--- EXPERIMENT NOTES
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken
#
### General parameters ###
#
# The maximum number of sequences to use for the master file
sequence_limit=90
# The random seed
random_seed=3976763
#
### Alignment ###
#
# The alignment method: clustalw, muscle, kalign, t_coffee, or amap
align_method=muscle
# Minimum support value for amino acid positions in the alignment
tcoffee_min_score=3
#
### MrBayes ###
#
# Number of iterations in MrBayes
mrbayes_generations=1000000
# MrBayes burnin
mrbayes_burnin=2500
#
### FUBAR ###
#
# The maximum number of sequences to be used by FUBAR.
fubar_sequence_limit=90
# The number of FUBAR runs
fubar_runs=1
#
### codeML ###
#
# The maximum number of sequences to be used by CodeML
codeml_sequence_limit=30
# The number of CodeML runs
codeml_runs=1
# The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'.
codeml_models=1 2 7 8
#
### OmegaMap ###
#
# The maximum number of sequences to use in OmegaMap
omegamap_sequence_limit=90
# The number of OmegaMap runs
omegamap_runs=1
# The number of OmegaMap iterations
omegamap_iterations=2500
--- EXPERIMENT PROPERTIES
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -141.73 -152.56
2 -141.72 -154.91
--------------------------------------
TOTAL -141.73 -154.31
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.324707 0.022122 0.110791 0.607763 0.297195 1271.40 1386.20 1.000
r(A<->C){all} 0.063787 0.003933 0.000012 0.192315 0.044259 284.09 289.43 1.005
r(A<->G){all} 0.342964 0.017076 0.093315 0.591816 0.339198 93.45 133.24 1.010
r(A<->T){all} 0.077452 0.004119 0.000008 0.208162 0.062552 204.26 224.26 1.000
r(C<->G){all} 0.064250 0.003871 0.000002 0.184231 0.045722 194.15 214.29 1.000
r(C<->T){all} 0.352910 0.015936 0.117457 0.594664 0.345420 113.65 139.43 1.015
r(G<->T){all} 0.098637 0.004746 0.000317 0.234816 0.083536 183.80 253.12 1.010
pi(A){all} 0.241663 0.002641 0.144656 0.346215 0.239310 669.24 749.83 1.000
pi(C){all} 0.196624 0.002295 0.103435 0.284129 0.194183 645.99 762.79 1.004
pi(G){all} 0.276434 0.002825 0.182206 0.386350 0.274207 872.33 893.15 1.001
pi(T){all} 0.285279 0.003089 0.180605 0.394718 0.283671 821.25 855.12 1.001
alpha{1,2} 0.582281 0.528540 0.000224 1.982054 0.327552 780.91 827.42 1.001
alpha{3} 1.509678 1.261131 0.001708 3.829231 1.216155 1136.70 1168.23 1.000
pinvar{all} 0.325199 0.038307 0.001402 0.665188 0.312099 593.74 659.56 1.002
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
--- CODEML SUMMARY
-- Starting log on Wed Nov 09 22:46:01 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
C1 GTTIDQSYLNECGVLVQLD
C2 GTTIDQSYLNECGVLVQLD
C3 SSTVDQSYLNECGVLVQLD
C4 GTTIDQSYLNECGVLVQLD
C5 STTIDQSYLNECGVLVQLD
C6 GTTIDQSYLNECGVLVQLD
C7 GATMDQSYLNECGVLVQLD
C8 SSTVDQSYLNECGVLVQLD
C9 SSTVDQSYLNECGVLVQLD
C10 SFTVDQSYLNECGVLVQLD
C11 SSTVDQSYLNECGVLVQLD
. *:***************
-- Starting log on Wed Nov 09 22:47:03 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
C1 GTTIDQSYLNECGVLVQLD
C2 GTTIDQSYLNECGVLVQLD
C3 SSTVDQSYLNECGVLVQLD
C4 GTTIDQSYLNECGVLVQLD
C5 STTIDQSYLNECGVLVQLD
C6 GTTIDQSYLNECGVLVQLD
C7 GATMDQSYLNECGVLVQLD
C8 SSTVDQSYLNECGVLVQLD
C9 SSTVDQSYLNECGVLVQLD
C10 SFTVDQSYLNECGVLVQLD
C11 SSTVDQSYLNECGVLVQLD
. *:***************
-- Starting log on Wed Nov 09 22:46:01 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
C1 GTTIDQSYLNECGVLVQLD
C2 GTTIDQSYLNECGVLVQLD
C3 SSTVDQSYLNECGVLVQLD
C4 GTTIDQSYLNECGVLVQLD
C5 STTIDQSYLNECGVLVQLD
C6 GTTIDQSYLNECGVLVQLD
C7 GATMDQSYLNECGVLVQLD
C8 SSTVDQSYLNECGVLVQLD
C9 SSTVDQSYLNECGVLVQLD
C10 SFTVDQSYLNECGVLVQLD
C11 SSTVDQSYLNECGVLVQLD
. *:***************
-- Starting log on Thu Nov 10 01:14:35 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/gapped_alignment/fubar,A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1--
MrBayes v3.2.6 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/mrbayes_input.nex"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 11 taxa and 57 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C10
Taxon 3 -> C11
Taxon 4 -> C2
Taxon 5 -> C3
Taxon 6 -> C4
Taxon 7 -> C5
Taxon 8 -> C6
Taxon 9 -> C7
Taxon 10 -> C8
Taxon 11 -> C9
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1668042877
Setting output file names to "/data/mrbayes_input.nex.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called 'first_pos'
Defining charset called 'second_pos'
Defining charset called 'third_pos'
Defining partition called 'by_codon'
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 72715673
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 7555419412
Seed = 2083565577
Swapseed = 1668042877
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Active parameters:
Partition(s)
Parameters 1 2 3
---------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
---------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:GammaDir(1.0,0.1000,1.0,1.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
0.91 % Dirichlet(Revmat{all})
0.91 % Slider(Revmat{all})
0.91 % Dirichlet(Pi{all})
0.91 % Slider(Pi{all})
1.82 % Multiplier(Alpha{1,2})
1.82 % Multiplier(Alpha{3})
1.82 % Slider(Pinvar{all})
9.09 % ExtSPR(Tau{all},V{all})
9.09 % ExtTBR(Tau{all},V{all})
9.09 % NNI(Tau{all},V{all})
9.09 % ParsSPR(Tau{all},V{all})
36.36 % Multiplier(V{all})
12.73 % Nodeslider(V{all})
5.45 % TLMultiplier(V{all})
Division 1 has 7 unique site patterns
Division 2 has 5 unique site patterns
Division 3 has 8 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -221.274858 -- 38.695331
Chain 2 -- -236.714236 -- 38.695331
Chain 3 -- -238.321204 -- 38.695331
Chain 4 -- -230.065964 -- 38.695331
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -219.731883 -- 38.695331
Chain 2 -- -223.208984 -- 38.695331
Chain 3 -- -208.351320 -- 38.695331
Chain 4 -- -214.867095 -- 38.695331
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-221.275] (-236.714) (-238.321) (-230.066) * [-219.732] (-223.209) (-208.351) (-214.867)
1000 -- [-149.820] (-151.632) (-155.219) (-149.258) * [-157.249] (-161.940) (-153.069) (-151.082) -- 0:00:00
2000 -- (-150.500) (-152.021) [-151.431] (-152.897) * (-152.234) (-147.676) [-149.220] (-153.881) -- 0:08:19
3000 -- (-154.176) [-148.768] (-157.425) (-144.017) * [-148.797] (-148.727) (-149.831) (-159.560) -- 0:05:32
4000 -- (-150.878) [-146.151] (-152.056) (-154.447) * (-145.455) (-156.536) [-150.724] (-142.932) -- 0:04:09
5000 -- (-151.773) (-157.317) (-149.290) [-150.237] * (-144.372) [-142.643] (-156.328) (-153.110) -- 0:03:19
Average standard deviation of split frequencies: 0.091357
6000 -- [-151.238] (-160.051) (-145.953) (-151.355) * [-144.599] (-152.955) (-159.241) (-148.244) -- 0:02:45
7000 -- [-144.141] (-151.777) (-149.072) (-150.790) * (-143.852) [-149.856] (-161.566) (-149.278) -- 0:02:21
8000 -- (-143.183) (-159.097) [-141.034] (-153.322) * (-147.648) [-143.471] (-159.333) (-152.012) -- 0:04:08
9000 -- (-151.950) (-155.544) [-145.737] (-166.354) * [-146.329] (-146.616) (-165.736) (-162.947) -- 0:03:40
10000 -- (-144.907) (-158.408) [-142.575] (-165.632) * (-150.870) (-143.100) (-159.609) [-151.405] -- 0:03:18
Average standard deviation of split frequencies: 0.082250
11000 -- (-143.187) (-160.521) [-152.129] (-165.220) * [-142.761] (-148.368) (-157.266) (-152.444) -- 0:02:59
12000 -- (-143.325) (-159.540) [-145.802] (-157.762) * [-139.439] (-153.655) (-159.797) (-154.154) -- 0:02:44
13000 -- (-152.453) (-161.282) [-150.696] (-158.829) * (-151.768) (-145.544) (-161.203) [-144.174] -- 0:03:47
14000 -- (-148.758) (-164.476) [-148.026] (-163.619) * (-167.210) [-142.411] (-159.641) (-150.062) -- 0:03:31
15000 -- [-143.019] (-167.681) (-149.851) (-158.037) * (-148.034) (-153.523) (-161.879) [-150.414] -- 0:03:17
Average standard deviation of split frequencies: 0.070331
16000 -- (-143.843) (-160.103) [-149.430] (-155.530) * (-162.177) (-150.950) (-168.043) [-145.360] -- 0:03:04
17000 -- (-148.658) (-157.367) [-143.684] (-164.197) * (-159.413) [-148.027] (-163.457) (-156.853) -- 0:02:53
18000 -- (-145.841) (-154.872) [-146.232] (-160.442) * [-149.032] (-148.909) (-159.338) (-150.977) -- 0:03:38
19000 -- [-144.705] (-159.390) (-148.701) (-163.863) * (-147.983) [-147.836] (-158.534) (-152.457) -- 0:03:26
20000 -- [-145.807] (-164.942) (-156.661) (-150.382) * (-147.430) [-143.493] (-164.345) (-158.665) -- 0:03:16
Average standard deviation of split frequencies: 0.062727
21000 -- (-142.196) (-165.449) [-147.554] (-148.813) * [-144.632] (-154.511) (-157.318) (-149.460) -- 0:03:06
22000 -- [-145.526] (-156.170) (-149.506) (-165.414) * [-143.338] (-155.336) (-160.242) (-149.814) -- 0:02:57
23000 -- (-152.367) (-161.592) [-150.258] (-161.795) * (-140.714) [-148.357] (-168.155) (-146.551) -- 0:03:32
24000 -- (-148.829) (-162.398) [-146.581] (-162.603) * (-149.160) [-149.194] (-162.969) (-149.142) -- 0:03:23
25000 -- (-148.580) (-158.518) [-150.189] (-164.977) * (-160.513) [-143.072] (-160.155) (-148.888) -- 0:03:15
Average standard deviation of split frequencies: 0.055993
26000 -- [-154.326] (-166.332) (-149.650) (-166.127) * [-143.873] (-148.215) (-164.241) (-146.098) -- 0:03:07
27000 -- (-149.465) [-147.237] (-146.651) (-165.449) * (-143.732) [-139.486] (-165.059) (-147.525) -- 0:03:00
28000 -- [-139.549] (-151.796) (-147.052) (-165.939) * (-148.669) (-150.257) (-170.066) [-144.715] -- 0:02:53
29000 -- (-138.461) (-157.086) [-142.897] (-161.524) * (-155.476) (-145.404) (-165.471) [-144.535] -- 0:03:20
30000 -- (-151.655) [-145.903] (-144.146) (-164.703) * (-150.235) [-148.909] (-159.456) (-145.988) -- 0:03:14
Average standard deviation of split frequencies: 0.044252
31000 -- (-161.564) [-142.025] (-147.502) (-161.938) * (-152.822) (-142.724) (-159.031) [-146.348] -- 0:03:07
32000 -- [-144.667] (-148.632) (-148.229) (-160.769) * (-155.389) (-146.364) (-166.021) [-142.686] -- 0:03:01
33000 -- (-154.983) (-145.541) [-146.326] (-168.230) * (-150.248) (-148.352) (-158.532) [-148.054] -- 0:02:55
34000 -- (-144.943) (-144.440) [-141.941] (-164.993) * (-142.601) (-150.275) (-160.517) [-149.155] -- 0:03:18
35000 -- (-148.047) (-161.366) [-139.705] (-168.384) * [-144.498] (-149.818) (-165.203) (-147.872) -- 0:03:13
Average standard deviation of split frequencies: 0.046042
36000 -- [-144.279] (-147.524) (-148.856) (-162.504) * [-149.708] (-146.332) (-166.491) (-150.691) -- 0:03:07
37000 -- (-144.630) (-146.733) [-142.189] (-155.375) * (-142.746) (-150.185) (-171.833) [-144.956] -- 0:03:02
38000 -- [-144.795] (-149.143) (-145.231) (-164.632) * (-147.808) (-149.387) (-174.463) [-144.145] -- 0:02:57
39000 -- (-145.449) (-146.589) [-140.497] (-156.345) * [-142.737] (-140.958) (-159.133) (-149.897) -- 0:03:17
40000 -- (-146.754) [-146.192] (-143.394) (-158.833) * [-142.106] (-144.658) (-161.160) (-150.406) -- 0:03:12
Average standard deviation of split frequencies: 0.042228
41000 -- (-151.028) (-154.805) [-144.157] (-157.057) * (-150.753) [-148.606] (-164.226) (-143.605) -- 0:03:07
42000 -- (-143.095) (-149.920) [-147.999] (-160.701) * (-143.353) [-142.425] (-164.371) (-143.338) -- 0:03:02
43000 -- [-145.497] (-145.500) (-146.754) (-165.730) * [-139.675] (-145.935) (-159.854) (-154.940) -- 0:02:58
44000 -- (-154.420) (-150.106) [-141.000] (-158.201) * (-146.748) [-145.583] (-166.920) (-144.388) -- 0:03:15
45000 -- (-144.264) (-148.924) [-147.812] (-164.045) * [-143.201] (-148.054) (-157.799) (-151.466) -- 0:03:11
Average standard deviation of split frequencies: 0.040309
46000 -- (-142.973) [-142.568] (-149.595) (-170.280) * [-139.633] (-159.965) (-164.217) (-156.448) -- 0:03:06
47000 -- [-146.018] (-146.146) (-147.467) (-168.871) * (-147.345) [-143.677] (-161.796) (-145.900) -- 0:03:02
48000 -- [-142.608] (-147.530) (-150.127) (-173.990) * (-142.009) (-154.066) (-163.445) [-151.226] -- 0:02:58
49000 -- (-142.904) (-149.050) [-145.090] (-163.588) * (-144.380) (-143.649) (-166.573) [-145.469] -- 0:02:54
50000 -- (-148.535) (-154.352) [-142.169] (-169.236) * [-148.319] (-142.428) (-158.896) (-151.886) -- 0:03:10
Average standard deviation of split frequencies: 0.035493
51000 -- (-148.747) [-143.655] (-140.649) (-165.859) * (-143.966) [-144.428] (-161.323) (-146.892) -- 0:03:06
52000 -- [-146.769] (-154.336) (-143.696) (-163.936) * (-144.975) [-143.350] (-162.340) (-164.337) -- 0:03:02
53000 -- [-148.056] (-146.113) (-146.962) (-155.071) * [-141.940] (-149.777) (-162.392) (-166.470) -- 0:02:58
54000 -- (-151.071) [-146.117] (-145.720) (-162.326) * [-145.413] (-144.259) (-159.705) (-170.260) -- 0:02:55
55000 -- [-149.136] (-151.415) (-146.715) (-165.807) * [-144.105] (-142.779) (-159.001) (-164.637) -- 0:03:09
Average standard deviation of split frequencies: 0.035938
56000 -- (-144.732) (-147.158) [-145.181] (-171.850) * (-147.421) [-151.653] (-163.932) (-163.999) -- 0:03:05
57000 -- (-148.280) [-146.372] (-145.806) (-154.035) * (-146.437) [-152.007] (-159.061) (-170.060) -- 0:03:01
58000 -- (-145.595) [-146.223] (-151.529) (-162.557) * [-145.610] (-151.563) (-151.269) (-165.917) -- 0:02:58
59000 -- (-150.672) (-142.539) [-147.189] (-161.605) * (-148.209) [-149.505] (-140.789) (-164.323) -- 0:02:55
60000 -- [-144.797] (-145.181) (-145.129) (-158.912) * [-148.756] (-151.235) (-144.603) (-158.701) -- 0:03:08
Average standard deviation of split frequencies: 0.030249
61000 -- [-140.160] (-154.267) (-147.727) (-153.941) * (-153.854) (-147.034) [-142.502] (-163.165) -- 0:03:04
62000 -- (-156.456) (-147.831) [-146.958] (-157.862) * (-150.419) (-141.467) [-145.276] (-159.907) -- 0:03:01
63000 -- (-142.445) (-149.300) [-140.108] (-166.971) * [-145.508] (-146.957) (-145.196) (-164.478) -- 0:02:58
64000 -- [-144.042] (-145.205) (-143.422) (-160.901) * [-148.597] (-146.661) (-147.598) (-158.251) -- 0:02:55
65000 -- (-144.983) [-149.787] (-145.871) (-155.776) * (-155.005) (-146.491) [-148.352] (-155.792) -- 0:03:07
Average standard deviation of split frequencies: 0.028324
66000 -- (-149.406) (-140.237) [-151.464] (-159.084) * [-145.194] (-151.434) (-150.539) (-155.884) -- 0:03:03
67000 -- [-147.514] (-154.365) (-150.357) (-164.634) * (-146.914) [-144.327] (-164.017) (-158.268) -- 0:03:01
68000 -- (-148.575) [-143.039] (-150.464) (-158.189) * (-145.855) (-149.272) [-149.984] (-164.806) -- 0:02:58
69000 -- [-149.637] (-156.236) (-146.738) (-156.021) * (-150.385) [-150.336] (-157.367) (-156.582) -- 0:02:55
70000 -- [-154.522] (-155.910) (-140.572) (-159.499) * [-151.716] (-139.403) (-150.629) (-157.695) -- 0:03:06
Average standard deviation of split frequencies: 0.027160
71000 -- (-152.396) (-154.397) [-148.863] (-166.199) * (-145.645) (-148.286) [-151.266] (-168.183) -- 0:03:03
72000 -- (-143.500) (-148.999) [-150.141] (-165.300) * (-162.992) [-144.637] (-144.519) (-157.733) -- 0:03:00
73000 -- (-163.445) (-151.482) [-147.259] (-162.215) * [-147.596] (-157.197) (-140.176) (-156.851) -- 0:02:57
74000 -- (-150.211) [-146.602] (-154.517) (-157.819) * (-156.917) [-148.765] (-146.564) (-160.010) -- 0:02:55
75000 -- (-145.043) (-145.686) [-151.073] (-163.147) * [-150.867] (-147.249) (-153.390) (-157.000) -- 0:02:52
Average standard deviation of split frequencies: 0.029302
76000 -- (-145.297) (-153.701) [-145.944] (-158.980) * (-145.914) [-144.729] (-152.535) (-159.266) -- 0:03:02
77000 -- [-145.862] (-159.225) (-147.811) (-157.361) * [-145.376] (-146.532) (-154.988) (-162.888) -- 0:02:59
78000 -- (-161.610) (-156.876) [-144.618] (-158.213) * (-148.893) [-144.236] (-160.047) (-156.413) -- 0:02:57
79000 -- [-146.608] (-163.781) (-143.704) (-156.909) * [-144.894] (-144.273) (-156.309) (-163.354) -- 0:02:54
80000 -- (-139.150) (-154.691) [-148.140] (-163.920) * [-143.750] (-146.290) (-159.110) (-161.133) -- 0:02:52
Average standard deviation of split frequencies: 0.030132
81000 -- (-153.061) (-169.836) [-146.593] (-159.483) * [-144.837] (-143.642) (-161.163) (-154.148) -- 0:03:01
82000 -- (-143.667) (-164.714) [-142.859] (-163.639) * [-142.404] (-150.796) (-169.283) (-164.289) -- 0:02:59
83000 -- (-149.673) (-160.437) [-144.084] (-167.766) * (-143.962) [-142.503] (-160.103) (-165.687) -- 0:02:56
84000 -- [-145.928] (-162.216) (-144.731) (-164.743) * (-148.756) [-147.756] (-163.013) (-164.672) -- 0:02:54
85000 -- [-147.371] (-154.717) (-148.449) (-154.852) * [-138.814] (-146.781) (-169.375) (-162.502) -- 0:02:52
Average standard deviation of split frequencies: 0.026078
86000 -- [-147.632] (-167.986) (-146.249) (-157.663) * (-143.869) [-147.000] (-161.446) (-161.976) -- 0:03:00
87000 -- (-148.600) (-152.522) [-140.551] (-157.077) * (-144.941) [-146.696] (-155.836) (-163.603) -- 0:02:58
88000 -- (-146.951) (-158.992) [-143.148] (-161.262) * [-142.787] (-149.262) (-159.824) (-158.912) -- 0:02:56
89000 -- [-147.755] (-156.260) (-146.617) (-159.026) * (-142.564) [-145.492] (-161.944) (-153.857) -- 0:02:54
90000 -- [-146.108] (-157.969) (-149.894) (-158.303) * [-143.024] (-147.887) (-157.576) (-151.441) -- 0:02:51
Average standard deviation of split frequencies: 0.024823
91000 -- (-143.488) (-159.213) [-141.255] (-152.207) * [-142.766] (-152.296) (-169.464) (-153.723) -- 0:02:59
92000 -- (-142.598) (-161.743) [-141.149] (-162.869) * (-154.709) [-144.676] (-157.492) (-159.260) -- 0:02:57
93000 -- (-143.031) (-156.832) [-140.333] (-157.162) * [-142.111] (-144.613) (-164.816) (-154.147) -- 0:02:55
94000 -- [-141.470] (-163.092) (-141.464) (-157.551) * (-147.828) [-145.750] (-166.686) (-162.240) -- 0:02:53
95000 -- (-151.671) (-157.710) [-144.451] (-154.565) * (-144.564) [-145.898] (-155.667) (-164.085) -- 0:02:51
Average standard deviation of split frequencies: 0.023407
96000 -- (-151.168) (-156.792) [-142.247] (-147.335) * (-148.484) [-149.170] (-162.017) (-163.089) -- 0:02:58
97000 -- [-139.764] (-157.676) (-144.500) (-152.196) * (-153.076) (-144.641) [-142.008] (-166.922) -- 0:02:56
98000 -- (-145.985) (-161.498) (-150.869) [-142.656] * [-140.261] (-158.647) (-150.304) (-156.464) -- 0:02:54
99000 -- (-144.244) (-158.429) (-145.360) [-144.176] * [-143.445] (-148.323) (-151.232) (-160.669) -- 0:02:52
100000 -- (-153.132) (-153.233) [-139.849] (-157.509) * (-153.511) (-143.817) [-142.215] (-156.439) -- 0:02:51
Average standard deviation of split frequencies: 0.027595
101000 -- (-149.638) (-154.452) [-138.492] (-148.621) * (-157.242) [-147.300] (-141.332) (-152.680) -- 0:02:58
102000 -- (-147.255) (-166.243) (-140.085) [-148.375] * (-159.610) (-147.161) [-152.259] (-156.844) -- 0:02:56
103000 -- (-154.098) (-152.857) [-148.767] (-148.170) * (-153.573) (-145.887) [-141.086] (-149.241) -- 0:02:54
104000 -- [-138.249] (-159.894) (-149.111) (-151.730) * (-163.163) [-140.953] (-143.332) (-155.883) -- 0:02:52
105000 -- (-143.905) (-156.526) [-148.594] (-159.913) * (-155.904) [-143.912] (-146.606) (-159.335) -- 0:02:50
Average standard deviation of split frequencies: 0.026832
106000 -- (-146.369) (-161.757) [-148.444] (-156.202) * (-161.310) (-145.443) [-143.303] (-155.229) -- 0:02:48
107000 -- [-145.988] (-160.237) (-148.084) (-163.467) * (-159.120) (-144.608) [-147.893] (-156.799) -- 0:02:55
108000 -- [-140.302] (-155.816) (-141.585) (-161.090) * (-161.657) (-148.937) [-148.449] (-171.633) -- 0:02:53
109000 -- (-144.071) (-162.791) [-143.870] (-161.797) * (-155.772) (-141.597) [-144.826] (-164.323) -- 0:02:51
110000 -- [-143.011] (-158.260) (-146.584) (-170.479) * (-161.518) [-146.747] (-149.747) (-165.003) -- 0:02:49
Average standard deviation of split frequencies: 0.028643
111000 -- (-142.253) (-152.038) [-149.773] (-160.633) * (-158.160) (-146.786) [-145.120] (-160.256) -- 0:02:48
112000 -- [-144.985] (-158.122) (-147.965) (-158.130) * (-165.134) [-145.572] (-150.953) (-165.582) -- 0:02:54
113000 -- (-144.094) (-153.807) [-147.000] (-158.596) * (-161.594) (-144.758) [-147.770] (-166.232) -- 0:02:52
114000 -- (-143.776) (-164.463) [-147.330] (-152.690) * (-162.777) (-148.129) [-144.044] (-151.839) -- 0:02:50
115000 -- [-146.652] (-158.914) (-155.070) (-158.601) * (-167.726) [-139.992] (-156.257) (-151.710) -- 0:02:49
Average standard deviation of split frequencies: 0.028167
116000 -- [-152.095] (-171.287) (-147.282) (-164.051) * (-158.929) [-147.308] (-148.418) (-149.864) -- 0:02:47
117000 -- [-148.513] (-170.040) (-149.877) (-159.845) * (-159.651) [-144.836] (-144.684) (-155.482) -- 0:02:53
118000 -- [-148.162] (-160.876) (-149.207) (-159.454) * (-160.522) (-147.059) [-143.302] (-152.470) -- 0:02:51
119000 -- [-144.501] (-164.661) (-149.464) (-163.064) * (-161.456) (-143.718) [-149.506] (-154.703) -- 0:02:50
120000 -- [-150.773] (-167.208) (-147.531) (-162.317) * (-162.326) [-142.266] (-150.001) (-156.396) -- 0:02:48
Average standard deviation of split frequencies: 0.026404
121000 -- [-146.392] (-166.797) (-153.216) (-166.314) * (-160.265) [-141.764] (-145.880) (-161.857) -- 0:02:47
122000 -- (-152.610) (-159.911) [-147.729] (-164.923) * (-154.238) [-142.859] (-146.001) (-166.419) -- 0:02:52
123000 -- (-142.137) (-149.336) [-141.469] (-163.615) * (-151.696) (-147.665) [-145.220] (-157.279) -- 0:02:51
124000 -- (-154.800) [-151.522] (-143.609) (-165.023) * (-152.349) (-151.026) [-144.408] (-165.932) -- 0:02:49
125000 -- (-157.555) [-140.078] (-145.908) (-160.847) * (-158.711) (-152.156) [-140.888] (-152.911) -- 0:02:48
Average standard deviation of split frequencies: 0.025802
126000 -- (-145.393) (-147.254) [-141.156] (-165.284) * (-160.031) (-147.261) [-143.893] (-160.848) -- 0:02:46
127000 -- (-151.901) (-155.269) [-145.890] (-156.325) * (-155.177) (-144.512) [-148.396] (-152.089) -- 0:02:44
128000 -- (-142.907) [-140.535] (-153.917) (-163.528) * (-165.039) (-146.580) (-146.575) [-146.325] -- 0:02:50
129000 -- [-149.453] (-153.250) (-157.660) (-160.797) * (-156.888) (-151.402) [-147.002] (-146.888) -- 0:02:48
130000 -- [-146.962] (-150.676) (-156.132) (-164.058) * (-157.828) (-152.706) [-150.637] (-143.422) -- 0:02:47
Average standard deviation of split frequencies: 0.023089
131000 -- (-148.350) [-144.850] (-161.316) (-162.928) * (-160.516) (-140.185) (-157.365) [-147.658] -- 0:02:45
132000 -- [-145.150] (-153.060) (-167.183) (-164.579) * (-159.790) [-144.190] (-157.642) (-151.723) -- 0:02:44
133000 -- [-142.315] (-149.886) (-166.359) (-158.798) * (-164.482) [-146.369] (-165.823) (-144.390) -- 0:02:49
134000 -- (-147.687) [-141.400] (-162.504) (-157.002) * (-155.178) (-139.594) (-164.952) [-143.304] -- 0:02:48
135000 -- (-144.704) [-143.525] (-157.770) (-167.328) * (-157.211) [-143.802] (-161.950) (-152.206) -- 0:02:46
Average standard deviation of split frequencies: 0.022829
136000 -- [-140.023] (-147.416) (-163.062) (-157.271) * (-157.151) [-150.645] (-166.502) (-147.499) -- 0:02:45
137000 -- [-142.811] (-145.158) (-157.580) (-163.745) * (-161.852) [-144.364] (-163.185) (-145.106) -- 0:02:43
138000 -- (-151.321) [-148.061] (-146.748) (-168.600) * (-155.734) (-144.802) (-157.180) [-146.044] -- 0:02:48
139000 -- (-145.951) [-150.408] (-143.420) (-152.068) * (-152.904) (-144.006) (-159.287) [-143.263] -- 0:02:47
140000 -- [-138.111] (-143.605) (-151.629) (-153.768) * (-162.364) [-147.588] (-159.720) (-156.649) -- 0:02:45
Average standard deviation of split frequencies: 0.023227
141000 -- (-143.863) [-145.410] (-144.452) (-166.794) * (-156.774) (-142.414) (-163.349) [-144.900] -- 0:02:44
142000 -- [-140.743] (-140.898) (-155.071) (-159.061) * (-161.970) (-148.252) (-159.971) [-140.208] -- 0:02:43
143000 -- [-140.248] (-143.696) (-141.492) (-156.934) * (-154.867) [-144.148] (-151.829) (-149.413) -- 0:02:47
144000 -- (-153.077) [-143.876] (-150.574) (-153.007) * (-156.364) [-148.199] (-162.194) (-150.203) -- 0:02:46
145000 -- [-144.493] (-149.203) (-146.864) (-151.661) * (-164.305) (-142.719) (-159.760) [-145.619] -- 0:02:45
Average standard deviation of split frequencies: 0.023785
146000 -- (-144.876) [-140.964] (-147.293) (-156.635) * (-158.037) (-152.312) (-154.648) [-143.821] -- 0:02:43
147000 -- (-155.348) (-149.987) [-139.744] (-161.256) * (-158.572) (-148.384) (-160.550) [-155.763] -- 0:02:42
148000 -- [-144.044] (-145.457) (-146.681) (-156.246) * (-165.520) [-147.514] (-159.412) (-153.817) -- 0:02:46
149000 -- (-152.885) [-146.752] (-148.004) (-154.454) * (-164.958) [-143.733] (-167.125) (-143.988) -- 0:02:45
150000 -- (-156.811) (-142.624) [-144.352] (-165.374) * (-153.874) (-144.340) (-156.376) [-142.587] -- 0:02:44
Average standard deviation of split frequencies: 0.023088
151000 -- (-150.142) [-138.525] (-149.170) (-157.443) * (-163.454) (-144.391) (-157.598) [-144.749] -- 0:02:43
152000 -- (-152.244) (-141.639) [-145.191] (-156.959) * (-165.346) [-144.970] (-160.342) (-149.834) -- 0:02:41
153000 -- (-145.938) (-144.464) [-141.804] (-161.653) * (-157.262) (-147.050) (-158.849) [-146.193] -- 0:02:40
154000 -- (-151.968) (-149.321) [-141.662] (-163.576) * (-155.221) (-147.469) (-158.618) [-149.126] -- 0:02:44
155000 -- [-153.560] (-144.294) (-146.332) (-160.643) * (-163.327) [-142.155] (-151.391) (-145.003) -- 0:02:43
Average standard deviation of split frequencies: 0.023095
156000 -- (-144.552) (-148.234) [-145.325] (-157.499) * (-160.078) [-148.281] (-147.897) (-152.956) -- 0:02:42
157000 -- (-154.966) [-147.526] (-147.522) (-153.245) * (-162.102) [-147.865] (-149.392) (-150.649) -- 0:02:41
158000 -- (-141.195) (-141.633) [-142.338] (-166.345) * (-159.136) (-158.790) (-154.466) [-148.542] -- 0:02:39
159000 -- (-151.068) (-143.557) [-145.547] (-159.668) * (-163.758) [-142.060] (-154.014) (-153.391) -- 0:02:43
160000 -- (-151.234) (-144.999) [-144.634] (-166.562) * (-156.588) (-149.123) [-147.523] (-146.466) -- 0:02:42
Average standard deviation of split frequencies: 0.024416
161000 -- (-151.297) [-142.516] (-146.773) (-169.331) * (-157.634) [-142.286] (-146.751) (-149.272) -- 0:02:41
162000 -- (-143.995) (-144.546) [-146.452] (-170.694) * (-159.731) [-142.635] (-144.455) (-150.056) -- 0:02:40
163000 -- (-161.480) [-151.694] (-151.580) (-157.673) * (-162.372) (-151.325) (-147.291) [-142.895] -- 0:02:39
164000 -- (-150.148) (-152.034) [-151.378] (-163.309) * (-169.465) (-150.091) [-150.294] (-151.938) -- 0:02:43
165000 -- (-147.799) (-151.431) [-148.981] (-158.869) * (-162.604) [-146.160] (-149.432) (-146.098) -- 0:02:41
Average standard deviation of split frequencies: 0.023110
166000 -- [-140.846] (-155.740) (-148.215) (-161.889) * (-166.117) [-144.244] (-152.098) (-145.904) -- 0:02:40
167000 -- (-146.226) [-153.725] (-143.965) (-163.483) * (-156.427) (-167.387) (-148.852) [-144.108] -- 0:02:39
168000 -- (-152.370) (-147.206) [-149.191] (-158.985) * (-161.240) (-145.180) (-145.629) [-146.217] -- 0:02:38
169000 -- [-148.997] (-153.438) (-142.415) (-162.081) * (-163.157) (-148.448) (-147.776) [-144.504] -- 0:02:37
170000 -- (-144.596) (-152.013) [-142.779] (-159.705) * (-160.002) (-161.153) [-139.210] (-143.254) -- 0:02:41
Average standard deviation of split frequencies: 0.022886
171000 -- [-145.495] (-147.964) (-146.640) (-159.878) * (-165.388) [-143.756] (-150.285) (-150.740) -- 0:02:39
172000 -- (-166.142) (-148.638) [-140.022] (-167.653) * (-162.329) [-146.526] (-145.856) (-153.714) -- 0:02:38
173000 -- (-160.947) (-151.274) [-145.363] (-157.789) * (-163.310) (-148.925) (-145.631) [-152.400] -- 0:02:37
174000 -- (-160.965) (-152.255) [-142.705] (-163.197) * (-159.888) (-144.581) (-145.914) [-144.832] -- 0:02:36
175000 -- (-166.034) (-145.178) [-150.899] (-158.186) * (-163.634) (-161.400) [-145.399] (-147.975) -- 0:02:40
Average standard deviation of split frequencies: 0.022480
176000 -- (-162.332) (-155.696) [-142.798] (-155.484) * (-160.503) (-150.587) [-139.585] (-149.957) -- 0:02:39
177000 -- (-162.816) [-143.026] (-147.499) (-162.000) * (-153.802) (-159.938) [-139.494] (-147.250) -- 0:02:38
178000 -- (-158.273) [-145.871] (-151.356) (-165.979) * (-159.157) (-148.542) (-146.609) [-144.778] -- 0:02:37
179000 -- (-159.970) (-138.732) [-145.192] (-158.792) * (-153.749) [-140.013] (-147.961) (-147.850) -- 0:02:35
180000 -- (-163.853) (-147.667) [-149.329] (-166.565) * (-157.673) [-139.865] (-147.306) (-142.413) -- 0:02:39
Average standard deviation of split frequencies: 0.020584
181000 -- (-155.320) (-149.410) [-146.207] (-160.148) * (-153.081) (-144.988) (-142.899) [-145.906] -- 0:02:38
182000 -- [-141.520] (-141.146) (-145.427) (-170.783) * (-152.886) [-146.623] (-144.744) (-153.570) -- 0:02:37
183000 -- (-145.854) (-147.275) [-146.327] (-169.004) * (-154.029) [-142.075] (-150.693) (-143.128) -- 0:02:36
184000 -- (-146.016) [-147.104] (-149.594) (-163.109) * (-160.599) (-148.585) [-148.283] (-144.155) -- 0:02:35
185000 -- (-149.025) [-152.219] (-147.660) (-156.881) * (-156.313) [-144.039] (-146.432) (-143.903) -- 0:02:38
Average standard deviation of split frequencies: 0.019642
186000 -- (-142.440) (-149.309) [-147.634] (-163.007) * (-161.675) [-148.025] (-147.644) (-156.403) -- 0:02:37
187000 -- [-144.907] (-151.484) (-148.732) (-156.920) * (-151.099) (-161.961) (-154.062) [-149.272] -- 0:02:36
188000 -- (-148.510) (-141.712) [-143.921] (-162.197) * (-158.170) (-150.353) [-146.538] (-158.009) -- 0:02:35
189000 -- (-145.993) [-146.534] (-154.010) (-155.580) * (-163.642) [-154.082] (-151.922) (-153.488) -- 0:02:34
190000 -- (-144.614) [-149.504] (-145.669) (-150.509) * (-157.179) (-158.005) (-145.302) [-143.286] -- 0:02:37
Average standard deviation of split frequencies: 0.020662
191000 -- (-155.662) (-150.199) [-144.118] (-157.618) * (-155.507) [-152.946] (-146.438) (-145.873) -- 0:02:36
192000 -- (-157.812) (-152.950) [-148.530] (-155.136) * (-163.924) (-155.114) [-146.573] (-151.900) -- 0:02:35
193000 -- (-164.379) [-148.652] (-154.858) (-161.341) * (-158.545) (-150.120) (-145.971) [-143.991] -- 0:02:34
194000 -- (-157.736) (-151.068) [-151.701] (-165.617) * (-156.725) [-140.595] (-149.432) (-145.994) -- 0:02:33
195000 -- (-170.317) [-145.877] (-158.422) (-158.639) * (-160.949) (-147.905) (-143.739) [-147.292] -- 0:02:32
Average standard deviation of split frequencies: 0.020568
196000 -- (-156.086) [-145.575] (-158.342) (-161.965) * (-165.239) (-152.406) [-155.595] (-152.003) -- 0:02:35
197000 -- (-163.026) [-142.265] (-147.431) (-156.600) * (-164.635) [-144.116] (-155.122) (-156.873) -- 0:02:34
198000 -- (-155.985) (-154.718) [-144.880] (-172.969) * (-160.647) [-150.781] (-148.663) (-148.428) -- 0:02:33
199000 -- (-148.319) (-148.027) [-148.681] (-164.145) * (-162.372) (-149.757) [-145.854] (-144.375) -- 0:02:32
200000 -- (-153.545) (-144.921) [-151.693] (-168.788) * (-161.622) [-149.418] (-146.410) (-140.570) -- 0:02:32
Average standard deviation of split frequencies: 0.022066
201000 -- (-162.172) [-143.604] (-148.616) (-164.610) * (-164.893) (-151.214) (-143.345) [-149.728] -- 0:02:35
202000 -- (-163.719) [-140.619] (-146.665) (-166.346) * (-152.242) (-151.630) [-142.476] (-145.327) -- 0:02:34
203000 -- (-160.835) [-144.472] (-148.380) (-164.007) * (-156.764) (-153.127) (-147.623) [-144.087] -- 0:02:33
204000 -- (-161.266) (-154.752) [-147.979] (-153.041) * (-158.187) (-150.036) [-143.488] (-146.740) -- 0:02:32
205000 -- (-162.352) [-148.942] (-145.311) (-163.061) * (-157.902) (-149.732) (-152.465) [-139.305] -- 0:02:31
Average standard deviation of split frequencies: 0.022174
206000 -- (-158.796) [-145.703] (-147.181) (-161.986) * (-155.291) (-148.403) (-150.772) [-140.453] -- 0:02:34
207000 -- (-157.238) [-149.968] (-146.497) (-171.264) * (-154.810) (-147.608) (-156.844) [-145.221] -- 0:02:33
208000 -- (-152.908) (-149.013) [-144.894] (-163.828) * (-165.551) [-145.352] (-156.901) (-141.841) -- 0:02:32
209000 -- (-156.501) [-147.542] (-146.434) (-170.484) * (-153.868) [-146.273] (-160.026) (-147.728) -- 0:02:31
210000 -- (-164.457) (-149.604) [-145.048] (-167.904) * (-154.408) [-148.501] (-151.526) (-143.736) -- 0:02:30
Average standard deviation of split frequencies: 0.020219
211000 -- (-153.695) [-147.049] (-152.553) (-164.115) * (-158.870) (-169.603) (-145.082) [-146.727] -- 0:02:33
212000 -- [-145.772] (-146.280) (-141.532) (-158.019) * (-158.128) (-155.561) [-150.815] (-155.227) -- 0:02:32
213000 -- (-144.286) (-153.439) [-139.894] (-162.614) * (-162.784) (-157.537) (-139.994) [-144.302] -- 0:02:31
214000 -- (-143.999) (-146.044) [-140.859] (-158.353) * (-164.280) (-165.641) (-148.997) [-144.556] -- 0:02:30
215000 -- [-145.065] (-153.073) (-148.299) (-156.949) * (-170.328) (-156.696) [-145.793] (-142.173) -- 0:02:29
Average standard deviation of split frequencies: 0.018137
216000 -- [-141.890] (-145.199) (-142.389) (-167.863) * (-157.066) (-160.800) [-145.967] (-147.764) -- 0:02:28
217000 -- (-159.438) [-154.280] (-146.390) (-163.219) * (-163.435) (-163.966) (-144.892) [-147.298] -- 0:02:31
218000 -- (-157.226) (-147.163) [-148.510] (-169.290) * (-159.743) (-159.626) (-146.350) [-146.367] -- 0:02:30
219000 -- (-161.685) (-149.542) [-146.745] (-162.816) * (-158.400) (-162.138) (-145.810) [-144.128] -- 0:02:29
220000 -- (-160.669) (-144.712) [-146.140] (-159.752) * (-155.041) (-163.607) (-147.166) [-149.780] -- 0:02:28
Average standard deviation of split frequencies: 0.018158
221000 -- (-157.004) (-143.149) [-148.488] (-153.612) * (-160.448) (-161.256) (-147.552) [-140.933] -- 0:02:28
222000 -- (-164.934) (-143.212) [-146.516] (-154.634) * (-165.816) (-152.293) (-148.766) [-145.612] -- 0:02:30
223000 -- (-158.221) (-142.315) [-144.674] (-154.598) * (-152.906) (-157.439) (-152.897) [-143.398] -- 0:02:29
224000 -- (-171.643) (-145.112) [-141.295] (-160.699) * (-156.947) (-158.334) (-144.671) [-145.089] -- 0:02:28
225000 -- (-168.808) [-146.699] (-156.483) (-161.869) * (-157.228) (-159.280) (-145.975) [-144.813] -- 0:02:28
Average standard deviation of split frequencies: 0.017357
226000 -- (-169.137) [-145.334] (-147.552) (-165.982) * (-153.893) (-153.313) [-146.711] (-141.999) -- 0:02:27
227000 -- (-154.301) (-142.710) [-147.995] (-154.610) * (-160.731) (-160.869) [-152.854] (-145.387) -- 0:02:29
228000 -- (-164.481) (-149.431) [-151.357] (-160.936) * (-155.238) (-159.738) (-150.173) [-147.061] -- 0:02:28
229000 -- (-160.422) [-147.175] (-140.237) (-165.232) * (-156.549) (-165.504) (-147.714) [-142.762] -- 0:02:28
230000 -- (-155.461) (-151.965) [-141.792] (-158.391) * (-165.532) (-161.725) (-144.018) [-145.596] -- 0:02:27
Average standard deviation of split frequencies: 0.018612
231000 -- (-158.530) [-149.190] (-143.367) (-159.717) * (-169.123) (-164.729) [-143.531] (-150.531) -- 0:02:26
232000 -- (-162.936) [-142.565] (-147.164) (-168.731) * (-155.038) (-154.883) (-146.614) [-145.684] -- 0:02:28
233000 -- (-162.200) [-145.385] (-143.929) (-149.234) * (-157.396) (-157.762) [-145.331] (-150.529) -- 0:02:28
234000 -- (-167.220) [-144.420] (-151.603) (-142.096) * (-155.546) (-155.727) [-145.979] (-150.603) -- 0:02:27
235000 -- (-159.311) (-145.452) (-152.637) [-152.130] * (-157.444) (-163.339) [-144.987] (-146.849) -- 0:02:26
Average standard deviation of split frequencies: 0.018191
236000 -- (-170.941) (-141.066) (-144.935) [-143.312] * (-158.345) (-158.371) (-150.832) [-144.410] -- 0:02:25
237000 -- (-162.043) (-145.110) [-146.517] (-163.780) * (-161.001) (-162.666) [-146.560] (-151.080) -- 0:02:28
238000 -- (-157.081) [-146.752] (-149.120) (-154.081) * (-157.970) (-166.846) (-150.939) [-147.567] -- 0:02:27
239000 -- (-162.113) (-147.555) [-142.662] (-161.746) * (-157.098) (-165.140) [-146.302] (-152.903) -- 0:02:26
240000 -- (-164.290) (-156.552) [-141.565] (-156.048) * (-159.324) (-155.372) (-143.766) [-146.137] -- 0:02:25
Average standard deviation of split frequencies: 0.018258
241000 -- (-169.435) [-145.246] (-142.682) (-162.717) * (-159.921) (-155.929) [-147.907] (-154.589) -- 0:02:24
242000 -- (-160.905) [-148.854] (-145.721) (-155.899) * (-159.834) (-158.476) (-155.968) [-149.436] -- 0:02:24
243000 -- (-156.381) (-144.633) [-141.211] (-159.986) * (-160.003) (-160.926) [-148.116] (-145.280) -- 0:02:26
244000 -- (-157.185) [-146.484] (-148.231) (-165.210) * (-157.254) (-159.449) (-155.225) [-148.477] -- 0:02:25
245000 -- (-163.892) [-144.774] (-147.334) (-157.651) * (-158.414) (-170.449) (-147.490) [-142.120] -- 0:02:24
Average standard deviation of split frequencies: 0.018205
246000 -- (-158.154) (-142.784) [-148.204] (-163.209) * (-161.591) (-158.559) [-149.242] (-153.494) -- 0:02:24
247000 -- (-162.678) [-140.168] (-159.962) (-152.179) * (-167.004) (-160.634) (-145.641) [-145.564] -- 0:02:23
248000 -- (-160.356) [-147.625] (-143.294) (-154.389) * (-160.486) (-161.009) (-150.683) [-148.136] -- 0:02:25
249000 -- (-162.642) (-144.480) [-144.176] (-145.990) * (-157.743) (-170.561) (-151.127) [-144.479] -- 0:02:24
250000 -- (-162.901) (-147.242) (-144.856) [-149.901] * (-164.527) (-165.251) [-154.967] (-146.866) -- 0:02:24
Average standard deviation of split frequencies: 0.017622
251000 -- (-163.046) [-153.910] (-162.516) (-144.041) * (-162.593) (-163.057) (-139.776) [-153.080] -- 0:02:23
252000 -- (-165.810) [-139.094] (-158.479) (-148.207) * (-161.018) (-156.715) [-146.779] (-146.128) -- 0:02:22
253000 -- (-162.788) [-140.339] (-160.030) (-144.362) * (-163.667) (-165.410) [-149.611] (-144.094) -- 0:02:24
254000 -- (-162.238) [-145.441] (-164.741) (-148.454) * (-169.318) (-168.291) (-151.748) [-145.943] -- 0:02:23
255000 -- (-157.310) [-146.755] (-158.512) (-144.021) * (-163.541) (-164.101) (-145.860) [-143.774] -- 0:02:23
Average standard deviation of split frequencies: 0.017050
256000 -- (-170.759) [-150.385] (-154.155) (-144.913) * (-167.181) (-162.419) (-141.147) [-141.252] -- 0:02:22
257000 -- (-160.678) (-151.112) (-153.183) [-142.013] * (-157.391) (-160.083) (-140.995) [-141.175] -- 0:02:21
258000 -- (-160.594) (-152.713) [-146.700] (-141.819) * (-155.137) (-159.419) (-148.098) [-147.095] -- 0:02:23
259000 -- (-161.398) (-150.369) (-143.634) [-143.980] * (-157.881) (-163.413) (-145.186) [-148.632] -- 0:02:23
260000 -- (-162.421) (-148.409) [-142.847] (-151.034) * (-160.782) (-154.232) [-147.799] (-153.634) -- 0:02:22
Average standard deviation of split frequencies: 0.017549
261000 -- (-156.714) (-150.230) [-148.182] (-152.814) * (-156.074) (-162.472) (-147.137) [-141.755] -- 0:02:21
262000 -- (-157.356) [-148.360] (-150.029) (-158.942) * (-159.556) (-168.661) (-161.518) [-149.904] -- 0:02:20
263000 -- (-154.093) (-151.969) [-151.145] (-153.102) * (-162.313) (-158.770) [-143.559] (-150.653) -- 0:02:22
264000 -- (-163.077) (-156.132) [-144.200] (-149.360) * (-157.222) (-157.092) (-143.590) [-152.223] -- 0:02:22
265000 -- (-153.793) [-150.637] (-149.098) (-154.956) * (-159.897) (-143.228) [-148.257] (-155.833) -- 0:02:21
Average standard deviation of split frequencies: 0.016737
266000 -- (-154.356) (-151.634) [-147.931] (-159.423) * (-163.571) [-144.630] (-144.753) (-158.978) -- 0:02:20
267000 -- (-159.962) (-153.728) [-147.300] (-154.190) * (-163.225) [-145.041] (-145.078) (-161.549) -- 0:02:20
268000 -- (-153.567) [-147.822] (-147.803) (-154.579) * (-161.285) [-145.967] (-151.231) (-167.175) -- 0:02:19
269000 -- (-157.881) (-150.011) [-147.157] (-155.269) * (-165.249) (-145.221) [-148.887] (-160.169) -- 0:02:21
270000 -- (-164.029) (-150.873) (-148.658) [-147.922] * (-158.428) (-139.792) [-142.758] (-160.537) -- 0:02:20
Average standard deviation of split frequencies: 0.017158
271000 -- (-162.854) (-147.356) (-144.868) [-147.515] * (-162.227) (-150.279) [-147.094] (-155.354) -- 0:02:19
272000 -- (-164.499) (-154.657) [-143.455] (-158.406) * (-162.225) (-146.197) [-147.050] (-167.168) -- 0:02:19
273000 -- (-158.761) [-149.085] (-140.825) (-148.929) * (-162.839) [-143.088] (-144.037) (-160.963) -- 0:02:18
274000 -- (-159.292) (-144.067) (-151.659) [-145.743] * (-162.294) (-147.643) [-147.221] (-156.090) -- 0:02:20
275000 -- (-156.324) (-145.435) (-157.280) [-149.998] * (-163.802) (-145.660) [-145.084] (-159.214) -- 0:02:19
Average standard deviation of split frequencies: 0.016258
276000 -- (-164.064) (-150.670) (-143.737) [-144.633] * (-161.134) [-149.231] (-151.842) (-159.450) -- 0:02:19
277000 -- (-156.231) (-148.217) [-147.554] (-149.823) * (-159.072) (-149.768) [-144.399] (-163.098) -- 0:02:18
278000 -- (-158.244) [-142.561] (-142.353) (-144.245) * (-163.921) [-148.938] (-145.981) (-158.590) -- 0:02:17
279000 -- (-160.512) [-148.174] (-147.108) (-141.075) * (-171.573) (-144.412) [-144.368] (-155.437) -- 0:02:19
280000 -- (-159.753) (-148.399) (-150.470) [-144.361] * (-164.238) (-154.520) [-143.240] (-155.475) -- 0:02:18
Average standard deviation of split frequencies: 0.017119
281000 -- (-152.474) (-149.219) (-153.781) [-147.208] * (-158.456) (-144.756) [-147.270] (-149.555) -- 0:02:18
282000 -- (-160.031) [-148.532] (-147.911) (-152.598) * (-158.968) (-147.722) (-145.577) [-142.844] -- 0:02:17
283000 -- (-157.976) (-150.578) [-140.295] (-147.572) * (-167.556) (-152.147) [-148.829] (-152.419) -- 0:02:16
284000 -- (-155.736) (-151.883) [-145.823] (-140.472) * (-154.894) (-149.712) (-150.471) [-144.794] -- 0:02:18
285000 -- (-164.936) (-149.477) [-139.923] (-149.821) * (-163.307) (-152.079) (-148.705) [-137.743] -- 0:02:17
Average standard deviation of split frequencies: 0.016544
286000 -- (-155.765) (-160.478) [-142.851] (-162.656) * (-165.537) (-149.341) [-141.784] (-146.532) -- 0:02:17
287000 -- (-156.292) [-153.585] (-143.368) (-162.630) * (-170.845) (-152.024) [-144.612] (-153.713) -- 0:02:16
288000 -- (-151.335) (-145.257) (-145.498) [-152.084] * (-166.201) [-145.562] (-144.036) (-156.604) -- 0:02:15
289000 -- (-156.147) (-145.258) [-145.891] (-150.329) * (-169.587) (-149.516) [-143.501] (-164.069) -- 0:02:15
290000 -- (-167.508) (-150.452) [-144.737] (-148.169) * (-149.047) (-147.090) [-144.323] (-163.737) -- 0:02:17
Average standard deviation of split frequencies: 0.015871
291000 -- (-158.511) [-144.865] (-151.207) (-151.260) * (-147.194) [-150.997] (-151.378) (-158.493) -- 0:02:16
292000 -- (-161.515) (-150.683) (-148.739) [-145.583] * [-142.442] (-145.632) (-157.251) (-156.941) -- 0:02:15
293000 -- (-161.665) [-147.082] (-149.874) (-147.497) * [-145.529] (-144.832) (-158.915) (-161.316) -- 0:02:15
294000 -- (-169.018) [-144.003] (-147.089) (-156.946) * (-144.363) [-148.168] (-156.816) (-164.467) -- 0:02:14
295000 -- (-159.513) (-149.576) (-143.472) [-142.184] * (-145.519) [-145.903] (-149.959) (-156.174) -- 0:02:16
Average standard deviation of split frequencies: 0.016153
296000 -- (-162.690) [-139.320] (-147.413) (-148.099) * (-151.260) (-144.512) [-149.707] (-157.820) -- 0:02:15
297000 -- (-168.450) (-147.781) [-143.711] (-143.294) * (-155.515) [-147.736] (-151.468) (-160.078) -- 0:02:14
298000 -- (-155.091) (-151.542) [-144.198] (-153.224) * (-156.788) (-141.751) [-149.808] (-167.303) -- 0:02:14
299000 -- (-160.449) [-147.584] (-153.332) (-146.704) * [-139.991] (-152.599) (-144.172) (-159.606) -- 0:02:13
300000 -- (-154.550) [-145.845] (-172.070) (-144.306) * (-149.546) [-144.941] (-148.321) (-160.344) -- 0:02:15
Average standard deviation of split frequencies: 0.016375
301000 -- (-157.871) (-141.321) (-170.807) [-150.653] * (-142.775) (-154.550) [-150.642] (-158.516) -- 0:02:14
302000 -- [-143.398] (-154.205) (-169.982) (-151.088) * (-147.299) (-147.609) [-152.533] (-159.423) -- 0:02:14
303000 -- (-143.864) [-147.248] (-156.742) (-146.850) * [-142.437] (-153.421) (-139.748) (-152.904) -- 0:02:13
304000 -- (-151.674) (-146.958) (-170.880) [-147.765] * [-147.262] (-159.073) (-143.380) (-157.236) -- 0:02:12
305000 -- [-146.389] (-147.726) (-170.441) (-146.561) * [-153.601] (-158.319) (-141.344) (-154.879) -- 0:02:14
Average standard deviation of split frequencies: 0.016946
306000 -- (-144.347) (-151.541) (-174.937) [-143.781] * [-144.524] (-156.033) (-150.281) (-151.729) -- 0:02:13
307000 -- [-145.501] (-145.590) (-172.762) (-151.657) * [-141.770] (-160.505) (-147.038) (-156.519) -- 0:02:13
308000 -- (-144.463) (-148.368) (-173.179) [-142.925] * (-146.641) (-159.310) [-149.666] (-160.408) -- 0:02:12
309000 -- (-151.635) (-143.340) (-159.678) [-142.962] * [-142.172] (-145.661) (-150.746) (-163.436) -- 0:02:11
310000 -- (-147.876) [-141.016] (-162.527) (-146.288) * [-144.089] (-162.374) (-153.208) (-165.434) -- 0:02:13
Average standard deviation of split frequencies: 0.016925
311000 -- (-145.039) (-158.637) (-154.973) [-142.283] * (-143.205) (-160.428) [-148.853] (-159.777) -- 0:02:12
312000 -- (-145.903) (-160.759) (-159.435) [-139.135] * (-151.231) [-147.875] (-150.796) (-165.918) -- 0:02:12
313000 -- (-149.596) (-161.745) (-167.302) [-141.609] * (-144.284) (-158.694) [-147.185] (-166.427) -- 0:02:11
314000 -- [-146.816] (-156.367) (-166.945) (-146.486) * [-151.396] (-167.036) (-150.491) (-167.691) -- 0:02:11
315000 -- [-147.762] (-159.195) (-167.557) (-149.123) * (-146.275) (-160.042) [-151.741] (-161.515) -- 0:02:10
Average standard deviation of split frequencies: 0.017557
316000 -- (-144.178) (-157.621) (-169.401) [-146.846] * (-146.960) (-157.250) [-146.741] (-164.144) -- 0:02:12
317000 -- (-145.382) (-160.632) (-169.345) [-153.854] * (-154.021) (-159.940) [-142.258] (-161.548) -- 0:02:11
318000 -- (-146.924) (-158.404) (-173.920) [-142.646] * [-148.651] (-159.500) (-148.272) (-163.394) -- 0:02:10
319000 -- (-151.900) (-158.546) (-178.550) [-144.598] * [-145.853] (-164.873) (-141.893) (-164.685) -- 0:02:10
320000 -- [-148.677] (-157.589) (-163.265) (-142.743) * [-143.958] (-159.199) (-155.102) (-164.383) -- 0:02:09
Average standard deviation of split frequencies: 0.017019
321000 -- (-149.112) [-152.677] (-171.380) (-144.865) * (-148.720) (-158.330) [-150.185] (-159.301) -- 0:02:11
322000 -- (-147.190) [-144.260] (-174.168) (-148.642) * [-138.518] (-165.636) (-149.523) (-157.240) -- 0:02:10
323000 -- (-148.531) [-147.305] (-165.182) (-157.840) * [-147.231] (-164.772) (-157.524) (-166.065) -- 0:02:09
324000 -- (-154.877) (-147.634) (-166.722) [-139.091] * (-139.821) (-166.327) [-144.225] (-155.064) -- 0:02:09
325000 -- (-149.320) [-138.337] (-165.233) (-144.767) * [-144.495] (-158.490) (-153.629) (-153.973) -- 0:02:08
Average standard deviation of split frequencies: 0.016629
326000 -- (-162.345) [-146.540] (-162.332) (-148.866) * (-152.308) (-159.065) [-155.852] (-159.372) -- 0:02:10
327000 -- (-154.770) (-150.733) [-146.872] (-141.526) * (-145.049) (-158.111) [-150.711] (-158.094) -- 0:02:09
328000 -- (-159.732) (-143.264) [-148.118] (-146.136) * (-146.334) (-164.031) [-144.551] (-163.812) -- 0:02:09
329000 -- (-159.789) (-144.338) (-158.206) [-145.069] * (-140.262) (-153.343) [-145.643] (-158.247) -- 0:02:08
330000 -- (-165.661) [-144.115] (-164.619) (-144.320) * [-146.354] (-158.339) (-144.224) (-160.947) -- 0:02:07
Average standard deviation of split frequencies: 0.016474
331000 -- (-163.373) (-150.039) (-157.678) [-142.745] * (-147.074) (-158.332) [-140.996] (-154.207) -- 0:02:09
332000 -- (-168.958) [-140.798] (-168.366) (-142.730) * (-152.309) (-154.227) [-149.618] (-160.375) -- 0:02:08
333000 -- (-162.072) (-151.280) (-160.410) [-151.872] * (-152.173) [-143.420] (-146.610) (-163.859) -- 0:02:08
334000 -- (-161.353) (-144.432) (-165.583) [-146.710] * (-149.373) (-149.147) [-145.790] (-155.289) -- 0:02:07
335000 -- (-161.415) (-141.792) (-155.705) [-144.182] * [-151.394] (-153.247) (-146.525) (-160.089) -- 0:02:07
Average standard deviation of split frequencies: 0.017483
336000 -- (-168.303) [-143.051] (-154.542) (-151.204) * [-144.964] (-147.090) (-147.963) (-152.787) -- 0:02:06
337000 -- (-168.680) [-146.926] (-161.837) (-154.829) * [-150.240] (-156.335) (-146.354) (-164.649) -- 0:02:07
338000 -- [-153.094] (-144.360) (-164.746) (-153.094) * (-147.872) [-147.746] (-152.104) (-156.159) -- 0:02:07
339000 -- (-151.281) (-154.712) (-161.613) [-151.417] * (-152.155) [-147.166] (-160.329) (-159.793) -- 0:02:06
340000 -- [-144.768] (-150.967) (-165.549) (-141.827) * (-142.189) [-144.615] (-145.145) (-171.155) -- 0:02:06
Average standard deviation of split frequencies: 0.017182
341000 -- (-143.960) (-143.904) (-160.452) [-144.603] * (-145.242) [-143.198] (-151.829) (-158.543) -- 0:02:05
342000 -- (-146.301) (-150.070) (-159.254) [-142.348] * [-141.279] (-149.052) (-160.679) (-159.636) -- 0:02:06
343000 -- (-149.004) (-146.601) (-160.804) [-144.003] * [-149.188] (-147.694) (-152.010) (-153.701) -- 0:02:06
344000 -- (-146.335) [-141.286] (-168.262) (-155.210) * (-154.620) (-148.315) [-150.713] (-158.765) -- 0:02:05
345000 -- (-141.726) [-138.937] (-160.361) (-155.246) * [-153.179] (-144.054) (-164.382) (-150.396) -- 0:02:05
Average standard deviation of split frequencies: 0.015946
346000 -- (-149.852) [-141.325] (-158.309) (-153.003) * [-145.146] (-145.837) (-154.500) (-159.149) -- 0:02:04
347000 -- [-145.009] (-145.130) (-165.241) (-148.601) * (-153.312) [-145.698] (-157.331) (-161.561) -- 0:02:06
348000 -- (-146.440) (-147.780) (-165.313) [-151.423] * (-145.491) [-141.768] (-152.753) (-159.347) -- 0:02:05
349000 -- [-146.041] (-145.377) (-163.287) (-145.911) * [-145.159] (-147.117) (-144.545) (-156.530) -- 0:02:04
350000 -- [-150.142] (-145.410) (-164.453) (-143.433) * [-143.393] (-151.723) (-151.529) (-160.907) -- 0:02:04
Average standard deviation of split frequencies: 0.017153
351000 -- (-151.461) (-150.679) (-156.353) [-154.691] * (-145.424) [-136.943] (-178.099) (-157.630) -- 0:02:03
352000 -- (-150.992) (-144.180) (-159.911) [-148.187] * (-146.844) [-140.202] (-165.360) (-153.590) -- 0:02:05
353000 -- [-147.399] (-145.562) (-164.153) (-146.648) * [-147.867] (-146.130) (-146.269) (-167.708) -- 0:02:04
354000 -- [-145.695] (-143.908) (-159.285) (-151.129) * [-147.791] (-143.766) (-167.765) (-163.071) -- 0:02:04
355000 -- (-148.672) [-144.931] (-154.115) (-159.034) * (-143.295) [-141.148] (-151.181) (-178.064) -- 0:02:03
Average standard deviation of split frequencies: 0.016599
356000 -- (-145.271) [-150.016] (-159.063) (-153.061) * (-151.427) (-142.348) [-144.472] (-162.644) -- 0:02:03
357000 -- [-147.742] (-141.050) (-161.414) (-150.404) * (-146.611) (-143.803) [-145.949] (-173.436) -- 0:02:02
358000 -- (-152.540) [-146.432] (-163.921) (-154.424) * (-152.548) (-142.714) [-145.784] (-160.060) -- 0:02:03
359000 -- (-144.480) [-141.893] (-156.978) (-151.369) * (-152.342) (-146.304) [-143.690] (-162.338) -- 0:02:03
360000 -- (-144.965) [-143.204] (-161.888) (-149.253) * (-164.136) (-144.482) [-142.953] (-163.162) -- 0:02:02
Average standard deviation of split frequencies: 0.016851
361000 -- [-147.626] (-143.320) (-156.183) (-148.787) * (-166.537) (-149.439) [-143.253] (-153.813) -- 0:02:02
362000 -- (-154.441) [-143.374] (-160.500) (-141.923) * (-160.073) (-152.256) [-142.623] (-166.201) -- 0:02:01
363000 -- (-150.886) (-150.152) (-160.446) [-142.372] * (-165.887) (-153.014) [-144.462] (-161.181) -- 0:02:02
364000 -- (-146.687) [-145.961] (-159.019) (-145.574) * (-157.067) (-148.855) [-149.118] (-162.976) -- 0:02:02
365000 -- (-152.340) (-152.805) (-160.930) [-142.400] * (-152.388) (-153.219) [-144.338] (-156.534) -- 0:02:01
Average standard deviation of split frequencies: 0.016422
366000 -- [-143.647] (-144.159) (-154.658) (-158.291) * (-159.509) (-143.618) [-147.091] (-162.199) -- 0:02:01
367000 -- [-143.910] (-155.037) (-152.971) (-152.194) * (-160.291) [-140.421] (-147.805) (-157.940) -- 0:02:00
368000 -- (-145.617) [-146.334] (-157.801) (-153.648) * (-153.653) (-145.251) [-148.309] (-160.110) -- 0:02:01
369000 -- [-150.065] (-144.459) (-155.408) (-149.480) * (-162.806) (-145.760) [-148.866] (-156.965) -- 0:02:01
370000 -- (-149.083) [-145.473] (-161.620) (-145.882) * (-163.215) [-144.166] (-147.407) (-158.772) -- 0:02:00
Average standard deviation of split frequencies: 0.016721
371000 -- (-149.945) (-144.790) (-152.415) [-141.800] * (-156.794) (-147.735) (-145.195) [-140.806] -- 0:02:00
372000 -- [-140.733] (-145.354) (-161.341) (-146.670) * (-153.481) (-141.538) (-160.556) [-147.621] -- 0:01:59
373000 -- (-145.319) [-151.890] (-161.746) (-145.718) * (-161.756) [-140.049] (-146.260) (-169.554) -- 0:02:01
374000 -- (-146.257) [-154.227] (-159.782) (-148.874) * (-164.250) (-146.597) [-147.773] (-153.497) -- 0:02:00
375000 -- (-144.461) (-156.553) (-155.907) [-143.675] * (-154.610) [-143.724] (-150.533) (-160.538) -- 0:02:00
Average standard deviation of split frequencies: 0.016829
376000 -- (-140.684) (-162.535) (-154.781) [-151.052] * (-156.631) [-145.414] (-146.572) (-161.336) -- 0:01:59
377000 -- [-142.462] (-164.213) (-160.278) (-147.764) * (-159.168) [-145.310] (-140.447) (-155.048) -- 0:01:58
378000 -- [-142.835] (-161.672) (-162.746) (-148.303) * (-169.744) [-143.317] (-144.077) (-161.128) -- 0:02:00
379000 -- (-146.309) (-157.970) (-165.813) [-140.174] * (-158.698) (-152.910) [-145.907] (-162.963) -- 0:01:59
380000 -- [-144.541] (-157.164) (-164.544) (-147.966) * (-149.905) [-144.842] (-147.740) (-166.081) -- 0:01:59
Average standard deviation of split frequencies: 0.016289
381000 -- (-149.451) (-157.499) (-147.025) [-151.703] * (-155.667) (-143.496) [-140.746] (-167.890) -- 0:01:58
382000 -- (-148.174) (-159.755) (-148.615) [-143.703] * (-152.683) [-145.701] (-147.426) (-159.595) -- 0:01:58
383000 -- (-150.971) (-158.845) (-157.441) [-141.645] * (-156.884) [-144.887] (-154.348) (-163.982) -- 0:01:57
384000 -- (-153.668) (-159.108) (-169.647) [-151.773] * (-160.733) (-145.729) [-147.411] (-159.499) -- 0:01:58
385000 -- [-148.351] (-159.510) (-159.055) (-154.029) * (-162.284) [-142.145] (-151.558) (-159.752) -- 0:01:58
Average standard deviation of split frequencies: 0.017278
386000 -- (-145.475) (-165.344) (-152.113) [-147.329] * (-161.443) [-147.190] (-145.430) (-161.091) -- 0:01:57
387000 -- (-148.618) (-157.433) (-159.537) [-148.673] * (-165.537) [-145.128] (-150.442) (-161.848) -- 0:01:57
388000 -- (-144.897) (-157.162) (-155.042) [-152.097] * (-152.131) [-146.152] (-155.416) (-156.530) -- 0:01:56
389000 -- (-143.623) (-151.185) (-154.460) [-150.629] * (-157.301) [-150.211] (-149.511) (-161.256) -- 0:01:57
390000 -- (-143.814) (-161.672) (-153.042) [-148.882] * (-159.353) [-148.460] (-150.196) (-165.156) -- 0:01:57
Average standard deviation of split frequencies: 0.016940
391000 -- [-144.584] (-160.482) (-160.900) (-148.515) * (-155.437) (-148.480) [-149.228] (-158.945) -- 0:01:56
392000 -- [-145.953] (-153.865) (-167.867) (-146.249) * (-159.443) [-147.149] (-143.768) (-164.819) -- 0:01:56
393000 -- (-149.825) (-152.893) (-161.851) [-145.251] * (-161.343) (-145.399) [-143.378] (-155.971) -- 0:01:55
394000 -- (-144.038) [-148.377] (-168.159) (-145.451) * [-146.034] (-151.513) (-148.752) (-158.543) -- 0:01:56
395000 -- (-150.123) [-143.763] (-151.528) (-151.547) * (-143.550) (-147.599) [-140.035] (-152.910) -- 0:01:56
Average standard deviation of split frequencies: 0.016666
396000 -- (-148.646) [-140.721] (-158.066) (-144.778) * (-141.410) [-145.082] (-151.996) (-150.410) -- 0:01:55
397000 -- (-151.459) [-145.341] (-158.843) (-155.344) * (-149.542) (-170.794) [-144.038] (-163.734) -- 0:01:55
398000 -- [-150.473] (-150.635) (-167.262) (-162.655) * (-149.688) (-169.286) [-152.827] (-159.497) -- 0:01:54
399000 -- (-145.312) [-145.890] (-158.091) (-159.478) * [-143.446] (-167.980) (-149.178) (-158.226) -- 0:01:55
400000 -- (-149.281) [-144.929] (-157.178) (-157.285) * [-144.765] (-164.894) (-147.876) (-157.893) -- 0:01:55
Average standard deviation of split frequencies: 0.016019
401000 -- (-154.104) [-146.954] (-160.429) (-149.476) * (-148.021) (-161.683) [-150.491] (-163.279) -- 0:01:55
402000 -- (-147.001) [-143.915] (-164.120) (-147.608) * (-141.597) (-166.223) (-154.034) [-145.023] -- 0:01:54
403000 -- [-144.616] (-150.674) (-164.187) (-159.828) * (-143.105) (-164.668) [-153.095] (-155.750) -- 0:01:54
404000 -- [-146.499] (-154.076) (-163.819) (-162.149) * [-148.589] (-153.198) (-148.245) (-158.009) -- 0:01:53
405000 -- [-142.599] (-144.009) (-157.648) (-164.523) * (-152.917) (-157.427) [-147.973] (-154.268) -- 0:01:54
Average standard deviation of split frequencies: 0.016747
406000 -- [-142.818] (-150.916) (-159.733) (-166.670) * (-149.322) (-161.678) [-148.197] (-153.156) -- 0:01:54
407000 -- [-143.620] (-142.453) (-158.403) (-166.188) * [-149.338] (-158.309) (-150.725) (-152.717) -- 0:01:53
408000 -- (-145.303) [-141.156] (-159.522) (-166.781) * [-148.444] (-162.056) (-143.568) (-162.318) -- 0:01:53
409000 -- (-143.158) [-146.314] (-153.375) (-164.314) * [-143.727] (-154.379) (-138.828) (-159.644) -- 0:01:52
410000 -- (-152.812) [-145.512] (-158.496) (-159.705) * [-148.019] (-160.279) (-150.544) (-155.415) -- 0:01:53
Average standard deviation of split frequencies: 0.016600
411000 -- [-141.916] (-144.042) (-164.953) (-162.709) * (-142.758) (-160.127) [-145.461] (-155.309) -- 0:01:53
412000 -- [-148.122] (-144.443) (-163.858) (-167.061) * [-141.291] (-165.298) (-145.214) (-167.572) -- 0:01:52
413000 -- [-139.307] (-142.968) (-158.641) (-167.414) * (-153.031) (-156.908) [-139.562] (-165.300) -- 0:01:52
414000 -- (-143.725) (-149.243) [-146.418] (-158.338) * (-148.124) (-161.544) [-142.633] (-157.056) -- 0:01:51
415000 -- (-151.255) [-139.784] (-148.519) (-161.532) * (-145.055) (-153.840) [-138.961] (-154.116) -- 0:01:52
Average standard deviation of split frequencies: 0.016736
416000 -- (-159.897) (-146.958) [-150.675] (-163.501) * (-148.878) (-167.706) [-141.620] (-155.344) -- 0:01:52
417000 -- (-171.374) [-141.885] (-148.142) (-165.317) * [-144.254] (-156.988) (-152.216) (-158.889) -- 0:01:51
418000 -- (-162.115) [-145.763] (-148.389) (-162.649) * [-148.397] (-155.819) (-151.240) (-156.191) -- 0:01:51
419000 -- (-149.597) [-139.545] (-151.531) (-157.429) * [-142.737] (-161.367) (-151.732) (-153.153) -- 0:01:50
420000 -- (-145.394) (-151.137) [-145.199] (-152.955) * [-146.459] (-157.851) (-144.446) (-157.959) -- 0:01:51
Average standard deviation of split frequencies: 0.016723
421000 -- [-148.887] (-145.820) (-145.270) (-158.629) * [-144.949] (-148.644) (-148.639) (-161.265) -- 0:01:51
422000 -- (-146.046) [-142.525] (-146.710) (-165.831) * [-141.476] (-162.081) (-152.370) (-163.610) -- 0:01:50
423000 -- [-149.758] (-160.272) (-146.098) (-159.111) * (-146.410) (-148.663) [-146.952] (-158.975) -- 0:01:50
424000 -- (-146.299) (-161.011) [-145.034] (-163.723) * (-143.712) (-153.372) [-151.544] (-159.961) -- 0:01:50
425000 -- (-150.778) [-149.362] (-152.455) (-162.801) * (-142.894) (-150.563) [-145.921] (-157.953) -- 0:01:50
Average standard deviation of split frequencies: 0.016173
426000 -- [-146.333] (-147.452) (-142.807) (-162.433) * (-144.265) (-166.608) [-143.985] (-153.214) -- 0:01:50
427000 -- [-146.373] (-156.385) (-150.501) (-158.428) * (-147.044) (-160.355) (-161.089) [-143.833] -- 0:01:50
428000 -- [-147.460] (-153.978) (-146.436) (-162.967) * [-142.758] (-161.201) (-161.939) (-152.205) -- 0:01:49
429000 -- (-147.213) [-147.606] (-150.678) (-158.752) * (-157.756) (-153.732) (-168.274) [-147.543] -- 0:01:49
430000 -- [-143.390] (-152.866) (-158.333) (-154.621) * (-149.455) (-163.548) (-156.532) [-144.220] -- 0:01:48
Average standard deviation of split frequencies: 0.015368
431000 -- (-157.357) (-149.107) [-145.479] (-159.688) * [-155.095] (-155.340) (-175.820) (-146.507) -- 0:01:49
432000 -- (-148.121) (-147.491) [-146.254] (-159.599) * (-154.463) [-146.110] (-163.195) (-146.293) -- 0:01:49
433000 -- [-147.849] (-148.445) (-155.735) (-160.672) * [-157.418] (-147.840) (-156.449) (-157.493) -- 0:01:48
434000 -- (-146.068) (-157.429) [-138.663] (-161.202) * (-148.484) [-148.724] (-156.787) (-156.839) -- 0:01:48
435000 -- [-146.866] (-147.488) (-144.658) (-157.250) * (-149.438) [-141.371] (-156.281) (-157.006) -- 0:01:47
Average standard deviation of split frequencies: 0.014887
436000 -- [-148.672] (-148.894) (-151.022) (-163.835) * (-146.100) [-145.587] (-154.181) (-168.208) -- 0:01:48
437000 -- (-153.109) [-148.457] (-145.625) (-160.180) * (-150.670) [-148.210] (-157.996) (-163.583) -- 0:01:48
438000 -- (-155.055) (-148.424) [-146.866] (-153.888) * [-147.984] (-155.134) (-152.644) (-155.761) -- 0:01:47
439000 -- (-155.519) (-149.747) [-152.102] (-155.750) * [-151.121] (-156.581) (-159.888) (-158.557) -- 0:01:47
440000 -- (-161.855) (-144.006) [-147.264] (-160.094) * (-154.902) [-143.974] (-163.317) (-159.270) -- 0:01:46
Average standard deviation of split frequencies: 0.015019
441000 -- (-157.831) [-143.558] (-148.101) (-152.543) * (-152.850) [-147.162] (-156.714) (-164.596) -- 0:01:47
442000 -- (-163.589) [-146.220] (-152.114) (-158.962) * [-152.567] (-148.187) (-155.046) (-158.623) -- 0:01:47
443000 -- (-155.319) (-150.066) [-147.850] (-156.823) * (-148.970) (-153.699) (-163.046) [-149.580] -- 0:01:46
444000 -- [-143.889] (-142.603) (-149.687) (-165.078) * [-149.963] (-147.547) (-157.122) (-159.147) -- 0:01:46
445000 -- [-144.821] (-146.077) (-140.128) (-166.514) * [-148.806] (-151.002) (-160.388) (-152.842) -- 0:01:46
Average standard deviation of split frequencies: 0.014716
446000 -- [-148.309] (-145.625) (-166.962) (-154.482) * (-148.896) [-141.356] (-161.942) (-147.723) -- 0:01:46
447000 -- [-138.528] (-138.405) (-161.417) (-151.243) * (-147.072) [-140.927] (-162.028) (-149.497) -- 0:01:46
448000 -- (-148.092) [-144.984] (-160.696) (-165.144) * (-154.945) [-140.481] (-151.197) (-142.000) -- 0:01:45
449000 -- (-148.079) (-145.431) (-170.297) [-150.131] * (-149.191) [-138.880] (-160.280) (-148.658) -- 0:01:45
450000 -- (-148.327) [-157.856] (-166.216) (-145.448) * (-152.851) [-149.452] (-155.240) (-154.320) -- 0:01:45
Average standard deviation of split frequencies: 0.014100
451000 -- (-160.904) (-145.125) (-161.470) [-149.126] * [-151.371] (-158.833) (-158.187) (-145.380) -- 0:01:44
452000 -- (-166.413) (-141.522) (-162.461) [-149.884] * (-151.465) [-141.861] (-161.950) (-143.377) -- 0:01:45
453000 -- (-166.211) [-145.191] (-160.124) (-156.640) * (-148.538) [-147.586] (-156.732) (-149.489) -- 0:01:45
454000 -- (-160.647) (-148.497) (-167.806) [-154.467] * (-151.523) (-156.625) (-156.223) [-141.447] -- 0:01:44
455000 -- (-160.225) (-149.947) (-162.612) [-150.772] * (-151.884) (-162.806) (-166.857) [-144.610] -- 0:01:44
Average standard deviation of split frequencies: 0.013935
456000 -- (-158.437) (-144.936) (-164.407) [-144.133] * (-147.455) (-151.153) (-162.562) [-141.094] -- 0:01:43
457000 -- (-164.033) [-147.163] (-158.860) (-142.017) * [-144.239] (-156.769) (-157.169) (-158.339) -- 0:01:44
458000 -- (-165.500) [-147.060] (-158.128) (-150.298) * [-147.226] (-156.572) (-162.295) (-149.556) -- 0:01:44
459000 -- (-160.938) [-142.342] (-159.376) (-150.293) * [-145.263] (-160.654) (-146.746) (-153.328) -- 0:01:43
460000 -- (-157.022) [-149.216] (-163.430) (-142.833) * [-148.405] (-169.173) (-146.956) (-148.886) -- 0:01:43
Average standard deviation of split frequencies: 0.013385
461000 -- (-157.476) (-150.540) (-164.783) [-147.195] * [-145.833] (-171.551) (-159.871) (-144.075) -- 0:01:42
462000 -- (-158.617) (-149.307) (-158.467) [-148.103] * [-146.778] (-158.243) (-163.284) (-139.559) -- 0:01:43
463000 -- (-156.307) [-145.171] (-162.368) (-145.746) * (-149.590) [-143.599] (-166.924) (-143.404) -- 0:01:43
464000 -- (-154.137) [-148.431] (-159.104) (-140.315) * (-146.593) (-139.751) (-162.411) [-141.261] -- 0:01:42
465000 -- (-161.381) (-151.905) (-159.320) [-140.318] * (-155.017) (-147.074) (-164.498) [-142.604] -- 0:01:42
Average standard deviation of split frequencies: 0.013345
466000 -- (-164.697) [-150.116] (-162.243) (-143.855) * (-160.357) [-141.982] (-165.652) (-144.205) -- 0:01:41
467000 -- (-169.178) [-146.403] (-150.394) (-151.966) * (-159.372) [-150.175] (-160.911) (-148.906) -- 0:01:42
468000 -- (-160.187) (-146.176) (-165.006) [-143.343] * (-165.179) [-146.797] (-155.693) (-155.436) -- 0:01:42
469000 -- (-163.869) [-148.458] (-158.885) (-149.159) * (-162.532) [-140.366] (-155.017) (-148.408) -- 0:01:41
470000 -- (-162.428) (-149.047) (-155.337) [-150.120] * (-157.266) (-145.590) (-151.970) [-146.106] -- 0:01:41
Average standard deviation of split frequencies: 0.013101
471000 -- (-154.463) (-146.562) (-155.822) [-144.565] * (-164.037) [-144.013] (-154.563) (-143.760) -- 0:01:41
472000 -- (-157.971) [-150.787] (-162.783) (-141.297) * (-161.069) [-149.643] (-165.373) (-146.172) -- 0:01:40
473000 -- (-159.258) [-150.627] (-160.108) (-147.774) * (-158.139) [-143.848] (-163.630) (-149.853) -- 0:01:41
474000 -- (-153.638) [-145.671] (-158.650) (-144.252) * (-174.275) [-146.570] (-156.778) (-141.669) -- 0:01:40
475000 -- (-152.904) (-165.737) (-140.355) [-145.315] * (-167.053) (-146.707) (-156.670) [-150.092] -- 0:01:40
Average standard deviation of split frequencies: 0.012914
476000 -- (-158.924) [-147.023] (-154.950) (-149.837) * (-162.460) [-145.599] (-147.258) (-152.716) -- 0:01:40
477000 -- (-159.993) (-138.269) [-152.130] (-150.678) * (-164.863) (-149.228) (-147.105) [-143.289] -- 0:01:39
478000 -- (-157.831) (-146.213) [-146.321] (-154.504) * [-146.846] (-146.031) (-150.188) (-164.483) -- 0:01:40
479000 -- (-164.820) [-147.209] (-146.473) (-144.353) * (-158.121) (-144.878) [-149.689] (-157.536) -- 0:01:40
480000 -- (-160.599) (-140.966) (-151.163) [-146.192] * (-162.554) (-149.645) (-150.940) [-149.630] -- 0:01:39
Average standard deviation of split frequencies: 0.012593
481000 -- (-159.121) [-141.413] (-171.636) (-146.029) * (-161.846) (-142.502) (-144.257) [-143.853] -- 0:01:39
482000 -- (-156.749) (-147.499) (-151.336) [-148.049] * (-160.873) [-142.882] (-149.120) (-141.123) -- 0:01:38
483000 -- (-152.684) (-163.045) (-146.848) [-146.177] * (-159.957) (-149.932) (-145.121) [-140.037] -- 0:01:39
484000 -- (-150.465) (-172.703) (-147.851) [-146.854] * (-154.504) (-149.555) (-143.147) [-143.323] -- 0:01:39
485000 -- (-157.047) (-165.652) [-143.665] (-144.261) * (-155.181) (-143.467) (-155.032) [-146.669] -- 0:01:38
Average standard deviation of split frequencies: 0.012726
486000 -- (-157.806) (-158.829) (-143.932) [-148.422] * (-160.765) (-154.274) (-165.082) [-141.787] -- 0:01:38
487000 -- (-150.300) (-163.762) (-145.532) [-148.572] * (-155.515) [-146.570] (-168.194) (-148.132) -- 0:01:37
488000 -- (-159.942) (-160.239) [-140.404] (-141.283) * (-160.890) [-147.685] (-160.771) (-145.097) -- 0:01:38
489000 -- (-154.053) (-150.246) (-143.855) [-148.633] * (-156.179) [-146.091] (-160.518) (-143.454) -- 0:01:38
490000 -- (-158.906) (-154.359) [-146.271] (-158.485) * (-163.588) [-146.134] (-160.032) (-147.914) -- 0:01:37
Average standard deviation of split frequencies: 0.012912
491000 -- (-161.094) (-157.735) (-145.231) [-145.011] * (-157.711) (-142.086) (-165.991) [-147.341] -- 0:01:37
492000 -- (-161.163) (-151.840) [-143.477] (-147.934) * (-155.770) [-142.408] (-155.963) (-145.336) -- 0:01:37
493000 -- (-166.017) (-159.785) [-141.532] (-145.899) * (-161.767) (-141.790) (-156.804) [-138.058] -- 0:01:37
494000 -- (-169.794) (-160.384) [-144.593] (-144.168) * (-163.561) [-148.026] (-171.824) (-140.844) -- 0:01:37
495000 -- (-167.847) (-157.145) [-143.915] (-143.271) * (-162.037) (-151.237) (-164.796) [-145.223] -- 0:01:36
Average standard deviation of split frequencies: 0.012633
496000 -- (-170.344) (-156.349) (-141.105) [-144.845] * (-164.546) [-150.661] (-171.861) (-143.483) -- 0:01:36
497000 -- (-162.628) (-150.362) [-143.510] (-146.615) * (-171.531) (-150.258) (-164.943) [-144.164] -- 0:01:36
498000 -- (-173.141) (-161.898) [-147.995] (-139.223) * (-158.576) (-152.398) (-160.091) [-147.102] -- 0:01:35
499000 -- (-163.356) (-157.409) (-141.277) [-144.614] * (-160.195) (-156.494) (-158.611) [-148.540] -- 0:01:36
500000 -- (-168.740) (-153.076) [-150.123] (-152.016) * (-155.581) (-147.074) (-156.210) [-141.528] -- 0:01:36
Average standard deviation of split frequencies: 0.012316
501000 -- (-170.047) (-148.839) [-146.076] (-148.115) * (-156.704) [-148.268] (-158.713) (-145.671) -- 0:01:35
502000 -- (-159.525) (-157.291) [-143.181] (-144.984) * (-153.664) (-144.391) (-164.430) [-143.598] -- 0:01:35
503000 -- (-168.404) (-162.103) (-145.510) [-147.109] * (-162.052) [-145.440] (-157.534) (-140.116) -- 0:01:34
504000 -- (-170.123) (-157.237) [-144.217] (-144.900) * (-163.810) (-146.690) (-156.105) [-145.765] -- 0:01:35
505000 -- (-163.126) (-162.357) [-143.134] (-142.075) * (-155.376) (-152.085) (-160.069) [-153.810] -- 0:01:35
Average standard deviation of split frequencies: 0.012223
506000 -- (-152.728) (-165.889) (-142.024) [-149.413] * (-164.149) (-158.169) (-160.413) [-146.000] -- 0:01:34
507000 -- (-168.446) (-157.180) (-144.942) [-142.615] * (-157.210) [-151.355] (-153.151) (-147.940) -- 0:01:34
508000 -- (-162.706) (-159.474) (-148.735) [-144.944] * (-161.547) (-152.476) [-147.562] (-142.259) -- 0:01:33
509000 -- (-154.505) (-162.423) [-146.039] (-144.520) * (-152.502) (-145.462) [-144.188] (-141.793) -- 0:01:34
510000 -- (-156.731) (-154.349) (-146.935) [-138.960] * (-168.488) (-152.834) (-148.833) [-141.676] -- 0:01:34
Average standard deviation of split frequencies: 0.012462
511000 -- (-166.431) (-160.142) (-149.508) [-141.030] * (-158.599) (-154.391) (-148.487) [-142.496] -- 0:01:33
512000 -- (-162.171) (-160.204) [-151.974] (-147.627) * (-159.216) (-150.206) (-146.027) [-149.180] -- 0:01:33
513000 -- (-174.526) (-146.908) (-147.847) [-151.424] * (-167.020) [-149.893] (-154.845) (-139.491) -- 0:01:33
514000 -- (-162.138) (-144.884) (-147.278) [-139.785] * (-160.693) (-149.236) [-143.503] (-146.615) -- 0:01:33
515000 -- (-157.623) [-141.197] (-148.435) (-148.281) * (-165.441) (-161.865) [-148.301] (-147.022) -- 0:01:33
Average standard deviation of split frequencies: 0.011139
516000 -- (-164.307) [-143.463] (-151.221) (-151.931) * (-160.306) (-156.291) [-146.540] (-140.654) -- 0:01:32
517000 -- (-168.027) (-146.107) (-154.861) [-145.074] * (-160.460) (-162.395) (-151.613) [-144.473] -- 0:01:32
518000 -- (-157.513) [-137.738] (-163.132) (-144.094) * (-161.073) (-161.748) [-151.344] (-144.944) -- 0:01:32
519000 -- (-162.658) [-149.670] (-158.766) (-149.530) * (-160.362) (-158.251) (-155.241) [-147.769] -- 0:01:32
520000 -- (-161.561) (-151.496) (-153.922) [-144.354] * (-161.716) [-153.424] (-150.645) (-148.206) -- 0:01:32
Average standard deviation of split frequencies: 0.011372
521000 -- (-151.630) (-148.813) (-158.314) [-145.619] * (-164.403) [-145.302] (-147.614) (-148.437) -- 0:01:31
522000 -- (-155.299) [-144.735] (-162.422) (-146.165) * (-164.397) (-148.895) [-146.274] (-153.024) -- 0:01:31
523000 -- (-163.573) [-145.936] (-155.485) (-139.776) * (-163.276) (-147.968) [-141.733] (-150.421) -- 0:01:31
524000 -- (-159.843) (-143.309) (-156.521) [-142.099] * (-157.604) (-145.664) (-146.404) [-147.046] -- 0:01:31
525000 -- (-164.778) [-146.854] (-158.953) (-146.775) * (-157.094) [-147.253] (-147.998) (-149.369) -- 0:01:31
Average standard deviation of split frequencies: 0.011478
526000 -- (-157.899) [-142.305] (-168.196) (-144.915) * (-161.024) [-146.277] (-148.494) (-157.676) -- 0:01:31
527000 -- (-158.435) (-152.868) (-160.408) [-144.663] * (-159.226) (-147.921) [-144.513] (-161.152) -- 0:01:30
528000 -- (-159.246) [-143.788] (-167.177) (-147.658) * (-154.616) (-145.284) [-144.784] (-147.000) -- 0:01:30
529000 -- (-158.979) [-149.604] (-162.957) (-147.751) * (-154.834) [-146.130] (-143.348) (-163.838) -- 0:01:30
530000 -- (-159.050) [-147.097] (-161.351) (-155.453) * (-158.000) [-145.933] (-146.550) (-162.640) -- 0:01:30
Average standard deviation of split frequencies: 0.010797
531000 -- (-157.161) [-141.037] (-159.010) (-153.152) * (-154.663) (-147.049) [-142.512] (-162.644) -- 0:01:30
532000 -- (-170.613) (-142.005) (-155.490) [-144.475] * (-159.599) (-152.381) [-142.343] (-150.019) -- 0:01:29
533000 -- (-172.282) [-144.842] (-164.821) (-143.571) * (-155.810) (-148.499) [-140.718] (-156.309) -- 0:01:29
534000 -- (-166.797) (-147.824) (-165.196) [-152.757] * (-145.504) (-150.501) [-147.076] (-158.784) -- 0:01:29
535000 -- (-155.312) [-139.469] (-159.273) (-146.881) * (-144.866) [-146.109] (-146.267) (-164.482) -- 0:01:29
Average standard deviation of split frequencies: 0.010351
536000 -- (-162.965) (-143.434) (-162.471) [-152.560] * (-149.258) (-150.896) [-148.540] (-162.578) -- 0:01:29
537000 -- (-154.743) [-140.068] (-163.021) (-139.207) * (-151.042) (-150.342) [-145.827] (-160.712) -- 0:01:28
538000 -- (-154.727) (-143.189) (-159.202) [-141.777] * [-148.491] (-146.771) (-147.453) (-161.123) -- 0:01:28
539000 -- (-164.594) [-147.363] (-159.851) (-150.405) * [-145.495] (-144.028) (-156.162) (-157.964) -- 0:01:28
540000 -- (-162.484) (-147.115) (-164.033) [-143.939] * [-141.871] (-145.998) (-164.385) (-161.043) -- 0:01:28
Average standard deviation of split frequencies: 0.010295
541000 -- (-160.018) [-141.804] (-162.447) (-144.027) * (-147.225) [-144.106] (-164.851) (-157.685) -- 0:01:28
542000 -- (-166.810) [-145.852] (-160.951) (-146.215) * [-143.382] (-142.747) (-155.281) (-161.655) -- 0:01:27
543000 -- (-175.830) [-145.628] (-163.139) (-144.292) * [-140.034] (-157.087) (-159.388) (-149.552) -- 0:01:27
544000 -- (-161.334) [-145.303] (-154.750) (-153.117) * [-144.814] (-147.471) (-158.833) (-156.836) -- 0:01:27
545000 -- (-169.458) [-145.214] (-155.401) (-143.205) * (-145.129) [-144.436] (-154.465) (-163.802) -- 0:01:27
Average standard deviation of split frequencies: 0.009829
546000 -- (-161.018) (-144.530) (-158.913) [-145.609] * [-144.418] (-142.652) (-162.970) (-152.096) -- 0:01:27
547000 -- (-163.434) (-158.097) (-156.585) [-145.805] * (-149.595) [-150.245] (-157.794) (-158.491) -- 0:01:26
548000 -- (-158.913) (-147.584) (-157.061) [-142.740] * (-144.236) [-151.936] (-153.548) (-168.041) -- 0:01:26
549000 -- (-155.358) [-143.856] (-162.857) (-143.429) * [-145.403] (-143.674) (-160.843) (-160.550) -- 0:01:26
550000 -- (-156.090) [-147.217] (-164.806) (-151.251) * (-140.937) [-143.097] (-165.210) (-156.565) -- 0:01:26
Average standard deviation of split frequencies: 0.009581
551000 -- (-166.158) (-144.909) (-158.847) [-151.077] * [-148.913] (-146.291) (-145.141) (-161.812) -- 0:01:26
552000 -- (-164.462) [-151.125] (-159.968) (-158.130) * [-140.335] (-142.720) (-161.756) (-157.326) -- 0:01:26
553000 -- (-158.225) [-140.900] (-153.732) (-157.643) * [-146.071] (-149.403) (-153.119) (-163.236) -- 0:01:25
554000 -- (-163.133) [-157.418] (-144.360) (-161.472) * (-153.810) [-143.193] (-154.041) (-165.470) -- 0:01:25
555000 -- (-161.940) [-149.665] (-143.936) (-166.698) * (-151.059) [-140.195] (-145.815) (-159.762) -- 0:01:25
Average standard deviation of split frequencies: 0.009652
556000 -- (-160.590) [-141.276] (-153.833) (-161.008) * (-151.764) [-149.009] (-146.307) (-159.253) -- 0:01:25
557000 -- (-170.925) [-140.102] (-151.693) (-159.249) * (-165.375) [-151.572] (-156.038) (-162.437) -- 0:01:25
558000 -- (-165.050) [-139.804] (-150.610) (-159.239) * (-163.196) [-147.552] (-143.249) (-155.514) -- 0:01:24
559000 -- (-161.154) (-149.298) [-148.507] (-171.659) * (-164.270) (-152.946) [-147.138] (-164.165) -- 0:01:24
560000 -- (-156.369) (-141.706) [-147.690] (-161.610) * (-176.236) (-143.865) (-141.755) [-143.441] -- 0:01:24
Average standard deviation of split frequencies: 0.009518
561000 -- (-157.454) (-142.902) [-143.919] (-162.406) * (-169.715) (-163.198) [-148.290] (-154.562) -- 0:01:24
562000 -- [-146.725] (-158.613) (-151.131) (-155.756) * (-164.848) (-145.514) [-142.812] (-150.112) -- 0:01:24
563000 -- [-152.232] (-143.641) (-149.511) (-163.190) * (-168.482) (-145.037) (-144.795) [-143.025] -- 0:01:23
564000 -- [-143.512] (-148.851) (-166.206) (-158.554) * (-160.883) (-144.754) (-143.817) [-144.960] -- 0:01:23
565000 -- (-147.400) (-154.282) [-143.723] (-157.350) * (-165.230) (-148.532) [-143.239] (-148.822) -- 0:01:23
Average standard deviation of split frequencies: 0.009065
566000 -- [-145.686] (-158.017) (-152.486) (-166.036) * (-167.292) (-145.427) [-144.224] (-145.548) -- 0:01:23
567000 -- (-150.407) (-155.347) [-144.787] (-162.453) * (-166.322) [-139.734] (-143.182) (-143.477) -- 0:01:23
568000 -- [-149.620] (-165.805) (-148.163) (-164.189) * (-157.611) [-143.807] (-149.079) (-149.837) -- 0:01:22
569000 -- (-157.095) (-162.256) [-148.860] (-166.200) * (-159.719) (-141.194) [-145.695] (-147.080) -- 0:01:22
570000 -- [-147.507] (-161.966) (-155.966) (-147.670) * (-162.339) (-154.566) [-149.141] (-159.131) -- 0:01:22
Average standard deviation of split frequencies: 0.008811
571000 -- (-148.134) (-169.158) [-151.256] (-145.595) * (-166.214) (-144.638) [-146.779] (-160.291) -- 0:01:22
572000 -- (-152.460) (-157.105) (-156.544) [-149.192] * (-160.335) (-146.389) [-147.207] (-164.312) -- 0:01:22
573000 -- (-149.832) (-152.929) [-149.606] (-149.569) * (-154.359) (-150.643) [-152.578] (-164.481) -- 0:01:21
574000 -- [-146.893] (-160.335) (-153.682) (-154.134) * (-162.426) [-151.041] (-145.456) (-161.327) -- 0:01:21
575000 -- (-149.484) (-158.851) [-143.944] (-159.351) * (-160.066) [-148.364] (-145.942) (-161.592) -- 0:01:21
Average standard deviation of split frequencies: 0.008806
576000 -- (-144.146) (-158.378) [-149.560] (-156.044) * (-155.005) [-144.613] (-142.630) (-159.447) -- 0:01:21
577000 -- (-147.441) (-164.033) [-144.467] (-156.906) * (-154.937) (-144.742) [-142.765] (-160.767) -- 0:01:21
578000 -- (-151.248) (-163.348) [-140.601] (-156.819) * (-165.772) [-146.023] (-142.154) (-157.499) -- 0:01:21
579000 -- [-143.099] (-160.915) (-155.226) (-161.860) * [-141.407] (-151.978) (-137.556) (-156.971) -- 0:01:20
580000 -- (-152.892) (-153.472) [-140.389] (-165.442) * (-147.491) (-156.013) [-150.255] (-154.625) -- 0:01:20
Average standard deviation of split frequencies: 0.009235
581000 -- (-142.547) (-167.464) [-144.042] (-153.286) * [-142.191] (-143.766) (-154.149) (-163.360) -- 0:01:20
582000 -- (-148.072) (-159.380) [-145.073] (-158.497) * [-143.094] (-143.045) (-144.162) (-160.513) -- 0:01:20
583000 -- [-146.272] (-174.248) (-145.642) (-168.772) * (-146.385) [-144.990] (-145.191) (-164.791) -- 0:01:20
584000 -- [-148.662] (-156.959) (-143.075) (-156.835) * (-149.817) [-152.596] (-149.614) (-163.065) -- 0:01:19
585000 -- (-141.500) (-145.969) [-141.404] (-163.480) * (-165.307) [-150.675] (-146.910) (-174.095) -- 0:01:19
Average standard deviation of split frequencies: 0.008681
586000 -- [-145.322] (-153.069) (-142.549) (-161.408) * (-152.431) (-144.280) [-148.234] (-164.450) -- 0:01:19
587000 -- (-149.550) (-145.218) [-143.885] (-152.690) * (-158.705) (-147.558) [-142.968] (-164.580) -- 0:01:19
588000 -- (-146.957) (-147.845) [-144.187] (-158.212) * (-164.636) [-153.229] (-152.413) (-160.667) -- 0:01:19
589000 -- (-149.877) [-148.492] (-150.061) (-156.573) * (-164.610) [-137.726] (-152.820) (-164.076) -- 0:01:18
590000 -- [-144.702] (-158.766) (-150.947) (-154.533) * (-172.970) (-143.448) [-144.558] (-164.509) -- 0:01:18
Average standard deviation of split frequencies: 0.008646
591000 -- [-140.354] (-158.847) (-152.035) (-157.281) * (-150.438) (-148.197) [-145.671] (-159.311) -- 0:01:18
592000 -- [-142.746] (-160.455) (-147.240) (-158.461) * [-143.879] (-146.242) (-155.361) (-171.760) -- 0:01:18
593000 -- (-143.895) (-159.509) [-150.902] (-144.352) * [-151.928] (-147.762) (-160.768) (-156.059) -- 0:01:18
594000 -- (-151.242) (-165.944) [-144.323] (-152.625) * [-148.104] (-145.989) (-169.965) (-156.775) -- 0:01:17
595000 -- (-142.813) (-167.275) [-149.510] (-151.067) * [-146.764] (-149.570) (-154.499) (-163.701) -- 0:01:17
Average standard deviation of split frequencies: 0.008931
596000 -- (-155.055) (-157.441) [-141.259] (-162.037) * (-147.966) [-147.823] (-152.944) (-158.995) -- 0:01:17
597000 -- [-156.203] (-154.082) (-145.316) (-151.547) * (-151.919) [-140.721] (-159.649) (-157.380) -- 0:01:17
598000 -- (-150.199) (-157.235) [-141.387] (-156.138) * [-144.011] (-148.170) (-162.212) (-155.874) -- 0:01:17
599000 -- (-144.364) (-160.813) [-142.109] (-150.480) * (-144.599) [-150.830] (-157.960) (-161.469) -- 0:01:16
600000 -- (-140.740) (-157.561) [-150.737] (-167.106) * (-144.336) [-148.683] (-154.403) (-156.229) -- 0:01:16
Average standard deviation of split frequencies: 0.009254
601000 -- [-142.830] (-152.610) (-147.583) (-155.956) * (-147.806) (-150.472) [-152.421] (-159.694) -- 0:01:16
602000 -- [-144.977] (-172.520) (-148.033) (-162.049) * (-150.079) (-157.989) [-141.683] (-159.602) -- 0:01:16
603000 -- (-147.808) (-149.457) [-141.508] (-151.183) * (-156.880) (-161.951) [-144.197] (-158.842) -- 0:01:16
604000 -- [-140.368] (-150.393) (-143.599) (-160.267) * (-147.961) (-162.487) [-142.178] (-163.978) -- 0:01:16
605000 -- [-142.094] (-144.660) (-149.577) (-158.239) * [-148.208] (-159.975) (-147.652) (-170.387) -- 0:01:15
Average standard deviation of split frequencies: 0.008492
606000 -- [-145.884] (-147.698) (-140.442) (-157.000) * (-151.001) (-162.370) [-145.669] (-166.385) -- 0:01:15
607000 -- [-147.478] (-149.648) (-140.187) (-153.801) * [-148.394] (-167.142) (-142.007) (-143.512) -- 0:01:15
608000 -- (-143.842) [-138.507] (-143.251) (-158.431) * (-149.862) (-167.041) (-149.571) [-148.088] -- 0:01:15
609000 -- [-145.679] (-145.506) (-147.854) (-158.798) * (-145.563) (-157.726) (-157.018) [-157.870] -- 0:01:15
610000 -- [-149.804] (-143.363) (-153.242) (-157.287) * [-146.449] (-160.617) (-160.320) (-144.400) -- 0:01:14
Average standard deviation of split frequencies: 0.008105
611000 -- (-146.306) [-143.072] (-141.442) (-156.181) * (-156.762) [-148.098] (-158.510) (-146.886) -- 0:01:14
612000 -- [-145.247] (-140.582) (-156.748) (-151.818) * [-143.523] (-156.107) (-159.454) (-154.251) -- 0:01:14
613000 -- (-164.482) (-144.389) [-143.338] (-159.975) * [-147.940] (-155.492) (-160.227) (-147.123) -- 0:01:14
614000 -- (-161.566) [-150.638] (-146.448) (-160.529) * (-144.316) [-150.930] (-157.584) (-141.554) -- 0:01:14
615000 -- (-168.463) [-149.924] (-146.405) (-156.489) * (-154.165) (-144.107) (-158.278) [-141.023] -- 0:01:13
Average standard deviation of split frequencies: 0.008259
616000 -- (-163.034) [-147.998] (-146.801) (-157.550) * (-157.318) (-153.394) (-163.563) [-144.735] -- 0:01:13
617000 -- (-157.535) (-147.756) [-142.148] (-157.909) * (-144.826) (-157.585) (-157.989) [-150.947] -- 0:01:13
618000 -- (-159.794) (-148.664) [-145.564] (-144.164) * [-143.006] (-146.119) (-160.988) (-165.566) -- 0:01:13
619000 -- (-154.544) [-146.597] (-141.945) (-148.900) * (-143.220) [-146.558] (-159.703) (-151.366) -- 0:01:13
620000 -- (-161.097) (-146.700) (-145.651) [-143.506] * [-139.163] (-144.613) (-155.978) (-153.948) -- 0:01:12
Average standard deviation of split frequencies: 0.008133
621000 -- (-155.091) (-147.893) (-148.711) [-143.236] * [-142.070] (-152.754) (-161.225) (-164.279) -- 0:01:12
622000 -- (-160.883) (-146.374) (-149.211) [-145.998] * (-144.393) [-148.160] (-158.954) (-148.821) -- 0:01:12
623000 -- (-152.771) [-144.786] (-154.959) (-148.633) * (-153.565) [-148.247] (-168.204) (-150.535) -- 0:01:12
624000 -- (-159.762) (-147.760) (-146.392) [-145.275] * [-145.485] (-149.901) (-156.049) (-154.194) -- 0:01:12
625000 -- (-164.813) (-152.362) [-147.107] (-147.748) * [-149.131] (-151.928) (-166.586) (-158.458) -- 0:01:12
Average standard deviation of split frequencies: 0.008103
626000 -- (-167.629) (-140.026) (-151.322) [-144.801] * (-147.661) [-144.152] (-153.198) (-150.314) -- 0:01:11
627000 -- (-157.532) (-143.324) (-143.799) [-141.166] * [-147.574] (-145.151) (-154.757) (-155.972) -- 0:01:11
628000 -- (-159.341) [-142.415] (-144.355) (-152.532) * (-145.085) [-142.804] (-150.295) (-159.848) -- 0:01:11
629000 -- (-160.694) [-141.172] (-148.493) (-152.322) * [-146.416] (-145.694) (-163.043) (-161.453) -- 0:01:11
630000 -- (-160.563) [-143.554] (-143.491) (-153.197) * (-150.920) [-144.360] (-153.185) (-164.099) -- 0:01:11
Average standard deviation of split frequencies: 0.008162
631000 -- (-156.388) (-149.883) [-145.312] (-151.985) * [-143.431] (-153.145) (-162.607) (-158.353) -- 0:01:10
632000 -- (-163.138) [-142.608] (-149.706) (-162.017) * (-145.434) [-151.417] (-165.273) (-158.662) -- 0:01:10
633000 -- (-153.054) (-149.268) [-142.258] (-164.731) * [-141.936] (-150.137) (-151.133) (-159.941) -- 0:01:10
634000 -- (-160.648) [-142.911] (-144.937) (-147.622) * [-151.631] (-151.285) (-154.464) (-166.703) -- 0:01:10
635000 -- (-155.845) [-149.864] (-145.958) (-158.853) * [-140.026] (-157.421) (-157.753) (-154.393) -- 0:01:10
Average standard deviation of split frequencies: 0.007709
636000 -- (-166.226) [-141.722] (-144.280) (-152.580) * (-146.155) (-149.761) (-164.255) [-149.845] -- 0:01:09
637000 -- (-157.298) (-149.180) [-143.792] (-165.380) * (-145.694) (-142.829) (-164.315) [-147.267] -- 0:01:09
638000 -- (-163.470) [-144.546] (-145.155) (-158.631) * [-146.215] (-146.501) (-159.806) (-157.534) -- 0:01:09
639000 -- (-156.595) (-148.885) [-150.608] (-157.487) * (-146.656) (-150.486) (-152.243) [-148.067] -- 0:01:09
640000 -- (-160.059) [-142.817] (-146.711) (-157.785) * (-152.977) [-147.994] (-158.414) (-170.227) -- 0:01:09
Average standard deviation of split frequencies: 0.007389
641000 -- (-156.068) (-145.886) [-145.800] (-161.150) * [-144.795] (-149.712) (-155.581) (-161.146) -- 0:01:08
642000 -- (-158.816) (-145.200) [-149.856] (-158.276) * [-145.538] (-156.834) (-150.187) (-157.556) -- 0:01:08
643000 -- (-160.595) (-143.897) [-150.622] (-151.812) * [-147.389] (-143.147) (-155.417) (-162.096) -- 0:01:08
644000 -- (-162.610) [-142.095] (-152.256) (-158.975) * (-152.683) [-145.070] (-151.624) (-156.550) -- 0:01:08
645000 -- (-157.213) [-143.673] (-140.882) (-156.748) * [-142.302] (-145.791) (-148.135) (-159.946) -- 0:01:08
Average standard deviation of split frequencies: 0.007073
646000 -- (-158.634) [-143.350] (-148.971) (-162.195) * (-146.388) (-148.691) [-143.261] (-161.151) -- 0:01:07
647000 -- (-163.537) [-143.657] (-147.975) (-157.009) * [-151.087] (-144.334) (-151.222) (-161.560) -- 0:01:07
648000 -- (-156.416) [-149.361] (-143.185) (-154.628) * (-144.257) (-146.385) [-149.947] (-161.394) -- 0:01:07
649000 -- (-159.992) (-152.279) [-142.590] (-148.980) * [-142.930] (-149.562) (-148.119) (-156.274) -- 0:01:07
650000 -- (-167.062) (-147.684) [-147.084] (-155.998) * [-147.535] (-144.870) (-145.676) (-156.668) -- 0:01:07
Average standard deviation of split frequencies: 0.006128
651000 -- (-153.892) [-142.910] (-149.515) (-155.638) * (-148.027) (-152.910) [-146.030] (-158.935) -- 0:01:07
652000 -- (-168.107) [-142.921] (-141.168) (-150.137) * [-143.287] (-148.487) (-169.467) (-157.703) -- 0:01:06
653000 -- (-160.621) (-142.269) [-143.527] (-146.426) * (-142.601) [-152.055] (-162.308) (-164.184) -- 0:01:06
654000 -- (-164.433) [-150.601] (-156.364) (-144.398) * [-143.790] (-145.036) (-151.181) (-161.615) -- 0:01:06
655000 -- (-155.158) (-152.129) [-141.370] (-150.490) * [-143.612] (-151.614) (-157.485) (-152.413) -- 0:01:06
Average standard deviation of split frequencies: 0.005749
656000 -- (-161.067) (-149.245) [-144.562] (-160.223) * (-142.720) [-144.927] (-158.312) (-160.998) -- 0:01:06
657000 -- (-160.239) (-152.129) [-147.289] (-158.670) * [-147.197] (-160.055) (-159.526) (-154.408) -- 0:01:05
658000 -- (-153.103) (-152.555) (-151.211) [-141.364] * (-150.237) [-153.560] (-169.511) (-161.210) -- 0:01:05
659000 -- (-162.117) [-139.906] (-145.410) (-147.658) * [-146.918] (-151.562) (-148.974) (-157.650) -- 0:01:05
660000 -- (-170.773) (-152.401) [-151.416] (-139.754) * (-155.727) [-160.385] (-155.433) (-158.711) -- 0:01:05
Average standard deviation of split frequencies: 0.006079
661000 -- (-158.770) (-143.709) [-142.204] (-149.066) * (-149.982) (-164.722) [-147.167] (-154.650) -- 0:01:05
662000 -- (-162.627) [-148.863] (-143.768) (-146.466) * (-148.135) (-154.558) [-144.894] (-158.699) -- 0:01:04
663000 -- (-154.775) (-147.802) (-150.829) [-143.565] * (-143.262) (-157.239) [-144.916] (-155.412) -- 0:01:04
664000 -- (-160.161) [-140.767] (-150.962) (-143.169) * [-145.900] (-160.619) (-147.240) (-158.266) -- 0:01:04
665000 -- (-164.183) (-150.635) (-155.323) [-145.716] * [-145.257] (-160.692) (-152.963) (-157.469) -- 0:01:04
Average standard deviation of split frequencies: 0.005747
666000 -- (-158.290) (-145.947) (-164.395) [-141.117] * [-147.753] (-158.038) (-142.866) (-144.528) -- 0:01:04
667000 -- (-158.916) (-149.673) (-156.027) [-142.222] * (-143.683) (-162.978) [-141.090] (-157.015) -- 0:01:03
668000 -- (-154.339) (-145.161) (-167.895) [-140.170] * [-146.243] (-157.008) (-143.868) (-153.620) -- 0:01:03
669000 -- (-148.226) [-149.135] (-158.466) (-146.906) * (-154.430) (-166.670) (-168.951) [-145.988] -- 0:01:03
670000 -- (-148.394) [-153.834] (-154.779) (-161.380) * [-143.875] (-163.997) (-156.816) (-152.470) -- 0:01:03
Average standard deviation of split frequencies: 0.006434
671000 -- (-156.868) (-146.857) (-160.040) [-141.302] * [-148.002] (-162.692) (-173.246) (-146.386) -- 0:01:03
672000 -- (-157.636) (-151.389) (-155.361) [-142.822] * [-151.528] (-159.966) (-158.183) (-143.100) -- 0:01:02
673000 -- (-149.742) (-139.885) (-160.714) [-152.658] * [-144.947] (-143.888) (-159.491) (-144.484) -- 0:01:02
674000 -- (-163.600) [-148.048] (-152.806) (-150.243) * (-145.215) [-142.957] (-157.852) (-151.356) -- 0:01:02
675000 -- (-155.980) [-141.829] (-160.954) (-145.451) * (-144.285) [-144.575] (-158.827) (-157.852) -- 0:01:02
Average standard deviation of split frequencies: 0.007085
676000 -- (-146.767) (-155.798) (-159.241) [-148.469] * (-153.490) [-145.372] (-165.155) (-150.100) -- 0:01:02
677000 -- (-145.821) (-147.358) (-160.980) [-146.085] * (-141.073) (-155.016) (-161.015) [-149.052] -- 0:01:02
678000 -- (-144.870) (-143.107) (-156.325) [-141.015] * (-145.337) (-149.015) (-160.525) [-152.739] -- 0:01:01
679000 -- (-164.239) (-147.337) [-154.067] (-151.719) * [-145.459] (-147.361) (-156.545) (-156.561) -- 0:01:01
680000 -- (-144.977) [-144.595] (-149.398) (-152.417) * (-155.435) [-143.212] (-157.655) (-162.873) -- 0:01:01
Average standard deviation of split frequencies: 0.006649
681000 -- [-146.440] (-145.515) (-146.045) (-163.951) * (-156.094) [-153.363] (-159.493) (-153.268) -- 0:01:01
682000 -- (-147.359) [-144.268] (-148.033) (-153.938) * (-146.887) (-150.112) (-161.723) [-153.608] -- 0:01:01
683000 -- [-145.335] (-143.547) (-143.338) (-156.092) * (-152.605) [-149.756] (-159.976) (-149.419) -- 0:01:00
684000 -- [-144.110] (-144.485) (-150.847) (-166.270) * [-154.713] (-151.598) (-158.859) (-151.660) -- 0:01:00
685000 -- [-150.861] (-154.427) (-154.565) (-155.432) * (-157.162) [-149.219] (-152.359) (-148.461) -- 0:01:00
Average standard deviation of split frequencies: 0.006264
686000 -- [-141.726] (-149.986) (-151.427) (-166.321) * (-162.369) (-140.778) (-153.060) [-141.083] -- 0:01:00
687000 -- [-146.359] (-155.241) (-147.722) (-168.001) * (-155.838) (-148.215) (-157.369) [-147.727] -- 0:01:00
688000 -- [-146.361] (-151.994) (-147.409) (-161.423) * (-163.930) [-140.347] (-154.287) (-146.208) -- 0:00:59
689000 -- [-144.541] (-149.135) (-145.358) (-164.298) * (-159.395) [-140.321] (-165.320) (-144.145) -- 0:00:59
690000 -- (-144.779) (-148.338) [-146.278] (-167.876) * (-154.812) [-144.274] (-161.552) (-154.799) -- 0:00:59
Average standard deviation of split frequencies: 0.006416
691000 -- [-141.606] (-147.987) (-149.217) (-161.013) * (-159.839) [-145.498] (-152.799) (-145.952) -- 0:00:59
692000 -- (-148.171) (-151.230) [-147.973] (-161.546) * (-162.995) [-145.528] (-153.027) (-146.270) -- 0:00:59
693000 -- [-147.635] (-150.956) (-150.815) (-156.341) * (-158.848) [-143.287] (-159.147) (-152.910) -- 0:00:58
694000 -- (-150.993) (-146.256) [-149.562] (-168.184) * (-160.950) [-144.530] (-162.528) (-148.607) -- 0:00:58
695000 -- [-148.636] (-146.163) (-153.393) (-163.485) * (-162.254) (-148.180) (-167.780) [-140.724] -- 0:00:58
Average standard deviation of split frequencies: 0.006123
696000 -- [-143.950] (-149.492) (-144.098) (-160.046) * (-159.811) [-145.733] (-173.801) (-150.602) -- 0:00:58
697000 -- (-150.020) [-143.191] (-150.180) (-161.964) * (-157.426) (-148.257) (-154.736) [-143.816] -- 0:00:58
698000 -- (-163.444) (-152.230) [-147.249] (-162.283) * (-158.560) [-143.787] (-149.478) (-147.226) -- 0:00:57
699000 -- (-155.900) (-146.162) [-145.078] (-163.116) * (-153.364) [-151.745] (-150.069) (-140.044) -- 0:00:57
700000 -- (-158.328) (-148.137) [-143.788] (-160.264) * (-168.360) [-146.542] (-150.864) (-146.247) -- 0:00:57
Average standard deviation of split frequencies: 0.006217
701000 -- (-163.451) (-154.805) [-143.335] (-169.151) * (-167.260) [-138.692] (-151.406) (-147.998) -- 0:00:57
702000 -- (-170.104) (-145.681) [-141.434] (-159.023) * (-162.542) [-150.897] (-140.758) (-152.003) -- 0:00:57
703000 -- (-156.423) [-148.014] (-144.318) (-162.542) * (-154.840) (-146.058) (-159.470) [-143.482] -- 0:00:57
704000 -- (-161.023) [-140.789] (-146.112) (-156.844) * (-160.635) [-142.069] (-157.145) (-149.070) -- 0:00:56
705000 -- (-154.826) [-147.391] (-148.912) (-167.417) * (-157.584) (-142.510) (-162.544) [-144.778] -- 0:00:56
Average standard deviation of split frequencies: 0.006090
706000 -- (-163.394) (-150.217) [-147.307] (-154.800) * (-163.893) [-141.320] (-163.043) (-152.390) -- 0:00:56
707000 -- (-165.815) [-141.457] (-147.970) (-164.191) * [-144.685] (-145.046) (-168.084) (-146.700) -- 0:00:56
708000 -- (-156.669) [-147.029] (-142.604) (-174.126) * [-141.155] (-144.691) (-171.879) (-146.733) -- 0:00:56
709000 -- (-155.692) (-153.210) [-144.113] (-164.413) * (-147.341) (-155.852) (-163.462) [-148.644] -- 0:00:55
710000 -- [-149.227] (-145.913) (-145.461) (-162.329) * [-142.635] (-145.941) (-158.360) (-146.286) -- 0:00:55
Average standard deviation of split frequencies: 0.005970
711000 -- (-148.021) (-145.639) [-147.057] (-155.005) * (-146.162) [-141.311] (-155.707) (-156.045) -- 0:00:55
712000 -- [-140.351] (-145.077) (-148.276) (-161.979) * (-144.886) [-139.157] (-159.414) (-145.044) -- 0:00:55
713000 -- (-148.257) [-140.854] (-151.197) (-164.496) * [-148.489] (-142.718) (-167.213) (-143.953) -- 0:00:55
714000 -- [-144.517] (-150.961) (-158.383) (-162.986) * (-146.461) (-166.711) (-164.700) [-144.499] -- 0:00:54
715000 -- [-147.832] (-147.191) (-152.488) (-163.416) * [-145.349] (-157.764) (-161.807) (-150.758) -- 0:00:54
Average standard deviation of split frequencies: 0.005706
716000 -- (-159.596) [-146.174] (-151.657) (-152.927) * (-152.426) (-145.460) (-166.291) [-143.918] -- 0:00:54
717000 -- (-165.484) [-147.823] (-154.024) (-162.806) * (-148.949) (-159.356) (-168.514) [-147.000] -- 0:00:54
718000 -- (-162.657) [-146.964] (-142.550) (-159.940) * [-147.422] (-145.270) (-157.388) (-149.974) -- 0:00:54
719000 -- (-159.783) [-153.186] (-145.675) (-160.324) * (-154.122) (-162.343) (-160.215) [-144.045] -- 0:00:53
720000 -- (-165.046) [-147.697] (-144.563) (-154.035) * [-141.289] (-151.754) (-164.317) (-148.865) -- 0:00:53
Average standard deviation of split frequencies: 0.005972
721000 -- (-156.361) [-148.801] (-152.374) (-154.589) * [-140.251] (-148.964) (-162.983) (-146.621) -- 0:00:53
722000 -- (-150.569) [-151.502] (-149.180) (-158.870) * (-157.046) [-144.178] (-155.315) (-151.033) -- 0:00:53
723000 -- (-158.536) [-138.654] (-148.522) (-162.524) * [-149.994] (-148.451) (-155.522) (-149.242) -- 0:00:53
724000 -- (-158.819) [-148.469] (-144.780) (-158.920) * [-143.941] (-149.509) (-158.537) (-154.118) -- 0:00:52
725000 -- (-159.148) (-156.086) [-143.883] (-159.094) * (-147.484) (-150.647) (-157.069) [-145.851] -- 0:00:52
Average standard deviation of split frequencies: 0.005817
726000 -- (-160.589) [-143.628] (-147.402) (-156.464) * [-140.956] (-156.964) (-161.802) (-151.539) -- 0:00:52
727000 -- (-152.037) [-141.206] (-146.572) (-163.022) * (-151.272) (-153.980) (-160.195) [-147.764] -- 0:00:52
728000 -- (-159.521) [-148.809] (-150.704) (-173.175) * [-145.902] (-152.581) (-157.897) (-141.316) -- 0:00:52
729000 -- (-167.957) [-145.764] (-147.094) (-160.982) * [-146.542] (-154.145) (-161.034) (-148.954) -- 0:00:52
730000 -- (-162.404) (-153.728) [-142.553] (-150.280) * (-147.559) [-142.943] (-164.970) (-153.663) -- 0:00:51
Average standard deviation of split frequencies: 0.005403
731000 -- (-157.792) (-150.857) [-145.436] (-154.395) * (-143.501) [-148.142] (-159.059) (-149.653) -- 0:00:51
732000 -- (-167.911) (-144.042) [-148.334] (-154.446) * [-145.732] (-144.319) (-162.802) (-148.252) -- 0:00:51
733000 -- (-162.086) (-147.692) [-147.729] (-162.252) * [-140.435] (-147.303) (-155.993) (-152.978) -- 0:00:51
734000 -- (-159.660) [-141.627] (-151.633) (-160.958) * (-141.364) [-143.870] (-161.857) (-159.182) -- 0:00:51
735000 -- (-157.649) [-138.812] (-146.981) (-158.439) * (-143.612) [-147.058] (-164.302) (-159.024) -- 0:00:50
Average standard deviation of split frequencies: 0.005151
736000 -- (-164.177) (-150.699) [-152.993] (-162.396) * (-150.663) [-143.384] (-158.792) (-159.557) -- 0:00:50
737000 -- (-148.625) (-144.563) [-147.814] (-155.888) * (-143.167) [-142.783] (-156.975) (-171.922) -- 0:00:50
738000 -- (-150.066) (-144.990) [-144.287] (-164.828) * [-152.305] (-149.161) (-160.367) (-155.906) -- 0:00:50
739000 -- [-140.884] (-146.885) (-159.851) (-163.400) * [-150.213] (-153.263) (-163.379) (-156.827) -- 0:00:50
740000 -- [-145.157] (-147.594) (-158.130) (-153.022) * (-144.034) (-152.765) (-166.701) [-142.171] -- 0:00:49
Average standard deviation of split frequencies: 0.004800
741000 -- [-144.003] (-146.187) (-157.138) (-158.165) * [-156.418] (-150.958) (-167.857) (-162.610) -- 0:00:49
742000 -- (-150.360) [-146.578] (-162.841) (-165.827) * (-147.092) [-150.299] (-161.216) (-147.852) -- 0:00:49
743000 -- (-143.624) [-147.971] (-154.321) (-167.226) * [-145.255] (-146.968) (-162.480) (-153.452) -- 0:00:49
744000 -- (-154.988) [-145.025] (-160.154) (-163.354) * (-151.792) [-147.037] (-159.565) (-151.670) -- 0:00:49
745000 -- (-150.843) [-143.544] (-161.724) (-167.043) * (-150.160) [-144.305] (-162.528) (-157.796) -- 0:00:48
Average standard deviation of split frequencies: 0.004845
746000 -- (-142.032) (-146.959) [-141.822] (-162.307) * (-147.230) [-147.419] (-159.765) (-160.558) -- 0:00:48
747000 -- (-146.586) [-144.610] (-152.032) (-156.148) * [-146.515] (-154.285) (-166.219) (-155.027) -- 0:00:48
748000 -- [-142.607] (-153.587) (-140.721) (-154.915) * (-147.438) [-149.813] (-161.370) (-169.943) -- 0:00:48
749000 -- (-147.150) [-142.440] (-162.274) (-147.572) * [-141.289] (-153.070) (-156.688) (-152.934) -- 0:00:48
750000 -- (-145.093) [-145.056] (-160.962) (-145.351) * (-145.036) [-143.884] (-160.498) (-163.278) -- 0:00:48
Average standard deviation of split frequencies: 0.004945
751000 -- (-159.732) [-139.185] (-158.118) (-148.214) * (-148.111) [-154.862] (-148.905) (-162.451) -- 0:00:47
752000 -- (-150.682) [-147.255] (-159.284) (-149.988) * [-145.238] (-157.771) (-160.045) (-153.245) -- 0:00:47
753000 -- (-156.367) (-157.365) (-162.328) [-148.538] * [-144.561] (-146.250) (-167.674) (-158.781) -- 0:00:47
754000 -- (-147.316) [-142.404] (-154.278) (-140.836) * [-145.672] (-152.674) (-165.743) (-157.582) -- 0:00:47
755000 -- (-175.420) [-147.447] (-157.577) (-147.852) * [-143.533] (-149.192) (-168.750) (-158.300) -- 0:00:47
Average standard deviation of split frequencies: 0.005118
756000 -- [-137.235] (-148.214) (-164.138) (-152.166) * [-140.680] (-151.930) (-166.248) (-160.775) -- 0:00:46
757000 -- (-150.649) [-145.257] (-163.161) (-148.452) * [-141.845] (-150.353) (-163.214) (-155.772) -- 0:00:46
758000 -- (-145.136) [-146.765] (-165.610) (-145.929) * [-145.147] (-160.509) (-166.060) (-156.026) -- 0:00:46
759000 -- (-144.315) (-148.845) (-169.967) [-145.173] * [-141.568] (-143.082) (-166.648) (-148.445) -- 0:00:46
760000 -- (-153.697) (-144.064) (-160.694) [-147.538] * (-147.401) [-143.653] (-158.732) (-159.644) -- 0:00:46
Average standard deviation of split frequencies: 0.005526
761000 -- (-157.675) (-157.721) [-149.360] (-154.053) * [-142.210] (-157.415) (-164.050) (-154.967) -- 0:00:45
762000 -- (-165.917) [-146.696] (-154.071) (-143.064) * [-143.772] (-153.014) (-159.363) (-143.553) -- 0:00:45
763000 -- (-158.719) (-146.067) [-150.931] (-150.085) * [-143.958] (-148.704) (-165.645) (-152.217) -- 0:00:45
764000 -- (-164.866) [-138.883] (-157.576) (-157.758) * [-147.918] (-140.370) (-163.623) (-155.646) -- 0:00:45
765000 -- [-143.918] (-144.129) (-142.908) (-156.294) * [-155.035] (-144.985) (-174.618) (-162.474) -- 0:00:45
Average standard deviation of split frequencies: 0.005923
766000 -- (-149.455) [-144.257] (-147.523) (-161.785) * [-146.787] (-148.822) (-156.163) (-154.461) -- 0:00:44
767000 -- [-144.340] (-148.046) (-146.848) (-157.289) * (-145.597) [-150.262] (-171.577) (-164.532) -- 0:00:44
768000 -- (-145.247) [-144.915] (-148.419) (-158.819) * [-144.491] (-143.258) (-164.106) (-158.976) -- 0:00:44
769000 -- (-147.844) (-141.803) [-146.556] (-162.463) * (-145.729) (-146.704) [-149.805] (-158.353) -- 0:00:44
770000 -- (-152.797) [-137.350] (-153.362) (-163.082) * [-155.245] (-147.806) (-146.477) (-168.540) -- 0:00:44
Average standard deviation of split frequencies: 0.006295
771000 -- (-164.208) [-142.866] (-144.590) (-167.687) * [-147.503] (-143.159) (-144.388) (-162.441) -- 0:00:43
772000 -- (-158.714) [-154.654] (-153.210) (-170.015) * [-153.274] (-151.561) (-155.936) (-163.435) -- 0:00:43
773000 -- (-163.009) (-147.011) [-144.491] (-168.191) * (-144.528) (-146.304) [-146.110] (-158.992) -- 0:00:43
774000 -- (-150.126) (-154.626) [-147.490] (-163.535) * (-145.892) (-145.552) [-146.041] (-167.218) -- 0:00:43
775000 -- [-140.931] (-162.375) (-144.217) (-165.357) * (-145.306) [-143.968] (-158.269) (-159.075) -- 0:00:43
Average standard deviation of split frequencies: 0.006201
776000 -- (-147.855) (-149.233) [-142.103] (-158.441) * [-142.788] (-143.452) (-144.324) (-154.485) -- 0:00:43
777000 -- (-144.243) [-146.218] (-149.394) (-169.295) * (-146.503) (-147.404) [-153.536] (-156.157) -- 0:00:42
778000 -- (-158.544) [-150.797] (-143.934) (-160.714) * [-148.104] (-150.530) (-152.281) (-155.737) -- 0:00:42
779000 -- [-147.259] (-144.507) (-144.362) (-159.507) * (-154.321) [-150.694] (-157.603) (-162.132) -- 0:00:42
780000 -- (-147.088) (-163.346) [-154.273] (-160.468) * (-152.069) [-139.522] (-154.019) (-161.011) -- 0:00:42
Average standard deviation of split frequencies: 0.005862
781000 -- (-150.581) (-158.640) [-147.548] (-159.140) * [-145.156] (-152.810) (-157.905) (-160.366) -- 0:00:42
782000 -- (-139.960) (-162.270) [-142.370] (-160.027) * [-156.003] (-139.752) (-165.163) (-160.644) -- 0:00:41
783000 -- (-141.558) (-161.288) (-149.499) [-145.644] * (-154.247) [-141.931] (-151.496) (-154.637) -- 0:00:41
784000 -- [-139.618] (-161.623) (-149.965) (-154.519) * (-150.448) [-141.694] (-150.655) (-156.048) -- 0:00:41
785000 -- [-145.838] (-166.788) (-144.599) (-155.244) * (-148.185) [-143.070] (-152.770) (-163.648) -- 0:00:41
Average standard deviation of split frequencies: 0.005823
786000 -- [-140.424] (-170.925) (-145.095) (-144.006) * (-152.581) (-138.670) (-148.535) [-143.060] -- 0:00:41
787000 -- [-146.050] (-160.323) (-168.512) (-148.355) * (-150.503) (-154.470) (-147.932) [-146.308] -- 0:00:40
788000 -- [-143.857] (-156.118) (-166.854) (-146.073) * (-157.099) (-158.318) [-143.472] (-142.759) -- 0:00:40
789000 -- (-144.250) (-162.091) (-166.371) [-139.188] * [-151.005] (-162.857) (-146.594) (-145.163) -- 0:00:40
790000 -- [-151.090] (-151.112) (-155.812) (-142.129) * [-142.079] (-170.678) (-145.396) (-155.358) -- 0:00:40
Average standard deviation of split frequencies: 0.005795
791000 -- (-142.859) (-165.925) (-158.536) [-140.234] * (-146.774) (-169.453) [-147.201] (-151.149) -- 0:00:40
792000 -- [-147.318] (-156.989) (-161.665) (-146.722) * [-144.922] (-164.890) (-151.547) (-156.846) -- 0:00:39
793000 -- (-142.443) (-157.861) (-147.715) [-144.511] * (-170.763) (-163.001) [-147.003] (-146.017) -- 0:00:39
794000 -- [-148.524] (-164.953) (-146.584) (-152.151) * (-158.574) (-163.751) (-146.588) [-144.357] -- 0:00:39
795000 -- [-143.051] (-171.332) (-148.036) (-139.943) * (-160.220) (-163.692) (-145.404) [-143.513] -- 0:00:39
Average standard deviation of split frequencies: 0.005827
796000 -- (-146.229) (-163.734) [-146.607] (-147.493) * [-144.976] (-166.214) (-155.940) (-150.842) -- 0:00:39
797000 -- (-148.041) (-167.458) [-147.969] (-147.548) * (-149.345) (-165.935) (-150.886) [-140.090] -- 0:00:38
798000 -- (-142.907) (-162.816) [-145.223] (-158.486) * (-161.720) (-162.690) (-151.702) [-145.999] -- 0:00:38
799000 -- [-148.205] (-161.560) (-145.644) (-160.539) * (-148.311) (-155.374) (-161.386) [-146.670] -- 0:00:38
800000 -- [-149.879] (-157.748) (-148.865) (-156.999) * [-139.444] (-156.366) (-150.967) (-148.764) -- 0:00:38
Average standard deviation of split frequencies: 0.005841
801000 -- (-147.229) (-157.065) [-143.037] (-168.485) * [-148.445] (-163.982) (-152.637) (-147.154) -- 0:00:38
802000 -- [-150.669] (-160.838) (-150.593) (-161.767) * (-146.336) (-157.914) (-166.864) [-143.089] -- 0:00:38
803000 -- (-153.743) (-160.560) [-144.375] (-174.078) * (-150.372) (-156.467) (-158.816) [-144.530] -- 0:00:37
804000 -- (-144.513) (-149.746) [-150.196] (-157.477) * (-146.891) (-166.015) (-166.806) [-148.960] -- 0:00:37
805000 -- (-153.028) (-166.273) [-142.549] (-154.173) * (-146.146) (-153.765) (-160.191) [-141.884] -- 0:00:37
Average standard deviation of split frequencies: 0.005871
806000 -- [-144.079] (-161.940) (-143.726) (-158.535) * [-141.345] (-153.044) (-164.175) (-143.161) -- 0:00:37
807000 -- [-150.851] (-161.909) (-159.682) (-161.797) * [-148.544] (-159.238) (-161.388) (-144.685) -- 0:00:37
808000 -- (-150.861) (-164.312) [-140.626] (-161.220) * [-138.173] (-150.243) (-164.318) (-143.866) -- 0:00:36
809000 -- (-151.999) (-156.339) [-147.459] (-146.786) * [-145.563] (-159.428) (-161.026) (-148.668) -- 0:00:36
810000 -- [-151.942] (-154.227) (-147.187) (-160.015) * (-155.724) (-147.720) (-164.589) [-142.137] -- 0:00:36
Average standard deviation of split frequencies: 0.006048
811000 -- [-145.617] (-151.139) (-145.868) (-156.404) * (-167.950) (-153.198) (-160.694) [-145.871] -- 0:00:36
812000 -- [-146.813] (-157.051) (-142.257) (-162.132) * (-154.218) (-152.706) (-162.588) [-145.413] -- 0:00:36
813000 -- (-149.467) [-145.318] (-137.495) (-157.338) * (-153.653) [-148.797] (-159.089) (-148.375) -- 0:00:35
814000 -- [-144.781] (-147.044) (-147.467) (-158.757) * (-159.301) (-142.880) (-154.708) [-148.532] -- 0:00:35
815000 -- [-142.560] (-146.455) (-146.072) (-159.263) * (-152.799) [-147.114] (-157.904) (-149.962) -- 0:00:35
Average standard deviation of split frequencies: 0.005777
816000 -- (-145.863) [-146.455] (-150.736) (-160.959) * (-148.073) (-149.575) (-155.462) [-142.514] -- 0:00:35
817000 -- (-150.024) (-163.867) [-141.063] (-162.479) * [-147.929] (-145.386) (-156.241) (-146.036) -- 0:00:35
818000 -- (-140.453) (-170.609) [-152.400] (-158.106) * (-152.431) [-141.878] (-157.719) (-150.364) -- 0:00:34
819000 -- [-144.999] (-168.591) (-151.610) (-159.209) * (-146.524) (-156.507) (-148.273) [-153.277] -- 0:00:34
820000 -- (-144.009) (-164.817) [-151.170] (-164.177) * (-140.346) (-162.497) (-158.975) [-144.082] -- 0:00:34
Average standard deviation of split frequencies: 0.005899
821000 -- (-150.437) (-167.425) [-142.389] (-166.176) * (-142.471) (-159.050) (-163.681) [-139.960] -- 0:00:34
822000 -- [-145.252] (-161.519) (-147.102) (-148.251) * (-145.165) (-144.396) (-157.425) [-145.044] -- 0:00:34
823000 -- (-154.066) (-166.183) (-150.831) [-152.970] * [-149.994] (-151.309) (-163.830) (-143.531) -- 0:00:33
824000 -- (-148.671) (-162.953) [-140.126] (-151.835) * [-146.665] (-147.255) (-155.307) (-159.208) -- 0:00:33
825000 -- (-142.184) (-157.994) [-150.100] (-142.278) * [-143.104] (-152.589) (-161.407) (-150.828) -- 0:00:33
Average standard deviation of split frequencies: 0.005817
826000 -- [-151.169] (-158.851) (-143.786) (-149.178) * [-146.601] (-149.729) (-163.245) (-154.674) -- 0:00:33
827000 -- [-145.916] (-153.440) (-160.776) (-148.288) * (-150.432) (-156.672) (-163.734) [-147.979] -- 0:00:33
828000 -- [-144.097] (-170.851) (-152.996) (-143.724) * (-153.778) [-146.157] (-168.875) (-156.391) -- 0:00:33
829000 -- (-147.753) (-167.274) (-157.868) [-149.502] * (-142.627) (-160.057) (-161.949) [-154.812] -- 0:00:32
830000 -- (-145.481) (-157.906) (-151.314) [-144.462] * [-146.694] (-163.350) (-159.806) (-161.360) -- 0:00:32
Average standard deviation of split frequencies: 0.005607
831000 -- (-148.089) (-170.146) [-152.083] (-149.662) * [-146.924] (-161.504) (-154.280) (-147.815) -- 0:00:32
832000 -- [-140.367] (-167.650) (-146.468) (-164.007) * [-143.561] (-166.491) (-154.543) (-147.199) -- 0:00:32
833000 -- [-143.939] (-168.308) (-153.127) (-159.850) * [-146.977] (-159.366) (-155.871) (-148.511) -- 0:00:32
834000 -- [-148.181] (-165.460) (-158.660) (-160.735) * [-149.605] (-158.340) (-157.875) (-147.597) -- 0:00:31
835000 -- [-147.312] (-165.535) (-159.109) (-152.556) * [-151.526] (-156.075) (-154.023) (-151.832) -- 0:00:31
Average standard deviation of split frequencies: 0.005530
836000 -- (-154.446) [-149.685] (-150.789) (-168.063) * [-146.034] (-157.840) (-151.277) (-143.819) -- 0:00:31
837000 -- (-150.569) [-143.709] (-158.791) (-164.496) * [-143.985] (-157.797) (-153.115) (-146.823) -- 0:00:31
838000 -- (-168.776) [-142.306] (-143.698) (-156.262) * [-157.508] (-175.294) (-157.706) (-146.577) -- 0:00:31
839000 -- (-146.554) [-145.218] (-144.393) (-161.537) * [-148.689] (-165.942) (-156.704) (-143.970) -- 0:00:30
840000 -- (-150.429) [-148.357] (-150.440) (-161.147) * (-142.482) (-168.817) (-162.614) [-146.458] -- 0:00:30
Average standard deviation of split frequencies: 0.005742
841000 -- (-147.799) (-143.006) [-155.020] (-154.667) * [-142.526] (-149.800) (-161.684) (-139.173) -- 0:00:30
842000 -- [-141.785] (-149.220) (-149.977) (-153.228) * (-147.579) (-153.664) (-165.677) [-150.871] -- 0:00:30
843000 -- (-147.031) [-155.457] (-148.489) (-159.839) * (-151.179) [-148.603] (-162.377) (-148.930) -- 0:00:30
844000 -- (-151.126) [-153.554] (-153.191) (-151.546) * (-153.655) (-142.528) [-144.418] (-140.626) -- 0:00:29
845000 -- (-144.353) (-147.241) [-152.016] (-163.022) * [-143.743] (-150.501) (-162.749) (-143.931) -- 0:00:29
Average standard deviation of split frequencies: 0.005929
846000 -- (-143.145) [-148.040] (-148.190) (-164.776) * [-146.313] (-156.166) (-141.791) (-167.627) -- 0:00:29
847000 -- (-142.427) [-149.259] (-153.718) (-155.819) * [-141.346] (-156.419) (-146.275) (-161.521) -- 0:00:29
848000 -- (-148.379) [-145.077] (-152.234) (-169.232) * (-149.731) (-151.586) [-152.454] (-156.680) -- 0:00:29
849000 -- (-143.430) [-149.983] (-165.504) (-160.994) * (-148.148) (-152.068) [-145.987] (-160.691) -- 0:00:28
850000 -- (-167.057) (-146.020) [-143.755] (-166.813) * (-148.793) [-142.640] (-142.783) (-162.472) -- 0:00:28
Average standard deviation of split frequencies: 0.005763
851000 -- (-156.044) (-142.729) [-142.046] (-170.124) * (-155.725) (-143.139) [-146.161] (-155.965) -- 0:00:28
852000 -- (-166.544) [-142.636] (-140.128) (-159.990) * (-150.696) (-147.402) [-152.636] (-162.368) -- 0:00:28
853000 -- (-158.649) [-146.242] (-146.819) (-143.452) * (-156.204) (-145.332) [-143.268] (-159.380) -- 0:00:28
854000 -- (-162.224) (-148.599) [-145.539] (-152.656) * (-151.706) (-142.294) [-142.606] (-156.733) -- 0:00:28
855000 -- (-157.371) [-156.783] (-145.435) (-158.496) * (-155.523) [-150.854] (-150.940) (-160.968) -- 0:00:27
Average standard deviation of split frequencies: 0.005551
856000 -- (-167.386) (-146.241) [-144.501] (-153.553) * (-161.685) [-146.698] (-146.687) (-161.733) -- 0:00:27
857000 -- (-164.876) [-139.879] (-147.812) (-148.637) * [-142.210] (-149.582) (-148.379) (-157.137) -- 0:00:27
858000 -- (-160.990) (-142.783) (-154.678) [-141.971] * (-151.990) (-151.896) [-145.546] (-170.663) -- 0:00:27
859000 -- (-157.101) [-146.199] (-156.373) (-143.904) * [-149.511] (-145.526) (-149.863) (-161.274) -- 0:00:27
860000 -- (-159.932) (-157.539) [-152.114] (-145.949) * [-146.232] (-156.210) (-153.658) (-156.567) -- 0:00:26
Average standard deviation of split frequencies: 0.005258
861000 -- (-161.383) (-146.247) (-142.880) [-146.077] * (-146.730) (-145.956) [-150.526] (-162.435) -- 0:00:26
862000 -- (-164.884) (-142.942) [-147.717] (-167.226) * [-145.601] (-143.140) (-145.792) (-155.480) -- 0:00:26
863000 -- (-165.886) [-147.799] (-145.342) (-159.542) * (-142.591) (-164.688) [-146.738] (-156.431) -- 0:00:26
864000 -- (-161.176) [-143.942] (-152.754) (-166.586) * (-146.377) (-161.941) [-147.759] (-157.230) -- 0:00:26
865000 -- (-154.693) [-146.125] (-152.160) (-156.880) * (-144.017) (-160.267) [-145.915] (-161.185) -- 0:00:25
Average standard deviation of split frequencies: 0.005509
866000 -- (-147.744) [-148.388] (-152.124) (-158.875) * [-149.236] (-160.771) (-154.000) (-158.195) -- 0:00:25
867000 -- [-145.095] (-144.997) (-154.627) (-157.308) * [-145.493] (-157.790) (-145.860) (-154.411) -- 0:00:25
868000 -- [-145.805] (-147.593) (-159.774) (-157.281) * [-146.847] (-154.391) (-153.998) (-162.960) -- 0:00:25
869000 -- (-146.609) [-145.010] (-155.767) (-156.339) * (-150.766) [-149.471] (-145.527) (-168.967) -- 0:00:25
870000 -- [-143.151] (-146.018) (-166.142) (-160.277) * (-155.934) [-140.826] (-147.019) (-160.101) -- 0:00:24
Average standard deviation of split frequencies: 0.005826
871000 -- (-147.235) [-140.293] (-164.060) (-153.475) * (-153.542) (-147.874) [-146.070] (-165.016) -- 0:00:24
872000 -- [-142.237] (-143.210) (-162.598) (-161.586) * (-149.891) [-144.292] (-153.619) (-164.590) -- 0:00:24
873000 -- (-145.420) [-147.708] (-163.610) (-153.572) * (-145.210) [-148.197] (-158.895) (-163.664) -- 0:00:24
874000 -- (-148.148) [-148.518] (-152.555) (-144.736) * (-152.250) [-144.389] (-160.224) (-159.186) -- 0:00:24
875000 -- (-148.785) [-145.712] (-166.076) (-155.210) * [-145.119] (-139.783) (-158.036) (-165.312) -- 0:00:24
Average standard deviation of split frequencies: 0.005963
876000 -- [-147.017] (-147.319) (-158.048) (-154.368) * (-151.876) [-149.072] (-155.469) (-162.036) -- 0:00:23
877000 -- (-149.130) [-151.851] (-156.861) (-160.080) * [-150.693] (-139.648) (-149.174) (-165.971) -- 0:00:23
878000 -- (-145.295) [-144.068] (-153.804) (-152.662) * (-158.529) (-149.782) [-144.973] (-164.634) -- 0:00:23
879000 -- [-144.944] (-148.199) (-162.035) (-150.243) * (-160.696) [-140.435] (-143.396) (-161.691) -- 0:00:23
880000 -- [-150.180] (-142.046) (-161.682) (-158.353) * [-141.067] (-148.216) (-147.325) (-169.326) -- 0:00:23
Average standard deviation of split frequencies: 0.005824
881000 -- (-141.321) [-143.499] (-164.774) (-157.073) * [-141.618] (-145.969) (-148.310) (-154.647) -- 0:00:22
882000 -- (-143.199) (-142.772) (-166.230) [-148.082] * [-141.956] (-159.186) (-150.741) (-163.964) -- 0:00:22
883000 -- (-147.268) (-148.857) (-157.060) [-147.303] * (-144.512) (-149.504) [-143.293] (-159.884) -- 0:00:22
884000 -- [-144.560] (-147.759) (-160.637) (-166.102) * (-146.811) [-140.676] (-143.559) (-162.482) -- 0:00:22
885000 -- [-147.883] (-144.776) (-156.519) (-149.946) * [-140.183] (-148.441) (-145.724) (-161.257) -- 0:00:22
Average standard deviation of split frequencies: 0.005853
886000 -- (-150.710) (-147.288) (-163.612) [-141.508] * [-139.540] (-141.376) (-169.599) (-170.636) -- 0:00:21
887000 -- (-156.089) [-143.550] (-160.743) (-148.091) * [-144.798] (-148.990) (-161.990) (-160.127) -- 0:00:21
888000 -- (-142.617) (-148.838) (-153.442) [-145.706] * [-145.642] (-142.615) (-163.597) (-158.928) -- 0:00:21
889000 -- (-148.821) [-145.694] (-167.337) (-158.755) * [-142.339] (-150.259) (-158.124) (-159.835) -- 0:00:21
890000 -- (-148.758) [-145.393] (-156.559) (-154.759) * (-150.491) [-149.383] (-161.126) (-156.786) -- 0:00:21
Average standard deviation of split frequencies: 0.005780
891000 -- [-147.602] (-150.864) (-159.994) (-163.289) * [-142.196] (-148.894) (-164.804) (-162.974) -- 0:00:20
892000 -- (-149.363) [-146.019] (-154.457) (-157.642) * [-149.135] (-148.935) (-155.546) (-166.245) -- 0:00:20
893000 -- (-142.379) [-140.593] (-165.823) (-164.800) * (-149.234) [-150.713] (-149.609) (-174.600) -- 0:00:20
894000 -- (-159.266) [-147.592] (-151.176) (-156.237) * (-151.962) [-142.813] (-149.897) (-168.639) -- 0:00:20
895000 -- (-165.652) (-144.066) [-144.744] (-161.688) * (-148.277) (-150.690) [-142.232] (-162.969) -- 0:00:20
Average standard deviation of split frequencies: 0.006061
896000 -- (-165.712) [-144.534] (-139.910) (-156.018) * [-142.499] (-147.002) (-152.270) (-169.630) -- 0:00:19
897000 -- (-162.527) [-146.755] (-142.259) (-166.342) * (-146.734) [-143.954] (-151.829) (-161.852) -- 0:00:19
898000 -- (-165.394) (-149.978) [-143.708] (-157.830) * (-148.611) [-146.719] (-143.708) (-166.367) -- 0:00:19
899000 -- (-158.994) (-148.717) (-147.626) [-154.729] * [-142.947] (-141.387) (-146.804) (-168.170) -- 0:00:19
900000 -- (-155.700) [-145.521] (-147.822) (-160.758) * [-147.148] (-146.038) (-151.382) (-157.456) -- 0:00:19
Average standard deviation of split frequencies: 0.006218
901000 -- (-171.321) (-143.228) [-146.892] (-152.355) * (-144.161) (-154.357) [-146.897] (-159.152) -- 0:00:19
902000 -- (-159.975) (-145.007) [-150.913] (-144.527) * (-151.823) (-161.298) [-145.846] (-169.361) -- 0:00:18
903000 -- (-161.284) (-144.489) [-146.658] (-165.918) * (-152.722) (-160.892) [-137.946] (-154.250) -- 0:00:18
904000 -- (-157.648) [-145.168] (-149.449) (-157.976) * (-152.530) (-159.292) [-147.647] (-159.533) -- 0:00:18
905000 -- (-163.641) (-144.298) (-154.376) [-147.613] * (-155.038) (-165.266) (-145.251) [-153.199] -- 0:00:18
Average standard deviation of split frequencies: 0.006222
906000 -- (-169.848) (-147.356) (-150.076) [-146.847] * (-145.306) (-159.245) (-154.668) [-145.361] -- 0:00:18
907000 -- (-159.818) [-142.634] (-159.147) (-152.309) * (-152.026) (-156.580) [-145.084] (-145.054) -- 0:00:17
908000 -- (-161.077) [-141.412] (-159.209) (-150.263) * (-150.492) (-159.049) (-154.082) [-145.014] -- 0:00:17
909000 -- (-161.459) (-155.575) (-150.857) [-144.109] * [-150.482] (-166.787) (-158.253) (-150.467) -- 0:00:17
910000 -- (-175.660) [-139.524] (-162.140) (-148.088) * [-142.630] (-166.308) (-163.166) (-155.567) -- 0:00:17
Average standard deviation of split frequencies: 0.006212
911000 -- (-163.462) [-156.932] (-162.667) (-153.965) * [-144.016] (-146.371) (-162.660) (-146.317) -- 0:00:17
912000 -- (-145.186) (-153.872) (-158.061) [-146.426] * (-149.153) (-146.387) [-144.750] (-154.411) -- 0:00:16
913000 -- (-152.068) [-145.756] (-163.203) (-151.160) * [-143.551] (-152.898) (-149.324) (-160.480) -- 0:00:16
914000 -- (-148.788) [-140.625] (-156.638) (-147.353) * [-142.690] (-155.272) (-142.251) (-159.760) -- 0:00:16
915000 -- (-143.839) (-170.126) (-160.642) [-147.541] * (-154.222) (-165.229) [-141.267] (-145.375) -- 0:00:16
Average standard deviation of split frequencies: 0.006004
916000 -- [-142.773] (-149.771) (-148.807) (-170.968) * [-141.606] (-164.795) (-145.767) (-150.495) -- 0:00:16
917000 -- (-141.334) (-148.995) [-144.305] (-168.525) * [-144.027] (-157.197) (-148.054) (-147.470) -- 0:00:15
918000 -- (-142.427) (-152.424) [-147.427] (-163.626) * (-149.385) (-162.598) (-157.551) [-145.837] -- 0:00:15
919000 -- (-150.654) [-141.891] (-160.793) (-160.094) * (-146.250) (-167.664) (-150.517) [-146.212] -- 0:00:15
920000 -- [-143.521] (-155.859) (-142.114) (-158.849) * (-150.611) (-158.440) (-148.074) [-150.760] -- 0:00:15
Average standard deviation of split frequencies: 0.006080
921000 -- [-138.878] (-151.591) (-143.554) (-151.189) * (-146.377) (-165.987) [-145.770] (-157.969) -- 0:00:15
922000 -- [-143.753] (-149.006) (-150.384) (-156.270) * (-141.568) (-156.229) [-150.619] (-164.918) -- 0:00:14
923000 -- [-142.389] (-144.653) (-150.466) (-156.678) * [-146.542] (-156.527) (-149.518) (-160.878) -- 0:00:14
924000 -- [-148.334] (-153.033) (-150.770) (-159.969) * (-145.975) (-165.463) [-146.097] (-163.774) -- 0:00:14
925000 -- (-154.212) (-146.537) [-145.688] (-163.876) * [-148.043] (-157.953) (-150.534) (-164.246) -- 0:00:14
Average standard deviation of split frequencies: 0.006374
926000 -- (-167.415) [-142.606] (-144.026) (-157.769) * [-145.106] (-164.775) (-147.048) (-162.781) -- 0:00:14
927000 -- (-158.876) (-144.497) [-144.571] (-149.576) * [-140.672] (-148.855) (-153.592) (-166.551) -- 0:00:14
928000 -- (-173.356) [-144.015] (-144.105) (-154.520) * (-145.413) (-149.695) [-146.326] (-160.326) -- 0:00:13
929000 -- (-161.324) (-154.503) [-141.706] (-153.572) * [-144.199] (-146.775) (-146.035) (-162.274) -- 0:00:13
930000 -- (-165.002) (-154.948) [-147.444] (-147.494) * (-146.240) [-147.421] (-164.740) (-165.876) -- 0:00:13
Average standard deviation of split frequencies: 0.006281
931000 -- (-160.433) (-166.705) (-147.387) [-142.915] * [-144.014] (-144.866) (-174.315) (-160.533) -- 0:00:13
932000 -- (-158.242) (-168.074) [-144.034] (-155.817) * (-140.966) [-156.411] (-159.879) (-151.852) -- 0:00:13
933000 -- (-170.288) (-172.727) [-140.753] (-147.338) * (-146.413) [-150.383] (-159.756) (-159.595) -- 0:00:12
934000 -- (-163.597) [-150.666] (-164.019) (-144.937) * [-143.600] (-144.612) (-174.575) (-163.402) -- 0:00:12
935000 -- (-160.291) (-155.985) (-164.775) [-148.238] * (-144.632) [-142.658] (-163.485) (-158.589) -- 0:00:12
Average standard deviation of split frequencies: 0.006205
936000 -- (-158.558) (-147.267) (-160.871) [-139.684] * [-149.680] (-145.076) (-158.662) (-162.789) -- 0:00:12
937000 -- (-156.251) (-149.669) (-165.257) [-144.640] * (-143.375) [-143.973] (-168.957) (-162.013) -- 0:00:12
938000 -- (-159.133) (-152.753) (-156.886) [-146.288] * [-140.051] (-149.910) (-158.088) (-154.198) -- 0:00:11
939000 -- (-157.831) [-141.881] (-155.915) (-145.962) * [-144.108] (-154.050) (-162.631) (-153.483) -- 0:00:11
940000 -- (-162.271) [-146.593] (-149.694) (-150.697) * [-148.073] (-154.516) (-163.751) (-159.176) -- 0:00:11
Average standard deviation of split frequencies: 0.005974
941000 -- (-157.269) (-142.119) (-141.331) [-148.474] * (-150.115) [-146.825] (-161.214) (-164.344) -- 0:00:11
942000 -- (-155.865) (-146.123) (-149.376) [-144.343] * (-148.263) [-149.350] (-155.395) (-158.078) -- 0:00:11
943000 -- (-167.868) [-143.340] (-146.093) (-147.284) * (-145.645) (-146.077) [-144.396] (-160.686) -- 0:00:10
944000 -- (-161.827) (-147.558) (-150.131) [-145.293] * (-150.042) [-152.020] (-146.612) (-157.082) -- 0:00:10
945000 -- (-168.883) (-162.227) (-144.461) [-147.782] * (-143.654) [-150.716] (-149.680) (-156.390) -- 0:00:10
Average standard deviation of split frequencies: 0.005780
946000 -- (-161.303) (-161.731) [-147.873] (-153.489) * (-141.508) (-155.325) [-144.496] (-159.389) -- 0:00:10
947000 -- (-158.760) (-169.044) (-147.185) [-144.582] * (-154.276) (-152.579) [-138.740] (-162.844) -- 0:00:10
948000 -- (-163.277) (-163.306) [-144.780] (-153.399) * (-161.151) (-146.885) [-152.035] (-162.472) -- 0:00:09
949000 -- (-160.517) (-159.474) [-151.134] (-148.789) * (-156.367) [-143.190] (-151.655) (-165.529) -- 0:00:09
950000 -- (-159.828) (-150.368) [-149.607] (-146.463) * (-159.717) [-145.439] (-141.609) (-165.349) -- 0:00:09
Average standard deviation of split frequencies: 0.005990
951000 -- (-157.529) (-150.486) [-147.722] (-145.530) * (-154.267) (-153.580) [-141.717] (-164.348) -- 0:00:09
952000 -- (-166.078) (-150.516) (-143.790) [-143.512] * (-156.984) [-150.938] (-139.083) (-161.768) -- 0:00:09
953000 -- (-165.027) (-163.269) (-146.407) [-149.400] * (-164.529) [-144.221] (-153.302) (-145.676) -- 0:00:09
954000 -- [-149.015] (-160.650) (-146.379) (-148.723) * (-158.595) (-153.266) (-159.008) [-144.356] -- 0:00:08
955000 -- (-147.140) (-160.057) [-146.501] (-158.901) * (-156.769) (-144.804) [-140.589] (-148.196) -- 0:00:08
Average standard deviation of split frequencies: 0.005897
956000 -- (-145.300) (-167.191) (-151.090) [-145.376] * (-154.183) (-147.539) (-153.649) [-145.430] -- 0:00:08
957000 -- (-149.077) (-160.605) (-150.878) [-144.607] * (-169.634) (-151.737) (-162.453) [-149.046] -- 0:00:08
958000 -- (-149.439) (-161.920) (-147.795) [-144.560] * (-157.243) [-143.263] (-148.958) (-145.857) -- 0:00:08
959000 -- (-142.000) (-159.370) (-145.121) [-149.632] * (-159.327) (-145.200) (-151.823) [-144.970] -- 0:00:07
960000 -- (-162.488) (-156.869) [-146.589] (-151.515) * (-158.128) (-145.151) (-156.218) [-146.808] -- 0:00:07
Average standard deviation of split frequencies: 0.005929
961000 -- (-159.132) (-157.003) [-147.573] (-142.928) * (-166.181) (-161.174) [-147.288] (-150.313) -- 0:00:07
962000 -- (-158.560) (-161.312) (-149.865) [-144.283] * (-154.057) (-159.948) (-141.950) [-145.774] -- 0:00:07
963000 -- (-167.668) (-161.396) [-144.242] (-155.785) * (-159.261) (-162.114) (-146.398) [-145.482] -- 0:00:07
964000 -- (-159.729) (-160.313) [-151.188] (-153.585) * (-163.548) (-156.337) [-147.893] (-149.279) -- 0:00:06
965000 -- (-164.479) (-155.873) [-146.294] (-145.063) * (-164.758) (-159.955) (-147.328) [-141.858] -- 0:00:06
Average standard deviation of split frequencies: 0.006227
966000 -- (-166.885) (-153.487) [-143.172] (-148.880) * (-154.679) (-161.451) [-145.226] (-145.109) -- 0:00:06
967000 -- (-165.972) (-157.741) [-142.731] (-150.018) * (-160.487) (-160.871) (-141.855) [-143.801] -- 0:00:06
968000 -- (-161.918) (-151.686) [-140.022] (-146.378) * (-161.165) (-163.675) (-146.622) [-151.340] -- 0:00:06
969000 -- (-156.165) [-145.570] (-142.595) (-168.125) * (-143.349) (-157.440) (-144.460) [-147.336] -- 0:00:05
970000 -- (-155.827) (-146.574) [-144.358] (-162.486) * (-159.600) (-166.611) [-142.870] (-139.584) -- 0:00:05
Average standard deviation of split frequencies: 0.005949
971000 -- (-165.618) (-145.964) [-143.934] (-158.817) * (-161.732) (-157.463) [-142.379] (-149.706) -- 0:00:05
972000 -- (-165.133) [-145.551] (-145.971) (-160.249) * (-159.795) (-151.686) [-145.618] (-149.642) -- 0:00:05
973000 -- (-153.318) (-146.134) [-141.268] (-163.560) * (-167.111) (-159.288) (-145.747) [-147.533] -- 0:00:05
974000 -- (-160.030) [-144.670] (-146.710) (-145.705) * (-158.548) (-154.252) (-151.715) [-143.779] -- 0:00:04
975000 -- (-165.890) [-139.830] (-151.869) (-144.828) * (-163.071) (-155.935) [-145.220] (-145.595) -- 0:00:04
Average standard deviation of split frequencies: 0.005997
976000 -- (-158.918) (-149.550) [-148.774] (-148.584) * (-167.763) (-161.826) [-144.116] (-142.073) -- 0:00:04
977000 -- (-157.690) (-151.347) [-143.396] (-143.092) * (-158.394) (-160.807) [-153.631] (-148.485) -- 0:00:04
978000 -- (-161.215) (-152.065) (-147.772) [-145.944] * (-163.358) (-156.144) (-146.701) [-151.959] -- 0:00:04
979000 -- (-157.505) (-141.198) [-146.910] (-147.392) * (-160.354) (-155.563) [-141.776] (-143.003) -- 0:00:04
980000 -- (-157.617) (-142.084) [-150.890] (-150.818) * (-159.051) (-154.060) (-145.041) [-143.975] -- 0:00:03
Average standard deviation of split frequencies: 0.006570
981000 -- (-160.111) (-146.528) [-145.984] (-141.340) * (-161.984) (-158.614) (-148.209) [-149.588] -- 0:00:03
982000 -- (-152.449) (-149.510) [-142.588] (-159.599) * (-160.714) (-159.621) (-155.345) [-144.719] -- 0:00:03
983000 -- [-140.025] (-143.980) (-150.059) (-166.657) * (-168.138) (-157.507) [-145.388] (-148.588) -- 0:00:03
984000 -- [-142.660] (-148.776) (-145.279) (-161.196) * (-156.152) (-165.532) (-146.882) [-142.434] -- 0:00:03
985000 -- (-153.680) (-144.639) [-148.163] (-159.203) * (-158.113) (-165.546) (-148.096) [-151.808] -- 0:00:02
Average standard deviation of split frequencies: 0.005996
986000 -- [-144.831] (-146.023) (-153.970) (-160.878) * (-171.121) (-161.911) (-155.684) [-140.030] -- 0:00:02
987000 -- (-153.637) (-148.397) [-139.382] (-158.178) * (-161.589) (-157.589) [-148.531] (-144.523) -- 0:00:02
988000 -- (-148.713) [-149.079] (-146.976) (-164.040) * (-159.193) (-155.976) [-148.639] (-144.466) -- 0:00:02
989000 -- (-165.838) [-151.286] (-152.611) (-161.417) * (-158.446) (-162.317) (-147.462) [-147.257] -- 0:00:02
990000 -- (-145.456) [-155.907] (-146.115) (-156.752) * (-157.498) (-153.262) [-146.824] (-144.719) -- 0:00:01
Average standard deviation of split frequencies: 0.005988
991000 -- [-147.115] (-144.843) (-147.414) (-158.851) * (-159.905) (-161.712) (-142.738) [-151.150] -- 0:00:01
992000 -- (-146.110) [-146.504] (-143.592) (-158.081) * (-159.622) (-158.452) [-143.584] (-146.084) -- 0:00:01
993000 -- (-147.804) [-143.301] (-146.974) (-153.395) * (-157.381) (-155.828) [-146.109] (-152.142) -- 0:00:01
994000 -- (-145.878) [-145.098] (-152.178) (-158.014) * (-158.948) (-156.432) (-146.704) [-150.952] -- 0:00:01
995000 -- (-150.316) [-142.228] (-160.188) (-155.548) * (-163.354) (-162.412) [-148.265] (-154.404) -- 0:00:00
Average standard deviation of split frequencies: 0.005642
996000 -- [-146.061] (-140.757) (-171.647) (-148.661) * (-143.299) (-162.625) (-150.390) [-144.139] -- 0:00:00
997000 -- [-143.884] (-143.634) (-164.486) (-159.940) * [-139.235] (-166.617) (-143.863) (-147.977) -- 0:00:00
998000 -- (-143.350) [-142.394] (-162.054) (-159.673) * (-146.825) (-155.729) [-139.214] (-145.943) -- 0:00:00
999000 -- (-152.177) [-139.168] (-156.935) (-167.231) * [-146.324] (-165.572) (-149.442) (-148.066) -- 0:00:00
1000000 -- [-146.893] (-141.552) (-160.199) (-168.363) * (-150.421) (-160.872) [-147.924] (-147.850) -- 0:00:00
Average standard deviation of split frequencies: 0.005418
Analysis completed in 3 mins 12 seconds
Analysis used 191.74 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -134.62
Likelihood of best state for "cold" chain of run 2 was -134.80
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
70.2 % ( 73 %) Dirichlet(Revmat{all})
89.9 % ( 84 %) Slider(Revmat{all})
66.4 % ( 52 %) Dirichlet(Pi{all})
63.1 % ( 44 %) Slider(Pi{all})
80.4 % ( 65 %) Multiplier(Alpha{1,2})
72.1 % ( 48 %) Multiplier(Alpha{3})
90.7 % ( 85 %) Slider(Pinvar{all})
65.3 % ( 73 %) ExtSPR(Tau{all},V{all})
47.7 % ( 54 %) ExtTBR(Tau{all},V{all})
66.8 % ( 73 %) NNI(Tau{all},V{all})
54.7 % ( 60 %) ParsSPR(Tau{all},V{all})
27.6 % ( 19 %) Multiplier(V{all})
78.5 % ( 80 %) Nodeslider(V{all})
30.1 % ( 27 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
69.2 % ( 56 %) Dirichlet(Revmat{all})
89.5 % ( 85 %) Slider(Revmat{all})
66.0 % ( 52 %) Dirichlet(Pi{all})
64.6 % ( 51 %) Slider(Pi{all})
80.3 % ( 59 %) Multiplier(Alpha{1,2})
72.2 % ( 46 %) Multiplier(Alpha{3})
90.4 % ( 78 %) Slider(Pinvar{all})
65.5 % ( 59 %) ExtSPR(Tau{all},V{all})
47.2 % ( 47 %) ExtTBR(Tau{all},V{all})
66.5 % ( 68 %) NNI(Tau{all},V{all})
54.6 % ( 63 %) ParsSPR(Tau{all},V{all})
27.7 % ( 26 %) Multiplier(V{all})
78.5 % ( 64 %) Nodeslider(V{all})
29.4 % ( 19 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.56 0.12 0.00
2 | 166924 0.27 0.00
3 | 166482 166141 0.24
4 | 167103 167018 166332
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.56 0.11 0.00
2 | 166744 0.26 0.00
3 | 166315 166256 0.26
4 | 167246 166326 167113
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/mrbayes_input.nex.run1.p and /data/mrbayes_input.nex.run2.p
Writing summary statistics to file /data/mrbayes_input.nex.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -143.49
| 1 |
| |
| 2 |
| 1 1 12 1 2 22 2 1 1 |
| 212 1 2 * 21 1 1 2 2 1 |
| 1 2 21 1 1 1 2 1 |
| 21 12 1 1 1 * 21 1 1 2 |
| 2 11 1 12 2 12 12 * * 2 2 1 2 22|
| 1 22 2 212 2 1 2 * 1 1122 1 1|
|* 2 1 2 1 2 2 1 1 *2 2 |
| 1 2 1 2 1 2 2 2 2 |
| 2 1 |
| 1 1 2 |
| 2 |
| 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -148.30
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -141.62 -152.28
2 -141.56 -153.49
--------------------------------------
TOTAL -141.59 -153.06
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.323575 0.021259 0.107421 0.589939 0.296665 1375.77 1381.18 1.000
r(A<->C){all} 0.066166 0.003853 0.000028 0.194451 0.047245 188.28 244.81 1.003
r(A<->G){all} 0.338544 0.017350 0.101712 0.591974 0.322034 105.11 168.11 1.004
r(A<->T){all} 0.072738 0.003729 0.000010 0.193576 0.056693 224.46 282.23 1.003
r(C<->G){all} 0.061944 0.003560 0.000018 0.178664 0.042650 290.91 309.42 1.014
r(C<->T){all} 0.359973 0.017740 0.134312 0.638675 0.349662 126.47 162.21 1.004
r(G<->T){all} 0.100636 0.005388 0.000021 0.240551 0.085494 239.27 254.95 1.000
pi(A){all} 0.242488 0.002709 0.139781 0.343405 0.239447 610.53 649.44 1.000
pi(C){all} 0.195156 0.002259 0.105366 0.288018 0.191419 862.92 869.46 1.004
pi(G){all} 0.280028 0.002826 0.178457 0.382263 0.279258 833.50 904.95 1.001
pi(T){all} 0.282328 0.002996 0.182563 0.391300 0.280182 689.44 754.14 1.001
alpha{1,2} 0.573269 0.537577 0.000160 2.048770 0.309765 749.26 844.65 1.000
alpha{3} 1.486115 1.301605 0.000760 3.739900 1.214929 1041.44 1081.27 1.000
pinvar{all} 0.326316 0.037725 0.000123 0.659712 0.312234 662.30 674.51 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/mrbayes_input.nex.run1.t" and "/data/mrbayes_input.nex.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/mrbayes_input.nex.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/mrbayes_input.nex.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a parameter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C10
3 -- C11
4 -- C2
5 -- C3
6 -- C4
7 -- C5
8 -- C6
9 -- C7
10 -- C8
11 -- C9
Key to taxon bipartitions (saved to file "/data/mrbayes_input.nex.parts"):
ID -- Partition
-----------------
1 -- .**********
2 -- .*.........
3 -- ..*........
4 -- ...*.......
5 -- ....*......
6 -- .....*.....
7 -- ......*....
8 -- .......*...
9 -- ........*..
10 -- .........*.
11 -- ..........*
12 -- .**.*....**
13 -- .**.*...***
14 -- .**......**
15 -- .**.*.*.***
16 -- ..*.......*
17 -- .**........
18 -- .*.......*.
19 -- .........**
20 -- ..*......*.
21 -- .**.......*
22 -- .*........*
23 -- ..*......**
24 -- .**.*.*..**
25 -- .**.*******
26 -- ...*...*...
27 -- .**......*.
28 -- .****.*****
29 -- .....*.*...
30 -- .*.......**
31 -- .******.***
32 -- ...*.*.....
33 -- .****.*.***
34 -- .**.*.*****
35 -- .....**....
-----------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/mrbayes_input.nex.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
12 2820 0.939374 0.007537 0.934044 0.944704 2
13 2197 0.731845 0.011777 0.723518 0.740173 2
14 2036 0.678215 0.007537 0.672885 0.683544 2
15 782 0.260493 0.001884 0.259161 0.261825 2
16 568 0.189207 0.002827 0.187209 0.191206 2
17 565 0.188208 0.004240 0.185210 0.191206 2
18 536 0.178548 0.005653 0.174550 0.182545 2
19 531 0.176882 0.007066 0.171885 0.181879 2
20 522 0.173884 0.000942 0.173218 0.174550 2
21 514 0.171219 0.005653 0.167222 0.175217 2
22 513 0.170886 0.007066 0.165889 0.175883 2
23 508 0.169221 0.008480 0.163225 0.175217 2
24 483 0.160893 0.012719 0.151899 0.169887 2
25 469 0.156229 0.003298 0.153897 0.158561 2
26 455 0.151566 0.001413 0.150566 0.152565 2
27 448 0.149234 0.008480 0.143238 0.155230 2
28 441 0.146902 0.006124 0.142572 0.151233 2
29 438 0.145903 0.000942 0.145237 0.146569 2
30 428 0.142572 0.008480 0.136576 0.148568 2
31 425 0.141572 0.002355 0.139907 0.143238 2
32 424 0.141239 0.000942 0.140573 0.141905 2
33 311 0.103598 0.005182 0.099933 0.107262 2
34 306 0.101932 0.003769 0.099267 0.104597 2
35 300 0.099933 0.005653 0.095936 0.103931 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/mrbayes_input.nex.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.009733 0.000122 0.000004 0.030745 0.006226 1.000 2
length{all}[2] 0.020100 0.000314 0.000110 0.052544 0.015395 1.000 2
length{all}[3] 0.009890 0.000141 0.000002 0.030415 0.006385 1.000 2
length{all}[4] 0.009572 0.000114 0.000003 0.029331 0.006394 1.000 2
length{all}[5] 0.013329 0.000212 0.000004 0.042394 0.008618 1.000 2
length{all}[6] 0.009682 0.000120 0.000002 0.030354 0.006262 1.000 2
length{all}[7] 0.016440 0.000251 0.000011 0.045442 0.012274 1.000 2
length{all}[8] 0.009789 0.000122 0.000006 0.031414 0.006344 1.000 2
length{all}[9] 0.059555 0.001557 0.005512 0.136325 0.050736 1.001 2
length{all}[10] 0.010012 0.000140 0.000004 0.032256 0.006226 1.000 2
length{all}[11] 0.009919 0.000135 0.000008 0.030795 0.006431 1.001 2
length{all}[12] 0.046664 0.001302 0.000156 0.111365 0.037766 1.000 2
length{all}[13] 0.039894 0.001156 0.000255 0.097756 0.032366 1.000 2
length{all}[14] 0.019601 0.000448 0.000071 0.050865 0.014920 1.000 2
length{all}[15] 0.015690 0.000267 0.000060 0.046973 0.010934 1.002 2
length{all}[16] 0.009426 0.000123 0.000003 0.030580 0.005917 0.998 2
length{all}[17] 0.009893 0.000109 0.000002 0.029949 0.006826 0.998 2
length{all}[18] 0.009894 0.000148 0.000013 0.026513 0.006925 1.000 2
length{all}[19] 0.009478 0.000124 0.000009 0.031483 0.005828 1.000 2
length{all}[20] 0.009773 0.000139 0.000005 0.031257 0.006101 0.999 2
length{all}[21] 0.009293 0.000097 0.000029 0.024832 0.006436 0.998 2
length{all}[22] 0.010517 0.000146 0.000026 0.038045 0.007043 0.999 2
length{all}[23] 0.010416 0.000132 0.000046 0.032941 0.007007 0.998 2
length{all}[24] 0.018208 0.000311 0.000521 0.050078 0.012913 0.998 2
length{all}[25] 0.009135 0.000086 0.000003 0.027657 0.005936 1.006 2
length{all}[26] 0.009755 0.000115 0.000002 0.027791 0.006772 0.999 2
length{all}[27] 0.010626 0.000112 0.000034 0.032452 0.007447 1.002 2
length{all}[28] 0.008805 0.000088 0.000000 0.027384 0.005464 1.002 2
length{all}[29] 0.008744 0.000088 0.000048 0.026568 0.005831 0.998 2
length{all}[30] 0.009843 0.000122 0.000003 0.031835 0.005981 0.999 2
length{all}[31] 0.009223 0.000110 0.000028 0.030218 0.005933 1.000 2
length{all}[32] 0.009598 0.000108 0.000086 0.031592 0.006397 0.998 2
length{all}[33] 0.008682 0.000079 0.000008 0.025495 0.005938 1.000 2
length{all}[34] 0.009449 0.000087 0.000027 0.028571 0.006484 0.997 2
length{all}[35] 0.009973 0.000115 0.000011 0.030263 0.006598 0.997 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.005418
Maximum standard deviation of split frequencies = 0.012719
Average PSRF for parameter values (excluding NA and >10.0) = 1.000
Maximum PSRF for parameter values = 1.006
Clade credibility values:
/----------------------------------------------------------------------- C1 (1)
|
|----------------------------------------------------------------------- C2 (4)
|
|----------------------------------------------------------------------- C4 (6)
|
|----------------------------------------------------------------------- C5 (7)
|
|----------------------------------------------------------------------- C6 (8)
+
| /------------------ C10 (2)
| |
| |------------------ C11 (3)
| /-------68-------+
| | |------------------ C8 (10)
| | |
| /--------94-------+ \------------------ C9 (11)
| | |
\--------73-------+ \----------------------------------- C3 (5)
|
\----------------------------------------------------- C7 (9)
Phylogram (based on average branch lengths):
/---- C1 (1)
|
|----- C2 (4)
|
|---- C4 (6)
|
|--------- C5 (7)
|
|---- C6 (8)
+
| /----------- C10 (2)
| |
| |----- C11 (3)
| /---------+
| | |----- C8 (10)
| | |
| /--------------------------+ \----- C9 (11)
| | |
\----------------------+ \------ C3 (5)
|
\------------------------------------ C7 (9)
|-------------| 0.020 expected changes per site
Calculating tree probabilities...
Credible sets of trees (2403 trees sampled):
50 % credible set contains 902 trees
90 % credible set contains 2103 trees
95 % credible set contains 2253 trees
99 % credible set contains 2373 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
Running FUBAR...
[2J[H /HYPHY 2.3.14.20190214beta(MP) for Linux on x86_64\
***************** TYPES OF STANDARD ANALYSES *****************
(1) Selection Analyses
(2) Evolutionary Hypothesis Testing
(3) Relative evolutionary rate inference
(4) Coevolutionary analysis
(5) Basic Analyses
(6) Codon Selection Analyses
(7) Compartmentalization
(8) Data File Tools
(9) Miscellaneous
(10) Model Comparison
(11) Kernel Analysis Tools
(12) Molecular Clock
(13) Phylogeny Reconstruction
(14) Positive Selection
(15) Recombination
(16) Selection/Recombination
(17) Relative Rate
(18) Relative Ratio
(19) Substitution Rates
Please select type of analyses you want to list (or press ENTER to process custom batch file):[2J[H***************** FILES IN 'Selection Analyses' *****************
(1) [MEME] Test for episodic site-level selection using MEME (Mixed Effects Model of Evolution).
(2) [FEL] Test for pervasive site-level selection using FEL (Fixed Effects Likelihood).
(3) [SLAC] Test for pervasive site-level selection using SLAC (Single Likelihood Ancestor Counting).
(4) [FUBAR] Test for pervasive site-level selection using FUBAR (Fast Unconstrained Bayesian AppRoximation for inferring selection).
(5) [BUSTED] Test for episodic gene-wide selection using BUSTED (Branch-site Unrestricted Statistical Test of Episodic Diversification).
(6) [aBSREL] Test for lineage-specific evolution using the branch-site method aBS-REL (Adaptive Branch-Site Random Effects Likelihood).
(7) [RELAX] Test for relaxation of selection pressure along a specified set of test branches using RELAX (a random effects test of selection relaxation).
Please select the analysis you would like to perform (or press ENTER to return to the list of analysis types):
Analysis Description
--------------------
Perform a Fast Unbiased AppRoximate Bayesian (FUBAR) analysis of a
coding sequence alignment to determine whether some sites have been
subject to pervasive purifying or diversifying selection. v2.1
introduces two more methods for estimating the posterior distribution of
grid weights: collapsed Gibbs MCMC (faster) and 0-th order Variation
Bayes approximation (fastest). Please note that a FUBAR analysis
generates a cache and a results JSON file in the same directory as
directory as the original alignment. HyPhy needs to have write
privileges to this directory. For example if the original file is in
/home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there
will also exist FUBAR-generated files
/home/sergei/FUBAR/data/pol.nex.FUBAR.json,
/home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also provide
checkpointing so that a partially completed analysis can be restarted.
- __Requirements__: in-frame codon alignment (possibly partitioned) and a phylogenetic tree
(one per partition)
- __Citation__: FUBAR: a fast, unconstrained bayesian approximation for inferring
selection (2013), Mol Biol Evol. 30(5):1196-205
- __Written by__: Sergei L Kosakovsky Pond
- __Contact Information__: spond@temple.edu
- __Analysis Version__: 2.1
####Choose Genetic Code
1. [**Universal**] Universal code. (Genebank transl_table=1).
2. [**Vertebrate mtDNA**] Vertebrate mitochondrial DNA code. (Genebank transl_table=2).
3. [**Yeast mtDNA**] Yeast mitochondrial DNA code. (Genebank transl_table=3).
4. [**Mold/Protozoan mtDNA**] Mold, Protozoan and Coelenterate mitochondrial DNA and the Mycloplasma/Spiroplasma code. (Genebank transl_table=4).
5. [**Invertebrate mtDNA**] Invertebrate mitochondrial DNA code. (Genebank transl_table=5).
6. [**Ciliate Nuclear**] Ciliate, Dasycladacean and Hexamita Nuclear code. (Genebank transl_table=6).
7. [**Echinoderm mtDNA**] Echinoderm mitochondrial DNA code. (Genebank transl_table=9).
8. [**Euplotid Nuclear**] Euplotid Nuclear code. (Genebank transl_table=10).
9. [**Alt. Yeast Nuclear**] Alternative Yeast Nuclear code. (Genebank transl_table=12).
10. [**Ascidian mtDNA**] Ascidian mitochondrial DNA code. (Genebank transl_table=13).
11. [**Flatworm mtDNA**] Flatworm mitochondrial DNA code. (Genebank transl_table=14).
12. [**Blepharisma Nuclear**] Blepharisma Nuclear code. (Genebank transl_table=15).
13. [**Chlorophycean mtDNA**] Chlorophycean Mitochondrial Code (transl_table=16).
14. [**Trematode mtDNA**] Trematode Mitochondrial Code (transl_table=21).
15. [**Scenedesmus obliquus mtDNA**] Scenedesmus obliquus mitochondrial Code (transl_table=22).
16. [**Thraustochytrium mtDNA**] Thraustochytrium Mitochondrial Code (transl_table=23).
17. [**Pterobranchia mtDNA**] Pterobranchia Mitochondrial Code (transl_table=24).
18. [**SR1 and Gracilibacteria**] Candidate Division SR1 and Gracilibacteria Code (transl_table=25).
19. [**Pachysolen Nuclear**] Pachysolen tannophilus Nuclear Code (transl_table=26).
>Please choose an option (or press q to cancel selection):
>Select a coding sequence alignment file (`/usr/local/lib/hyphy/TemplateBatchFiles/SelectionAnalyses/`)
>A tree was found in the data file: `(C1,C2,C4,C5,C6,(((C10,C11,C8,C9),C3),C7))`
>Would you like to use it (y/n)?
>Loaded a multiple sequence alignment with **11** sequences, **19** codons, and **1** partitions from `/data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/results/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1.fna`
> FUBAR will write cache and result files to _/data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/results/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1.fna.FUBAR.cache_ and _/data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/results/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1.fna.FUBAR.json_, respectively
> Number of grid points per dimension (total number is D^2) (permissible range = [5,50], default value = 20, integer):
####Posterior estimation method
1. [**Metropolis-Hastings**] Full Metropolis-Hastings MCMC algorithm (slowest, original 2013 paper implementation)
2. [**Collapsed Gibbs**] Collapsed Gibbs sampler (intermediate speed)
3. [**Variational Bayes**] 0-th order Variational Bayes approximations (fastest, recommended default)
>Please choose an option (or press q to cancel selection):> The concentration parameter of the Dirichlet prior (permissible range = [0.001,1], default value = 0.5):
### Obtaining branch lengths and nucleotide substitution biases under the nucleotide GTR model
* Log(L) = -132.88, AIC-c = 311.44 (22 estimated parameters)
* Tree length (expected substitutions/site) for partition 1 : 0.225
### Computing the phylogenetic likelihood function on the grid
* Determining appropriate tree scaling based on the best score from a 20 x 20 rate grid
* Best scaling achieved for
* synonymous rate = 1.227
* non-synonymous rate = 1.000
* Computing conditional site likelihoods on a 20 x 20 rate grid
### Running an iterative zeroth order variational Bayes procedure to estimate the posterior mean of rate weights
* Using the following settings
* Dirichlet alpha : 0.5
### Tabulating site-level results
----
## FUBAR inferred no sites under subject to positive selection at posterior probability >= 0.9
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1 STTIDQSYLNECGVLVQLD
FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1 GATMDQSYLNECGVLVQLD
K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_10 SFTVDQSYLNECGVLVQLD
171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_11 SSTVDQSYLNECGVLVQLD
. *:***************
>171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1 AGTTCTACTGTTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1 AGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1 GGTGCTACCATGGACCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 AGTTCTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 AGTTCTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1 AGTTTTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1 AGTTCTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC
>171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD >Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1 STTIDQSYLNECGVLVQLD >FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1 GATMDQSYLNECGVLVQLD >K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD >S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD >UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1 SFTVDQSYLNECGVLVQLD >partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
Reading sequence file /data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/fasta/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1 Found 11 sequences of length 57 Alignment looks like a valid DNA alignment. Estimated diversity is (pairwise deletion - ignoring missing/ambig): 7.1% Found 6 informative sites. Writing alignment of informative sites to: Phi.inf.sites Writing list of informative sites to: Phi.inf.list Calculating all pairwise incompatibilities... Done: 0.0%100.0% Using a window size of 80 with k as 8 Too few informative sites to use normal approximation. Try doing a permutation test or increasing alignment length Can also try decreasing windowsize.
#NEXUS
[ID: 7555419412]
begin taxa;
dimensions ntax=11;
taxlabels
171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1
UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1
partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1
79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1
A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1
Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1
DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1
FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1
Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1
K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1
S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1
;
end;
begin trees;
translate
1 171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1,
2 UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1,
3 partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1,
4 79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1,
5 A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1,
6 Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1,
7 DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1,
8 FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1,
9 Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1,
10 K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1,
11 S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:6.226442e-03,4:6.393667e-03,6:6.261856e-03,7:1.227361e-02,8:6.343534e-03,(((2:1.539478e-02,3:6.385401e-03,10:6.225724e-03,11:6.431155e-03)0.678:1.491957e-02,5:8.617870e-03)0.939:3.776619e-02,9:5.073591e-02)0.732:3.236592e-02);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:6.226442e-03,4:6.393667e-03,6:6.261856e-03,7:1.227361e-02,8:6.343534e-03,(((2:1.539478e-02,3:6.385401e-03,10:6.225724e-03,11:6.431155e-03):1.491957e-02,5:8.617870e-03):3.776619e-02,9:5.073591e-02):3.236592e-02);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -141.73 -152.56
2 -141.72 -154.91
--------------------------------------
TOTAL -141.73 -154.31
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.324707 0.022122 0.110791 0.607763 0.297195 1271.40 1386.20 1.000
r(A<->C){all} 0.063787 0.003933 0.000012 0.192315 0.044259 284.09 289.43 1.005
r(A<->G){all} 0.342964 0.017076 0.093315 0.591816 0.339198 93.45 133.24 1.010
r(A<->T){all} 0.077452 0.004119 0.000008 0.208162 0.062552 204.26 224.26 1.000
r(C<->G){all} 0.064250 0.003871 0.000002 0.184231 0.045722 194.15 214.29 1.000
r(C<->T){all} 0.352910 0.015936 0.117457 0.594664 0.345420 113.65 139.43 1.015
r(G<->T){all} 0.098637 0.004746 0.000317 0.234816 0.083536 183.80 253.12 1.010
pi(A){all} 0.241663 0.002641 0.144656 0.346215 0.239310 669.24 749.83 1.000
pi(C){all} 0.196624 0.002295 0.103435 0.284129 0.194183 645.99 762.79 1.004
pi(G){all} 0.276434 0.002825 0.182206 0.386350 0.274207 872.33 893.15 1.001
pi(T){all} 0.285279 0.003089 0.180605 0.394718 0.283671 821.25 855.12 1.001
alpha{1,2} 0.582281 0.528540 0.000224 1.982054 0.327552 780.91 827.42 1.001
alpha{3} 1.509678 1.261131 0.001708 3.829231 1.216155 1136.70 1168.23 1.000
pinvar{all} 0.325199 0.038307 0.001402 0.665188 0.312099 593.74 659.56 1.002
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
[2J[H /HYPHY 2.3.14.20190214beta(MP) for Linux on x86_64\ ***************** TYPES OF STANDARD ANALYSES ***************** (1) Selection Analyses (2) Evolutionary Hypothesis Testing (3) Relative evolutionary rate inference (4) Coevolutionary analysis (5) Basic Analyses (6) Codon Selection Analyses (7) Compartmentalization (8) Data File Tools (9) Miscellaneous (10) Model Comparison (11) Kernel Analysis Tools (12) Molecular Clock (13) Phylogeny Reconstruction (14) Positive Selection (15) Recombination (16) Selection/Recombination (17) Relative Rate (18) Relative Ratio (19) Substitution Rates Please select type of analyses you want to list (or press ENTER to process custom batch file):[2J[H***************** FILES IN 'Selection Analyses' ***************** (1) [MEME] Test for episodic site-level selection using MEME (Mixed Effects Model of Evolution). (2) [FEL] Test for pervasive site-level selection using FEL (Fixed Effects Likelihood). (3) [SLAC] Test for pervasive site-level selection using SLAC (Single Likelihood Ancestor Counting). (4) [FUBAR] Test for pervasive site-level selection using FUBAR (Fast Unconstrained Bayesian AppRoximation for inferring selection). (5) [BUSTED] Test for episodic gene-wide selection using BUSTED (Branch-site Unrestricted Statistical Test of Episodic Diversification). (6) [aBSREL] Test for lineage-specific evolution using the branch-site method aBS-REL (Adaptive Branch-Site Random Effects Likelihood). (7) [RELAX] Test for relaxation of selection pressure along a specified set of test branches using RELAX (a random effects test of selection relaxation). Please select the analysis you would like to perform (or press ENTER to return to the list of analysis types): Analysis Description -------------------- Perform a Fast Unbiased AppRoximate Bayesian (FUBAR) analysis of a coding sequence alignment to determine whether some sites have been subject to pervasive purifying or diversifying selection. v2.1 introduces two more methods for estimating the posterior distribution of grid weights: collapsed Gibbs MCMC (faster) and 0-th order Variation Bayes approximation (fastest). Please note that a FUBAR analysis generates a cache and a results JSON file in the same directory as directory as the original alignment. HyPhy needs to have write privileges to this directory. For example if the original file is in /home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there will also exist FUBAR-generated files /home/sergei/FUBAR/data/pol.nex.FUBAR.json, /home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also provide checkpointing so that a partially completed analysis can be restarted. - __Requirements__: in-frame codon alignment (possibly partitioned) and a phylogenetic tree (one per partition) - __Citation__: FUBAR: a fast, unconstrained bayesian approximation for inferring selection (2013), Mol Biol Evol. 30(5):1196-205 - __Written by__: Sergei L Kosakovsky Pond - __Contact Information__: spond@temple.edu - __Analysis Version__: 2.1 ####Choose Genetic Code 1. [**Universal**] Universal code. (Genebank transl_table=1). 2. [**Vertebrate mtDNA**] Vertebrate mitochondrial DNA code. (Genebank transl_table=2). 3. [**Yeast mtDNA**] Yeast mitochondrial DNA code. (Genebank transl_table=3). 4. [**Mold/Protozoan mtDNA**] Mold, Protozoan and Coelenterate mitochondrial DNA and the Mycloplasma/Spiroplasma code. (Genebank transl_table=4). 5. [**Invertebrate mtDNA**] Invertebrate mitochondrial DNA code. (Genebank transl_table=5). 6. [**Ciliate Nuclear**] Ciliate, Dasycladacean and Hexamita Nuclear code. (Genebank transl_table=6). 7. [**Echinoderm mtDNA**] Echinoderm mitochondrial DNA code. (Genebank transl_table=9). 8. [**Euplotid Nuclear**] Euplotid Nuclear code. (Genebank transl_table=10). 9. [**Alt. Yeast Nuclear**] Alternative Yeast Nuclear code. (Genebank transl_table=12). 10. [**Ascidian mtDNA**] Ascidian mitochondrial DNA code. (Genebank transl_table=13). 11. [**Flatworm mtDNA**] Flatworm mitochondrial DNA code. (Genebank transl_table=14). 12. [**Blepharisma Nuclear**] Blepharisma Nuclear code. (Genebank transl_table=15). 13. [**Chlorophycean mtDNA**] Chlorophycean Mitochondrial Code (transl_table=16). 14. [**Trematode mtDNA**] Trematode Mitochondrial Code (transl_table=21). 15. [**Scenedesmus obliquus mtDNA**] Scenedesmus obliquus mitochondrial Code (transl_table=22). 16. [**Thraustochytrium mtDNA**] Thraustochytrium Mitochondrial Code (transl_table=23). 17. [**Pterobranchia mtDNA**] Pterobranchia Mitochondrial Code (transl_table=24). 18. [**SR1 and Gracilibacteria**] Candidate Division SR1 and Gracilibacteria Code (transl_table=25). 19. [**Pachysolen Nuclear**] Pachysolen tannophilus Nuclear Code (transl_table=26). >Please choose an option (or press q to cancel selection): >Select a coding sequence alignment file (`/usr/local/lib/hyphy/TemplateBatchFiles/SelectionAnalyses/`) >A tree was found in the data file: `(C1,C2,C4,C5,C6,(((C10,C11,C8,C9),C3),C7))` >Would you like to use it (y/n)? >Loaded a multiple sequence alignment with **11** sequences, **19** codons, and **1** partitions from `/data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/results/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1.fna` > FUBAR will write cache and result files to _/data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/results/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1.fna.FUBAR.cache_ and _/data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/fubar/results/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1.fna.FUBAR.json_, respectively > Number of grid points per dimension (total number is D^2) (permissible range = [5,50], default value = 20, integer): ####Posterior estimation method 1. [**Metropolis-Hastings**] Full Metropolis-Hastings MCMC algorithm (slowest, original 2013 paper implementation) 2. [**Collapsed Gibbs**] Collapsed Gibbs sampler (intermediate speed) 3. [**Variational Bayes**] 0-th order Variational Bayes approximations (fastest, recommended default) >Please choose an option (or press q to cancel selection):> The concentration parameter of the Dirichlet prior (permissible range = [0.001,1], default value = 0.5): ### Obtaining branch lengths and nucleotide substitution biases under the nucleotide GTR model * Log(L) = -132.88, AIC-c = 311.44 (22 estimated parameters) * Tree length (expected substitutions/site) for partition 1 : 0.225 ### Computing the phylogenetic likelihood function on the grid * Determining appropriate tree scaling based on the best score from a 20 x 20 rate grid * Best scaling achieved for * synonymous rate = 1.227 * non-synonymous rate = 1.000 * Computing conditional site likelihoods on a 20 x 20 rate grid ### Running an iterative zeroth order variational Bayes procedure to estimate the posterior mean of rate weights * Using the following settings * Dirichlet alpha : 0.5 ### Tabulating site-level results ---- ## FUBAR inferred no sites under subject to positive selection at posterior probability >= 0.9
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken # ### General parameters ### # # The maximum number of sequences to use for the master file sequence_limit=90 # The random seed random_seed=3976763 # ### Alignment ### # # The alignment method: clustalw, muscle, kalign, t_coffee, or amap align_method=muscle # Minimum support value for amino acid positions in the alignment tcoffee_min_score=3 # ### MrBayes ### # # Number of iterations in MrBayes mrbayes_generations=1000000 # MrBayes burnin mrbayes_burnin=2500 # ### FUBAR ### # # The maximum number of sequences to be used by FUBAR. fubar_sequence_limit=90 # The number of FUBAR runs fubar_runs=1 # ### codeML ### # # The maximum number of sequences to be used by CodeML codeml_sequence_limit=30 # The number of CodeML runs codeml_runs=1 # The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'. codeml_models=1 2 7 8 # ### OmegaMap ### # # The maximum number of sequences to use in OmegaMap omegamap_sequence_limit=90 # The number of OmegaMap runs omegamap_runs=1 # The number of OmegaMap iterations omegamap_iterations=2500
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
