 0.365560 0.251131 1065.27 1112.85 1.000
pi(C){all} 0.219404 0.003008 0.122665 0.329370 0.214602 936.60 964.88 1.000
pi(G){all} 0.289806 0.003682 0.166780 0.404752 0.286162 908.47 912.26 1.000
pi(T){all} 0.236425 0.003234 0.121747 0.344512 0.233334 1040.75 1047.34 1.000
alpha{1,2} 0.909566 0.939920 0.000018 2.867286 0.592594 1111.85 1238.31 1.000
alpha{3} 0.989977 1.094933 0.001033 3.096136 0.643431 1244.30 1320.06 1.000
pinvar{all} 0.928248 0.027795 0.514775 0.999955 0.980216 162.84 177.80 1.001
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/mrbayes_input.nex.run1.t" and "/data/mrbayes_input.nex.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/mrbayes_input.nex.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/mrbayes_input.nex.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a parameter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
Key to taxon bipartitions (saved to file "/data/mrbayes_input.nex.parts"):
ID -- Partition
----------
1 -- .***
2 -- .*..
3 -- ..*.
4 -- ...*
5 -- ..**
6 -- .*.*
7 -- .**.
----------
Summary statistics for informative taxon bipartitions
(saved to file "/data/mrbayes_input.nex.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
5 1054 0.351099 0.000942 0.350433 0.351765 2
6 976 0.325117 0.009422 0.318454 0.331779 2
7 972 0.323784 0.008480 0.317788 0.329780 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/mrbayes_input.nex.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
------------------------------------------------------------------------------------------
length{all}[1] 1.758421 8.088193 0.000001 6.964992 0.673657 1.001 2
length{all}[2] 1.728665 8.470899 0.000002 7.276977 0.640347 1.000 2
length{all}[3] 1.717736 8.032011 0.000003 6.932513 0.663997 1.000 2
length{all}[4] 1.731416 8.235382 0.000000 6.830717 0.625798 1.000 2
length{all}[5] 1.816950 8.174061 0.000003 7.606027 0.671680 1.002 2
length{all}[6] 1.679464 6.876077 0.000003 6.448849 0.712614 1.000 2
length{all}[7] 1.651605 7.375591 0.000004 7.647240 0.634975 0.999 2
------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.006281
Maximum standard deviation of split frequencies = 0.009422
Average PSRF for parameter values (excluding NA and >10.0) = 1.000
Maximum PSRF for parameter values = 1.002
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
+
|------------------------------------------------------------------------ C3 (3)
|
\------------------------------------------------------------------------ C4 (4)
Phylogram (based on average branch lengths):
/------------------------------------------------------------------------ C1 (1)
|
|-------------------------------------------------------------------- C2 (2)
+
|----------------------------------------------------------------------- C3 (3)
|
\------------------------------------------------------------------- C4 (4)
|---------| 0.100 expected changes per site
Calculating tree probabilities...
Credible sets of trees (3 trees sampled):
50 % credible set contains 2 trees
90 % credible set contains 3 trees
95 % credible set contains 3 trees
99 % credible set contains 3 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
Running FUBAR...
[2J[H /HYPHY 2.3.14.20190214beta(MP) for Linux on x86_64\
***************** TYPES OF STANDARD ANALYSES *****************
(1) Selection Analyses
(2) Evolutionary Hypothesis Testing
(3) Relative evolutionary rate inference
(4) Coevolutionary analysis
(5) Basic Analyses
(6) Codon Selection Analyses
(7) Compartmentalization
(8) Data File Tools
(9) Miscellaneous
(10) Model Comparison
(11) Kernel Analysis Tools
(12) Molecular Clock
(13) Phylogeny Reconstruction
(14) Positive Selection
(15) Recombination
(16) Selection/Recombination
(17) Relative Rate
(18) Relative Ratio
(19) Substitution Rates
Please select type of analyses you want to list (or press ENTER to process custom batch file):[2J[H***************** FILES IN 'Selection Analyses' *****************
(1) [MEME] Test for episodic site-level selection using MEME (Mixed Effects Model of Evolution).
(2) [FEL] Test for pervasive site-level selection using FEL (Fixed Effects Likelihood).
(3) [SLAC] Test for pervasive site-level selection using SLAC (Single Likelihood Ancestor Counting).
(4) [FUBAR] Test for pervasive site-level selection using FUBAR (Fast Unconstrained Bayesian AppRoximation for inferring selection).
(5) [BUSTED] Test for episodic gene-wide selection using BUSTED (Branch-site Unrestricted Statistical Test of Episodic Diversification).
(6) [aBSREL] Test for lineage-specific evolution using the branch-site method aBS-REL (Adaptive Branch-Site Random Effects Likelihood).
(7) [RELAX] Test for relaxation of selection pressure along a specified set of test branches using RELAX (a random effects test of selection relaxation).
Please select the analysis you would like to perform (or press ENTER to return to the list of analysis types):
Analysis Description
--------------------
Perform a Fast Unbiased AppRoximate Bayesian (FUBAR) analysis of a
coding sequence alignment to determine whether some sites have been
subject to pervasive purifying or diversifying selection. v2.1
introduces two more methods for estimating the posterior distribution of
grid weights: collapsed Gibbs MCMC (faster) and 0-th order Variation
Bayes approximation (fastest). Please note that a FUBAR analysis
generates a cache and a results JSON file in the same directory as
directory as the original alignment. HyPhy needs to have write
privileges to this directory. For example if the original file is in
/home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there
will also exist FUBAR-generated files
/home/sergei/FUBAR/data/pol.nex.FUBAR.json,
/home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also provide
checkpointing so that a partially completed analysis can be restarted.
- __Requirements__: in-frame codon alignment (possibly partitioned) and a phylogenetic tree
(one per partition)
- __Citation__: FUBAR: a fast, unconstrained bayesian approximation for inferring
selection (2013), Mol Biol Evol. 30(5):1196-205
- __Written by__: Sergei L Kosakovsky Pond
- __Contact Information__: spond@temple.edu
- __Analysis Version__: 2.1
####Choose Genetic Code
1. [**Universal**] Universal code. (Genebank transl_table=1).
2. [**Vertebrate mtDNA**] Vertebrate mitochondrial DNA code. (Genebank transl_table=2).
3. [**Yeast mtDNA**] Yeast mitochondrial DNA code. (Genebank transl_table=3).
4. [**Mold/Protozoan mtDNA**] Mold, Protozoan and Coelenterate mitochondrial DNA and the Mycloplasma/Spiroplasma code. (Genebank transl_table=4).
5. [**Invertebrate mtDNA**] Invertebrate mitochondrial DNA code. (Genebank transl_table=5).
6. [**Ciliate Nuclear**] Ciliate, Dasycladacean and Hexamita Nuclear code. (Genebank transl_table=6).
7. [**Echinoderm mtDNA**] Echinoderm mitochondrial DNA code. (Genebank transl_table=9).
8. [**Euplotid Nuclear**] Euplotid Nuclear code. (Genebank transl_table=10).
9. [**Alt. Yeast Nuclear**] Alternative Yeast Nuclear code. (Genebank transl_table=12).
10. [**Ascidian mtDNA**] Ascidian mitochondrial DNA code. (Genebank transl_table=13).
11. [**Flatworm mtDNA**] Flatworm mitochondrial DNA code. (Genebank transl_table=14).
12. [**Blepharisma Nuclear**] Blepharisma Nuclear code. (Genebank transl_table=15).
13. [**Chlorophycean mtDNA**] Chlorophycean Mitochondrial Code (transl_table=16).
14. [**Trematode mtDNA**] Trematode Mitochondrial Code (transl_table=21).
15. [**Scenedesmus obliquus mtDNA**] Scenedesmus obliquus mitochondrial Code (transl_table=22).
16. [**Thraustochytrium mtDNA**] Thraustochytrium Mitochondrial Code (transl_table=23).
17. [**Pterobranchia mtDNA**] Pterobranchia Mitochondrial Code (transl_table=24).
18. [**SR1 and Gracilibacteria**] Candidate Division SR1 and Gracilibacteria Code (transl_table=25).
19. [**Pachysolen Nuclear**] Pachysolen tannophilus Nuclear Code (transl_table=26).
>Please choose an option (or press q to cancel selection):
>Select a coding sequence alignment file (`/usr/local/lib/hyphy/TemplateBatchFiles/SelectionAnalyses/`)
>A tree was found in the data file: `(C1,C2,C3,C4)`
>Would you like to use it (y/n)?
>Loaded a multiple sequence alignment with **4** sequences, **17** codons, and **1** partitions from `/data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/results/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1.fna`
> FUBAR will write cache and result files to _/data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/results/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1.fna.FUBAR.cache_ and _/data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/results/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1.fna.FUBAR.json_, respectively
> Number of grid points per dimension (total number is D^2) (permissible range = [5,50], default value = 20, integer):
####Posterior estimation method
1. [**Metropolis-Hastings**] Full Metropolis-Hastings MCMC algorithm (slowest, original 2013 paper implementation)
2. [**Collapsed Gibbs**] Collapsed Gibbs sampler (intermediate speed)
3. [**Variational Bayes**] 0-th order Variational Bayes approximations (fastest, recommended default)
>Please choose an option (or press q to cancel selection):> The concentration parameter of the Dirichlet prior (permissible range = [0.001,1], default value = 0.5):
### Obtaining branch lengths and nucleotide substitution biases under the nucleotide GTR model
* Log(L) = -70.36, AIC-c = 166.36 (12 estimated parameters)
* Tree length (expected substitutions/site) for partition 1 : 0.000
### Computing the phylogenetic likelihood function on the grid
* Determining appropriate tree scaling based on the best score from a 20 x 20 rate grid
* Best scaling achieved for
* synonymous rate = 0.000
* non-synonymous rate = 0.000
* Computing conditional site likelihoods on a 20 x 20 rate grid
### Running an iterative zeroth order variational Bayes procedure to estimate the posterior mean of rate weights
* Using the following settings
* Dirichlet alpha : 0.5
### Tabulating site-level results
----
## FUBAR inferred no sites under subject to positive selection at posterior probability >= 0.9
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.05 sec, SCORE=1000, Nseq=4, Len=17
HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
*****************
>HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC >HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC >HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC >HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC
>HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD >HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD >HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD >HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
Reading sequence file /data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/fasta/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1 Found 4 sequences of length 51 Alignment looks like a valid DNA alignment. Estimated diversity is (pairwise deletion - ignoring missing/ambig): 0.0% Found 0 informative sites. Writing alignment of informative sites to: Phi.inf.sites Writing list of informative sites to: Phi.inf.list Calculating all pairwise incompatibilities... 100.0% Using a window size of 80 with k as 1 Too few informative sites to use normal approximation. Try doing a permutation test or increasing alignment length Can also try decreasing windowsize.
#NEXUS
[ID: 8330645367]
begin taxa;
dimensions ntax=4;
taxlabels
HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
;
end;
begin trees;
translate
1 HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2,
2 HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2,
3 HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2,
4 HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:6.736571e-01,2:6.403469e-01,3:6.639968e-01,4:6.257983e-01);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:6.736571e-01,2:6.403469e-01,3:6.639968e-01,4:6.257983e-01);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -72.05 -74.47
2 -72.07 -74.78
--------------------------------------
TOTAL -72.06 -74.64
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 9.060323 101.864467 0.000003 29.013160 5.884873 1017.15 1233.78 1.000
r(A<->C){all} 0.165592 0.018922 0.000266 0.435340 0.129797 215.70 219.74 1.000
r(A<->G){all} 0.161673 0.017703 0.000015 0.425335 0.129403 138.29 143.64 1.000
r(A<->T){all} 0.156101 0.019405 0.000030 0.447208 0.113951 113.26 258.98 1.004
r(C<->G){all} 0.171670 0.019629 0.000149 0.451438 0.139285 205.80 218.84 1.000
r(C<->T){all} 0.184021 0.023248 0.000064 0.491020 0.143781 135.99 183.63 1.009
r(G<->T){all} 0.160944 0.018572 0.000031 0.441283 0.123745 90.75 126.98 1.000
pi(A){all} 0.253509 0.003285 0.147406 0.369375 0.251334 774.36 809.19 1.000
pi(C){all} 0.218975 0.002935 0.119419 0.325882 0.216659 1040.30 1051.19 1.000
pi(G){all} 0.291540 0.003828 0.169117 0.407766 0.290671 826.83 936.90 1.002
pi(T){all} 0.235976 0.003257 0.132748 0.352200 0.231704 1005.26 1005.69 1.001
alpha{1,2} 0.919965 0.987703 0.000221 2.845420 0.599634 1068.82 1144.92 1.000
alpha{3} 0.938031 0.953241 0.000064 2.806031 0.636980 998.71 1025.89 1.000
pinvar{all} 0.937445 0.021866 0.636041 0.999970 0.981684 86.72 155.66 1.013
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
[2J[H /HYPHY 2.3.14.20190214beta(MP) for Linux on x86_64\ ***************** TYPES OF STANDARD ANALYSES ***************** (1) Selection Analyses (2) Evolutionary Hypothesis Testing (3) Relative evolutionary rate inference (4) Coevolutionary analysis (5) Basic Analyses (6) Codon Selection Analyses (7) Compartmentalization (8) Data File Tools (9) Miscellaneous (10) Model Comparison (11) Kernel Analysis Tools (12) Molecular Clock (13) Phylogeny Reconstruction (14) Positive Selection (15) Recombination (16) Selection/Recombination (17) Relative Rate (18) Relative Ratio (19) Substitution Rates Please select type of analyses you want to list (or press ENTER to process custom batch file):[2J[H***************** FILES IN 'Selection Analyses' ***************** (1) [MEME] Test for episodic site-level selection using MEME (Mixed Effects Model of Evolution). (2) [FEL] Test for pervasive site-level selection using FEL (Fixed Effects Likelihood). (3) [SLAC] Test for pervasive site-level selection using SLAC (Single Likelihood Ancestor Counting). (4) [FUBAR] Test for pervasive site-level selection using FUBAR (Fast Unconstrained Bayesian AppRoximation for inferring selection). (5) [BUSTED] Test for episodic gene-wide selection using BUSTED (Branch-site Unrestricted Statistical Test of Episodic Diversification). (6) [aBSREL] Test for lineage-specific evolution using the branch-site method aBS-REL (Adaptive Branch-Site Random Effects Likelihood). (7) [RELAX] Test for relaxation of selection pressure along a specified set of test branches using RELAX (a random effects test of selection relaxation). Please select the analysis you would like to perform (or press ENTER to return to the list of analysis types): Analysis Description -------------------- Perform a Fast Unbiased AppRoximate Bayesian (FUBAR) analysis of a coding sequence alignment to determine whether some sites have been subject to pervasive purifying or diversifying selection. v2.1 introduces two more methods for estimating the posterior distribution of grid weights: collapsed Gibbs MCMC (faster) and 0-th order Variation Bayes approximation (fastest). Please note that a FUBAR analysis generates a cache and a results JSON file in the same directory as directory as the original alignment. HyPhy needs to have write privileges to this directory. For example if the original file is in /home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there will also exist FUBAR-generated files /home/sergei/FUBAR/data/pol.nex.FUBAR.json, /home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also provide checkpointing so that a partially completed analysis can be restarted. - __Requirements__: in-frame codon alignment (possibly partitioned) and a phylogenetic tree (one per partition) - __Citation__: FUBAR: a fast, unconstrained bayesian approximation for inferring selection (2013), Mol Biol Evol. 30(5):1196-205 - __Written by__: Sergei L Kosakovsky Pond - __Contact Information__: spond@temple.edu - __Analysis Version__: 2.1 ####Choose Genetic Code 1. [**Universal**] Universal code. (Genebank transl_table=1). 2. [**Vertebrate mtDNA**] Vertebrate mitochondrial DNA code. (Genebank transl_table=2). 3. [**Yeast mtDNA**] Yeast mitochondrial DNA code. (Genebank transl_table=3). 4. [**Mold/Protozoan mtDNA**] Mold, Protozoan and Coelenterate mitochondrial DNA and the Mycloplasma/Spiroplasma code. (Genebank transl_table=4). 5. [**Invertebrate mtDNA**] Invertebrate mitochondrial DNA code. (Genebank transl_table=5). 6. [**Ciliate Nuclear**] Ciliate, Dasycladacean and Hexamita Nuclear code. (Genebank transl_table=6). 7. [**Echinoderm mtDNA**] Echinoderm mitochondrial DNA code. (Genebank transl_table=9). 8. [**Euplotid Nuclear**] Euplotid Nuclear code. (Genebank transl_table=10). 9. [**Alt. Yeast Nuclear**] Alternative Yeast Nuclear code. (Genebank transl_table=12). 10. [**Ascidian mtDNA**] Ascidian mitochondrial DNA code. (Genebank transl_table=13). 11. [**Flatworm mtDNA**] Flatworm mitochondrial DNA code. (Genebank transl_table=14). 12. [**Blepharisma Nuclear**] Blepharisma Nuclear code. (Genebank transl_table=15). 13. [**Chlorophycean mtDNA**] Chlorophycean Mitochondrial Code (transl_table=16). 14. [**Trematode mtDNA**] Trematode Mitochondrial Code (transl_table=21). 15. [**Scenedesmus obliquus mtDNA**] Scenedesmus obliquus mitochondrial Code (transl_table=22). 16. [**Thraustochytrium mtDNA**] Thraustochytrium Mitochondrial Code (transl_table=23). 17. [**Pterobranchia mtDNA**] Pterobranchia Mitochondrial Code (transl_table=24). 18. [**SR1 and Gracilibacteria**] Candidate Division SR1 and Gracilibacteria Code (transl_table=25). 19. [**Pachysolen Nuclear**] Pachysolen tannophilus Nuclear Code (transl_table=26). >Please choose an option (or press q to cancel selection): >Select a coding sequence alignment file (`/usr/local/lib/hyphy/TemplateBatchFiles/SelectionAnalyses/`) >A tree was found in the data file: `(C1,C2,C3,C4)` >Would you like to use it (y/n)? >Loaded a multiple sequence alignment with **4** sequences, **17** codons, and **1** partitions from `/data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/results/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1.fna` > FUBAR will write cache and result files to _/data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/results/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1.fna.FUBAR.cache_ and _/data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/fubar/results/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1.fna.FUBAR.json_, respectively > Number of grid points per dimension (total number is D^2) (permissible range = [5,50], default value = 20, integer): ####Posterior estimation method 1. [**Metropolis-Hastings**] Full Metropolis-Hastings MCMC algorithm (slowest, original 2013 paper implementation) 2. [**Collapsed Gibbs**] Collapsed Gibbs sampler (intermediate speed) 3. [**Variational Bayes**] 0-th order Variational Bayes approximations (fastest, recommended default) >Please choose an option (or press q to cancel selection):> The concentration parameter of the Dirichlet prior (permissible range = [0.001,1], default value = 0.5): ### Obtaining branch lengths and nucleotide substitution biases under the nucleotide GTR model * Log(L) = -70.36, AIC-c = 166.36 (12 estimated parameters) * Tree length (expected substitutions/site) for partition 1 : 0.000 ### Computing the phylogenetic likelihood function on the grid * Determining appropriate tree scaling based on the best score from a 20 x 20 rate grid * Best scaling achieved for * synonymous rate = 0.000 * non-synonymous rate = 0.000 * Computing conditional site likelihoods on a 20 x 20 rate grid ### Running an iterative zeroth order variational Bayes procedure to estimate the posterior mean of rate weights * Using the following settings * Dirichlet alpha : 0.5 ### Tabulating site-level results ---- ## FUBAR inferred no sites under subject to positive selection at posterior probability >= 0.9
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken # ### General parameters ### # # The maximum number of sequences to use for the master file sequence_limit=90 # The random seed random_seed=3976763 # ### Alignment ### # # The alignment method: clustalw, muscle, kalign, t_coffee, or amap align_method=muscle # Minimum support value for amino acid positions in the alignment tcoffee_min_score=3 # ### MrBayes ### # # Number of iterations in MrBayes mrbayes_generations=1000000 # MrBayes burnin mrbayes_burnin=2500 # ### FUBAR ### # # The maximum number of sequences to be used by FUBAR. fubar_sequence_limit=90 # The number of FUBAR runs fubar_runs=1 # ### codeML ### # # The maximum number of sequences to be used by CodeML codeml_sequence_limit=30 # The number of CodeML runs codeml_runs=1 # The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'. codeml_models=1 2 7 8 # ### OmegaMap ### # # The maximum number of sequences to use in OmegaMap omegamap_sequence_limit=90 # The number of OmegaMap runs omegamap_runs=1 # The number of OmegaMap iterations omegamap_iterations=2500
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
