--- EXPERIMENT NOTES
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken.
#
### General parameters ###
#
# The maximum number of sequences to use for the master file
sequence_limit=90
# The random seed
random_seed=3976763
#
### Alignment ###
#
# The alignment method: clustalw, muscle, kalign, t_coffee, or amap
align_method=muscle
# Minimum support value for amino acid positions in the alignment
tcoffee_min_score=3
#
### MrBayes ###
#
# Number of iterations in MrBayes
mrbayes_generations=1000000
# MrBayes burnin
mrbayes_burnin=2500
#
### FUBAR ###
#
# The maximum number of sequences to be used by FUBAR.
fubar_sequence_limit=90
# The number of FUBAR runs
fubar_runs=1
#
### codeML ###
#
# The maximum number of sequences to be used by CodeML
codeml_sequence_limit=30
# The number of CodeML runs
codeml_runs=1
# The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'.
codeml_models=1 2 7 8
#
### OmegaMap ###
#
# The maximum number of sequences to use in OmegaMap
omegamap_sequence_limit=90
# The number of OmegaMap runs
omegamap_runs=1
# The number of OmegaMap iterations
omegamap_iterations=2500
--- EXPERIMENT PROPERTIES
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -72.05 -74.47
2 -72.07 -74.78
--------------------------------------
TOTAL -72.06 -74.64
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 9.060323 101.864467 0.000003 29.013160 5.884873 1017.15 1233.78 1.000
r(A<->C){all} 0.165592 0.018922 0.000266 0.435340 0.129797 215.70 219.74 1.000
r(A<->G){all} 0.161673 0.017703 0.000015 0.425335 0.129403 138.29 143.64 1.000
r(A<->T){all} 0.156101 0.019405 0.000030 0.447208 0.113951 113.26 258.98 1.004
r(C<->G){all} 0.171670 0.019629 0.000149 0.451438 0.139285 205.80 218.84 1.000
r(C<->T){all} 0.184021 0.023248 0.000064 0.491020 0.143781 135.99 183.63 1.009
r(G<->T){all} 0.160944 0.018572 0.000031 0.441283 0.123745 90.75 126.98 1.000
pi(A){all} 0.253509 0.003285 0.147406 0.369375 0.251334 774.36 809.19 1.000
pi(C){all} 0.218975 0.002935 0.119419 0.325882 0.216659 1040.30 1051.19 1.000
pi(G){all} 0.291540 0.003828 0.169117 0.407766 0.290671 826.83 936.90 1.002
pi(T){all} 0.235976 0.003257 0.132748 0.352200 0.231704 1005.26 1005.69 1.001
alpha{1,2} 0.919965 0.987703 0.000221 2.845420 0.599634 1068.82 1144.92 1.000
alpha{3} 0.938031 0.953241 0.000064 2.806031 0.636980 998.71 1025.89 1.000
pinvar{all} 0.937445 0.021866 0.636041 0.999970 0.981684 86.72 155.66 1.013
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
--- CODEML SUMMARY
Model 1: NearlyNeutral -66.539930
Model 2: PositiveSelection -66.539930
Model 7: beta -66.539927
Model 8: beta&w>1 -66.539930
Model 2 vs 1 0
Model 8 vs 7 -.000006
-- Starting log on Fri Oct 21 22:38:33 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.05 sec, SCORE=1000, Nseq=4, Len=17
C1 STDQAYLNGQGALVQLD
C2 STDQAYLNGQGALVQLD
C3 STDQAYLNGQGALVQLD
C4 STDQAYLNGQGALVQLD
*****************
-- Starting log on Fri Oct 21 22:39:02 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=4, Len=17
C1 STDQAYLNGQGALVQLD
C2 STDQAYLNGQGALVQLD
C3 STDQAYLNGQGALVQLD
C4 STDQAYLNGQGALVQLD
*****************
-- Starting log on Fri Oct 21 22:49:55 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/gapped_alignment/codeml,HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1--
MrBayes v3.2.6 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/mrbayes_input.nex"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 4 taxa and 51 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1666392597
Setting output file names to "/data/mrbayes_input.nex.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called 'first_pos'
Defining charset called 'second_pos'
Defining charset called 'third_pos'
Defining partition called 'by_codon'
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1189421880
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 8314311582
Seed = 1674557132
Swapseed = 1666392597
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Active parameters:
Partition(s)
Parameters 1 2 3
---------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
---------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:GammaDir(1.0,0.1000,1.0,1.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.00 % Dirichlet(Revmat{all})
1.00 % Slider(Revmat{all})
1.00 % Dirichlet(Pi{all})
1.00 % Slider(Pi{all})
2.00 % Multiplier(Alpha{1,2})
2.00 % Multiplier(Alpha{3})
2.00 % Slider(Pinvar{all})
10.00 % ExtSPR(Tau{all},V{all})
10.00 % NNI(Tau{all},V{all})
10.00 % ParsSPR(Tau{all},V{all})
40.00 % Multiplier(V{all})
14.00 % Nodeslider(V{all})
6.00 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -75.590765 -- 13.556448
Chain 2 -- -75.590765 -- 13.556448
Chain 3 -- -75.590765 -- 13.556448
Chain 4 -- -75.590765 -- 13.556448
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -75.590765 -- 13.556448
Chain 2 -- -75.590765 -- 13.556448
Chain 3 -- -75.590765 -- 13.556448
Chain 4 -- -75.590765 -- 13.556448
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-75.591] (-75.591) (-75.591) (-75.591) * [-75.591] (-75.591) (-75.591) (-75.591)
1000 -- (-74.010) [-73.554] (-76.943) (-72.634) * (-72.092) [-71.550] (-72.874) (-71.794) -- 0:00:00
2000 -- [-71.071] (-72.107) (-75.378) (-72.240) * (-73.880) (-77.379) (-73.869) [-72.610] -- 0:00:00
3000 -- (-72.998) [-72.948] (-74.849) (-73.636) * (-75.733) (-73.863) (-72.241) [-73.176] -- 0:00:00
4000 -- [-78.325] (-71.015) (-76.480) (-77.066) * [-71.220] (-72.454) (-73.880) (-72.857) -- 0:00:00
5000 -- (-81.461) [-73.304] (-78.400) (-71.455) * (-71.796) (-76.569) (-73.326) [-71.129] -- 0:00:00
Average standard deviation of split frequencies: 0.209513
6000 -- (-79.484) (-78.061) (-83.889) [-72.220] * (-74.638) (-73.711) [-72.568] (-77.370) -- 0:00:00
7000 -- (-79.850) (-72.289) (-78.524) [-74.019] * (-79.575) [-71.993] (-72.352) (-72.740) -- 0:02:21
8000 -- (-74.181) (-73.481) (-76.516) [-74.045] * (-80.278) [-72.000] (-71.852) (-71.797) -- 0:02:04
9000 -- (-74.293) [-72.186] (-77.510) (-73.845) * (-71.510) (-75.813) [-71.867] (-73.338) -- 0:01:50
10000 -- (-75.082) (-74.794) (-72.382) [-73.846] * (-72.417) (-74.395) [-73.916] (-72.120) -- 0:01:39
Average standard deviation of split frequencies: 0.265165
11000 -- (-74.859) [-71.909] (-76.399) (-74.410) * (-72.376) (-77.043) [-73.062] (-73.568) -- 0:01:29
12000 -- (-75.335) (-70.886) (-71.195) [-73.417] * [-72.546] (-72.393) (-73.067) (-72.240) -- 0:01:22
13000 -- (-78.009) [-70.874] (-72.658) (-77.719) * (-72.956) [-71.616] (-74.330) (-73.676) -- 0:01:15
14000 -- (-75.467) [-71.926] (-71.785) (-73.206) * (-71.146) (-78.520) [-71.139] (-72.920) -- 0:01:10
15000 -- (-75.559) (-72.690) (-72.278) [-72.606] * [-72.703] (-75.413) (-75.069) (-73.277) -- 0:01:05
Average standard deviation of split frequencies: 0.157135
16000 -- (-75.159) [-71.243] (-71.851) (-77.775) * [-71.665] (-74.972) (-73.258) (-79.474) -- 0:01:01
17000 -- (-73.899) (-72.184) (-77.706) [-75.240] * (-75.468) (-72.790) [-76.439] (-76.955) -- 0:00:57
18000 -- (-71.831) (-70.944) (-74.374) [-77.179] * (-77.882) (-76.294) [-71.703] (-72.419) -- 0:00:54
19000 -- (-73.740) (-72.093) (-74.713) [-72.164] * (-74.673) (-71.203) [-71.255] (-75.892) -- 0:01:43
20000 -- (-72.334) [-71.443] (-73.308) (-75.187) * (-72.278) (-72.175) [-72.336] (-71.723) -- 0:01:38
Average standard deviation of split frequencies: 0.121653
21000 -- (-73.760) [-71.843] (-72.740) (-73.345) * (-73.565) (-74.196) (-75.851) [-72.487] -- 0:01:33
22000 -- (-72.970) (-72.582) [-74.257] (-71.744) * (-75.882) (-74.906) [-71.855] (-83.852) -- 0:01:28
23000 -- (-71.651) [-71.150] (-73.975) (-72.253) * [-71.002] (-77.708) (-71.356) (-73.017) -- 0:01:24
24000 -- (-70.797) [-71.762] (-72.212) (-71.163) * (-72.433) (-74.563) [-73.426] (-76.058) -- 0:01:21
25000 -- (-71.834) [-72.629] (-73.589) (-70.635) * [-73.201] (-71.695) (-79.193) (-71.981) -- 0:01:18
Average standard deviation of split frequencies: 0.072524
26000 -- (-71.816) (-71.819) [-75.408] (-71.897) * (-74.347) (-71.355) [-73.561] (-71.217) -- 0:01:14
27000 -- (-71.863) (-74.349) (-71.120) [-75.023] * (-72.060) (-73.583) [-72.942] (-71.790) -- 0:01:12
28000 -- (-71.795) [-71.610] (-73.316) (-72.293) * (-71.685) (-73.769) [-73.410] (-73.187) -- 0:01:09
29000 -- (-71.206) (-72.272) [-71.127] (-75.842) * (-74.058) (-71.869) [-71.564] (-81.265) -- 0:01:06
30000 -- (-71.404) [-75.889] (-76.786) (-74.736) * (-71.118) (-71.477) [-71.603] (-72.895) -- 0:01:04
Average standard deviation of split frequencies: 0.061488
31000 -- [-74.199] (-75.923) (-72.487) (-73.641) * (-72.375) (-72.642) [-72.885] (-72.823) -- 0:01:33
32000 -- (-73.787) (-71.254) [-72.930] (-71.983) * (-76.391) (-71.973) [-72.555] (-73.658) -- 0:01:30
33000 -- [-70.887] (-74.322) (-73.940) (-73.769) * (-71.688) (-72.724) [-72.462] (-77.179) -- 0:01:27
34000 -- [-72.793] (-73.228) (-72.995) (-70.672) * (-76.261) (-72.751) [-70.767] (-76.822) -- 0:01:25
35000 -- [-72.505] (-71.321) (-71.743) (-74.398) * (-72.234) (-72.754) [-74.071] (-74.247) -- 0:01:22
Average standard deviation of split frequencies: 0.061108
36000 -- [-71.852] (-72.377) (-73.745) (-72.957) * (-72.008) (-79.334) [-73.035] (-73.591) -- 0:01:20
37000 -- (-72.082) [-71.123] (-75.011) (-73.476) * (-71.864) (-71.723) [-72.495] (-73.661) -- 0:01:18
38000 -- (-77.822) [-71.334] (-71.147) (-88.187) * [-75.008] (-75.215) (-72.845) (-72.981) -- 0:01:15
39000 -- (-71.083) (-72.129) [-76.808] (-73.708) * (-75.316) (-70.846) [-71.940] (-75.604) -- 0:01:13
40000 -- (-73.885) [-71.665] (-72.660) (-71.316) * (-74.597) (-71.169) [-70.928] (-73.420) -- 0:01:12
Average standard deviation of split frequencies: 0.069551
41000 -- (-73.171) (-71.993) (-73.866) [-72.006] * (-71.638) (-71.748) [-72.287] (-76.942) -- 0:01:10
42000 -- [-74.013] (-73.886) (-70.436) (-72.617) * (-72.471) (-71.336) [-74.013] (-72.023) -- 0:01:08
43000 -- (-75.624) (-72.728) [-71.683] (-71.952) * [-72.078] (-71.430) (-72.010) (-70.729) -- 0:01:06
44000 -- (-76.358) [-77.133] (-72.596) (-70.925) * (-71.870) (-71.523) (-71.543) [-71.627] -- 0:01:26
45000 -- [-73.382] (-72.006) (-73.001) (-74.355) * [-71.169] (-72.132) (-71.706) (-72.449) -- 0:01:24
Average standard deviation of split frequencies: 0.061488
46000 -- (-71.148) (-71.996) [-72.824] (-70.982) * [-71.350] (-73.887) (-72.697) (-70.771) -- 0:01:22
47000 -- [-73.718] (-71.804) (-70.986) (-73.138) * [-73.791] (-70.849) (-72.678) (-72.660) -- 0:01:21
48000 -- (-71.551) [-71.352] (-73.523) (-73.455) * (-70.959) [-72.448] (-71.941) (-72.779) -- 0:01:19
49000 -- (-77.181) [-72.846] (-75.538) (-72.848) * (-72.005) (-71.470) (-72.599) [-70.776] -- 0:01:17
50000 -- (-72.804) [-71.800] (-72.727) (-76.237) * [-71.939] (-71.860) (-74.054) (-72.212) -- 0:01:16
Average standard deviation of split frequencies: 0.068230
51000 -- (-73.309) [-72.372] (-73.906) (-72.279) * (-75.252) (-75.096) [-74.635] (-72.007) -- 0:01:14
52000 -- (-71.681) (-72.953) [-71.877] (-73.877) * (-72.361) (-70.712) [-71.415] (-73.568) -- 0:01:12
53000 -- (-70.486) [-72.324] (-71.184) (-72.996) * (-71.925) (-71.567) [-70.913] (-72.855) -- 0:01:11
54000 -- (-72.232) (-75.949) [-71.846] (-72.566) * [-72.907] (-74.415) (-71.481) (-71.610) -- 0:01:10
55000 -- (-74.501) (-81.455) [-72.209] (-70.780) * (-73.279) [-74.185] (-73.100) (-73.276) -- 0:01:08
Average standard deviation of split frequencies: 0.056120
56000 -- (-70.791) (-76.982) [-73.035] (-71.462) * (-71.856) [-73.236] (-71.439) (-72.697) -- 0:01:24
57000 -- (-71.847) (-73.330) [-73.533] (-72.315) * (-74.543) (-82.274) (-73.280) [-72.014] -- 0:01:22
58000 -- (-72.274) (-71.968) [-74.277] (-73.384) * (-74.984) (-81.616) (-73.153) [-71.396] -- 0:01:21
59000 -- (-71.148) (-71.908) (-71.160) [-72.647] * (-71.240) (-74.609) [-73.751] (-71.190) -- 0:01:19
60000 -- [-71.141] (-72.781) (-71.411) (-71.967) * (-71.695) [-71.224] (-72.199) (-75.943) -- 0:01:18
Average standard deviation of split frequencies: 0.046622
61000 -- [-77.311] (-72.302) (-71.305) (-76.538) * [-74.261] (-72.484) (-74.472) (-73.225) -- 0:01:16
62000 -- [-72.654] (-76.146) (-70.696) (-72.685) * (-73.289) (-74.174) (-75.824) [-75.098] -- 0:01:15
63000 -- (-71.738) (-72.536) (-73.085) [-75.276] * [-72.066] (-74.655) (-74.119) (-72.524) -- 0:01:14
64000 -- (-73.129) [-73.433] (-72.151) (-73.269) * (-71.451) (-74.907) (-70.794) [-73.622] -- 0:01:13
65000 -- (-74.201) (-73.551) [-71.384] (-72.938) * [-71.782] (-71.637) (-72.848) (-72.095) -- 0:01:11
Average standard deviation of split frequencies: 0.042855
66000 -- [-72.990] (-75.628) (-73.002) (-72.542) * [-71.367] (-71.809) (-74.318) (-75.156) -- 0:01:10
67000 -- (-72.482) (-75.476) [-75.535] (-74.686) * (-71.313) (-73.024) [-75.102] (-74.455) -- 0:01:09
68000 -- (-71.752) (-70.650) (-76.066) [-71.150] * (-71.554) (-75.188) (-77.299) [-73.390] -- 0:01:08
69000 -- (-71.473) [-73.750] (-71.919) (-72.345) * (-71.671) (-73.368) (-71.101) [-71.024] -- 0:01:20
70000 -- (-71.402) (-72.641) (-73.835) [-70.551] * (-71.372) (-74.728) [-71.068] (-72.244) -- 0:01:19
Average standard deviation of split frequencies: 0.053367
71000 -- (-71.466) (-73.521) [-71.651] (-74.354) * [-73.914] (-72.585) (-71.510) (-76.117) -- 0:01:18
72000 -- (-70.836) (-71.632) (-70.923) [-71.939] * (-71.686) (-73.972) (-72.520) [-75.733] -- 0:01:17
73000 -- (-72.039) (-71.048) (-74.864) [-73.254] * (-71.707) (-75.201) [-74.006] (-72.809) -- 0:01:16
74000 -- (-71.955) (-71.962) (-71.233) [-70.891] * (-72.318) (-73.313) [-72.760] (-72.144) -- 0:01:15
75000 -- [-71.994] (-72.446) (-71.000) (-71.847) * (-71.245) (-70.861) [-73.527] (-75.619) -- 0:01:14
Average standard deviation of split frequencies: 0.062027
76000 -- (-72.068) [-72.839] (-73.659) (-71.406) * [-73.119] (-72.775) (-73.453) (-73.859) -- 0:01:12
77000 -- [-71.148] (-71.745) (-74.927) (-70.987) * (-72.609) (-73.102) [-73.093] (-71.866) -- 0:01:11
78000 -- (-75.633) [-71.657] (-71.939) (-71.908) * (-77.155) [-73.293] (-74.075) (-73.514) -- 0:01:10
79000 -- (-75.195) (-70.940) (-73.728) [-75.361] * (-75.763) [-72.159] (-71.174) (-71.660) -- 0:01:09
80000 -- (-76.154) [-72.671] (-71.636) (-76.782) * (-74.301) (-72.307) [-70.669] (-75.119) -- 0:01:09
Average standard deviation of split frequencies: 0.054543
81000 -- (-78.357) [-72.228] (-73.348) (-73.286) * (-72.016) [-70.862] (-73.786) (-75.989) -- 0:01:19
82000 -- (-76.751) [-71.869] (-75.957) (-72.001) * (-72.891) (-72.198) [-70.990] (-71.956) -- 0:01:18
83000 -- (-75.289) (-73.293) [-72.204] (-71.361) * (-71.528) [-71.880] (-74.040) (-71.726) -- 0:01:17
84000 -- (-72.066) (-74.159) [-71.875] (-72.884) * (-72.038) (-71.327) (-77.045) [-71.714] -- 0:01:16
85000 -- (-71.857) [-71.716] (-72.725) (-75.815) * (-74.549) [-74.901] (-73.400) (-71.388) -- 0:01:15
Average standard deviation of split frequencies: 0.062123
86000 -- (-74.647) (-72.074) [-73.198] (-71.759) * (-70.622) (-71.073) [-75.098] (-73.768) -- 0:01:14
87000 -- (-71.216) (-72.143) (-72.428) [-71.423] * (-71.748) (-71.493) [-75.371] (-72.257) -- 0:01:13
88000 -- (-72.509) [-71.748] (-72.203) (-71.375) * (-72.754) (-72.609) [-73.465] (-70.755) -- 0:01:12
89000 -- [-71.834] (-72.209) (-70.743) (-73.272) * (-71.285) (-74.448) (-73.367) [-74.416] -- 0:01:11
90000 -- (-76.468) (-73.261) [-71.402] (-73.992) * (-71.929) (-73.082) [-72.545] (-72.710) -- 0:01:10
Average standard deviation of split frequencies: 0.062392
91000 -- (-70.827) (-71.935) [-72.510] (-71.545) * [-71.327] (-71.749) (-73.691) (-72.417) -- 0:01:09
92000 -- [-71.216] (-72.879) (-73.142) (-71.425) * (-74.098) [-72.032] (-71.328) (-71.995) -- 0:01:09
93000 -- [-72.126] (-71.090) (-71.766) (-74.428) * (-72.070) (-73.856) [-72.306] (-72.905) -- 0:01:18
94000 -- (-71.253) (-75.104) (-74.089) [-74.960] * (-71.623) (-75.967) (-70.399) [-71.831] -- 0:01:17
95000 -- (-74.403) (-75.821) (-76.269) [-74.212] * (-72.408) (-74.174) (-74.835) [-71.943] -- 0:01:16
Average standard deviation of split frequencies: 0.052378
96000 -- (-73.119) (-72.573) [-73.339] (-74.255) * (-71.833) (-72.125) (-71.479) [-72.228] -- 0:01:15
97000 -- [-71.585] (-72.771) (-72.864) (-74.725) * (-72.423) (-73.613) [-74.774] (-76.778) -- 0:01:14
98000 -- (-73.237) (-72.328) (-76.008) [-75.754] * [-70.856] (-75.108) (-75.083) (-73.458) -- 0:01:13
99000 -- (-74.132) (-74.204) (-74.455) [-70.975] * (-70.802) [-74.376] (-71.156) (-73.415) -- 0:01:12
100000 -- (-72.453) (-73.857) [-72.717] (-73.145) * (-71.655) (-75.383) (-71.031) [-74.783] -- 0:01:12
Average standard deviation of split frequencies: 0.056194
101000 -- (-72.065) (-74.228) (-71.676) [-74.191] * [-71.173] (-72.720) (-73.644) (-78.092) -- 0:01:11
102000 -- (-72.828) (-74.888) [-70.886] (-72.824) * (-72.558) (-76.918) [-72.062] (-78.908) -- 0:01:10
103000 -- (-72.038) [-76.377] (-72.254) (-74.851) * [-73.018] (-72.282) (-71.358) (-73.750) -- 0:01:09
104000 -- (-71.061) (-77.656) (-74.279) [-71.377] * (-74.408) (-74.502) [-73.279] (-71.297) -- 0:01:08
105000 -- (-71.568) (-71.894) (-74.280) [-71.397] * (-75.648) (-72.401) (-71.378) [-72.109] -- 0:01:16
Average standard deviation of split frequencies: 0.047437
106000 -- [-71.563] (-72.888) (-76.101) (-73.396) * (-73.707) [-72.325] (-73.833) (-73.441) -- 0:01:15
107000 -- (-73.601) (-72.721) [-72.721] (-72.504) * (-72.020) [-72.892] (-75.526) (-75.536) -- 0:01:15
108000 -- [-72.311] (-72.747) (-71.585) (-72.871) * (-72.749) (-75.288) [-71.478] (-75.340) -- 0:01:14
109000 -- (-75.063) (-75.874) [-73.037] (-70.607) * (-72.429) (-73.412) [-72.750] (-72.451) -- 0:01:13
110000 -- [-74.767] (-72.663) (-71.963) (-74.915) * (-71.947) (-76.076) (-74.118) [-72.087] -- 0:01:12
Average standard deviation of split frequencies: 0.045437
111000 -- [-71.505] (-73.771) (-77.380) (-72.873) * (-75.033) (-74.406) [-74.352] (-73.859) -- 0:01:12
112000 -- (-71.639) (-70.901) (-73.766) [-70.982] * (-72.766) (-72.329) (-73.818) [-73.926] -- 0:01:11
113000 -- (-71.651) (-73.144) (-72.124) [-73.178] * (-72.594) [-72.087] (-78.508) (-72.187) -- 0:01:10
114000 -- [-73.574] (-71.623) (-72.955) (-71.526) * (-71.305) (-75.415) [-72.857] (-71.819) -- 0:01:09
115000 -- (-73.309) (-72.457) [-73.229] (-72.561) * (-73.161) (-72.253) (-75.174) [-73.204] -- 0:01:09
Average standard deviation of split frequencies: 0.046057
116000 -- [-72.937] (-73.923) (-71.253) (-72.750) * [-72.272] (-72.259) (-73.006) (-77.956) -- 0:01:16
117000 -- (-72.505) (-74.106) (-75.213) [-74.048] * [-76.335] (-71.748) (-81.397) (-71.909) -- 0:01:15
118000 -- (-75.302) (-71.321) (-74.687) [-73.845] * (-74.920) [-72.575] (-76.016) (-72.013) -- 0:01:14
119000 -- (-70.667) (-71.394) (-72.099) [-71.632] * (-71.908) [-73.201] (-73.534) (-73.588) -- 0:01:14
120000 -- (-73.515) [-72.588] (-72.679) (-73.537) * (-74.080) (-72.044) [-72.655] (-74.413) -- 0:01:13
Average standard deviation of split frequencies: 0.054693
121000 -- [-72.453] (-72.152) (-73.664) (-72.474) * (-72.646) [-73.165] (-72.178) (-72.189) -- 0:01:12
122000 -- (-72.230) [-71.329] (-71.617) (-70.991) * (-74.882) [-71.125] (-74.490) (-74.303) -- 0:01:11
123000 -- (-73.396) [-71.827] (-70.777) (-72.617) * (-74.892) (-71.698) [-76.660] (-73.452) -- 0:01:11
124000 -- (-72.605) (-72.741) (-77.721) [-72.857] * (-73.009) (-71.962) (-70.750) [-73.211] -- 0:01:10
125000 -- (-72.542) (-71.179) [-72.673] (-73.465) * [-73.728] (-75.609) (-73.221) (-74.795) -- 0:01:10
Average standard deviation of split frequencies: 0.054872
126000 -- (-72.935) [-71.719] (-73.496) (-71.871) * [-73.669] (-72.666) (-78.064) (-80.039) -- 0:01:09
127000 -- [-71.503] (-74.340) (-72.332) (-71.417) * (-74.287) [-71.042] (-72.880) (-76.386) -- 0:01:08
128000 -- (-70.987) [-75.919] (-72.665) (-74.868) * (-71.847) [-73.975] (-73.126) (-75.861) -- 0:01:08
129000 -- (-70.927) (-71.869) [-71.322] (-70.984) * (-72.280) (-74.860) [-71.670] (-76.707) -- 0:01:14
130000 -- [-73.072] (-72.447) (-73.848) (-73.265) * (-71.278) (-72.387) (-75.819) [-72.773] -- 0:01:13
Average standard deviation of split frequencies: 0.052913
131000 -- (-73.106) (-74.853) (-74.281) [-72.514] * (-73.533) (-72.706) (-74.059) [-76.801] -- 0:01:12
132000 -- (-70.840) (-72.518) [-73.836] (-71.957) * (-75.016) (-71.756) (-71.877) [-74.355] -- 0:01:12
133000 -- (-71.700) (-73.409) [-72.288] (-71.927) * (-72.865) [-71.335] (-72.196) (-73.148) -- 0:01:11
134000 -- (-73.439) [-72.161] (-74.777) (-72.826) * (-71.867) (-71.126) (-70.623) [-73.251] -- 0:01:11
135000 -- (-72.673) (-71.637) (-73.547) [-71.517] * (-72.636) (-72.083) [-71.886] (-75.189) -- 0:01:10
Average standard deviation of split frequencies: 0.041595
136000 -- [-74.114] (-73.027) (-74.111) (-72.927) * [-71.350] (-74.345) (-72.965) (-74.221) -- 0:01:09
137000 -- [-71.903] (-71.944) (-73.654) (-71.719) * (-72.008) [-73.766] (-74.160) (-74.139) -- 0:01:09
138000 -- (-72.779) (-74.853) [-71.104] (-72.315) * (-71.455) (-71.931) [-74.601] (-73.037) -- 0:01:08
139000 -- (-75.384) (-71.339) [-70.849] (-71.834) * (-72.670) [-72.349] (-74.028) (-72.803) -- 0:01:08
140000 -- (-74.233) [-73.865] (-74.303) (-73.371) * (-73.572) (-71.236) (-73.899) [-71.728] -- 0:01:07
Average standard deviation of split frequencies: 0.029044
141000 -- [-74.600] (-73.213) (-70.660) (-73.632) * (-75.004) (-75.001) (-73.569) [-72.304] -- 0:01:07
142000 -- (-70.923) (-72.477) [-71.122] (-71.720) * (-70.833) (-72.332) [-74.547] (-72.833) -- 0:01:12
143000 -- (-70.647) [-75.716] (-72.198) (-74.159) * (-75.656) (-77.251) [-71.231] (-70.928) -- 0:01:11
144000 -- (-72.290) (-73.213) [-75.894] (-71.851) * [-71.037] (-73.058) (-72.711) (-71.657) -- 0:01:11
145000 -- (-71.892) [-71.376] (-75.744) (-72.605) * [-70.565] (-76.744) (-73.429) (-76.403) -- 0:01:10
Average standard deviation of split frequencies: 0.025830
146000 -- (-75.160) [-72.240] (-77.046) (-73.710) * (-71.225) (-72.975) (-70.807) [-73.863] -- 0:01:10
147000 -- (-76.895) [-72.062] (-72.449) (-73.068) * (-72.924) (-71.436) [-73.109] (-73.519) -- 0:01:09
148000 -- (-71.556) [-74.868] (-71.498) (-76.484) * (-73.000) [-71.129] (-72.648) (-74.040) -- 0:01:09
149000 -- (-73.833) [-72.484] (-72.350) (-72.992) * [-71.681] (-72.767) (-72.717) (-73.150) -- 0:01:08
150000 -- (-75.496) [-71.439] (-74.583) (-71.652) * (-72.233) [-71.247] (-71.937) (-72.249) -- 0:01:08
Average standard deviation of split frequencies: 0.029202
151000 -- (-73.381) (-72.563) [-71.523] (-72.357) * (-72.276) (-76.264) [-72.315] (-71.931) -- 0:01:07
152000 -- (-72.176) (-71.757) (-71.576) [-76.235] * (-71.274) (-75.280) [-75.774] (-71.450) -- 0:01:06
153000 -- [-72.390] (-76.358) (-72.465) (-73.665) * (-73.103) (-72.747) [-73.219] (-74.032) -- 0:01:06
154000 -- (-73.784) [-72.587] (-70.847) (-77.058) * [-77.989] (-75.362) (-72.976) (-74.398) -- 0:01:11
155000 -- (-76.035) (-73.193) [-73.288] (-72.351) * (-72.148) (-73.860) (-72.107) [-72.285] -- 0:01:10
Average standard deviation of split frequencies: 0.024175
156000 -- (-71.253) [-74.339] (-76.436) (-72.519) * (-71.599) (-71.908) [-75.001] (-73.944) -- 0:01:10
157000 -- (-73.698) [-70.830] (-71.836) (-70.833) * (-74.092) [-72.277] (-71.685) (-72.639) -- 0:01:09
158000 -- (-72.401) (-73.502) (-71.872) [-71.983] * [-72.203] (-71.584) (-77.783) (-70.892) -- 0:01:09
159000 -- (-71.551) [-72.392] (-71.897) (-72.353) * (-74.383) (-72.688) [-71.362] (-73.725) -- 0:01:08
160000 -- (-73.599) [-71.127] (-71.478) (-73.902) * (-73.504) (-75.101) (-72.812) [-73.673] -- 0:01:08
Average standard deviation of split frequencies: 0.025428
161000 -- (-71.866) [-72.194] (-74.671) (-73.202) * (-73.920) [-73.301] (-76.808) (-75.106) -- 0:01:07
162000 -- (-76.203) [-70.738] (-74.113) (-74.695) * (-73.273) [-71.547] (-74.631) (-73.372) -- 0:01:07
163000 -- (-73.044) (-74.538) (-73.607) [-76.390] * (-72.667) [-72.182] (-71.714) (-73.557) -- 0:01:06
164000 -- [-81.844] (-74.752) (-72.604) (-70.563) * (-72.973) [-70.718] (-71.453) (-71.786) -- 0:01:06
165000 -- [-75.516] (-74.641) (-76.082) (-74.280) * (-73.779) (-71.457) (-71.865) [-71.970] -- 0:01:05
Average standard deviation of split frequencies: 0.028398
166000 -- [-74.783] (-74.985) (-72.922) (-71.883) * (-71.433) (-73.692) (-74.855) [-71.854] -- 0:01:05
167000 -- (-78.324) [-73.970] (-72.998) (-76.875) * [-74.186] (-72.153) (-75.480) (-72.365) -- 0:01:09
168000 -- (-71.277) [-71.482] (-70.894) (-72.634) * (-71.644) [-72.592] (-72.771) (-75.161) -- 0:01:09
169000 -- [-71.122] (-72.132) (-78.258) (-72.021) * [-71.209] (-73.352) (-72.697) (-71.574) -- 0:01:08
170000 -- [-72.743] (-72.680) (-72.514) (-75.936) * (-72.127) [-71.437] (-74.501) (-73.742) -- 0:01:08
Average standard deviation of split frequencies: 0.016573
171000 -- (-70.501) (-75.336) (-73.387) [-71.196] * (-72.640) [-71.281] (-71.723) (-73.452) -- 0:01:07
172000 -- (-73.884) (-73.101) (-73.958) [-73.040] * [-73.717] (-73.949) (-72.966) (-74.349) -- 0:01:07
173000 -- (-76.854) [-71.172] (-74.445) (-70.879) * [-71.506] (-71.989) (-73.601) (-71.953) -- 0:01:06
174000 -- (-72.258) (-72.008) (-72.152) [-71.013] * (-72.731) [-70.753] (-73.929) (-74.912) -- 0:01:06
175000 -- (-73.841) [-74.989] (-74.732) (-73.075) * (-71.652) [-72.625] (-70.907) (-72.665) -- 0:01:06
Average standard deviation of split frequencies: 0.017856
176000 -- (-72.478) [-78.948] (-75.548) (-71.535) * (-74.502) [-72.503] (-72.417) (-71.855) -- 0:01:05
177000 -- [-71.300] (-80.096) (-73.981) (-73.944) * (-71.045) [-74.193] (-74.440) (-72.736) -- 0:01:05
178000 -- [-72.021] (-71.407) (-72.681) (-72.521) * [-72.974] (-75.509) (-74.152) (-72.040) -- 0:01:04
179000 -- [-75.132] (-72.481) (-72.306) (-71.777) * [-72.770] (-72.488) (-75.648) (-72.522) -- 0:01:04
180000 -- (-74.398) (-74.387) (-75.801) [-72.388] * [-72.940] (-74.039) (-73.327) (-73.116) -- 0:01:08
Average standard deviation of split frequencies: 0.015656
181000 -- (-71.905) (-71.210) [-71.056] (-71.477) * (-73.091) (-74.624) [-73.742] (-73.456) -- 0:01:07
182000 -- [-71.828] (-72.474) (-72.239) (-70.892) * (-71.590) [-70.868] (-73.508) (-71.413) -- 0:01:07
183000 -- (-70.596) (-73.471) (-74.763) [-72.276] * (-72.483) [-73.940] (-75.203) (-74.018) -- 0:01:06
184000 -- (-76.124) (-71.260) (-71.147) [-73.081] * (-75.121) (-72.123) [-74.756] (-71.805) -- 0:01:06
185000 -- [-70.611] (-71.700) (-72.804) (-74.248) * (-74.092) (-72.585) [-71.844] (-72.589) -- 0:01:06
Average standard deviation of split frequencies: 0.013517
186000 -- (-72.315) (-72.511) [-73.043] (-71.917) * (-74.461) (-73.453) [-75.435] (-73.403) -- 0:01:05
187000 -- (-71.559) (-73.060) [-72.718] (-74.027) * (-75.304) (-71.877) (-72.316) [-74.499] -- 0:01:05
188000 -- (-73.303) [-72.128] (-71.563) (-73.694) * [-76.143] (-74.255) (-71.959) (-72.517) -- 0:01:04
189000 -- (-71.253) [-71.872] (-73.265) (-72.210) * (-75.427) (-73.842) (-70.994) [-73.790] -- 0:01:04
190000 -- (-75.144) (-77.766) (-76.559) [-71.686] * (-74.331) (-72.160) (-76.606) [-72.227] -- 0:01:03
Average standard deviation of split frequencies: 0.008241
191000 -- (-71.132) (-77.373) (-78.596) [-73.450] * (-73.302) (-73.549) [-74.204] (-74.333) -- 0:01:03
192000 -- (-73.061) (-71.669) (-74.854) [-74.078] * (-71.857) [-70.519] (-71.385) (-72.385) -- 0:01:07
193000 -- [-73.078] (-73.720) (-77.516) (-73.283) * (-72.659) (-74.398) [-73.022] (-73.943) -- 0:01:06
194000 -- (-78.417) (-74.181) [-73.227] (-71.455) * (-72.020) [-71.056] (-72.259) (-74.880) -- 0:01:06
195000 -- (-71.778) [-72.137] (-73.642) (-73.501) * (-71.992) (-71.079) (-74.643) [-74.614] -- 0:01:06
Average standard deviation of split frequencies: 0.004810
196000 -- [-73.598] (-71.721) (-73.676) (-75.230) * (-71.400) (-75.554) [-71.783] (-71.468) -- 0:01:05
197000 -- [-71.974] (-71.833) (-78.012) (-76.709) * (-72.758) [-74.088] (-70.855) (-72.055) -- 0:01:05
198000 -- [-71.821] (-71.982) (-75.858) (-73.087) * (-71.067) (-74.016) [-72.035] (-71.603) -- 0:01:04
199000 -- [-71.372] (-71.581) (-73.625) (-75.747) * [-73.374] (-74.790) (-77.190) (-75.171) -- 0:01:04
200000 -- (-71.510) (-72.248) (-73.245) [-74.140] * (-72.234) [-71.395] (-76.762) (-75.013) -- 0:01:04
Average standard deviation of split frequencies: 0.010963
201000 -- (-75.485) [-71.259] (-70.908) (-72.179) * (-72.780) (-71.675) [-73.617] (-75.917) -- 0:01:03
202000 -- (-73.826) (-72.402) (-71.387) [-74.826] * (-72.358) [-72.894] (-73.379) (-72.002) -- 0:01:03
203000 -- (-71.151) (-72.848) (-73.484) [-79.106] * [-73.903] (-74.517) (-73.163) (-72.697) -- 0:01:02
204000 -- (-72.080) [-74.600] (-73.976) (-72.795) * (-71.563) (-72.303) [-73.889] (-71.802) -- 0:01:02
205000 -- (-74.019) [-72.437] (-74.386) (-76.816) * (-71.803) (-73.316) [-72.807] (-71.901) -- 0:01:05
Average standard deviation of split frequencies: 0.012205
206000 -- (-76.839) (-72.561) (-75.738) [-73.965] * (-72.365) [-74.964] (-76.769) (-73.398) -- 0:01:05
207000 -- [-73.858] (-71.869) (-72.224) (-73.896) * [-73.680] (-73.180) (-71.244) (-73.062) -- 0:01:05
208000 -- (-71.510) [-73.649] (-71.594) (-71.784) * (-70.631) (-71.057) [-72.610] (-70.891) -- 0:01:04
209000 -- [-73.440] (-74.391) (-71.339) (-77.814) * [-73.436] (-71.763) (-71.306) (-72.978) -- 0:01:04
210000 -- (-78.665) (-73.171) (-73.360) [-76.411] * [-75.805] (-73.202) (-73.493) (-72.358) -- 0:01:03
Average standard deviation of split frequencies: 0.014918
211000 -- (-73.667) [-72.492] (-74.738) (-78.639) * [-74.699] (-72.068) (-74.119) (-74.209) -- 0:01:03
212000 -- (-71.377) (-71.205) [-71.083] (-74.700) * [-72.837] (-73.406) (-71.034) (-70.806) -- 0:01:03
213000 -- [-72.241] (-71.379) (-76.110) (-73.286) * [-72.060] (-73.454) (-73.428) (-71.415) -- 0:01:02
214000 -- (-71.241) (-72.886) [-73.810] (-77.128) * (-73.492) [-72.788] (-73.212) (-75.182) -- 0:01:02
215000 -- (-73.571) [-71.305] (-75.066) (-72.712) * (-72.354) (-76.209) [-74.110] (-72.514) -- 0:01:02
Average standard deviation of split frequencies: 0.014550
216000 -- (-70.617) (-71.141) (-76.220) [-73.325] * (-71.604) (-73.080) (-72.785) [-72.203] -- 0:01:01
217000 -- (-72.468) [-74.448] (-73.054) (-76.529) * [-72.514] (-74.076) (-76.123) (-70.944) -- 0:01:04
218000 -- (-71.540) (-73.087) (-74.422) [-72.010] * [-71.975] (-71.445) (-73.756) (-74.129) -- 0:01:04
219000 -- (-71.080) [-71.692] (-71.844) (-73.572) * (-72.446) (-76.419) [-70.839] (-71.476) -- 0:01:04
220000 -- (-72.002) [-73.718] (-71.038) (-71.256) * (-72.969) (-72.233) [-76.317] (-73.628) -- 0:01:03
Average standard deviation of split frequencies: 0.017090
221000 -- (-74.367) [-73.698] (-72.992) (-74.247) * [-71.751] (-72.543) (-71.797) (-72.181) -- 0:01:03
222000 -- [-71.481] (-72.437) (-72.054) (-71.660) * (-71.287) (-74.433) (-72.195) [-70.994] -- 0:01:03
223000 -- (-71.962) [-71.185] (-72.429) (-73.238) * (-75.822) [-71.355] (-72.269) (-72.542) -- 0:01:02
224000 -- (-73.272) (-74.286) (-72.192) [-74.375] * (-75.208) (-72.523) (-72.275) [-73.182] -- 0:01:02
225000 -- (-73.463) (-73.431) [-73.207] (-71.563) * [-72.259] (-72.257) (-71.697) (-73.941) -- 0:01:02
Average standard deviation of split frequencies: 0.019468
226000 -- (-74.985) (-75.313) (-75.470) [-72.880] * (-76.431) (-72.098) [-72.185] (-72.644) -- 0:01:01
227000 -- [-73.047] (-72.900) (-74.864) (-74.558) * (-74.762) [-74.449] (-71.934) (-72.399) -- 0:01:01
228000 -- (-71.633) (-72.210) [-73.211] (-73.778) * (-73.006) [-71.222] (-77.676) (-77.758) -- 0:01:00
229000 -- (-74.660) (-72.251) (-72.544) [-72.781] * [-72.769] (-71.713) (-72.282) (-74.009) -- 0:01:03
230000 -- (-74.047) (-74.211) (-71.781) [-72.047] * [-73.533] (-71.074) (-71.590) (-71.337) -- 0:01:03
Average standard deviation of split frequencies: 0.023161
231000 -- (-72.872) (-74.592) [-72.480] (-71.614) * (-73.962) (-71.932) [-72.611] (-70.991) -- 0:01:03
232000 -- (-72.438) (-72.829) [-72.563] (-73.068) * [-74.242] (-73.141) (-72.402) (-77.758) -- 0:01:02
233000 -- (-77.380) (-71.842) (-71.886) [-74.994] * (-75.844) (-71.700) (-74.968) [-72.097] -- 0:01:02
234000 -- (-74.426) (-72.938) (-71.745) [-71.131] * (-74.967) (-72.100) [-74.968] (-71.377) -- 0:01:02
235000 -- [-74.236] (-71.551) (-74.438) (-72.247) * (-77.240) (-75.171) [-71.056] (-72.932) -- 0:01:01
Average standard deviation of split frequencies: 0.023970
236000 -- [-73.738] (-72.706) (-73.129) (-71.576) * (-74.947) [-72.472] (-71.480) (-72.413) -- 0:01:01
237000 -- (-74.216) (-72.066) (-72.925) [-75.424] * (-71.996) [-73.319] (-74.861) (-72.601) -- 0:01:01
238000 -- (-73.433) [-72.434] (-74.537) (-74.560) * [-71.537] (-71.800) (-71.800) (-72.372) -- 0:01:00
239000 -- (-72.505) [-73.165] (-72.383) (-73.890) * (-71.645) [-71.965] (-72.662) (-71.264) -- 0:01:00
240000 -- (-73.116) [-73.193] (-71.116) (-75.466) * [-71.939] (-71.789) (-71.652) (-73.168) -- 0:01:00
Average standard deviation of split frequencies: 0.027422
241000 -- [-73.135] (-74.251) (-71.877) (-73.818) * (-72.562) (-74.524) (-73.951) [-73.158] -- 0:00:59
242000 -- [-72.528] (-72.163) (-75.458) (-79.681) * (-72.846) (-72.650) [-72.041] (-73.070) -- 0:01:02
243000 -- [-72.143] (-71.914) (-73.937) (-75.558) * [-71.691] (-73.794) (-74.072) (-73.367) -- 0:01:02
244000 -- [-74.413] (-72.790) (-75.270) (-81.063) * [-72.233] (-71.584) (-76.303) (-75.668) -- 0:01:01
245000 -- (-72.080) (-71.202) (-72.939) [-74.473] * (-71.458) [-71.088] (-71.737) (-71.058) -- 0:01:01
Average standard deviation of split frequencies: 0.026828
246000 -- [-71.713] (-73.407) (-73.305) (-72.201) * [-70.975] (-74.976) (-74.272) (-71.966) -- 0:01:01
247000 -- [-72.819] (-70.744) (-77.141) (-73.420) * (-74.196) (-72.114) (-76.319) [-76.733] -- 0:01:00
248000 -- (-71.631) (-74.542) [-71.476] (-71.528) * (-72.791) (-71.955) [-71.007] (-72.712) -- 0:01:00
249000 -- [-72.448] (-71.608) (-75.168) (-80.778) * (-72.414) [-72.442] (-73.137) (-71.708) -- 0:01:00
250000 -- (-75.146) (-73.784) [-72.267] (-73.001) * (-72.494) [-71.699] (-72.372) (-71.657) -- 0:01:00
Average standard deviation of split frequencies: 0.025075
251000 -- (-72.211) (-75.601) [-71.750] (-72.886) * (-70.516) [-70.443] (-73.641) (-74.343) -- 0:00:59
252000 -- [-73.156] (-75.293) (-72.808) (-74.620) * (-74.259) [-73.165] (-72.726) (-72.682) -- 0:00:59
253000 -- (-76.113) (-71.516) [-73.241] (-73.385) * (-71.602) [-71.403] (-71.415) (-78.879) -- 0:00:59
254000 -- (-72.384) (-74.288) (-71.542) [-74.531] * (-76.238) [-72.681] (-71.834) (-75.531) -- 0:01:01
255000 -- (-71.652) (-73.855) (-73.286) [-74.787] * (-71.345) [-73.641] (-71.855) (-72.447) -- 0:01:01
Average standard deviation of split frequencies: 0.028235
256000 -- (-75.171) [-73.693] (-76.136) (-79.510) * (-71.580) [-71.313] (-70.785) (-76.860) -- 0:01:01
257000 -- (-72.588) (-71.663) (-75.120) [-72.514] * (-74.044) [-71.297] (-74.392) (-73.686) -- 0:01:00
258000 -- (-71.024) (-71.217) (-75.563) [-73.177] * (-77.806) [-72.180] (-74.543) (-73.014) -- 0:01:00
259000 -- [-71.551] (-75.579) (-72.522) (-73.485) * [-74.671] (-75.085) (-70.818) (-72.397) -- 0:01:00
260000 -- [-71.666] (-71.671) (-75.261) (-75.861) * (-73.343) (-74.363) (-73.960) [-75.310] -- 0:00:59
Average standard deviation of split frequencies: 0.022907
261000 -- [-72.296] (-71.303) (-72.547) (-71.886) * (-72.608) [-72.121] (-74.182) (-74.287) -- 0:00:59
262000 -- (-71.415) (-72.627) [-73.473] (-75.705) * (-75.923) [-73.012] (-73.287) (-73.260) -- 0:00:59
263000 -- (-76.958) [-75.731] (-71.494) (-74.540) * (-75.762) [-73.501] (-74.853) (-71.962) -- 0:00:58
264000 -- (-73.192) (-73.148) [-71.252] (-72.328) * (-74.410) [-73.033] (-72.087) (-78.951) -- 0:00:58
265000 -- [-75.983] (-72.249) (-70.743) (-73.236) * (-73.089) [-72.163] (-73.352) (-77.183) -- 0:00:58
Average standard deviation of split frequencies: 0.024811
266000 -- [-74.974] (-74.612) (-70.989) (-72.480) * (-71.921) [-71.140] (-73.052) (-73.439) -- 0:00:57
267000 -- (-71.956) (-73.151) (-72.908) [-72.558] * (-73.408) [-74.519] (-72.438) (-71.885) -- 0:01:00
268000 -- (-72.126) [-73.588] (-72.196) (-71.757) * (-72.545) [-73.633] (-75.517) (-74.571) -- 0:01:00
269000 -- [-71.479] (-72.138) (-73.347) (-74.208) * [-72.298] (-73.212) (-73.655) (-72.113) -- 0:00:59
270000 -- (-72.577) (-71.316) (-73.186) [-70.941] * (-78.123) (-75.064) [-73.064] (-72.340) -- 0:00:59
Average standard deviation of split frequencies: 0.022061
271000 -- (-71.550) [-73.315] (-72.188) (-70.553) * [-74.684] (-71.136) (-73.612) (-72.342) -- 0:00:59
272000 -- [-73.923] (-71.610) (-71.616) (-71.943) * [-73.231] (-72.977) (-72.296) (-71.189) -- 0:00:58
273000 -- [-71.046] (-73.007) (-74.349) (-73.975) * (-75.367) (-71.520) [-72.565] (-70.437) -- 0:00:58
274000 -- (-74.301) (-71.947) (-75.009) [-71.319] * (-80.138) [-75.179] (-73.425) (-73.782) -- 0:00:58
275000 -- [-71.314] (-70.771) (-75.094) (-73.308) * (-74.051) [-71.659] (-73.957) (-71.272) -- 0:00:58
Average standard deviation of split frequencies: 0.023912
276000 -- (-73.225) [-72.554] (-71.448) (-72.111) * (-74.205) (-71.428) [-74.110] (-74.792) -- 0:00:57
277000 -- (-71.635) (-77.795) (-75.679) [-72.678] * (-72.537) [-74.509] (-74.530) (-74.367) -- 0:00:57
278000 -- [-71.417] (-71.981) (-72.360) (-72.787) * (-74.946) [-74.612] (-71.765) (-74.918) -- 0:00:57
279000 -- (-70.537) (-76.814) [-72.493] (-73.014) * [-74.934] (-71.618) (-71.804) (-71.892) -- 0:00:56
280000 -- [-72.448] (-71.898) (-77.462) (-72.052) * [-73.365] (-73.278) (-74.920) (-74.335) -- 0:00:59
Average standard deviation of split frequencies: 0.023514
281000 -- (-71.640) (-71.322) (-73.217) [-73.295] * (-71.708) [-70.758] (-72.214) (-71.885) -- 0:00:58
282000 -- (-71.592) [-72.648] (-73.710) (-71.272) * [-71.154] (-70.635) (-72.197) (-71.431) -- 0:00:58
283000 -- (-74.803) [-71.164] (-71.007) (-75.942) * [-72.735] (-71.253) (-75.321) (-72.113) -- 0:00:58
284000 -- (-71.854) (-71.801) [-70.992] (-74.522) * (-74.522) [-72.377] (-76.039) (-71.577) -- 0:00:57
285000 -- [-71.974] (-80.784) (-70.824) (-72.435) * (-72.346) (-73.461) (-72.729) [-73.314] -- 0:00:57
Average standard deviation of split frequencies: 0.024175
286000 -- (-72.742) (-73.573) [-75.295] (-72.565) * (-71.198) [-73.482] (-72.502) (-72.429) -- 0:00:57
287000 -- (-74.402) (-73.194) [-72.326] (-73.119) * (-74.108) (-73.745) [-71.445] (-72.743) -- 0:00:57
288000 -- (-73.909) (-74.687) [-71.603] (-71.072) * (-75.027) (-73.428) [-72.669] (-75.298) -- 0:00:56
289000 -- [-73.678] (-72.681) (-71.140) (-72.977) * (-78.458) [-72.069] (-73.130) (-77.611) -- 0:00:56
290000 -- [-74.412] (-74.182) (-72.274) (-73.571) * (-71.047) (-70.505) (-71.492) [-70.884] -- 0:00:56
Average standard deviation of split frequencies: 0.022705
291000 -- (-71.898) (-75.944) [-73.374] (-74.882) * (-70.665) (-74.437) [-72.190] (-72.126) -- 0:00:56
292000 -- (-71.314) (-75.841) (-74.565) [-73.130] * [-73.670] (-71.214) (-72.109) (-74.375) -- 0:00:58
293000 -- [-71.583] (-70.863) (-74.640) (-71.922) * (-76.450) (-80.943) [-72.100] (-73.017) -- 0:00:57
294000 -- (-71.572) [-72.145] (-72.358) (-73.171) * (-74.432) (-72.488) (-73.288) [-76.923] -- 0:00:57
295000 -- (-72.576) (-73.605) [-74.460] (-75.790) * (-75.810) (-73.724) (-72.060) [-74.566] -- 0:00:57
Average standard deviation of split frequencies: 0.024420
296000 -- [-71.646] (-72.947) (-72.559) (-73.272) * (-77.438) (-70.954) (-70.870) [-74.756] -- 0:00:57
297000 -- [-73.191] (-71.854) (-72.908) (-71.895) * (-72.374) [-70.740] (-71.535) (-74.391) -- 0:00:56
298000 -- (-71.945) (-78.726) [-75.320] (-75.736) * (-71.816) (-71.134) [-73.838] (-73.530) -- 0:00:56
299000 -- [-74.987] (-71.253) (-72.342) (-76.041) * (-73.181) [-76.124] (-73.943) (-73.925) -- 0:00:56
300000 -- (-73.714) (-74.499) [-71.134] (-73.713) * (-72.108) (-74.464) (-70.975) [-72.534] -- 0:00:56
Average standard deviation of split frequencies: 0.021950
301000 -- [-71.532] (-75.701) (-72.013) (-72.837) * [-71.430] (-73.302) (-74.923) (-72.076) -- 0:00:55
302000 -- (-73.037) (-71.998) [-72.406] (-77.183) * (-76.108) [-73.257] (-74.285) (-72.074) -- 0:00:55
303000 -- (-72.277) [-72.522] (-71.473) (-72.908) * [-72.652] (-76.599) (-70.744) (-71.234) -- 0:00:55
304000 -- (-74.553) (-73.742) [-73.745] (-71.432) * [-70.768] (-71.717) (-73.853) (-73.739) -- 0:00:57
305000 -- (-72.121) (-72.596) [-74.138] (-71.346) * [-72.860] (-71.563) (-73.244) (-71.873) -- 0:00:56
Average standard deviation of split frequencies: 0.021568
306000 -- [-73.845] (-72.942) (-71.992) (-71.925) * (-72.118) (-77.365) [-70.880] (-70.751) -- 0:00:56
307000 -- (-76.866) [-72.772] (-72.123) (-71.662) * (-73.237) (-71.022) [-72.008] (-72.132) -- 0:00:56
308000 -- [-74.852] (-74.591) (-71.700) (-71.423) * (-73.015) [-72.992] (-72.164) (-75.122) -- 0:00:56
309000 -- (-70.951) [-74.498] (-74.208) (-71.501) * [-72.497] (-72.097) (-73.307) (-74.768) -- 0:00:55
310000 -- (-75.357) (-74.723) (-73.166) [-72.902] * [-72.184] (-74.390) (-72.368) (-71.069) -- 0:00:55
Average standard deviation of split frequencies: 0.020232
311000 -- (-70.911) (-73.469) [-73.418] (-74.007) * (-71.666) (-71.393) [-72.537] (-70.633) -- 0:00:55
312000 -- (-73.758) (-74.517) [-75.511] (-74.412) * (-71.845) (-75.755) [-73.579] (-70.972) -- 0:00:55
313000 -- (-72.641) (-72.460) (-77.645) [-71.772] * (-72.532) (-70.901) [-71.376] (-76.197) -- 0:00:54
314000 -- (-73.787) (-72.609) (-71.882) [-72.581] * [-72.531] (-76.542) (-73.578) (-72.122) -- 0:00:54
315000 -- [-72.667] (-76.281) (-70.547) (-70.912) * (-72.574) (-71.069) [-70.528] (-75.955) -- 0:00:54
Average standard deviation of split frequencies: 0.019890
316000 -- [-71.782] (-73.382) (-73.635) (-70.959) * (-75.464) (-73.500) [-72.114] (-76.054) -- 0:00:56
317000 -- (-73.591) (-71.230) [-72.783] (-70.833) * [-72.899] (-71.337) (-73.173) (-73.875) -- 0:00:56
318000 -- [-75.368] (-72.819) (-74.545) (-71.631) * [-71.535] (-73.150) (-72.228) (-73.606) -- 0:00:55
319000 -- (-71.596) [-72.055] (-74.763) (-71.798) * (-72.247) (-71.292) [-72.495] (-74.674) -- 0:00:55
320000 -- [-72.002] (-72.285) (-72.521) (-73.717) * (-72.128) (-72.733) (-71.735) [-71.113] -- 0:00:55
Average standard deviation of split frequencies: 0.018621
321000 -- (-74.891) (-71.481) [-72.336] (-74.436) * (-71.677) [-70.960] (-73.639) (-76.667) -- 0:00:54
322000 -- (-76.917) (-75.595) [-72.236] (-72.188) * (-71.746) [-72.986] (-72.969) (-72.243) -- 0:00:54
323000 -- [-73.420] (-74.534) (-71.743) (-76.948) * (-71.283) [-73.662] (-71.225) (-73.427) -- 0:00:54
324000 -- [-72.185] (-73.235) (-74.420) (-73.079) * [-70.871] (-74.622) (-76.178) (-73.345) -- 0:00:54
325000 -- [-72.769] (-74.200) (-72.524) (-71.201) * (-73.273) (-73.360) [-72.764] (-73.144) -- 0:00:54
Average standard deviation of split frequencies: 0.020244
326000 -- [-75.099] (-72.183) (-72.005) (-72.014) * (-75.142) (-73.246) [-75.460] (-71.537) -- 0:00:53
327000 -- [-71.407] (-74.103) (-72.286) (-71.759) * (-76.399) [-71.701] (-73.024) (-72.772) -- 0:00:53
328000 -- (-76.373) (-74.890) (-70.939) [-73.248] * (-72.488) (-73.577) (-73.005) [-74.261] -- 0:00:53
329000 -- [-71.172] (-72.382) (-73.768) (-72.089) * [-72.151] (-73.514) (-75.762) (-71.377) -- 0:00:55
330000 -- [-73.972] (-76.098) (-73.220) (-74.186) * (-71.813) [-71.490] (-76.186) (-73.838) -- 0:00:54
Average standard deviation of split frequencies: 0.022810
331000 -- (-72.296) (-73.112) (-75.189) [-71.960] * (-73.038) (-73.059) [-74.713] (-71.743) -- 0:00:54
332000 -- (-71.921) (-75.629) [-78.357] (-74.049) * (-73.356) [-70.896] (-76.647) (-71.891) -- 0:00:54
333000 -- (-73.325) (-75.163) (-75.588) [-71.824] * (-74.962) [-72.157] (-75.967) (-71.462) -- 0:00:54
334000 -- [-71.783] (-72.415) (-72.819) (-72.361) * [-73.618] (-79.530) (-72.330) (-74.487) -- 0:00:53
335000 -- (-72.071) (-74.543) [-72.632] (-71.155) * [-71.392] (-71.313) (-72.865) (-71.956) -- 0:00:53
Average standard deviation of split frequencies: 0.023383
336000 -- (-71.853) (-74.733) (-72.934) [-71.478] * (-70.950) (-72.271) (-72.533) [-72.450] -- 0:00:53
337000 -- (-70.609) (-74.481) [-72.099] (-74.008) * [-74.472] (-73.600) (-71.620) (-72.646) -- 0:00:53
338000 -- [-72.812] (-72.711) (-71.973) (-73.099) * (-73.018) (-74.071) (-72.528) [-71.728] -- 0:00:52
339000 -- (-72.316) (-71.661) (-71.191) [-74.055] * (-73.051) (-72.079) (-72.908) [-70.920] -- 0:00:52
340000 -- [-71.653] (-71.734) (-72.542) (-70.731) * (-74.212) [-71.357] (-75.396) (-73.309) -- 0:00:52
Average standard deviation of split frequencies: 0.024908
341000 -- (-72.695) (-72.753) [-73.528] (-72.962) * (-72.183) [-77.713] (-71.399) (-71.574) -- 0:00:52
342000 -- (-72.208) (-70.782) (-73.660) [-73.954] * [-72.268] (-73.531) (-74.072) (-72.600) -- 0:00:53
343000 -- [-72.783] (-71.907) (-74.607) (-75.261) * (-72.171) [-73.252] (-75.139) (-73.877) -- 0:00:53
344000 -- (-74.190) [-73.829] (-73.850) (-73.218) * (-72.274) [-71.543] (-75.576) (-72.084) -- 0:00:53
345000 -- (-72.783) (-71.603) (-73.965) [-71.080] * (-73.139) (-73.240) [-70.914] (-73.779) -- 0:00:53
Average standard deviation of split frequencies: 0.026341
346000 -- (-72.720) (-71.867) (-73.887) [-73.272] * (-73.302) [-73.770] (-72.855) (-74.687) -- 0:00:52
347000 -- [-72.017] (-72.042) (-74.524) (-71.144) * (-73.291) (-71.507) [-71.756] (-79.450) -- 0:00:52
348000 -- (-71.233) (-77.085) (-71.257) [-73.309] * (-76.009) (-73.336) [-74.382] (-75.185) -- 0:00:52
349000 -- (-73.331) (-74.141) (-71.445) [-71.352] * [-72.101] (-70.678) (-77.996) (-72.199) -- 0:00:52
350000 -- (-72.902) (-72.702) (-74.179) [-71.688] * [-72.910] (-72.019) (-74.267) (-73.053) -- 0:00:52
Average standard deviation of split frequencies: 0.025094
351000 -- [-73.145] (-72.340) (-72.857) (-74.240) * [-71.989] (-72.686) (-74.111) (-71.372) -- 0:00:51
352000 -- (-72.054) [-72.836] (-70.824) (-73.595) * (-71.823) (-72.083) (-75.777) [-73.778] -- 0:00:51
353000 -- (-72.098) [-71.704] (-73.190) (-70.960) * [-73.571] (-72.006) (-70.797) (-73.890) -- 0:00:51
354000 -- (-76.009) [-72.613] (-72.780) (-73.112) * (-72.735) [-73.522] (-71.421) (-71.662) -- 0:00:51
355000 -- (-75.022) (-71.407) (-72.737) [-71.320] * (-74.397) (-73.525) [-73.250] (-71.308) -- 0:00:52
Average standard deviation of split frequencies: 0.024718
356000 -- [-73.245] (-73.760) (-72.376) (-75.616) * (-72.639) [-73.685] (-73.325) (-72.015) -- 0:00:52
357000 -- (-74.565) (-70.822) [-76.703] (-72.133) * [-73.262] (-74.293) (-72.161) (-75.782) -- 0:00:52
358000 -- (-73.461) (-72.163) [-76.025] (-73.815) * (-71.488) [-75.138] (-74.409) (-71.700) -- 0:00:52
359000 -- (-79.670) [-71.453] (-70.855) (-73.478) * (-72.773) [-73.040] (-75.400) (-77.300) -- 0:00:51
360000 -- (-77.978) [-71.357] (-71.875) (-72.507) * (-78.146) (-72.081) [-72.769] (-71.113) -- 0:00:51
Average standard deviation of split frequencies: 0.026141
361000 -- (-76.426) (-74.228) [-72.479] (-71.924) * (-71.907) [-71.779] (-76.766) (-72.792) -- 0:00:51
362000 -- (-74.351) [-73.720] (-75.629) (-73.611) * [-71.503] (-71.581) (-71.049) (-71.455) -- 0:00:51
363000 -- (-71.136) [-72.284] (-72.439) (-71.718) * [-72.052] (-72.732) (-72.377) (-73.334) -- 0:00:50
364000 -- (-71.865) (-73.927) (-73.690) [-71.282] * (-71.882) (-72.581) [-73.045] (-72.098) -- 0:00:50
365000 -- (-76.224) (-71.791) (-71.880) [-73.133] * (-71.642) (-73.456) (-72.142) [-72.955] -- 0:00:50
Average standard deviation of split frequencies: 0.027477
366000 -- (-75.290) (-70.641) [-72.917] (-72.220) * [-74.683] (-74.365) (-72.455) (-73.124) -- 0:00:50
367000 -- (-70.941) (-71.908) (-71.281) [-74.164] * [-74.506] (-70.869) (-73.966) (-71.321) -- 0:00:51
368000 -- (-72.115) (-72.853) [-71.049] (-71.411) * (-72.094) [-72.590] (-74.117) (-74.673) -- 0:00:51
369000 -- [-71.576] (-73.978) (-72.289) (-72.651) * (-73.050) [-72.728] (-71.287) (-73.314) -- 0:00:51
370000 -- [-75.672] (-72.544) (-72.864) (-71.918) * [-71.268] (-72.573) (-76.272) (-71.376) -- 0:00:51
Average standard deviation of split frequencies: 0.025435
371000 -- (-75.314) (-73.605) [-71.608] (-73.085) * [-73.521] (-72.823) (-78.576) (-73.750) -- 0:00:50
372000 -- (-74.226) (-73.274) (-71.573) [-77.604] * [-75.130] (-72.043) (-74.323) (-74.596) -- 0:00:50
373000 -- (-71.440) [-72.532] (-72.073) (-72.085) * (-74.938) (-74.947) [-70.817] (-73.700) -- 0:00:50
374000 -- (-75.939) (-73.274) [-73.048] (-72.782) * (-74.399) (-75.044) [-73.281] (-72.451) -- 0:00:50
375000 -- (-73.573) [-72.273] (-72.608) (-78.373) * (-72.366) (-70.972) [-70.981] (-70.919) -- 0:00:50
Average standard deviation of split frequencies: 0.028418
376000 -- [-72.336] (-73.397) (-73.883) (-75.019) * (-71.187) (-74.427) (-73.573) [-71.852] -- 0:00:49
377000 -- [-71.342] (-74.111) (-71.900) (-73.585) * [-71.515] (-72.836) (-75.896) (-72.538) -- 0:00:49
378000 -- [-71.293] (-72.459) (-74.603) (-72.274) * (-77.530) (-71.585) (-74.690) [-72.217] -- 0:00:49
379000 -- [-71.477] (-72.040) (-74.995) (-71.232) * (-71.622) (-74.661) (-73.461) [-72.046] -- 0:00:49
380000 -- (-72.452) (-72.616) [-71.591] (-71.952) * (-72.687) (-73.736) [-72.213] (-72.218) -- 0:00:50
Average standard deviation of split frequencies: 0.028070
381000 -- [-72.134] (-71.477) (-74.462) (-73.239) * (-73.055) (-71.770) (-71.128) [-71.351] -- 0:00:50
382000 -- (-72.178) [-71.384] (-71.498) (-71.088) * (-74.268) (-71.839) [-71.340] (-75.511) -- 0:00:50
383000 -- (-71.860) (-72.092) [-71.915] (-72.045) * [-74.051] (-72.708) (-74.421) (-71.840) -- 0:00:49
384000 -- (-75.569) (-72.423) [-71.317] (-72.789) * (-71.933) (-74.680) [-70.958] (-77.061) -- 0:00:49
385000 -- (-75.599) (-73.500) (-73.553) [-72.001] * (-78.406) (-75.280) (-77.298) [-72.338] -- 0:00:49
Average standard deviation of split frequencies: 0.026868
386000 -- (-73.832) (-76.623) (-78.378) [-72.221] * (-71.982) [-78.201] (-71.868) (-70.846) -- 0:00:49
387000 -- (-72.512) (-76.854) [-73.115] (-72.394) * (-72.006) [-71.296] (-71.891) (-74.345) -- 0:00:49
388000 -- (-74.622) [-72.428] (-74.602) (-73.655) * (-71.362) (-71.519) (-73.393) [-71.937] -- 0:00:48
389000 -- (-75.180) (-71.334) [-75.056] (-72.857) * (-71.964) (-77.138) [-71.619] (-76.021) -- 0:00:48
390000 -- [-74.115] (-74.830) (-72.106) (-73.453) * [-71.403] (-71.526) (-73.295) (-72.875) -- 0:00:48
Average standard deviation of split frequencies: 0.028960
391000 -- (-72.276) (-71.756) [-72.111] (-72.175) * (-77.294) (-71.409) (-71.791) [-73.419] -- 0:00:48
392000 -- (-71.659) (-71.862) [-72.883] (-72.717) * (-74.099) (-73.147) (-71.381) [-71.549] -- 0:00:48
393000 -- [-71.387] (-72.240) (-76.077) (-70.623) * (-72.641) (-70.848) (-71.173) [-72.555] -- 0:00:49
394000 -- (-71.519) (-73.788) [-73.208] (-71.885) * [-71.887] (-74.463) (-71.682) (-75.018) -- 0:00:49
395000 -- (-71.907) (-72.316) (-70.848) [-76.135] * (-70.932) (-71.959) (-72.694) [-76.036] -- 0:00:49
Average standard deviation of split frequencies: 0.031744
396000 -- (-71.311) (-74.691) [-71.465] (-72.416) * [-74.495] (-72.380) (-71.584) (-71.645) -- 0:00:48
397000 -- (-71.413) [-73.080] (-72.139) (-73.050) * (-72.737) (-71.869) (-74.949) [-71.616] -- 0:00:48
398000 -- (-71.972) (-73.186) [-72.862] (-70.891) * (-71.902) (-75.802) (-79.000) [-71.435] -- 0:00:48
399000 -- (-71.675) (-73.705) (-74.153) [-71.250] * (-71.696) [-71.040] (-73.131) (-71.621) -- 0:00:48
400000 -- (-71.821) [-72.588] (-70.932) (-72.885) * [-73.269] (-72.151) (-71.613) (-74.051) -- 0:00:48
Average standard deviation of split frequencies: 0.028237
401000 -- (-72.394) [-72.844] (-74.570) (-75.079) * (-74.557) (-71.408) [-71.755] (-72.934) -- 0:00:47
402000 -- (-72.048) (-71.896) [-73.669] (-73.936) * [-74.341] (-71.235) (-78.031) (-74.306) -- 0:00:47
403000 -- (-75.705) (-76.335) [-74.032] (-72.099) * [-71.477] (-72.830) (-71.366) (-71.507) -- 0:00:47
404000 -- (-71.120) (-72.538) (-74.148) [-72.202] * (-72.606) [-71.234] (-74.455) (-71.695) -- 0:00:47
405000 -- (-72.011) (-73.499) [-73.266] (-72.558) * (-71.738) [-71.760] (-72.309) (-70.670) -- 0:00:48
Average standard deviation of split frequencies: 0.026318
406000 -- (-73.218) (-71.197) [-72.827] (-72.980) * (-71.156) (-72.157) (-71.673) [-75.631] -- 0:00:48
407000 -- (-72.324) [-71.884] (-73.818) (-74.254) * [-72.724] (-72.206) (-71.183) (-72.893) -- 0:00:48
408000 -- (-74.762) (-72.042) (-72.469) [-73.370] * [-71.043] (-72.163) (-71.277) (-71.795) -- 0:00:47
409000 -- (-71.567) [-72.291] (-71.223) (-71.225) * (-73.391) (-73.521) (-75.311) [-73.980] -- 0:00:47
410000 -- [-71.037] (-73.325) (-72.407) (-72.959) * (-73.590) (-78.484) (-70.957) [-75.662] -- 0:00:47
Average standard deviation of split frequencies: 0.026019
411000 -- [-72.329] (-72.650) (-75.352) (-71.325) * (-71.051) (-73.898) [-73.814] (-72.336) -- 0:00:47
412000 -- [-71.474] (-75.212) (-74.132) (-72.383) * (-77.094) (-73.307) (-70.965) [-71.463] -- 0:00:47
413000 -- (-73.155) (-71.828) [-75.700] (-72.011) * [-73.350] (-72.875) (-73.048) (-74.212) -- 0:00:46
414000 -- (-72.204) [-73.531] (-79.172) (-73.112) * (-73.940) (-72.583) (-74.306) [-74.184] -- 0:00:46
415000 -- (-74.058) (-72.642) [-74.849] (-73.923) * [-74.670] (-77.512) (-74.397) (-71.811) -- 0:00:46
Average standard deviation of split frequencies: 0.027196
416000 -- (-72.199) (-77.583) (-75.332) [-71.361] * (-73.224) (-72.730) (-72.991) [-70.996] -- 0:00:46
417000 -- (-71.625) [-72.318] (-74.566) (-79.175) * [-71.318] (-71.886) (-73.025) (-76.146) -- 0:00:46
418000 -- [-71.269] (-74.048) (-74.600) (-76.317) * [-71.159] (-71.504) (-72.718) (-72.568) -- 0:00:47
419000 -- (-74.837) (-73.013) [-72.689] (-73.723) * (-72.837) (-71.429) (-70.448) [-71.725] -- 0:00:47
420000 -- (-71.529) [-73.325] (-72.504) (-72.658) * (-74.707) [-77.592] (-72.469) (-72.403) -- 0:00:46
Average standard deviation of split frequencies: 0.023159
421000 -- (-72.872) (-80.015) [-72.017] (-70.900) * (-72.410) (-75.161) [-71.124] (-71.994) -- 0:00:46
422000 -- (-72.695) [-73.726] (-72.162) (-73.697) * (-76.724) (-74.673) [-74.716] (-83.522) -- 0:00:46
423000 -- (-71.430) (-73.260) (-78.630) [-71.872] * (-74.824) (-74.020) [-71.623] (-72.697) -- 0:00:46
424000 -- [-72.362] (-71.786) (-72.987) (-77.486) * (-71.711) (-72.035) [-73.823] (-74.596) -- 0:00:46
425000 -- (-74.144) (-73.141) [-73.390] (-73.372) * (-70.731) (-73.794) (-73.400) [-72.429] -- 0:00:46
Average standard deviation of split frequencies: 0.022869
426000 -- (-72.576) [-71.529] (-74.335) (-70.751) * (-73.767) (-73.380) (-73.317) [-72.438] -- 0:00:45
427000 -- (-72.133) [-71.900] (-74.312) (-71.729) * (-72.208) (-72.355) [-71.377] (-72.484) -- 0:00:45
428000 -- (-73.485) (-71.541) (-76.978) [-70.691] * (-71.339) (-73.017) [-72.599] (-72.568) -- 0:00:45
429000 -- (-75.286) [-72.935] (-72.758) (-73.419) * [-72.267] (-74.758) (-74.036) (-71.758) -- 0:00:45
430000 -- (-73.895) [-74.482] (-71.161) (-71.843) * (-72.546) (-74.081) [-71.842] (-75.064) -- 0:00:45
Average standard deviation of split frequencies: 0.020432
431000 -- [-72.831] (-77.165) (-72.568) (-71.663) * (-71.128) [-71.658] (-70.909) (-73.996) -- 0:00:46
432000 -- (-70.772) (-72.470) [-71.788] (-76.148) * (-71.553) (-71.983) (-71.290) [-74.977] -- 0:00:46
433000 -- (-70.728) (-71.302) (-73.378) [-74.483] * (-73.037) (-74.456) [-75.595] (-71.476) -- 0:00:45
434000 -- (-71.919) (-72.037) [-73.046] (-71.930) * (-74.563) [-70.650] (-74.711) (-73.834) -- 0:00:45
435000 -- (-75.788) [-73.954] (-72.292) (-74.573) * (-72.551) (-72.098) (-76.704) [-73.317] -- 0:00:45
Average standard deviation of split frequencies: 0.022345
436000 -- (-72.543) (-77.175) [-74.475] (-72.244) * (-75.941) (-74.140) [-70.844] (-78.068) -- 0:00:45
437000 -- [-76.062] (-76.240) (-74.122) (-74.915) * (-72.841) [-72.912] (-73.174) (-74.738) -- 0:00:45
438000 -- (-74.026) [-71.842] (-73.023) (-71.800) * (-75.167) [-74.144] (-73.669) (-75.660) -- 0:00:44
439000 -- (-71.928) (-73.131) (-73.098) [-73.371] * (-74.461) [-72.638] (-72.673) (-80.061) -- 0:00:44
440000 -- [-74.874] (-73.028) (-70.898) (-76.683) * (-74.402) (-71.412) (-73.472) [-71.673] -- 0:00:44
Average standard deviation of split frequencies: 0.022821
441000 -- (-75.080) (-73.567) [-74.983] (-71.781) * (-73.002) (-72.308) [-72.152] (-72.530) -- 0:00:44
442000 -- (-73.487) (-73.276) (-73.340) [-70.913] * (-72.523) [-73.233] (-72.581) (-72.027) -- 0:00:44
443000 -- [-72.175] (-72.148) (-72.733) (-73.754) * (-73.468) [-71.234] (-72.167) (-76.163) -- 0:00:45
444000 -- [-71.032] (-72.640) (-73.632) (-71.797) * (-71.703) [-73.389] (-71.406) (-73.221) -- 0:00:45
445000 -- (-75.651) [-71.500] (-71.821) (-74.026) * (-71.218) (-72.570) [-70.655] (-75.556) -- 0:00:44
Average standard deviation of split frequencies: 0.021844
446000 -- (-73.326) (-72.819) [-73.552] (-70.469) * (-75.403) (-72.643) [-72.289] (-71.404) -- 0:00:44
447000 -- (-73.625) (-71.221) (-71.683) [-72.190] * (-73.203) (-72.372) [-72.195] (-74.855) -- 0:00:44
448000 -- (-83.809) (-71.917) (-74.138) [-76.132] * [-72.680] (-71.096) (-71.936) (-70.940) -- 0:00:44
449000 -- (-73.865) [-74.346] (-72.493) (-78.064) * (-75.234) [-73.636] (-71.239) (-76.154) -- 0:00:44
450000 -- (-72.897) [-72.896] (-73.123) (-73.401) * [-75.744] (-73.526) (-72.604) (-72.989) -- 0:00:44
Average standard deviation of split frequencies: 0.025104
451000 -- (-74.370) (-74.462) (-73.487) [-71.124] * (-74.997) (-71.766) [-72.146] (-75.453) -- 0:00:43
452000 -- [-74.222] (-72.175) (-76.438) (-71.692) * [-73.686] (-75.728) (-72.032) (-74.488) -- 0:00:43
453000 -- (-71.977) (-71.978) [-71.890] (-72.073) * [-72.356] (-77.223) (-72.662) (-73.876) -- 0:00:43
454000 -- (-71.507) [-74.221] (-71.654) (-74.795) * [-71.486] (-77.886) (-73.707) (-70.605) -- 0:00:43
455000 -- [-73.806] (-71.447) (-72.381) (-72.874) * (-71.040) [-70.800] (-71.290) (-71.801) -- 0:00:44
Average standard deviation of split frequencies: 0.024122
456000 -- [-72.288] (-76.372) (-75.572) (-77.437) * [-70.838] (-72.290) (-71.244) (-71.181) -- 0:00:44
457000 -- (-75.908) (-73.591) (-73.120) [-74.889] * (-72.874) (-72.246) (-75.998) [-71.464] -- 0:00:43
458000 -- (-72.995) [-75.703] (-75.638) (-71.994) * (-74.115) (-71.871) [-72.252] (-70.916) -- 0:00:43
459000 -- (-74.558) [-71.577] (-70.724) (-71.511) * (-72.029) (-73.831) [-72.559] (-71.879) -- 0:00:43
460000 -- (-72.980) (-74.033) (-76.746) [-70.856] * (-78.060) (-72.033) [-71.970] (-74.287) -- 0:00:43
Average standard deviation of split frequencies: 0.025242
461000 -- (-81.593) [-77.942] (-74.258) (-72.137) * (-74.568) [-70.893] (-77.944) (-71.395) -- 0:00:43
462000 -- (-73.285) (-72.468) (-73.136) [-73.539] * (-74.078) (-73.281) [-73.883] (-76.586) -- 0:00:43
463000 -- [-72.467] (-70.610) (-71.679) (-77.281) * (-74.488) (-73.960) [-72.378] (-71.274) -- 0:00:42
464000 -- (-70.994) [-72.625] (-77.126) (-72.437) * [-72.308] (-80.486) (-72.617) (-72.905) -- 0:00:42
465000 -- (-72.526) [-73.303] (-74.365) (-72.305) * (-73.354) (-72.319) [-72.112] (-76.380) -- 0:00:42
Average standard deviation of split frequencies: 0.027650
466000 -- (-70.482) (-71.201) (-73.494) [-72.878] * (-71.243) (-73.707) [-72.704] (-74.667) -- 0:00:42
467000 -- (-72.924) (-71.432) (-72.019) [-73.279] * (-71.068) [-74.102] (-72.632) (-74.720) -- 0:00:42
468000 -- (-72.026) (-74.006) [-73.823] (-76.371) * (-71.669) [-73.275] (-72.772) (-77.638) -- 0:00:43
469000 -- (-73.683) [-71.642] (-75.699) (-72.318) * (-73.464) (-71.852) (-73.670) [-72.340] -- 0:00:43
470000 -- [-73.602] (-74.205) (-73.728) (-71.601) * (-76.447) (-70.986) (-75.241) [-73.573] -- 0:00:42
Average standard deviation of split frequencies: 0.027376
471000 -- (-72.706) [-73.170] (-71.985) (-72.631) * (-70.951) (-76.376) [-72.375] (-72.474) -- 0:00:42
472000 -- (-75.091) (-72.095) (-74.328) [-71.910] * [-71.590] (-72.704) (-75.742) (-70.614) -- 0:00:42
473000 -- [-72.850] (-70.773) (-72.138) (-72.545) * [-71.497] (-73.475) (-71.746) (-71.479) -- 0:00:42
474000 -- (-71.079) (-78.724) (-71.224) [-71.311] * (-70.564) (-72.912) [-70.593] (-72.477) -- 0:00:42
475000 -- (-74.317) (-76.045) (-75.197) [-72.282] * (-72.785) (-75.166) (-71.761) [-73.375] -- 0:00:42
Average standard deviation of split frequencies: 0.025089
476000 -- (-71.058) (-74.946) (-73.302) [-72.809] * (-72.460) (-73.010) [-73.919] (-72.431) -- 0:00:41
477000 -- (-73.056) (-73.768) [-71.415] (-76.433) * [-71.138] (-77.607) (-77.612) (-73.221) -- 0:00:41
478000 -- [-75.739] (-77.314) (-73.593) (-76.667) * (-73.050) (-71.768) [-73.613] (-73.263) -- 0:00:41
479000 -- (-75.536) (-74.170) [-71.670] (-74.910) * [-70.591] (-72.086) (-74.703) (-75.105) -- 0:00:41
480000 -- (-72.418) [-73.476] (-71.102) (-71.997) * (-73.861) (-77.319) [-74.274] (-72.261) -- 0:00:42
Average standard deviation of split frequencies: 0.026153
481000 -- (-71.710) [-75.113] (-73.991) (-76.271) * (-75.305) (-75.638) [-71.124] (-75.092) -- 0:00:42
482000 -- [-72.694] (-77.696) (-74.632) (-71.823) * [-71.689] (-72.201) (-73.590) (-73.135) -- 0:00:41
483000 -- (-71.928) [-77.067] (-74.142) (-71.826) * [-72.894] (-76.871) (-75.235) (-72.525) -- 0:00:41
484000 -- [-73.296] (-71.242) (-71.824) (-72.414) * (-71.461) (-73.996) (-70.807) [-71.172] -- 0:00:41
485000 -- (-71.124) (-75.375) (-75.542) [-72.102] * (-71.393) (-76.726) [-77.048] (-73.666) -- 0:00:41
Average standard deviation of split frequencies: 0.027159
486000 -- [-72.258] (-78.377) (-71.776) (-72.737) * (-70.504) [-72.299] (-71.907) (-72.194) -- 0:00:41
487000 -- (-73.823) (-74.405) (-71.666) [-71.596] * (-71.072) (-73.921) [-72.134] (-72.520) -- 0:00:41
488000 -- (-73.071) (-72.189) (-72.724) [-71.202] * (-74.062) (-74.193) (-71.305) [-70.919] -- 0:00:40
489000 -- (-73.788) (-72.259) (-71.274) [-71.012] * (-74.812) [-73.846] (-71.867) (-73.994) -- 0:00:40
490000 -- (-72.030) [-76.094] (-71.106) (-71.333) * (-72.417) [-73.508] (-72.487) (-71.440) -- 0:00:40
Average standard deviation of split frequencies: 0.024339
491000 -- (-73.016) (-75.364) (-73.071) [-72.685] * [-72.524] (-73.064) (-72.251) (-74.410) -- 0:00:40
492000 -- (-71.673) [-76.099] (-71.582) (-75.023) * (-71.126) [-72.908] (-71.784) (-73.409) -- 0:00:40
493000 -- [-72.694] (-72.224) (-74.281) (-71.150) * (-73.044) [-71.627] (-74.837) (-71.556) -- 0:00:41
494000 -- (-75.468) [-72.847] (-73.446) (-76.547) * (-72.880) (-72.836) (-72.463) [-72.040] -- 0:00:40
495000 -- (-71.200) [-72.745] (-74.147) (-79.288) * (-76.822) (-71.119) [-72.006] (-73.408) -- 0:00:40
Average standard deviation of split frequencies: 0.022810
496000 -- [-72.442] (-75.348) (-74.110) (-74.839) * (-71.763) (-70.500) [-72.149] (-71.687) -- 0:00:40
497000 -- (-72.390) (-73.232) (-70.932) [-72.773] * [-70.870] (-72.400) (-74.096) (-71.271) -- 0:00:40
498000 -- (-73.880) (-74.117) (-72.686) [-72.802] * (-72.259) [-72.819] (-76.193) (-73.878) -- 0:00:40
499000 -- (-75.997) (-73.327) (-71.190) [-72.022] * [-71.831] (-71.207) (-73.230) (-74.438) -- 0:00:40
500000 -- (-74.685) [-73.891] (-74.062) (-72.558) * [-71.995] (-73.770) (-73.753) (-76.693) -- 0:00:40
Average standard deviation of split frequencies: 0.023225
501000 -- (-73.234) (-73.290) [-73.933] (-72.573) * [-75.455] (-73.397) (-73.172) (-81.120) -- 0:00:39
502000 -- (-70.853) (-72.773) (-75.053) [-73.339] * (-78.144) (-72.147) [-71.466] (-77.887) -- 0:00:39
503000 -- (-73.539) (-72.826) [-71.613] (-75.152) * (-75.064) (-72.447) (-74.231) [-72.052] -- 0:00:39
504000 -- (-71.891) (-71.489) [-71.091] (-73.979) * (-71.547) [-71.272] (-75.696) (-73.105) -- 0:00:39
505000 -- [-73.902] (-74.529) (-71.217) (-73.699) * [-71.493] (-70.666) (-73.687) (-74.682) -- 0:00:39
Average standard deviation of split frequencies: 0.021738
506000 -- (-71.112) (-71.481) (-72.093) [-71.759] * (-71.911) (-74.251) [-71.265] (-73.170) -- 0:00:40
507000 -- [-73.019] (-74.991) (-77.476) (-70.853) * (-82.459) (-76.221) (-72.973) [-72.036] -- 0:00:39
508000 -- (-74.218) (-72.623) [-73.288] (-70.949) * [-71.936] (-73.544) (-71.005) (-71.121) -- 0:00:39
509000 -- (-73.442) [-74.223] (-72.975) (-72.886) * (-73.470) (-75.556) (-74.313) [-73.091] -- 0:00:39
510000 -- (-74.639) [-73.963] (-74.996) (-71.685) * (-76.195) (-76.800) (-74.007) [-72.232] -- 0:00:39
Average standard deviation of split frequencies: 0.019078
511000 -- (-75.071) (-72.115) (-72.297) [-72.318] * [-71.842] (-72.914) (-72.810) (-79.943) -- 0:00:39
512000 -- (-70.830) (-74.391) (-73.265) [-71.333] * (-78.824) [-74.496] (-72.246) (-72.127) -- 0:00:39
513000 -- [-73.554] (-75.474) (-71.178) (-70.819) * (-72.936) (-72.021) [-73.595] (-70.694) -- 0:00:38
514000 -- (-71.887) (-70.626) [-70.914] (-72.564) * [-75.518] (-75.199) (-73.056) (-72.335) -- 0:00:38
515000 -- (-72.568) [-71.323] (-74.568) (-70.845) * (-70.819) [-73.321] (-76.510) (-72.307) -- 0:00:38
Average standard deviation of split frequencies: 0.019490
516000 -- [-71.063] (-71.798) (-74.227) (-70.813) * (-75.014) [-71.535] (-77.678) (-72.431) -- 0:00:38
517000 -- [-71.745] (-74.518) (-71.077) (-72.640) * (-71.709) [-70.927] (-75.801) (-72.377) -- 0:00:38
518000 -- [-71.943] (-76.785) (-75.026) (-72.496) * (-71.296) [-72.704] (-75.099) (-71.902) -- 0:00:39
519000 -- [-71.224] (-74.158) (-73.306) (-75.374) * (-72.707) [-71.488] (-72.523) (-74.273) -- 0:00:38
520000 -- (-72.860) (-73.324) [-72.045] (-71.347) * (-74.997) [-70.855] (-71.560) (-71.171) -- 0:00:38
Average standard deviation of split frequencies: 0.018108
521000 -- (-75.554) (-75.800) (-71.504) [-70.624] * (-71.709) [-70.970] (-73.941) (-76.755) -- 0:00:38
522000 -- [-73.377] (-74.902) (-72.243) (-72.788) * (-71.418) [-72.769] (-71.295) (-74.195) -- 0:00:38
523000 -- (-74.309) (-72.626) (-74.898) [-71.238] * [-72.501] (-74.525) (-74.197) (-76.549) -- 0:00:38
524000 -- (-75.508) (-74.146) [-74.679] (-71.672) * [-71.021] (-73.595) (-73.971) (-74.589) -- 0:00:38
525000 -- (-75.781) (-72.287) [-71.273] (-71.394) * [-75.248] (-73.512) (-76.854) (-76.650) -- 0:00:38
Average standard deviation of split frequencies: 0.019717
526000 -- [-72.146] (-72.503) (-72.400) (-73.138) * (-72.561) (-75.138) (-73.912) [-74.485] -- 0:00:37
527000 -- (-73.628) [-72.593] (-79.312) (-73.616) * (-71.523) [-73.571] (-73.206) (-73.787) -- 0:00:37
528000 -- (-72.895) (-71.042) (-72.329) [-75.125] * (-70.543) (-72.155) (-77.100) [-71.916] -- 0:00:37
529000 -- (-71.961) (-73.036) (-74.541) [-71.943] * (-71.310) [-75.186] (-74.115) (-72.440) -- 0:00:37
530000 -- [-71.298] (-72.973) (-73.326) (-71.163) * [-71.394] (-72.419) (-77.372) (-75.513) -- 0:00:37
Average standard deviation of split frequencies: 0.016582
531000 -- (-72.207) (-70.968) (-71.779) [-72.585] * [-72.205] (-73.922) (-71.411) (-74.214) -- 0:00:37
532000 -- [-72.538] (-71.292) (-78.748) (-75.010) * [-71.926] (-82.062) (-72.306) (-74.275) -- 0:00:37
533000 -- [-71.560] (-70.861) (-70.961) (-71.743) * [-73.220] (-75.452) (-71.632) (-73.303) -- 0:00:37
534000 -- [-73.246] (-73.148) (-73.642) (-73.548) * (-70.662) [-71.063] (-70.988) (-72.624) -- 0:00:37
535000 -- [-73.105] (-72.597) (-75.821) (-71.395) * [-72.982] (-73.164) (-73.845) (-75.370) -- 0:00:37
Average standard deviation of split frequencies: 0.017003
536000 -- [-71.436] (-73.421) (-75.116) (-74.771) * [-75.895] (-74.325) (-74.836) (-77.660) -- 0:00:37
537000 -- (-73.612) (-70.948) (-74.861) [-73.525] * [-71.650] (-72.107) (-72.463) (-72.644) -- 0:00:37
538000 -- (-71.867) [-72.262] (-72.984) (-72.839) * [-74.456] (-74.073) (-72.036) (-71.746) -- 0:00:36
539000 -- [-74.612] (-75.291) (-73.118) (-73.714) * [-71.107] (-72.576) (-72.167) (-70.570) -- 0:00:36
540000 -- (-72.963) (-74.471) [-72.211] (-74.715) * (-75.554) (-73.151) (-72.858) [-71.120] -- 0:00:36
Average standard deviation of split frequencies: 0.019763
541000 -- (-73.282) (-73.036) [-71.441] (-74.197) * (-73.859) (-75.602) [-72.576] (-71.599) -- 0:00:36
542000 -- (-71.866) (-72.899) (-74.275) [-71.855] * (-73.050) (-75.853) [-73.803] (-72.559) -- 0:00:36
543000 -- [-72.714] (-73.847) (-75.631) (-71.092) * (-72.257) [-74.656] (-71.764) (-74.891) -- 0:00:37
544000 -- [-71.652] (-70.964) (-76.503) (-73.711) * (-71.333) (-71.775) [-72.484] (-71.824) -- 0:00:36
545000 -- [-71.890] (-71.686) (-72.854) (-72.209) * (-71.653) [-72.913] (-72.290) (-71.592) -- 0:00:36
Average standard deviation of split frequencies: 0.017843
546000 -- [-72.646] (-72.118) (-73.662) (-71.723) * (-71.957) (-71.010) [-73.041] (-75.020) -- 0:00:36
547000 -- (-72.602) (-73.372) (-71.205) [-72.094] * (-73.107) (-75.469) [-72.609] (-72.761) -- 0:00:36
548000 -- [-71.898] (-72.040) (-71.642) (-74.843) * [-74.535] (-75.489) (-72.061) (-71.283) -- 0:00:36
549000 -- [-70.867] (-70.792) (-76.883) (-72.940) * [-72.840] (-72.283) (-74.131) (-73.205) -- 0:00:36
550000 -- [-72.599] (-70.719) (-70.977) (-70.653) * (-71.348) [-74.765] (-76.024) (-72.790) -- 0:00:36
Average standard deviation of split frequencies: 0.019404
551000 -- [-72.579] (-72.950) (-71.170) (-71.764) * [-70.838] (-71.735) (-74.538) (-75.209) -- 0:00:35
552000 -- (-70.764) (-74.523) [-71.339] (-72.331) * (-71.285) (-71.765) (-72.615) [-74.307] -- 0:00:35
553000 -- (-75.043) [-71.291] (-74.377) (-71.694) * (-70.849) (-72.984) [-72.104] (-72.982) -- 0:00:35
554000 -- (-70.969) (-74.588) (-76.660) [-73.977] * (-73.161) (-72.924) (-72.898) [-75.372] -- 0:00:35
555000 -- (-73.304) (-71.947) (-72.179) [-72.591] * (-72.588) (-72.030) (-74.354) [-72.940] -- 0:00:35
Average standard deviation of split frequencies: 0.019218
556000 -- [-72.221] (-73.595) (-71.206) (-71.801) * (-71.014) (-75.980) [-72.558] (-73.087) -- 0:00:35
557000 -- (-72.535) (-73.219) (-71.866) [-70.542] * [-71.420] (-71.193) (-76.569) (-70.666) -- 0:00:35
558000 -- (-73.835) (-71.877) [-72.927] (-76.043) * (-72.841) (-73.082) (-73.208) [-71.475] -- 0:00:35
559000 -- (-72.868) (-75.784) [-71.565] (-73.063) * (-74.957) (-71.727) (-71.151) [-73.341] -- 0:00:35
560000 -- (-71.407) (-74.664) (-71.444) [-72.139] * (-73.476) (-71.199) (-73.110) [-72.188] -- 0:00:35
Average standard deviation of split frequencies: 0.020740
561000 -- (-72.013) (-73.913) (-71.093) [-73.868] * [-72.504] (-72.183) (-79.387) (-73.682) -- 0:00:35
562000 -- [-73.507] (-72.151) (-72.567) (-74.031) * [-72.131] (-73.388) (-73.163) (-79.055) -- 0:00:35
563000 -- [-72.565] (-71.921) (-71.898) (-72.437) * (-71.547) (-72.639) (-73.545) [-71.887] -- 0:00:34
564000 -- (-72.876) [-74.652] (-72.248) (-72.029) * (-73.272) [-72.331] (-72.463) (-72.146) -- 0:00:34
565000 -- (-73.079) (-73.095) (-72.846) [-71.454] * (-73.291) [-71.184] (-72.785) (-79.036) -- 0:00:34
Average standard deviation of split frequencies: 0.021099
566000 -- [-72.120] (-71.980) (-73.383) (-72.910) * (-72.668) (-74.043) [-72.849] (-70.884) -- 0:00:34
567000 -- [-73.344] (-71.427) (-70.961) (-73.508) * (-72.837) (-71.725) (-71.465) [-71.232] -- 0:00:34
568000 -- [-72.622] (-74.728) (-72.763) (-73.057) * (-71.874) (-73.509) (-71.952) [-73.071] -- 0:00:34
569000 -- (-75.650) (-72.299) [-71.553] (-72.161) * (-70.927) [-72.685] (-73.524) (-73.271) -- 0:00:34
570000 -- (-72.347) (-71.999) [-71.949] (-72.970) * (-70.663) (-71.838) (-74.423) [-75.199] -- 0:00:34
Average standard deviation of split frequencies: 0.021478
571000 -- [-71.836] (-71.368) (-74.995) (-72.778) * (-72.856) [-71.652] (-71.926) (-72.537) -- 0:00:34
572000 -- (-73.953) [-71.758] (-75.481) (-72.878) * (-71.064) (-71.960) [-72.409] (-71.280) -- 0:00:34
573000 -- (-71.944) [-70.930] (-76.043) (-70.974) * (-76.244) [-71.997] (-71.268) (-74.277) -- 0:00:34
574000 -- [-72.558] (-74.811) (-74.991) (-72.630) * (-74.008) (-72.293) (-71.977) [-71.254] -- 0:00:34
575000 -- [-73.284] (-73.344) (-72.306) (-71.476) * (-74.341) [-77.898] (-72.203) (-74.368) -- 0:00:34
Average standard deviation of split frequencies: 0.020733
576000 -- (-73.253) [-77.172] (-73.771) (-73.686) * [-72.339] (-75.686) (-78.237) (-78.146) -- 0:00:33
577000 -- [-71.426] (-71.987) (-70.748) (-73.920) * (-72.361) [-73.754] (-75.273) (-75.935) -- 0:00:33
578000 -- (-72.331) [-72.473] (-71.544) (-76.856) * [-71.490] (-71.100) (-71.128) (-70.876) -- 0:00:33
579000 -- [-71.065] (-74.134) (-75.634) (-72.836) * (-74.640) (-71.508) [-72.231] (-76.170) -- 0:00:33
580000 -- (-74.643) (-71.347) (-73.714) [-71.355] * [-72.199] (-73.009) (-72.440) (-71.798) -- 0:00:33
Average standard deviation of split frequencies: 0.020566
581000 -- (-73.326) (-71.463) (-74.214) [-71.372] * (-72.300) (-73.011) (-74.113) [-70.895] -- 0:00:33
582000 -- [-72.533] (-75.132) (-70.579) (-77.455) * (-75.273) (-77.326) (-75.029) [-77.089] -- 0:00:33
583000 -- (-70.876) [-71.744] (-71.982) (-73.580) * (-70.443) [-72.268] (-73.936) (-75.988) -- 0:00:33
584000 -- [-71.004] (-74.234) (-70.873) (-71.048) * (-72.543) (-74.144) (-72.271) [-71.524] -- 0:00:33
585000 -- (-73.158) (-74.112) (-72.121) [-71.608] * (-71.669) (-73.654) [-70.986] (-71.839) -- 0:00:33
Average standard deviation of split frequencies: 0.019307
586000 -- (-73.287) (-71.155) [-72.708] (-75.106) * [-71.639] (-74.656) (-73.306) (-77.209) -- 0:00:33
587000 -- [-73.152] (-72.249) (-74.291) (-74.244) * (-73.402) [-72.990] (-71.839) (-73.685) -- 0:00:33
588000 -- (-71.132) (-71.947) (-73.417) [-72.366] * [-72.964] (-76.918) (-74.359) (-71.782) -- 0:00:32
589000 -- [-72.660] (-70.951) (-74.333) (-72.519) * (-71.099) (-73.511) [-73.648] (-71.269) -- 0:00:32
590000 -- [-71.852] (-71.869) (-72.626) (-76.489) * [-74.735] (-76.898) (-72.347) (-74.178) -- 0:00:32
Average standard deviation of split frequencies: 0.020218
591000 -- (-73.974) (-71.184) (-76.651) [-77.034] * [-72.061] (-71.920) (-71.231) (-73.680) -- 0:00:32
592000 -- (-73.933) (-71.384) (-72.177) [-72.231] * [-75.607] (-75.553) (-72.795) (-71.929) -- 0:00:32
593000 -- (-78.053) [-72.266] (-73.440) (-75.224) * [-72.940] (-72.278) (-73.742) (-72.513) -- 0:00:32
594000 -- (-71.454) (-71.733) [-71.738] (-71.830) * (-76.598) [-74.241] (-73.266) (-73.415) -- 0:00:32
595000 -- (-74.291) [-73.598] (-71.336) (-71.844) * [-71.553] (-72.442) (-75.322) (-71.383) -- 0:00:32
Average standard deviation of split frequencies: 0.020565
596000 -- (-71.015) (-74.414) (-72.391) [-72.011] * (-72.550) [-73.016] (-71.593) (-72.379) -- 0:00:32
597000 -- [-72.673] (-71.193) (-74.910) (-72.362) * [-75.325] (-83.157) (-71.406) (-73.523) -- 0:00:32
598000 -- (-71.125) [-70.618] (-75.294) (-72.350) * (-72.923) [-72.485] (-74.283) (-74.681) -- 0:00:32
599000 -- [-71.519] (-71.857) (-72.656) (-74.135) * [-72.806] (-75.072) (-71.125) (-77.024) -- 0:00:32
600000 -- (-73.306) [-73.116] (-74.697) (-73.338) * (-71.262) (-72.026) (-73.392) [-76.563] -- 0:00:32
Average standard deviation of split frequencies: 0.023021
601000 -- [-72.180] (-75.138) (-72.933) (-76.730) * (-72.878) [-70.836] (-71.723) (-73.041) -- 0:00:31
602000 -- (-70.949) [-71.973] (-71.908) (-73.927) * (-72.926) (-72.425) [-71.749] (-71.487) -- 0:00:31
603000 -- (-71.710) (-71.047) (-73.158) [-73.869] * (-70.867) (-75.177) [-72.511] (-71.220) -- 0:00:31
604000 -- [-72.768] (-73.165) (-73.175) (-74.085) * (-74.522) (-75.921) [-73.603] (-73.619) -- 0:00:31
605000 -- (-72.694) [-71.585] (-71.546) (-74.279) * (-71.578) [-73.051] (-72.456) (-74.469) -- 0:00:31
Average standard deviation of split frequencies: 0.023855
606000 -- (-71.806) (-72.225) (-74.208) [-76.876] * [-72.090] (-75.933) (-76.113) (-74.523) -- 0:00:31
607000 -- (-73.707) (-72.008) [-72.043] (-73.702) * (-77.526) (-73.549) (-72.746) [-74.174] -- 0:00:31
608000 -- (-74.620) [-73.412] (-73.848) (-73.494) * (-77.294) (-71.867) (-76.386) [-72.914] -- 0:00:31
609000 -- [-73.176] (-71.790) (-74.883) (-78.183) * [-70.843] (-71.419) (-72.044) (-71.753) -- 0:00:31
610000 -- [-73.432] (-74.148) (-74.872) (-76.317) * (-71.893) (-75.084) (-76.185) [-72.358] -- 0:00:31
Average standard deviation of split frequencies: 0.024702
611000 -- [-72.393] (-73.906) (-75.307) (-73.659) * (-76.214) [-74.780] (-74.852) (-71.548) -- 0:00:31
612000 -- (-72.327) [-73.239] (-71.519) (-75.267) * (-75.414) [-71.194] (-71.578) (-72.856) -- 0:00:31
613000 -- [-72.097] (-72.471) (-70.608) (-73.679) * (-72.844) [-74.004] (-72.597) (-72.215) -- 0:00:30
614000 -- (-71.503) (-72.996) (-72.271) [-71.881] * (-72.586) (-71.809) (-76.894) [-71.736] -- 0:00:30
615000 -- (-73.613) (-77.103) [-71.314] (-74.392) * (-75.639) [-72.156] (-72.111) (-77.397) -- 0:00:30
Average standard deviation of split frequencies: 0.024999
616000 -- (-74.732) (-73.148) [-75.102] (-74.336) * (-72.831) [-72.121] (-72.683) (-72.008) -- 0:00:31
617000 -- [-75.109] (-71.968) (-74.086) (-74.540) * [-73.270] (-71.333) (-72.703) (-71.347) -- 0:00:31
618000 -- [-72.971] (-74.679) (-74.609) (-73.320) * (-71.489) (-72.912) (-72.523) [-72.930] -- 0:00:30
619000 -- (-71.716) (-72.320) [-71.252] (-72.092) * (-73.115) (-74.217) [-72.675] (-71.813) -- 0:00:30
620000 -- (-73.039) (-75.332) (-76.363) [-71.774] * [-72.695] (-73.559) (-72.064) (-71.101) -- 0:00:30
Average standard deviation of split frequencies: 0.024811
621000 -- [-74.621] (-74.922) (-71.810) (-73.274) * (-74.155) (-72.542) [-73.930] (-76.180) -- 0:00:30
622000 -- (-77.689) [-73.860] (-72.236) (-72.954) * (-74.279) (-73.341) [-71.604] (-74.461) -- 0:00:30
623000 -- (-71.763) (-71.400) [-72.275] (-73.054) * (-72.624) (-74.077) [-71.555] (-73.334) -- 0:00:30
624000 -- (-71.544) (-76.889) [-77.881] (-72.785) * (-71.828) (-74.386) [-71.968] (-73.227) -- 0:00:30
625000 -- (-75.591) (-71.591) [-78.613] (-71.425) * (-77.852) [-72.773] (-70.820) (-73.070) -- 0:00:30
Average standard deviation of split frequencies: 0.024599
626000 -- (-73.414) (-73.510) [-72.005] (-70.982) * (-70.711) (-72.612) (-72.370) [-71.985] -- 0:00:29
627000 -- [-74.416] (-74.775) (-71.073) (-71.090) * (-70.972) [-71.428] (-72.074) (-71.796) -- 0:00:29
628000 -- (-74.541) (-72.480) (-71.369) [-72.315] * (-73.561) (-73.936) (-72.098) [-76.777] -- 0:00:29
629000 -- (-72.882) (-71.771) (-71.987) [-71.800] * (-73.482) (-71.114) [-71.904] (-71.519) -- 0:00:30
630000 -- (-71.253) (-73.856) (-74.491) [-71.505] * (-76.317) (-72.673) (-74.951) [-75.589] -- 0:00:29
Average standard deviation of split frequencies: 0.024916
631000 -- (-71.833) [-73.400] (-72.179) (-73.627) * (-74.423) [-71.290] (-72.412) (-72.104) -- 0:00:29
632000 -- (-72.366) [-73.467] (-71.466) (-71.809) * [-73.074] (-72.124) (-72.331) (-72.723) -- 0:00:29
633000 -- (-74.418) (-71.499) (-75.126) [-78.579] * (-73.825) (-71.994) (-71.658) [-72.373] -- 0:00:29
634000 -- (-72.813) (-71.617) [-71.310] (-74.070) * (-72.911) [-72.521] (-71.638) (-72.183) -- 0:00:29
635000 -- [-75.729] (-71.347) (-75.185) (-75.504) * (-73.111) [-72.039] (-71.604) (-71.777) -- 0:00:29
Average standard deviation of split frequencies: 0.025695
636000 -- (-71.398) [-71.830] (-74.268) (-71.608) * (-72.451) (-71.836) [-73.872] (-72.573) -- 0:00:29
637000 -- (-71.808) [-75.507] (-72.754) (-74.017) * (-75.497) (-73.072) (-72.004) [-76.207] -- 0:00:29
638000 -- [-71.095] (-73.387) (-73.036) (-70.758) * (-72.852) (-70.858) [-73.562] (-72.731) -- 0:00:28
639000 -- (-75.563) (-70.967) [-73.425] (-76.014) * [-71.774] (-72.099) (-75.323) (-73.056) -- 0:00:28
640000 -- (-74.471) (-71.356) (-73.722) [-71.810] * (-72.642) (-70.924) [-75.300] (-76.039) -- 0:00:28
Average standard deviation of split frequencies: 0.026489
641000 -- [-71.702] (-72.831) (-74.956) (-72.123) * (-73.302) [-72.879] (-73.198) (-72.150) -- 0:00:28
642000 -- (-72.612) (-72.820) (-72.048) [-74.862] * (-72.193) (-73.776) (-73.987) [-71.408] -- 0:00:28
643000 -- [-73.672] (-71.854) (-70.959) (-74.494) * (-72.816) [-74.537] (-71.988) (-72.651) -- 0:00:28
644000 -- (-72.674) [-72.534] (-71.858) (-73.371) * (-72.025) (-73.579) [-72.561] (-72.431) -- 0:00:28
645000 -- [-70.953] (-75.458) (-71.508) (-73.927) * (-72.308) (-73.189) (-70.896) [-70.875] -- 0:00:28
Average standard deviation of split frequencies: 0.025784
646000 -- (-71.478) (-72.507) [-73.047] (-73.702) * (-72.355) [-72.907] (-71.982) (-75.275) -- 0:00:28
647000 -- [-71.072] (-75.753) (-74.961) (-73.975) * (-71.055) [-71.531] (-73.676) (-73.566) -- 0:00:28
648000 -- [-72.866] (-71.168) (-71.281) (-78.118) * (-72.767) (-72.985) (-75.280) [-71.626] -- 0:00:28
649000 -- (-74.335) (-74.852) (-73.033) [-72.945] * (-72.976) [-72.588] (-73.497) (-71.146) -- 0:00:28
650000 -- (-72.786) [-72.895] (-71.371) (-72.286) * (-71.099) [-71.264] (-74.544) (-71.675) -- 0:00:28
Average standard deviation of split frequencies: 0.027048
651000 -- [-71.760] (-72.670) (-73.313) (-77.091) * (-71.180) (-72.183) (-70.768) [-72.072] -- 0:00:27
652000 -- [-74.771] (-71.876) (-75.394) (-72.396) * (-71.785) [-72.812] (-74.699) (-75.070) -- 0:00:27
653000 -- (-71.420) (-74.131) (-71.502) [-73.400] * (-72.103) (-71.194) [-73.126] (-75.397) -- 0:00:27
654000 -- (-72.162) [-73.315] (-74.618) (-73.030) * (-71.630) [-71.041] (-73.607) (-75.683) -- 0:00:28
655000 -- (-72.651) (-75.076) [-70.685] (-73.508) * [-71.988] (-73.483) (-71.594) (-71.884) -- 0:00:27
Average standard deviation of split frequencies: 0.025870
656000 -- [-71.114] (-73.747) (-72.870) (-70.850) * (-76.004) (-72.903) (-72.607) [-71.796] -- 0:00:27
657000 -- (-73.288) (-72.390) [-71.227] (-73.189) * (-71.501) (-73.127) [-70.697] (-72.250) -- 0:00:27
658000 -- (-71.248) (-72.563) [-74.645] (-72.559) * (-73.303) (-73.980) (-71.505) [-76.743] -- 0:00:27
659000 -- (-74.293) (-72.980) (-71.789) [-72.512] * [-71.893] (-79.213) (-73.079) (-74.609) -- 0:00:27
660000 -- (-71.344) [-70.649] (-72.459) (-73.580) * (-71.410) (-74.440) [-71.502] (-76.802) -- 0:00:27
Average standard deviation of split frequencies: 0.024736
661000 -- [-73.468] (-73.183) (-74.974) (-71.509) * (-74.537) [-71.638] (-72.520) (-72.358) -- 0:00:27
662000 -- (-73.136) (-72.963) [-73.715] (-72.528) * (-73.265) [-74.072] (-71.502) (-74.389) -- 0:00:27
663000 -- [-75.433] (-72.646) (-72.273) (-72.419) * (-72.370) [-71.640] (-73.631) (-72.742) -- 0:00:26
664000 -- (-73.157) [-73.044] (-73.389) (-75.390) * (-74.791) (-71.250) (-73.020) [-71.946] -- 0:00:26
665000 -- (-74.386) (-75.741) [-73.491] (-71.990) * (-73.534) [-72.060] (-75.101) (-74.393) -- 0:00:26
Average standard deviation of split frequencies: 0.024066
666000 -- (-71.976) (-78.727) (-72.086) [-71.196] * (-73.887) [-72.582] (-72.631) (-73.422) -- 0:00:26
667000 -- (-73.936) (-75.888) [-73.223] (-72.227) * (-75.172) (-73.352) (-72.104) [-72.631] -- 0:00:26
668000 -- (-76.667) [-72.418] (-73.052) (-73.430) * (-71.602) [-74.570] (-73.446) (-71.811) -- 0:00:26
669000 -- (-73.622) (-72.665) [-71.343] (-72.714) * (-72.044) (-77.365) [-71.167] (-72.934) -- 0:00:26
670000 -- (-72.197) [-72.699] (-71.741) (-71.923) * (-75.280) (-73.782) (-71.186) [-73.077] -- 0:00:26
Average standard deviation of split frequencies: 0.023430
671000 -- (-73.378) (-72.247) (-72.346) [-72.865] * (-73.517) (-70.922) [-74.363] (-70.858) -- 0:00:26
672000 -- (-73.931) (-72.449) (-72.070) [-72.610] * (-74.109) (-74.083) (-70.909) [-76.953] -- 0:00:26
673000 -- (-72.803) (-71.450) (-71.114) [-71.643] * [-71.107] (-73.838) (-73.465) (-72.571) -- 0:00:26
674000 -- (-77.745) [-73.053] (-70.957) (-72.949) * (-71.877) (-75.616) [-71.383] (-72.073) -- 0:00:26
675000 -- (-76.022) (-73.334) (-71.968) [-71.262] * [-75.742] (-70.889) (-72.810) (-72.599) -- 0:00:26
Average standard deviation of split frequencies: 0.023710
676000 -- (-74.223) [-74.059] (-74.718) (-73.541) * (-75.062) (-73.383) [-72.893] (-74.251) -- 0:00:25
677000 -- (-73.326) (-72.487) (-74.897) [-71.857] * (-71.148) [-73.690] (-72.568) (-72.486) -- 0:00:25
678000 -- (-73.444) (-73.775) (-73.239) [-71.257] * (-71.785) [-70.609] (-73.243) (-73.739) -- 0:00:25
679000 -- (-73.454) (-72.838) [-72.938] (-71.381) * (-72.134) [-71.380] (-72.838) (-72.947) -- 0:00:26
680000 -- (-74.006) (-71.675) (-71.381) [-72.528] * (-70.989) (-72.141) [-72.867] (-72.137) -- 0:00:25
Average standard deviation of split frequencies: 0.023547
681000 -- (-70.835) (-72.908) (-71.364) [-72.653] * (-78.157) (-71.213) [-72.181] (-70.600) -- 0:00:25
682000 -- [-70.681] (-73.011) (-70.661) (-71.526) * (-73.042) [-72.645] (-73.316) (-70.637) -- 0:00:25
683000 -- (-72.398) [-71.024] (-73.266) (-74.330) * [-71.907] (-71.150) (-70.805) (-73.712) -- 0:00:25
684000 -- (-72.691) (-72.269) [-73.082] (-74.649) * (-76.883) (-72.027) [-71.772] (-71.033) -- 0:00:25
685000 -- [-72.915] (-71.848) (-74.436) (-71.983) * (-75.281) [-73.385] (-73.509) (-71.267) -- 0:00:25
Average standard deviation of split frequencies: 0.023364
686000 -- [-73.235] (-73.754) (-71.071) (-74.788) * (-73.620) [-75.558] (-72.068) (-74.566) -- 0:00:25
687000 -- (-72.382) (-70.583) (-71.478) [-73.225] * (-71.948) (-72.893) [-74.522] (-78.574) -- 0:00:25
688000 -- (-72.967) (-71.953) (-77.289) [-74.669] * (-72.520) [-73.306] (-72.624) (-71.363) -- 0:00:24
689000 -- (-71.729) [-72.536] (-71.973) (-75.410) * (-74.511) [-77.112] (-71.845) (-71.436) -- 0:00:24
690000 -- [-72.974] (-72.857) (-73.827) (-74.432) * (-75.724) [-70.835] (-73.916) (-72.542) -- 0:00:24
Average standard deviation of split frequencies: 0.024116
691000 -- (-73.554) (-71.307) [-73.180] (-73.234) * (-73.341) [-74.177] (-71.850) (-72.721) -- 0:00:24
692000 -- [-71.527] (-74.292) (-72.036) (-73.022) * (-73.245) [-72.655] (-72.300) (-72.624) -- 0:00:24
693000 -- (-72.775) [-75.170] (-72.329) (-75.666) * (-73.971) (-71.869) (-74.707) [-70.844] -- 0:00:24
694000 -- [-73.369] (-72.544) (-73.994) (-73.665) * [-71.382] (-72.279) (-71.136) (-74.859) -- 0:00:24
695000 -- (-75.868) (-74.020) (-70.786) [-71.742] * (-74.138) (-76.558) (-71.298) [-72.427] -- 0:00:24
Average standard deviation of split frequencies: 0.024383
696000 -- (-72.383) [-72.125] (-71.761) (-70.518) * (-73.216) (-70.822) [-74.505] (-74.342) -- 0:00:24
697000 -- (-72.645) [-70.905] (-71.563) (-74.843) * [-72.077] (-74.885) (-75.914) (-73.964) -- 0:00:24
698000 -- [-71.633] (-71.728) (-71.456) (-77.803) * (-73.571) (-74.262) (-72.718) [-73.806] -- 0:00:24
699000 -- (-71.540) (-71.922) [-70.951] (-72.287) * [-71.065] (-72.375) (-73.191) (-71.231) -- 0:00:24
700000 -- (-72.162) (-71.665) (-73.923) [-72.137] * (-72.977) (-74.147) (-72.899) [-71.989] -- 0:00:24
Average standard deviation of split frequencies: 0.025118
701000 -- (-73.228) [-72.083] (-79.708) (-72.735) * (-80.414) [-72.165] (-73.606) (-72.593) -- 0:00:23
702000 -- (-72.583) [-72.065] (-71.499) (-71.948) * (-77.175) (-75.446) [-72.749] (-72.502) -- 0:00:23
703000 -- (-72.343) (-74.785) (-71.929) [-73.127] * [-72.215] (-73.281) (-73.993) (-75.820) -- 0:00:23
704000 -- (-72.508) (-72.943) [-70.938] (-72.001) * (-74.522) (-71.079) [-71.355] (-72.058) -- 0:00:23
705000 -- [-71.580] (-73.798) (-72.901) (-70.632) * (-71.438) [-73.532] (-73.594) (-70.757) -- 0:00:23
Average standard deviation of split frequencies: 0.024928
706000 -- [-73.660] (-72.518) (-71.604) (-72.364) * (-72.385) (-74.337) (-74.557) [-73.897] -- 0:00:23
707000 -- (-74.475) (-74.047) (-71.688) [-74.303] * [-71.288] (-72.189) (-74.265) (-72.892) -- 0:00:23
708000 -- (-74.622) (-72.987) [-72.671] (-77.132) * (-71.981) (-75.142) (-71.582) [-73.607] -- 0:00:23
709000 -- (-72.556) (-72.174) [-73.179] (-72.639) * (-72.266) [-73.701] (-71.350) (-73.854) -- 0:00:23
710000 -- [-72.870] (-70.871) (-73.088) (-77.041) * (-72.685) (-74.828) (-73.598) [-74.826] -- 0:00:23
Average standard deviation of split frequencies: 0.026975
711000 -- [-72.610] (-72.034) (-73.240) (-71.940) * (-71.011) (-71.774) (-73.238) [-70.866] -- 0:00:23
712000 -- (-76.258) [-72.226] (-73.408) (-71.402) * (-74.063) (-71.103) [-71.909] (-77.712) -- 0:00:23
713000 -- (-77.878) [-72.134] (-71.148) (-70.662) * (-73.362) (-74.442) (-72.817) [-71.194] -- 0:00:22
714000 -- (-71.576) (-72.456) (-72.856) [-74.335] * (-81.446) (-79.257) (-71.149) [-73.625] -- 0:00:22
715000 -- (-71.408) (-74.526) (-73.922) [-71.782] * (-72.140) [-71.901] (-72.324) (-73.153) -- 0:00:22
Average standard deviation of split frequencies: 0.028091
716000 -- (-74.995) (-71.749) (-70.808) [-71.483] * [-72.239] (-73.422) (-71.588) (-71.627) -- 0:00:22
717000 -- (-70.737) (-74.136) (-73.478) [-72.550] * (-70.908) (-72.705) [-72.743] (-78.641) -- 0:00:22
718000 -- (-71.441) [-71.521] (-71.327) (-73.084) * (-73.504) (-72.683) (-72.257) [-72.548] -- 0:00:22
719000 -- (-72.866) (-74.692) [-74.157] (-74.566) * (-73.909) (-72.801) [-71.878] (-74.816) -- 0:00:22
720000 -- (-73.466) (-73.417) (-72.566) [-73.796] * [-71.176] (-76.059) (-72.503) (-73.968) -- 0:00:22
Average standard deviation of split frequencies: 0.028781
721000 -- [-74.318] (-71.220) (-74.574) (-72.196) * [-71.005] (-75.015) (-75.504) (-71.018) -- 0:00:22
722000 -- [-73.802] (-72.266) (-72.792) (-74.941) * (-74.891) [-70.764] (-72.065) (-72.148) -- 0:00:22
723000 -- (-73.388) (-75.829) [-70.690] (-77.112) * [-73.198] (-75.534) (-72.483) (-71.314) -- 0:00:22
724000 -- (-71.647) (-78.736) [-75.179] (-71.524) * (-72.879) [-72.205] (-71.559) (-75.001) -- 0:00:22
725000 -- (-71.612) (-71.279) (-75.401) [-71.982] * (-73.313) (-76.766) [-71.599] (-76.604) -- 0:00:22
Average standard deviation of split frequencies: 0.029003
726000 -- (-71.785) (-76.369) (-71.806) [-72.927] * [-72.416] (-72.838) (-72.838) (-74.594) -- 0:00:21
727000 -- (-75.965) (-72.506) (-73.263) [-71.254] * (-72.663) (-70.795) [-74.429] (-72.481) -- 0:00:21
728000 -- (-75.501) [-72.356] (-75.259) (-74.197) * (-71.371) (-73.566) [-71.171] (-72.125) -- 0:00:22
729000 -- (-74.207) (-71.426) [-74.014] (-73.373) * [-73.971] (-72.845) (-71.483) (-74.556) -- 0:00:21
730000 -- (-71.484) [-71.724] (-72.134) (-74.804) * (-75.810) (-74.502) [-72.924] (-77.976) -- 0:00:21
Average standard deviation of split frequencies: 0.028387
731000 -- (-72.944) (-72.155) [-71.586] (-72.213) * (-78.138) (-73.193) [-73.251] (-71.299) -- 0:00:21
732000 -- (-71.612) (-71.974) (-72.227) [-72.841] * (-71.611) (-74.613) [-74.465] (-71.357) -- 0:00:21
733000 -- (-72.134) [-72.819] (-72.634) (-76.069) * (-72.157) [-74.639] (-72.978) (-70.789) -- 0:00:21
734000 -- (-72.255) [-71.367] (-71.542) (-71.844) * (-71.808) (-74.403) (-72.885) [-71.281] -- 0:00:21
735000 -- [-72.119] (-72.440) (-74.851) (-71.868) * [-71.877] (-70.991) (-71.330) (-72.358) -- 0:00:21
Average standard deviation of split frequencies: 0.029463
736000 -- [-77.302] (-73.603) (-72.083) (-72.369) * (-72.100) (-73.704) [-72.836] (-71.700) -- 0:00:21
737000 -- (-73.588) (-74.353) (-71.836) [-73.322] * [-72.234] (-71.342) (-76.440) (-74.049) -- 0:00:21
738000 -- (-71.802) (-73.468) [-74.992] (-76.235) * (-72.556) [-73.329] (-71.923) (-76.755) -- 0:00:20
739000 -- (-72.479) (-72.558) (-72.841) [-71.803] * (-71.471) (-73.077) (-71.154) [-72.911] -- 0:00:20
740000 -- [-71.536] (-71.886) (-72.335) (-72.109) * (-72.597) (-72.056) [-73.779] (-71.691) -- 0:00:21
Average standard deviation of split frequencies: 0.029277
741000 -- [-73.428] (-70.855) (-74.592) (-72.484) * (-72.318) [-72.906] (-71.561) (-74.533) -- 0:00:20
742000 -- (-76.173) [-72.665] (-73.590) (-75.485) * (-72.506) [-75.479] (-72.086) (-74.594) -- 0:00:20
743000 -- (-72.980) (-72.334) [-71.970] (-73.326) * [-71.346] (-71.240) (-72.583) (-71.971) -- 0:00:20
744000 -- [-71.932] (-71.551) (-71.366) (-74.971) * (-72.926) (-74.207) (-72.364) [-71.902] -- 0:00:20
745000 -- [-76.379] (-72.594) (-72.595) (-74.657) * (-72.163) (-72.762) (-72.016) [-72.411] -- 0:00:20
Average standard deviation of split frequencies: 0.029910
746000 -- [-71.507] (-71.916) (-73.014) (-74.204) * (-73.485) (-71.738) (-72.627) [-70.830] -- 0:00:20
747000 -- [-74.409] (-72.115) (-76.221) (-72.662) * (-74.163) (-74.280) (-72.199) [-73.059] -- 0:00:20
748000 -- (-72.139) (-72.868) [-73.838] (-71.339) * (-73.213) (-71.350) (-71.234) [-71.605] -- 0:00:20
749000 -- [-72.482] (-75.905) (-73.570) (-70.735) * (-73.137) (-75.438) (-70.860) [-74.452] -- 0:00:20
750000 -- (-70.762) (-73.950) [-71.070] (-77.115) * (-75.575) (-74.763) (-72.548) [-73.580] -- 0:00:20
Average standard deviation of split frequencies: 0.029306
751000 -- (-73.050) (-72.688) [-73.601] (-73.360) * (-71.721) (-76.724) (-71.333) [-73.851] -- 0:00:19
752000 -- (-72.256) (-73.142) [-72.828] (-73.955) * (-73.883) (-74.865) (-72.595) [-71.693] -- 0:00:20
753000 -- (-72.374) (-72.461) (-73.387) [-73.119] * (-74.471) [-75.252] (-72.666) (-73.156) -- 0:00:20
754000 -- (-74.362) (-73.330) (-72.054) [-71.743] * [-71.506] (-70.783) (-71.925) (-73.039) -- 0:00:19
755000 -- [-74.049] (-72.304) (-73.446) (-73.330) * (-71.405) [-72.088] (-71.751) (-71.681) -- 0:00:19
Average standard deviation of split frequencies: 0.027021
756000 -- (-73.266) [-74.130] (-71.819) (-72.259) * (-72.135) (-72.724) (-71.835) [-72.557] -- 0:00:19
757000 -- (-72.140) (-71.883) (-73.787) [-72.986] * [-71.367] (-76.237) (-70.761) (-73.952) -- 0:00:19
758000 -- (-77.056) (-76.231) [-74.183] (-72.771) * (-71.384) (-73.175) [-72.299] (-73.424) -- 0:00:19
759000 -- [-72.146] (-72.316) (-75.152) (-71.388) * [-74.638] (-72.327) (-72.778) (-71.847) -- 0:00:19
760000 -- (-75.118) [-73.623] (-76.888) (-75.619) * [-73.190] (-76.656) (-71.119) (-72.167) -- 0:00:19
Average standard deviation of split frequencies: 0.028094
761000 -- (-73.893) (-71.964) (-72.115) [-72.945] * [-73.361] (-72.501) (-72.990) (-73.817) -- 0:00:19
762000 -- (-71.191) [-71.134] (-72.369) (-72.753) * (-76.302) (-73.596) [-71.302] (-71.381) -- 0:00:19
763000 -- [-71.152] (-71.906) (-72.646) (-71.723) * (-71.552) [-71.162] (-74.930) (-73.354) -- 0:00:18
764000 -- [-71.605] (-72.313) (-71.622) (-73.702) * (-75.990) [-70.919] (-71.462) (-71.902) -- 0:00:18
765000 -- (-70.947) (-71.541) [-71.023] (-72.653) * [-72.877] (-73.353) (-74.886) (-75.496) -- 0:00:19
Average standard deviation of split frequencies: 0.029129
766000 -- [-76.385] (-70.581) (-71.177) (-72.287) * (-74.988) (-74.521) (-76.088) [-72.284] -- 0:00:18
767000 -- (-72.245) [-72.018] (-73.737) (-70.829) * (-73.321) (-73.718) (-73.228) [-76.432] -- 0:00:18
768000 -- [-71.043] (-72.695) (-75.347) (-73.465) * [-70.610] (-71.997) (-71.434) (-72.728) -- 0:00:18
769000 -- (-70.539) [-73.890] (-74.475) (-72.223) * (-74.292) (-71.638) [-70.854] (-71.843) -- 0:00:18
770000 -- (-71.246) [-71.180] (-75.850) (-71.113) * (-73.848) (-78.178) [-71.523] (-71.993) -- 0:00:18
Average standard deviation of split frequencies: 0.027730
771000 -- (-73.694) [-72.205] (-74.005) (-73.366) * (-73.875) [-72.541] (-72.011) (-75.378) -- 0:00:18
772000 -- (-71.272) (-74.453) (-71.536) [-74.057] * (-73.637) [-72.472] (-72.172) (-75.301) -- 0:00:18
773000 -- (-74.690) (-71.283) (-71.001) [-71.931] * (-73.575) [-71.306] (-73.535) (-72.536) -- 0:00:18
774000 -- (-71.011) (-72.973) [-76.243] (-72.790) * (-75.630) [-73.176] (-76.618) (-73.203) -- 0:00:18
775000 -- (-70.978) [-74.024] (-72.577) (-76.025) * (-76.715) (-71.132) [-73.431] (-71.546) -- 0:00:18
Average standard deviation of split frequencies: 0.028349
776000 -- (-73.766) (-74.791) (-71.159) [-72.936] * [-72.632] (-72.221) (-73.382) (-73.037) -- 0:00:17
777000 -- (-74.405) (-80.134) (-72.771) [-72.371] * (-81.091) (-76.885) (-71.731) [-71.930] -- 0:00:18
778000 -- [-72.774] (-76.298) (-73.210) (-72.393) * (-75.165) (-76.028) (-70.662) [-74.596] -- 0:00:17
779000 -- (-70.863) (-74.045) [-72.860] (-74.770) * (-72.327) [-74.651] (-72.901) (-71.666) -- 0:00:17
780000 -- (-71.406) (-71.308) [-73.002] (-71.374) * [-75.242] (-70.915) (-71.433) (-73.116) -- 0:00:17
Average standard deviation of split frequencies: 0.028180
781000 -- (-70.806) (-72.786) [-72.880] (-71.834) * (-71.467) [-71.590] (-70.583) (-72.300) -- 0:00:17
782000 -- (-73.223) [-72.615] (-71.440) (-72.900) * (-72.362) (-75.621) (-73.075) [-71.175] -- 0:00:17
783000 -- (-72.167) [-73.289] (-71.941) (-74.589) * (-71.154) (-76.472) (-72.677) [-73.902] -- 0:00:17
784000 -- (-74.060) (-73.267) (-72.585) [-71.972] * [-71.515] (-76.364) (-74.153) (-72.078) -- 0:00:17
785000 -- (-81.210) (-73.587) (-71.127) [-71.259] * (-74.408) [-71.240] (-72.472) (-71.558) -- 0:00:17
Average standard deviation of split frequencies: 0.029588
786000 -- (-76.183) (-73.408) [-70.654] (-73.053) * [-71.616] (-72.737) (-74.907) (-71.557) -- 0:00:17
787000 -- (-75.672) [-71.931] (-74.017) (-72.048) * [-72.032] (-73.966) (-72.276) (-70.494) -- 0:00:17
788000 -- (-72.610) (-72.963) [-70.789] (-73.950) * [-71.767] (-73.466) (-73.500) (-73.052) -- 0:00:16
789000 -- (-71.843) (-70.698) [-73.975] (-70.767) * (-73.685) (-73.869) [-71.913] (-73.647) -- 0:00:16
790000 -- (-75.075) (-72.253) (-74.325) [-71.355] * (-75.418) (-75.374) (-72.783) [-71.728] -- 0:00:17
Average standard deviation of split frequencies: 0.029016
791000 -- [-71.929] (-77.149) (-73.688) (-71.144) * (-72.741) [-70.732] (-74.377) (-71.543) -- 0:00:16
792000 -- (-72.256) [-72.810] (-74.836) (-75.222) * (-72.843) [-72.214] (-71.567) (-75.506) -- 0:00:16
793000 -- (-74.875) (-72.813) (-73.798) [-71.194] * (-76.578) [-71.315] (-71.876) (-73.665) -- 0:00:16
794000 -- [-71.764] (-71.502) (-73.353) (-75.199) * (-71.607) (-71.890) [-71.047] (-73.995) -- 0:00:16
795000 -- (-72.999) (-72.846) [-74.752] (-73.769) * (-72.436) [-71.460] (-74.959) (-71.326) -- 0:00:16
Average standard deviation of split frequencies: 0.028032
796000 -- (-71.759) (-74.415) [-74.172] (-73.371) * (-72.562) (-74.264) (-72.639) [-72.162] -- 0:00:16
797000 -- (-72.481) [-70.617] (-72.039) (-72.768) * (-74.738) (-72.964) [-74.094] (-73.153) -- 0:00:16
798000 -- (-74.037) (-71.299) [-72.620] (-77.344) * (-74.706) [-71.457] (-75.189) (-72.849) -- 0:00:16
799000 -- (-73.124) (-74.446) (-71.914) [-70.830] * (-72.045) [-72.688] (-74.561) (-72.794) -- 0:00:16
800000 -- (-74.233) (-72.213) [-71.792] (-73.033) * (-71.664) (-71.597) [-74.368] (-72.607) -- 0:00:16
Average standard deviation of split frequencies: 0.027476
801000 -- [-71.764] (-72.658) (-77.241) (-71.526) * (-75.770) [-71.143] (-72.989) (-71.381) -- 0:00:15
802000 -- (-72.364) (-72.268) (-73.217) [-72.627] * (-72.297) [-73.038] (-71.715) (-74.119) -- 0:00:16
803000 -- [-73.191] (-72.762) (-74.464) (-72.583) * (-74.880) [-70.800] (-71.955) (-74.085) -- 0:00:15
804000 -- [-71.882] (-72.273) (-71.085) (-74.053) * (-73.757) (-74.369) (-76.231) [-72.011] -- 0:00:15
805000 -- (-71.341) (-74.297) (-73.914) [-72.902] * (-73.065) (-73.929) [-72.689] (-74.847) -- 0:00:15
Average standard deviation of split frequencies: 0.026904
806000 -- (-74.718) (-75.432) (-71.201) [-72.940] * (-72.506) (-74.820) [-72.261] (-73.226) -- 0:00:15
807000 -- (-71.904) [-72.496] (-71.729) (-71.092) * (-76.056) (-74.115) (-72.253) [-80.518] -- 0:00:15
808000 -- [-73.490] (-73.929) (-72.328) (-77.805) * (-72.410) (-77.885) (-74.248) [-71.425] -- 0:00:15
809000 -- (-70.931) (-70.974) (-72.701) [-72.395] * (-73.435) [-72.020] (-72.657) (-70.576) -- 0:00:15
810000 -- (-72.879) [-72.978] (-74.860) (-77.407) * (-74.468) [-71.344] (-72.074) (-71.250) -- 0:00:15
Average standard deviation of split frequencies: 0.026749
811000 -- (-72.084) (-71.895) [-72.285] (-71.905) * (-73.229) (-73.685) (-71.450) [-71.895] -- 0:00:15
812000 -- (-74.016) (-71.680) (-75.285) [-71.655] * (-73.567) (-72.986) (-72.663) [-70.609] -- 0:00:15
813000 -- (-76.013) (-72.293) [-74.317] (-74.535) * [-72.458] (-73.421) (-72.199) (-73.685) -- 0:00:14
814000 -- (-70.991) (-72.378) (-72.195) [-72.739] * (-77.198) [-73.164] (-71.344) (-71.856) -- 0:00:15
815000 -- (-71.385) (-75.135) (-72.757) [-71.306] * (-71.456) (-72.186) (-72.346) [-73.515] -- 0:00:14
Average standard deviation of split frequencies: 0.026959
816000 -- (-73.515) [-70.804] (-72.424) (-73.207) * (-71.175) (-75.207) (-71.494) [-72.830] -- 0:00:14
817000 -- (-72.336) (-72.052) [-72.508] (-75.038) * (-74.012) (-73.472) [-70.503] (-73.673) -- 0:00:14
818000 -- (-72.385) [-71.376] (-70.953) (-71.508) * (-74.336) [-75.626] (-75.069) (-72.948) -- 0:00:14
819000 -- (-72.835) (-71.315) [-72.627] (-70.869) * (-71.681) [-71.582] (-73.792) (-75.115) -- 0:00:14
820000 -- (-72.963) [-73.712] (-74.168) (-72.463) * (-75.382) (-71.723) (-71.092) [-70.761] -- 0:00:14
Average standard deviation of split frequencies: 0.026423
821000 -- (-71.656) [-73.795] (-74.062) (-71.289) * (-74.192) (-74.166) [-71.298] (-72.424) -- 0:00:14
822000 -- [-71.406] (-73.468) (-71.554) (-72.542) * (-70.901) (-74.639) [-76.500] (-72.895) -- 0:00:14
823000 -- (-73.974) (-72.111) [-74.572] (-71.135) * (-71.501) (-74.801) (-74.806) [-72.521] -- 0:00:14
824000 -- [-73.026] (-74.865) (-70.926) (-72.366) * (-74.635) (-72.910) (-73.138) [-72.409] -- 0:00:14
825000 -- [-71.940] (-73.248) (-71.951) (-71.976) * (-74.861) [-72.988] (-72.432) (-71.822) -- 0:00:14
Average standard deviation of split frequencies: 0.026633
826000 -- [-72.545] (-72.316) (-71.682) (-73.630) * (-71.169) (-72.232) [-71.745] (-71.680) -- 0:00:14
827000 -- [-73.119] (-76.113) (-71.609) (-71.606) * (-76.090) (-77.823) [-71.566] (-72.369) -- 0:00:14
828000 -- (-70.949) [-72.273] (-71.680) (-71.966) * (-72.921) [-71.356] (-71.112) (-76.270) -- 0:00:13
829000 -- (-71.404) (-73.149) [-71.979] (-76.086) * [-71.678] (-75.408) (-72.414) (-71.673) -- 0:00:13
830000 -- (-72.953) (-70.964) [-73.169] (-71.241) * [-71.562] (-77.560) (-73.521) (-73.729) -- 0:00:13
Average standard deviation of split frequencies: 0.027240
831000 -- (-77.578) (-74.430) (-72.554) [-75.502] * (-72.440) (-71.899) [-71.811] (-71.416) -- 0:00:13
832000 -- (-74.522) (-74.077) (-71.199) [-72.499] * (-73.826) (-81.173) [-73.225] (-75.972) -- 0:00:13
833000 -- (-75.868) [-72.711] (-76.519) (-73.082) * (-74.552) (-73.405) (-73.762) [-74.411] -- 0:00:13
834000 -- [-72.253] (-72.842) (-73.113) (-72.104) * [-71.383] (-74.110) (-72.368) (-72.132) -- 0:00:13
835000 -- (-70.955) (-75.525) [-72.479] (-72.692) * (-72.519) (-80.238) (-81.032) [-72.042] -- 0:00:13
Average standard deviation of split frequencies: 0.026314
836000 -- (-73.064) (-72.550) [-71.726] (-75.711) * (-73.590) (-73.105) (-71.677) [-74.599] -- 0:00:13
837000 -- (-74.736) [-70.694] (-74.522) (-75.384) * (-71.255) [-74.159] (-70.937) (-75.242) -- 0:00:13
838000 -- (-71.684) [-70.933] (-72.875) (-73.235) * [-73.320] (-73.224) (-73.916) (-72.693) -- 0:00:12
839000 -- [-72.665] (-72.122) (-70.840) (-72.154) * (-73.810) [-73.636] (-72.555) (-75.513) -- 0:00:13
840000 -- (-74.299) [-71.425] (-74.030) (-75.654) * (-74.387) (-71.528) (-71.946) [-73.163] -- 0:00:12
Average standard deviation of split frequencies: 0.025047
841000 -- (-72.655) [-72.562] (-75.546) (-72.001) * (-72.580) (-74.824) (-72.296) [-72.491] -- 0:00:12
842000 -- [-71.634] (-72.639) (-71.931) (-73.183) * (-76.154) (-70.956) [-71.435] (-72.765) -- 0:00:12
843000 -- [-75.800] (-73.260) (-72.144) (-77.569) * (-73.667) (-72.434) (-77.203) [-72.553] -- 0:00:12
844000 -- (-77.672) [-72.080] (-71.999) (-71.852) * (-71.070) [-71.878] (-70.558) (-72.363) -- 0:00:12
845000 -- [-71.910] (-72.937) (-72.868) (-73.094) * (-72.898) [-71.135] (-71.499) (-75.719) -- 0:00:12
Average standard deviation of split frequencies: 0.024517
846000 -- (-72.194) [-73.353] (-71.464) (-71.761) * (-72.577) (-71.774) (-71.848) [-71.719] -- 0:00:12
847000 -- (-72.967) (-75.697) (-71.561) [-70.949] * (-73.067) (-71.505) (-73.372) [-71.503] -- 0:00:12
848000 -- [-73.306] (-70.889) (-71.002) (-71.925) * (-73.057) (-70.942) [-72.686] (-72.427) -- 0:00:12
849000 -- [-72.669] (-72.715) (-71.694) (-75.665) * (-71.699) (-72.458) (-72.354) [-74.872] -- 0:00:12
850000 -- (-74.423) (-71.257) (-70.571) [-73.898] * (-72.380) (-71.912) (-75.824) [-71.444] -- 0:00:12
Average standard deviation of split frequencies: 0.024383
851000 -- [-71.327] (-72.460) (-73.746) (-71.114) * (-72.857) [-72.252] (-74.114) (-71.925) -- 0:00:11
852000 -- [-73.681] (-74.892) (-74.115) (-73.751) * (-72.187) [-71.566] (-71.283) (-71.900) -- 0:00:11
853000 -- (-72.195) (-72.364) [-72.101] (-75.643) * (-73.367) (-70.872) [-71.398] (-71.900) -- 0:00:11
854000 -- (-72.895) (-71.369) [-72.830] (-70.703) * (-74.054) (-72.930) (-75.152) [-72.151] -- 0:00:11
855000 -- (-71.330) (-73.794) [-70.690] (-71.623) * (-73.393) [-72.701] (-75.480) (-78.259) -- 0:00:11
Average standard deviation of split frequencies: 0.024231
856000 -- (-72.819) [-71.837] (-76.474) (-70.983) * (-72.251) (-74.255) (-72.919) [-74.190] -- 0:00:11
857000 -- (-71.773) (-72.430) [-72.950] (-72.537) * [-72.143] (-71.648) (-81.868) (-73.481) -- 0:00:11
858000 -- (-70.814) (-73.904) [-74.983] (-71.945) * (-72.690) (-75.508) [-71.487] (-75.015) -- 0:00:11
859000 -- (-70.770) (-73.011) (-71.028) [-72.728] * (-75.151) (-75.659) (-71.746) [-71.246] -- 0:00:11
860000 -- [-72.428] (-72.123) (-74.754) (-73.999) * (-74.654) [-72.191] (-71.741) (-71.584) -- 0:00:11
Average standard deviation of split frequencies: 0.023735
861000 -- (-73.220) (-71.838) (-72.625) [-71.166] * (-72.010) (-73.103) [-74.413] (-72.740) -- 0:00:11
862000 -- (-75.536) (-73.383) [-71.547] (-73.525) * (-71.833) (-71.240) [-71.306] (-71.087) -- 0:00:11
863000 -- (-72.892) (-72.862) (-74.692) [-72.568] * (-76.530) [-71.288] (-77.040) (-72.708) -- 0:00:10
864000 -- (-72.632) [-73.668] (-71.379) (-71.368) * (-73.191) (-74.011) [-72.393] (-72.340) -- 0:00:11
865000 -- [-71.817] (-73.170) (-71.883) (-73.005) * (-74.791) (-74.163) [-72.051] (-74.150) -- 0:00:10
Average standard deviation of split frequencies: 0.022500
866000 -- (-73.474) [-72.864] (-71.476) (-72.929) * (-72.890) (-71.788) (-71.560) [-74.236] -- 0:00:10
867000 -- [-73.286] (-71.014) (-72.274) (-73.010) * (-72.850) [-73.402] (-75.205) (-75.789) -- 0:00:10
868000 -- (-77.173) (-74.183) [-72.127] (-71.350) * (-73.345) (-70.437) (-74.872) [-73.121] -- 0:00:10
869000 -- [-70.877] (-74.058) (-71.925) (-72.691) * (-74.961) (-71.041) [-71.736] (-72.426) -- 0:00:10
870000 -- [-75.249] (-72.511) (-75.962) (-73.794) * (-71.180) (-71.324) (-72.811) [-76.055] -- 0:00:10
Average standard deviation of split frequencies: 0.022740
871000 -- (-70.983) (-73.811) [-75.259] (-73.100) * [-72.425] (-73.262) (-73.396) (-70.982) -- 0:00:10
872000 -- (-72.836) [-75.148] (-72.618) (-72.867) * (-73.825) [-72.183] (-72.181) (-72.180) -- 0:00:10
873000 -- [-73.818] (-73.608) (-72.920) (-75.721) * (-73.896) [-72.365] (-71.673) (-72.240) -- 0:00:10
874000 -- (-73.620) [-71.829] (-71.764) (-72.542) * (-71.822) [-74.339] (-74.590) (-73.131) -- 0:00:10
875000 -- (-75.815) (-72.916) (-73.591) [-70.893] * [-71.603] (-75.142) (-73.396) (-71.716) -- 0:00:10
Average standard deviation of split frequencies: 0.022602
876000 -- (-74.240) (-74.458) [-70.861] (-73.154) * (-75.425) [-72.477] (-73.281) (-73.082) -- 0:00:10
877000 -- (-71.736) (-72.421) (-74.546) [-72.915] * [-72.694] (-73.699) (-71.144) (-71.966) -- 0:00:09
878000 -- (-74.484) (-73.782) [-73.827] (-74.392) * [-74.302] (-70.712) (-73.718) (-73.467) -- 0:00:09
879000 -- (-71.882) (-72.480) (-72.251) [-71.907] * (-73.489) [-71.821] (-72.702) (-74.765) -- 0:00:09
880000 -- (-72.458) (-73.183) (-71.690) [-73.084] * [-72.046] (-73.253) (-72.649) (-72.303) -- 0:00:09
Average standard deviation of split frequencies: 0.022125
881000 -- (-71.805) (-73.146) [-71.176] (-71.342) * (-75.696) (-72.764) (-71.760) [-76.326] -- 0:00:09
882000 -- [-74.504] (-71.321) (-72.530) (-72.294) * (-76.333) [-72.055] (-71.862) (-76.072) -- 0:00:09
883000 -- [-70.785] (-72.867) (-76.151) (-75.372) * (-71.948) [-72.032] (-72.051) (-71.215) -- 0:00:09
884000 -- (-73.018) [-71.605] (-72.677) (-74.184) * (-73.079) [-73.095] (-72.398) (-73.264) -- 0:00:09
885000 -- (-71.732) (-72.219) [-72.141] (-72.623) * (-76.678) [-77.766] (-71.523) (-71.936) -- 0:00:09
Average standard deviation of split frequencies: 0.022701
886000 -- [-70.944] (-72.691) (-71.602) (-71.718) * [-74.022] (-70.854) (-71.420) (-72.949) -- 0:00:09
887000 -- [-71.259] (-71.432) (-72.327) (-71.207) * (-73.290) (-74.125) (-72.905) [-73.739] -- 0:00:09
888000 -- (-71.372) (-74.554) (-71.417) [-71.335] * [-72.337] (-78.577) (-77.272) (-72.372) -- 0:00:09
889000 -- [-73.171] (-71.088) (-76.136) (-75.877) * (-72.526) (-73.986) (-71.920) [-71.352] -- 0:00:08
890000 -- (-73.007) (-72.942) [-74.363] (-72.059) * (-74.966) (-71.189) (-74.217) [-70.904] -- 0:00:08
Average standard deviation of split frequencies: 0.022582
891000 -- (-72.674) (-71.840) [-71.378] (-74.358) * (-71.589) (-72.939) [-72.136] (-71.967) -- 0:00:08
892000 -- (-71.438) (-71.484) [-74.720] (-71.681) * (-73.200) (-71.617) (-71.100) [-71.587] -- 0:00:08
893000 -- (-70.964) (-71.792) (-76.583) [-76.490] * [-72.854] (-71.630) (-72.818) (-71.405) -- 0:00:08
894000 -- (-72.209) (-75.095) [-71.012] (-73.241) * (-73.350) [-72.737] (-74.199) (-73.430) -- 0:00:08
895000 -- (-71.645) (-74.040) (-70.908) [-71.190] * (-71.626) (-74.543) [-77.436] (-71.204) -- 0:00:08
Average standard deviation of split frequencies: 0.021746
896000 -- [-71.696] (-73.570) (-72.267) (-76.840) * (-72.023) (-76.036) [-72.643] (-73.090) -- 0:00:08
897000 -- (-72.477) (-70.838) [-72.934] (-71.858) * (-73.493) [-77.042] (-71.203) (-73.556) -- 0:00:08
898000 -- [-74.004] (-72.933) (-74.083) (-72.950) * [-72.233] (-76.552) (-73.415) (-75.348) -- 0:00:08
899000 -- (-72.995) [-71.607] (-72.513) (-74.100) * (-74.728) (-73.663) [-74.970] (-75.945) -- 0:00:08
900000 -- (-72.365) [-72.424] (-73.713) (-74.574) * (-74.394) (-71.515) [-72.427] (-71.709) -- 0:00:08
Average standard deviation of split frequencies: 0.021983
901000 -- (-71.137) [-72.443] (-72.156) (-73.097) * (-73.851) (-72.343) [-71.911] (-75.861) -- 0:00:08
902000 -- (-74.123) (-71.573) (-74.450) [-73.505] * (-72.062) [-72.276] (-75.893) (-73.571) -- 0:00:07
903000 -- [-73.616] (-72.251) (-72.033) (-75.539) * [-72.389] (-71.825) (-77.214) (-76.380) -- 0:00:07
904000 -- (-72.721) (-76.938) [-73.120] (-72.509) * (-73.440) (-72.517) [-74.497] (-75.156) -- 0:00:07
905000 -- [-71.308] (-72.298) (-75.129) (-71.227) * (-73.473) (-71.459) [-71.506] (-72.774) -- 0:00:07
Average standard deviation of split frequencies: 0.021159
906000 -- [-71.520] (-72.772) (-72.241) (-72.811) * (-72.475) (-73.424) (-71.652) [-74.523] -- 0:00:07
907000 -- (-71.759) (-72.860) [-70.603] (-73.016) * (-73.861) (-72.183) (-73.134) [-71.481] -- 0:00:07
908000 -- (-72.790) (-72.172) [-72.062] (-73.420) * (-72.708) (-72.950) [-72.790] (-73.740) -- 0:00:07
909000 -- (-76.615) (-73.628) (-72.329) [-71.454] * (-72.183) [-71.861] (-70.762) (-74.167) -- 0:00:07
910000 -- (-71.452) [-71.274] (-72.746) (-73.643) * (-73.489) (-76.026) [-71.212] (-75.624) -- 0:00:07
Average standard deviation of split frequencies: 0.019671
911000 -- (-72.291) (-74.295) [-71.836] (-71.506) * (-76.863) [-75.185] (-72.875) (-73.653) -- 0:00:07
912000 -- [-73.710] (-76.055) (-71.552) (-75.247) * (-76.803) [-70.855] (-74.106) (-72.696) -- 0:00:07
913000 -- (-76.386) (-73.160) [-75.204] (-71.129) * (-72.024) (-70.807) (-74.709) [-70.972] -- 0:00:06
914000 -- (-72.284) (-76.189) [-71.424] (-73.923) * (-71.406) (-70.821) (-74.883) [-74.382] -- 0:00:06
915000 -- [-74.327] (-71.506) (-71.620) (-71.193) * (-71.384) (-75.418) (-76.126) [-71.219] -- 0:00:06
Average standard deviation of split frequencies: 0.019213
916000 -- (-74.242) [-71.200] (-71.484) (-72.873) * (-74.288) (-73.422) [-75.175] (-74.059) -- 0:00:06
917000 -- [-73.268] (-72.044) (-72.078) (-71.554) * [-73.852] (-71.315) (-71.381) (-72.911) -- 0:00:06
918000 -- (-71.148) (-73.091) [-71.910] (-70.924) * [-71.233] (-71.909) (-78.421) (-71.748) -- 0:00:06
919000 -- (-70.740) (-72.201) (-72.719) [-72.653] * [-71.646] (-72.608) (-72.737) (-72.432) -- 0:00:06
920000 -- (-71.316) (-76.810) [-73.467] (-70.744) * (-75.331) (-72.330) [-71.276] (-72.821) -- 0:00:06
Average standard deviation of split frequencies: 0.019116
921000 -- [-74.006] (-72.979) (-79.240) (-73.483) * (-74.369) [-72.004] (-73.057) (-72.362) -- 0:00:06
922000 -- (-70.905) (-74.290) [-73.179] (-72.810) * (-71.659) [-73.289] (-71.641) (-77.419) -- 0:00:06
923000 -- [-72.569] (-76.024) (-70.600) (-73.389) * (-71.685) [-75.106] (-72.658) (-72.927) -- 0:00:06
924000 -- (-76.072) (-78.510) (-75.254) [-71.619] * [-72.227] (-72.481) (-73.463) (-75.302) -- 0:00:06
925000 -- (-72.888) (-72.073) [-70.859] (-73.488) * (-73.417) (-70.762) (-72.833) [-72.003] -- 0:00:06
Average standard deviation of split frequencies: 0.019345
926000 -- [-71.186] (-72.262) (-77.542) (-71.314) * [-73.368] (-73.703) (-72.589) (-72.453) -- 0:00:05
927000 -- [-73.924] (-74.935) (-71.869) (-74.248) * (-76.280) (-73.655) (-74.098) [-72.353] -- 0:00:05
928000 -- (-73.109) [-71.665] (-71.412) (-70.833) * (-76.650) [-72.476] (-73.357) (-74.424) -- 0:00:05
929000 -- (-71.766) [-73.667] (-71.825) (-72.263) * (-71.700) (-73.758) [-70.779] (-72.896) -- 0:00:05
930000 -- [-73.314] (-74.422) (-70.938) (-75.690) * (-73.981) [-72.734] (-78.597) (-73.209) -- 0:00:05
Average standard deviation of split frequencies: 0.018573
931000 -- [-76.584] (-74.507) (-72.651) (-74.397) * (-71.832) [-73.736] (-71.987) (-74.422) -- 0:00:05
932000 -- [-75.380] (-72.705) (-75.193) (-73.603) * (-74.051) (-71.349) [-74.318] (-73.429) -- 0:00:05
933000 -- (-74.080) (-73.184) (-72.376) [-71.243] * [-71.955] (-73.627) (-74.046) (-71.854) -- 0:00:05
934000 -- (-72.525) [-73.402] (-73.599) (-70.527) * [-74.503] (-73.793) (-72.530) (-71.998) -- 0:00:05
935000 -- [-72.605] (-78.597) (-74.022) (-70.938) * (-72.223) (-72.369) (-72.284) [-71.827] -- 0:00:05
Average standard deviation of split frequencies: 0.019474
936000 -- (-72.240) (-79.244) (-73.057) [-71.043] * (-73.992) [-72.269] (-71.357) (-73.209) -- 0:00:05
937000 -- [-71.479] (-72.649) (-79.279) (-72.057) * [-74.537] (-71.876) (-72.886) (-74.907) -- 0:00:05
938000 -- (-73.233) (-71.185) [-75.203] (-71.469) * (-71.244) (-71.099) [-71.437] (-81.315) -- 0:00:04
939000 -- (-72.982) [-74.909] (-76.646) (-71.748) * (-71.445) (-70.818) [-71.527] (-72.849) -- 0:00:04
940000 -- [-72.958] (-70.883) (-75.348) (-75.372) * (-73.135) (-72.034) [-74.033] (-73.113) -- 0:00:04
Average standard deviation of split frequencies: 0.020046
941000 -- (-71.177) [-73.526] (-79.606) (-72.929) * (-71.518) (-73.660) [-70.758] (-77.599) -- 0:00:04
942000 -- (-71.422) [-73.472] (-74.966) (-72.598) * (-74.568) [-73.562] (-71.411) (-71.062) -- 0:00:04
943000 -- (-71.255) (-76.015) [-71.002] (-73.907) * [-72.521] (-72.123) (-71.580) (-80.326) -- 0:00:04
944000 -- (-73.489) (-71.873) (-70.628) [-71.280] * (-70.945) [-73.679] (-71.708) (-73.091) -- 0:00:04
945000 -- [-73.194] (-73.597) (-76.446) (-72.921) * [-73.533] (-75.038) (-72.007) (-73.956) -- 0:00:04
Average standard deviation of split frequencies: 0.019933
946000 -- [-70.717] (-72.787) (-72.384) (-71.850) * (-71.212) [-73.345] (-73.112) (-73.750) -- 0:00:04
947000 -- [-71.877] (-72.149) (-77.716) (-74.239) * (-71.631) [-71.469] (-74.388) (-73.691) -- 0:00:04
948000 -- [-74.412] (-73.521) (-73.493) (-72.164) * (-71.846) (-73.635) (-70.419) [-71.748] -- 0:00:04
949000 -- (-75.020) [-71.582] (-73.279) (-71.651) * [-72.230] (-73.672) (-72.624) (-72.389) -- 0:00:04
950000 -- (-79.993) [-72.349] (-72.973) (-74.565) * (-72.224) [-70.913] (-71.365) (-79.701) -- 0:00:04
Average standard deviation of split frequencies: 0.020165
951000 -- (-73.124) (-74.426) [-72.407] (-74.497) * (-73.620) [-72.535] (-76.225) (-70.770) -- 0:00:03
952000 -- [-71.652] (-71.993) (-76.335) (-72.942) * [-72.926] (-73.613) (-76.524) (-73.160) -- 0:00:03
953000 -- [-71.259] (-72.386) (-75.890) (-73.220) * (-73.672) [-71.736] (-74.276) (-75.800) -- 0:00:03
954000 -- (-71.033) (-77.505) [-76.481] (-71.017) * [-73.190] (-70.752) (-71.613) (-77.593) -- 0:00:03
955000 -- (-72.600) [-72.075] (-72.213) (-71.788) * (-71.776) (-77.616) (-76.030) [-70.556] -- 0:00:03
Average standard deviation of split frequencies: 0.020382
956000 -- (-81.644) [-74.678] (-72.281) (-73.615) * (-75.363) (-73.032) (-70.782) [-71.154] -- 0:00:03
957000 -- (-73.789) [-71.722] (-75.802) (-74.012) * (-75.366) (-72.138) (-72.638) [-73.641] -- 0:00:03
958000 -- [-71.451] (-72.271) (-72.731) (-74.069) * (-70.965) [-72.432] (-71.718) (-73.966) -- 0:00:03
959000 -- (-72.885) (-75.757) (-73.280) [-76.085] * (-74.562) (-72.579) (-77.571) [-73.912] -- 0:00:03
960000 -- (-72.704) (-74.641) (-72.803) [-71.824] * [-71.170] (-71.696) (-73.145) (-72.262) -- 0:00:03
Average standard deviation of split frequencies: 0.019628
961000 -- (-72.387) (-70.976) (-72.976) [-72.921] * (-72.504) [-72.078] (-75.974) (-71.766) -- 0:00:03
962000 -- (-72.963) (-73.021) (-73.021) [-71.015] * (-72.100) (-75.549) (-73.611) [-74.261] -- 0:00:03
963000 -- (-73.057) (-73.163) [-75.580] (-73.801) * (-71.793) (-70.886) [-71.553] (-79.167) -- 0:00:02
964000 -- [-73.068] (-72.370) (-74.830) (-75.043) * (-75.473) (-75.983) [-72.051] (-71.655) -- 0:00:02
965000 -- (-71.257) [-71.213] (-74.245) (-74.288) * (-74.422) [-73.753] (-71.800) (-73.517) -- 0:00:02
Average standard deviation of split frequencies: 0.019520
966000 -- (-70.925) (-72.605) (-73.800) [-73.654] * (-71.076) (-72.826) [-73.520] (-71.282) -- 0:00:02
967000 -- (-78.357) (-77.656) (-71.814) [-71.583] * (-70.941) (-77.428) [-71.410] (-72.767) -- 0:00:02
968000 -- (-73.202) (-72.738) [-70.960] (-71.431) * [-72.342] (-77.013) (-72.895) (-74.363) -- 0:00:02
969000 -- (-71.936) (-72.087) (-74.630) [-71.918] * (-74.395) (-71.853) (-73.883) [-77.111] -- 0:00:02
970000 -- (-71.963) (-71.665) [-70.827] (-72.416) * (-71.181) [-71.697] (-73.512) (-72.424) -- 0:00:02
Average standard deviation of split frequencies: 0.018778
971000 -- (-74.831) (-74.515) [-74.503] (-71.724) * (-72.827) [-73.081] (-75.490) (-71.546) -- 0:00:02
972000 -- [-71.606] (-74.488) (-73.409) (-71.559) * (-72.339) [-71.814] (-79.816) (-71.743) -- 0:00:02
973000 -- [-75.063] (-72.446) (-72.524) (-74.982) * (-71.126) [-72.614] (-72.167) (-71.951) -- 0:00:02
974000 -- (-71.869) (-72.224) [-72.902] (-73.304) * (-71.914) [-71.176] (-74.230) (-75.268) -- 0:00:02
975000 -- [-71.139] (-75.175) (-72.509) (-73.530) * (-72.728) [-71.649] (-72.085) (-75.803) -- 0:00:02
Average standard deviation of split frequencies: 0.018998
976000 -- (-71.672) [-71.086] (-71.322) (-71.262) * [-71.639] (-75.463) (-74.209) (-75.874) -- 0:00:01
977000 -- (-72.226) [-71.247] (-72.241) (-70.682) * (-73.106) (-74.286) (-71.766) [-71.583] -- 0:00:01
978000 -- (-71.565) [-71.528] (-73.862) (-73.343) * (-71.598) (-71.431) (-72.962) [-71.868] -- 0:00:01
979000 -- [-71.708] (-74.358) (-71.395) (-75.776) * (-72.285) (-77.612) [-72.140] (-73.896) -- 0:00:01
980000 -- (-72.324) (-72.547) (-74.212) [-72.259] * [-73.387] (-76.345) (-70.487) (-72.297) -- 0:00:01
Average standard deviation of split frequencies: 0.017626
981000 -- (-71.998) (-72.328) [-71.932] (-72.121) * [-74.791] (-77.199) (-70.712) (-71.848) -- 0:00:01
982000 -- [-73.165] (-74.723) (-73.444) (-71.258) * (-79.160) [-74.450] (-77.082) (-77.074) -- 0:00:01
983000 -- (-71.987) (-75.039) (-71.977) [-70.960] * (-75.201) (-73.537) [-73.461] (-74.967) -- 0:00:01
984000 -- (-78.974) [-72.068] (-71.362) (-73.928) * [-75.107] (-74.239) (-72.679) (-72.488) -- 0:00:01
985000 -- [-73.843] (-72.450) (-72.830) (-70.945) * [-76.660] (-71.340) (-75.700) (-80.542) -- 0:00:01
Average standard deviation of split frequencies: 0.017530
986000 -- (-71.823) (-73.033) [-71.058] (-71.815) * (-74.108) (-70.942) [-71.384] (-74.393) -- 0:00:01
987000 -- (-74.773) (-72.766) (-72.115) [-72.537] * (-71.067) (-70.961) (-71.196) [-72.061] -- 0:00:01
988000 -- (-72.434) [-71.571] (-73.582) (-74.743) * [-73.142] (-72.183) (-75.325) (-75.072) -- 0:00:00
989000 -- (-76.714) (-71.583) [-71.948] (-74.367) * (-73.604) (-72.928) [-73.422] (-72.029) -- 0:00:00
990000 -- [-71.957] (-74.355) (-71.642) (-72.249) * [-71.526] (-74.762) (-74.110) (-72.061) -- 0:00:00
Average standard deviation of split frequencies: 0.017765
991000 -- (-76.039) [-73.768] (-72.753) (-75.054) * (-72.620) (-71.847) (-76.149) [-71.580] -- 0:00:00
992000 -- (-71.234) (-74.819) (-74.349) [-72.285] * (-72.016) (-72.230) [-72.787] (-71.936) -- 0:00:00
993000 -- (-73.411) (-71.127) (-73.530) [-72.022] * (-75.328) [-73.678] (-72.967) (-71.997) -- 0:00:00
994000 -- (-72.466) [-73.251] (-71.567) (-74.365) * [-73.383] (-74.823) (-71.339) (-73.091) -- 0:00:00
995000 -- [-71.525] (-73.071) (-75.024) (-71.169) * (-70.864) (-73.449) [-72.269] (-75.239) -- 0:00:00
Average standard deviation of split frequencies: 0.018301
996000 -- (-73.954) (-72.106) [-71.556] (-71.520) * [-71.339] (-72.877) (-72.203) (-71.176) -- 0:00:00
997000 -- [-72.660] (-74.923) (-70.850) (-72.319) * (-71.820) (-79.118) (-72.388) [-74.086] -- 0:00:00
998000 -- (-74.051) (-73.511) (-76.379) [-71.206] * (-75.230) (-70.697) (-71.250) [-73.631] -- 0:00:00
999000 -- (-73.301) (-71.949) [-73.758] (-74.739) * (-71.629) (-71.377) (-73.419) [-73.769] -- 0:00:00
1000000 -- (-72.877) (-72.043) [-71.551] (-72.148) * (-72.994) (-71.997) (-73.735) [-70.574] -- 0:00:00
Average standard deviation of split frequencies: 0.017273
Analysis completed in 1 mins 20 seconds
Analysis used 80.25 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -70.38
Likelihood of best state for "cold" chain of run 2 was -70.38
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
75.4 % ( 68 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
68.4 % ( 66 %) Dirichlet(Pi{all})
66.3 % ( 43 %) Slider(Pi{all})
79.2 % ( 53 %) Multiplier(Alpha{1,2})
79.0 % ( 55 %) Multiplier(Alpha{3})
42.5 % ( 32 %) Slider(Pinvar{all})
98.7 % ( 99 %) ExtSPR(Tau{all},V{all})
99.9 % (100 %) NNI(Tau{all},V{all})
73.6 % ( 78 %) ParsSPR(Tau{all},V{all})
31.6 % ( 28 %) Multiplier(V{all})
97.0 % ( 97 %) Nodeslider(V{all})
40.0 % ( 19 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
75.7 % ( 68 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
69.9 % ( 63 %) Dirichlet(Pi{all})
67.4 % ( 56 %) Slider(Pi{all})
79.8 % ( 52 %) Multiplier(Alpha{1,2})
79.0 % ( 57 %) Multiplier(Alpha{3})
44.7 % ( 22 %) Slider(Pinvar{all})
98.8 % ( 99 %) ExtSPR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
74.1 % ( 69 %) ParsSPR(Tau{all},V{all})
31.4 % ( 28 %) Multiplier(V{all})
97.1 % ( 96 %) Nodeslider(V{all})
40.0 % ( 24 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.67 0.46 0.33
2 | 166951 0.75 0.57
3 | 166392 166830 0.80
4 | 166696 166357 166774
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.64 0.44 0.31
2 | 166681 0.75 0.57
3 | 166501 166247 0.80
4 | 166830 167482 166259
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/mrbayes_input.nex.run1.p and /data/mrbayes_input.nex.run2.p
Writing summary statistics to file /data/mrbayes_input.nex.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -71.84
| 2 1 |
| |
| 1 1 |
| 1 2 1 |
| 21 1 1 2 |
|2 2 2 1 1 2 1 1 1 1|
| 2 121 2 2 1 2 1 *2 2 21 22 2 |
| 1 1 1 21 2 2|
|1* 21 221 112 12 22 *2 2 1 * 2112 * 11 2 |
| 1 1 11 2* 2 1* 2 2 1 1* |
| 1 2* 2 1 11 2 2 |
| 2 2 22 1 2 2 |
| 1 11 2 |
| 2 2 |
| 11 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -73.55
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -72.05 -74.47
2 -72.07 -74.78
--------------------------------------
TOTAL -72.06 -74.64
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 9.060323 101.864467 0.000003 29.013160 5.884873 1017.15 1233.78 1.000
r(A<->C){all} 0.165592 0.018922 0.000266 0.435340 0.129797 215.70 219.74 1.000
r(A<->G){all} 0.161673 0.017703 0.000015 0.425335 0.129403 138.29 143.64 1.000
r(A<->T){all} 0.156101 0.019405 0.000030 0.447208 0.113951 113.26 258.98 1.004
r(C<->G){all} 0.171670 0.019629 0.000149 0.451438 0.139285 205.80 218.84 1.000
r(C<->T){all} 0.184021 0.023248 0.000064 0.491020 0.143781 135.99 183.63 1.009
r(G<->T){all} 0.160944 0.018572 0.000031 0.441283 0.123745 90.75 126.98 1.000
pi(A){all} 0.253509 0.003285 0.147406 0.369375 0.251334 774.36 809.19 1.000
pi(C){all} 0.218975 0.002935 0.119419 0.325882 0.216659 1040.30 1051.19 1.000
pi(G){all} 0.291540 0.003828 0.169117 0.407766 0.290671 826.83 936.90 1.002
pi(T){all} 0.235976 0.003257 0.132748 0.352200 0.231704 1005.26 1005.69 1.001
alpha{1,2} 0.919965 0.987703 0.000221 2.845420 0.599634 1068.82 1144.92 1.000
alpha{3} 0.938031 0.953241 0.000064 2.806031 0.636980 998.71 1025.89 1.000
pinvar{all} 0.937445 0.021866 0.636041 0.999970 0.981684 86.72 155.66 1.013
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/mrbayes_input.nex.run1.t" and "/data/mrbayes_input.nex.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/mrbayes_input.nex.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/mrbayes_input.nex.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a parameter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
Key to taxon bipartitions (saved to file "/data/mrbayes_input.nex.parts"):
ID -- Partition
----------
1 -- .***
2 -- .*..
3 -- ..*.
4 -- ...*
5 -- .*.*
6 -- ..**
7 -- .**.
----------
Summary statistics for informative taxon bipartitions
(saved to file "/data/mrbayes_input.nex.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
5 1016 0.338441 0.015075 0.327781 0.349101 2
6 993 0.330779 0.025910 0.312458 0.349101 2
7 993 0.330779 0.010835 0.323118 0.338441 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/mrbayes_input.nex.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
------------------------------------------------------------------------------------------
length{all}[1] 1.808929 9.291363 0.000001 7.540583 0.706099 1.000 2
length{all}[2] 1.859072 8.879933 0.000001 7.700799 0.718906 1.000 2
length{all}[3] 1.880326 9.694303 0.000000 7.633701 0.649028 1.000 2
length{all}[4] 1.783341 7.988949 0.000000 7.347113 0.705694 1.000 2
length{all}[5] 1.601650 6.053162 0.000007 6.408132 0.645625 0.999 2
length{all}[6] 1.774472 8.852663 0.000025 7.180947 0.717391 0.999 2
length{all}[7] 1.812785 9.639616 0.000000 7.471013 0.734531 0.999 2
------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.017273
Maximum standard deviation of split frequencies = 0.025910
Average PSRF for parameter values (excluding NA and >10.0) = 1.000
Maximum PSRF for parameter values = 1.000
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
+
|------------------------------------------------------------------------ C3 (3)
|
\------------------------------------------------------------------------ C4 (4)
Phylogram (based on average branch lengths):
/----------------------------------------------------------------------- C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
+
|----------------------------------------------------------------- C3 (3)
|
\----------------------------------------------------------------------- C4 (4)
|---------| 0.100 expected changes per site
Calculating tree probabilities...
Credible sets of trees (3 trees sampled):
50 % credible set contains 2 trees
90 % credible set contains 3 trees
95 % credible set contains 3 trees
99 % credible set contains 3 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
-- Starting log on Fri Oct 21 22:38:33 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.05 sec, SCORE=1000, Nseq=4, Len=17
C1 STDQAYLNGQGALVQLD
C2 STDQAYLNGQGALVQLD
C3 STDQAYLNGQGALVQLD
C4 STDQAYLNGQGALVQLD
*****************
-- Starting log on Fri Oct 21 22:56:44 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/codeml,HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1--
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 1 2 7 8
processing fasta file
reading seq# 1 C1 51 sites
reading seq# 2 C2 51 sites
reading seq# 3 C3 51 sites
reading seq# 4 C4 51 sitesns = 4 ls = 51
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Sequences read..
Counting site patterns.. 0:00
Compressing, 14 patterns at 17 / 17 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 14 patterns at 17 / 17 sites (100.0%), 0:00
Counting codons..
48 bytes for distance
13664 bytes for conP
1232 bytes for fhK
5000000 bytes for space
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, 4); MP score: 0
0.034178 0.066642 0.048353 0.036519 0.300000 0.650853 0.221160
ntime & nrate & np: 4 2 7
Bounds (np=7):
0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 12.385511
np = 7
lnL0 = -69.554377
Iterating by ming2
Initial: fx= 69.554377
x= 0.03418 0.06664 0.04835 0.03652 0.30000 0.65085 0.22116
1 h-m-p 0.0000 0.0022 31.3720 ++++ 67.361408 m 0.0022 14 | 1/7
2 h-m-p 0.0008 0.0042 8.0769 ++ 67.236236 m 0.0042 24 | 2/7
3 h-m-p 0.0002 0.0009 66.3406 ++ 66.872133 m 0.0009 34 | 3/7
4 h-m-p 0.0000 0.0001 1452.8129 ++ 66.549070 m 0.0001 44 | 4/7
5 h-m-p 0.0155 0.4958 2.1722 -------------.. | 4/7
6 h-m-p 0.0000 0.0000 16.8111 ++ 66.539930 m 0.0000 75 | 5/7
7 h-m-p 0.0160 8.0000 0.0000 ----N 66.539930 0 0.0000 89 | 5/7
8 h-m-p 0.0160 8.0000 0.0000 +C 66.539930 0 0.0640 102
Out..
lnL = -66.539930
103 lfun, 309 eigenQcodon, 824 P(t)
end of tree file.
Time used: 0:00
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, 4); MP score: 0
0.086171 0.045094 0.046999 0.078464 0.273185 1.321019 0.233135 0.117192 1.446782
ntime & nrate & np: 4 3 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 12.011413
np = 9
lnL0 = -70.488569
Iterating by ming2
Initial: fx= 70.488569
x= 0.08617 0.04509 0.04700 0.07846 0.27319 1.32102 0.23314 0.11719 1.44678
1 h-m-p 0.0000 0.0032 28.2128 +++++ 67.801587 m 0.0032 17 | 1/9
2 h-m-p 0.0003 0.0013 10.1267 ++ 67.704048 m 0.0013 29 | 2/9
3 h-m-p 0.0000 0.0001 720.2126 ++ 67.040976 m 0.0001 41 | 3/9
4 h-m-p 0.0291 5.2217 1.2887 --------------.. | 3/9
5 h-m-p 0.0000 0.0007 22.9518 ++++ 66.670666 m 0.0007 79 | 4/9
6 h-m-p 0.0216 1.3713 0.5205 -------------.. | 4/9
7 h-m-p 0.0000 0.0005 16.6430 +++ 66.539930 m 0.0005 120 | 5/9
8 h-m-p 1.3814 8.0000 0.0000 ++ 66.539930 m 8.0000 132 | 5/9
9 h-m-p 0.0160 8.0000 0.0002 ---------N 66.539930 0 0.0000 157
Out..
lnL = -66.539930
158 lfun, 632 eigenQcodon, 1896 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -66.540783 S = -66.539764 -0.000389
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 14 patterns 0:01
did 14 / 14 patterns 0:01end of tree file.
Time used: 0:01
Model 7: beta
TREE # 1
(1, 2, 3, 4); MP score: 0
0.081390 0.052467 0.063129 0.061394 0.257547 0.674583 1.983933
ntime & nrate & np: 4 1 7
Bounds (np=7):
0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 19.440385
np = 7
lnL0 = -70.698599
Iterating by ming2
Initial: fx= 70.698599
x= 0.08139 0.05247 0.06313 0.06139 0.25755 0.67458 1.98393
1 h-m-p 0.0000 0.0034 30.8389 +++++ 67.359946 m 0.0034 15 | 1/7
2 h-m-p 0.0256 0.1278 2.8293 -------------.. | 1/7
3 h-m-p 0.0000 0.0005 28.6065 +++ 66.909729 m 0.0005 47 | 2/7
4 h-m-p 0.0085 0.3592 1.4972 -------------.. | 2/7
5 h-m-p 0.0000 0.0001 23.5685 ++ 66.851015 m 0.0001 78 | 3/7
6 h-m-p 0.0014 0.5022 1.2994 -----------.. | 3/7
7 h-m-p 0.0000 0.0011 16.6459 ++++ 66.539930 m 0.0011 109 | 4/7
8 h-m-p 1.6000 8.0000 0.0000 ++ 66.539930 m 8.0000 119 | 4/7
9 h-m-p 0.0377 8.0000 0.0001 ++++ 66.539930 m 8.0000 134 | 4/7
10 h-m-p 0.0049 2.4696 0.3148 +++++ 66.539930 m 2.4696 150 | 5/7
11 h-m-p 0.2656 1.3279 1.0583 ++ 66.539927 m 1.3279 163 | 6/7
12 h-m-p 1.6000 8.0000 0.0044 -Y 66.539927 0 0.0312 174 | 6/7
13 h-m-p 1.6000 8.0000 0.0000 Y 66.539927 0 1.6000 185
Out..
lnL = -66.539927
186 lfun, 2046 eigenQcodon, 7440 P(t)
end of tree file.
Time used: 0:04
Model 8: beta&w>1
TREE # 1
(1, 2, 3, 4); MP score: 0
0.039453 0.027474 0.013832 0.087186 0.000100 0.900000 0.886304 1.309634 1.300000
ntime & nrate & np: 4 2 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 14.454936
np = 9
lnL0 = -69.252237
Iterating by ming2
Initial: fx= 69.252237
x= 0.03945 0.02747 0.01383 0.08719 0.00011 0.90000 0.88630 1.30963 1.30000
1 h-m-p 0.0000 0.0001 31.2109 ++ 69.189226 m 0.0001 14 | 1/9
2 h-m-p 0.0006 0.2838 4.6670 -----------.. | 1/9
3 h-m-p 0.0000 0.0008 31.2653 ++++ 68.386084 m 0.0008 49 | 2/9
4 h-m-p 0.0056 0.3458 3.9039 ------------.. | 2/9
5 h-m-p 0.0000 0.0009 27.6048 ++++ 67.729668 m 0.0009 85 | 3/9
6 h-m-p 0.0074 0.5696 2.5847 -------------.. | 3/9
7 h-m-p 0.0000 0.0007 22.8891 ++++ 67.339093 m 0.0007 122 | 4/9
8 h-m-p 0.0070 0.9471 1.6904 -------------.. | 4/9
9 h-m-p 0.0000 0.0030 16.2654 +++++ 66.539930 m 0.0030 160 | 5/9
10 h-m-p 1.6000 8.0000 0.0000 ++ 66.539930 m 8.0000 172 | 5/9
11 h-m-p 0.0160 8.0000 0.0019 +++++ 66.539930 m 8.0000 191 | 5/9
12 h-m-p 0.0466 3.2456 0.3231 ---------N 66.539930 0 0.0000 216 | 5/9
13 h-m-p 0.0160 8.0000 0.0006 +++++ 66.539930 m 8.0000 235 | 5/9
14 h-m-p 0.0148 3.3616 0.3135 ---------N 66.539930 0 0.0000 260 | 5/9
15 h-m-p 0.0160 8.0000 0.0001 -------Y 66.539930 0 0.0000 283 | 5/9
16 h-m-p 0.0160 8.0000 0.0000 +++++ 66.539930 m 8.0000 302 | 5/9
17 h-m-p 0.0047 2.3743 0.3019 -------Y 66.539930 0 0.0000 325 | 5/9
18 h-m-p 0.0160 8.0000 0.0011 ------Y 66.539930 0 0.0000 347 | 5/9
19 h-m-p 0.0160 8.0000 0.0001 +++++ 66.539930 m 8.0000 366 | 5/9
20 h-m-p 0.0046 2.3121 0.2860 -------Y 66.539930 0 0.0000 389 | 5/9
21 h-m-p 0.0160 8.0000 0.0003 +++++ 66.539930 m 8.0000 408 | 5/9
22 h-m-p 0.0073 2.3429 0.2822 ----------Y 66.539930 0 0.0000 434 | 5/9
23 h-m-p 0.0160 8.0000 0.0000 +++++ 66.539930 m 8.0000 453 | 5/9
24 h-m-p 0.0043 2.1268 0.2985 ---------C 66.539930 0 0.0000 478 | 5/9
25 h-m-p 0.0160 8.0000 0.0000 ------C 66.539930 0 0.0000 500 | 5/9
26 h-m-p 0.0160 8.0000 0.0000 ------C 66.539930 0 0.0000 522
Out..
lnL = -66.539930
523 lfun, 6276 eigenQcodon, 23012 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -66.541108 S = -66.539751 -0.000594
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 14 patterns 0:14
did 14 / 14 patterns 0:14end of tree file.
Time used: 0:14
The loglikelihoods for models M1, M2, M7 and M8 are -66.539930 -66.539930 -66.539927 -66.539930 respectively
CLUSTAL W (1.8) multiple sequence alignment (ALTER 1.3.3)
HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
*****************
>HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC >HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC >HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC >HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 AGTACTGATCAGGCTTATTTAAACGGGCAAGGGGCTCTAGTGCAGCTCGAC
>HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD >HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD >HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD >HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2 STDQAYLNGQGALVQLD
Reading sequence file /data//pss_subsets/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result/original_alignment/codeml/fasta/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1 Found 4 sequences of length 51 Alignment looks like a valid DNA alignment. Estimated diversity is (pairwise deletion - ignoring missing/ambig): 0.0% Found 0 informative sites. Writing alignment of informative sites to: Phi.inf.sites Writing list of informative sites to: Phi.inf.list Calculating all pairwise incompatibilities... 100.0% Using a window size of 80 with k as 1 Too few informative sites to use normal approximation. Try doing a permutation test or increasing alignment length Can also try decreasing windowsize.
#NEXUS
[ID: 8314311582]
begin taxa;
dimensions ntax=4;
taxlabels
HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
;
end;
begin trees;
translate
1 HKU2_GD_430_2006_nsp11_VIPR_P_148283140_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2,
2 HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2,
3 HKU2_HK_298_2006_NA_VIPR_P_148283158_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2,
4 HKU2_HK_33_2006_NA_VIPR_P_148283167_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:7.060988e-01,2:7.189062e-01,3:6.490282e-01,4:7.056944e-01);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:7.060988e-01,2:7.189062e-01,3:6.490282e-01,4:7.056944e-01);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -72.05 -74.47
2 -72.07 -74.78
--------------------------------------
TOTAL -72.06 -74.64
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 9.060323 101.864467 0.000003 29.013160 5.884873 1017.15 1233.78 1.000
r(A<->C){all} 0.165592 0.018922 0.000266 0.435340 0.129797 215.70 219.74 1.000
r(A<->G){all} 0.161673 0.017703 0.000015 0.425335 0.129403 138.29 143.64 1.000
r(A<->T){all} 0.156101 0.019405 0.000030 0.447208 0.113951 113.26 258.98 1.004
r(C<->G){all} 0.171670 0.019629 0.000149 0.451438 0.139285 205.80 218.84 1.000
r(C<->T){all} 0.184021 0.023248 0.000064 0.491020 0.143781 135.99 183.63 1.009
r(G<->T){all} 0.160944 0.018572 0.000031 0.441283 0.123745 90.75 126.98 1.000
pi(A){all} 0.253509 0.003285 0.147406 0.369375 0.251334 774.36 809.19 1.000
pi(C){all} 0.218975 0.002935 0.119419 0.325882 0.216659 1040.30 1051.19 1.000
pi(G){all} 0.291540 0.003828 0.169117 0.407766 0.290671 826.83 936.90 1.002
pi(T){all} 0.235976 0.003257 0.132748 0.352200 0.231704 1005.26 1005.69 1.001
alpha{1,2} 0.919965 0.987703 0.000221 2.845420 0.599634 1068.82 1144.92 1.000
alpha{3} 0.938031 0.953241 0.000064 2.806031 0.636980 998.71 1025.89 1.000
pinvar{all} 0.937445 0.021866 0.636041 0.999970 0.981684 86.72 155.66 1.013
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
CODONML (in paml version 4.9h, March 2018) /data/fasta_checked/HKU2_HK_46_2006_NA_VIPR_P_148283149_12423_12473_1_NA_NA_Unknown_Rhinolophus_bat_coronavirus_HKU2.result.1
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 4 ls = 17
Codon usage in sequences
------------------------------------------------------------------------------------------------------
Phe TTT 0 0 0 0 | Ser TCT 0 0 0 0 | Tyr TAT 1 1 1 1 | Cys TGT 0 0 0 0
TTC 0 0 0 0 | TCC 0 0 0 0 | TAC 0 0 0 0 | TGC 0 0 0 0
Leu TTA 1 1 1 1 | TCA 0 0 0 0 | *** TAA 0 0 0 0 | *** TGA 0 0 0 0
TTG 0 0 0 0 | TCG 0 0 0 0 | TAG 0 0 0 0 | Trp TGG 0 0 0 0
------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 | Pro CCT 0 0 0 0 | His CAT 0 0 0 0 | Arg CGT 0 0 0 0
CTC 1 1 1 1 | CCC 0 0 0 0 | CAC 0 0 0 0 | CGC 0 0 0 0
CTA 1 1 1 1 | CCA 0 0 0 0 | Gln CAA 1 1 1 1 | CGA 0 0 0 0
CTG 0 0 0 0 | CCG 0 0 0 0 | CAG 2 2 2 2 | CGG 0 0 0 0
------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 | Thr ACT 1 1 1 1 | Asn AAT 0 0 0 0 | Ser AGT 1 1 1 1
ATC 0 0 0 0 | ACC 0 0 0 0 | AAC 1 1 1 1 | AGC 0 0 0 0
ATA 0 0 0 0 | ACA 0 0 0 0 | Lys AAA 0 0 0 0 | Arg AGA 0 0 0 0
Met ATG 0 0 0 0 | ACG 0 0 0 0 | AAG 0 0 0 0 | AGG 0 0 0 0
------------------------------------------------------------------------------------------------------
Val GTT 0 0 0 0 | Ala GCT 2 2 2 2 | Asp GAT 1 1 1 1 | Gly GGT 0 0 0 0
GTC 0 0 0 0 | GCC 0 0 0 0 | GAC 1 1 1 1 | GGC 0 0 0 0
GTA 0 0 0 0 | GCA 0 0 0 0 | Glu GAA 0 0 0 0 | GGA 0 0 0 0
GTG 1 1 1 1 | GCG 0 0 0 0 | GAG 0 0 0 0 | GGG 2 2 2 2
------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: C1
position 1: T:0.11765 C:0.29412 A:0.17647 G:0.41176
position 2: T:0.23529 C:0.17647 A:0.41176 G:0.17647
position 3: T:0.35294 C:0.17647 A:0.17647 G:0.29412
Average T:0.23529 C:0.21569 A:0.25490 G:0.29412
#2: C2
position 1: T:0.11765 C:0.29412 A:0.17647 G:0.41176
position 2: T:0.23529 C:0.17647 A:0.41176 G:0.17647
position 3: T:0.35294 C:0.17647 A:0.17647 G:0.29412
Average T:0.23529 C:0.21569 A:0.25490 G:0.29412
#3: C3
position 1: T:0.11765 C:0.29412 A:0.17647 G:0.41176
position 2: T:0.23529 C:0.17647 A:0.41176 G:0.17647
position 3: T:0.35294 C:0.17647 A:0.17647 G:0.29412
Average T:0.23529 C:0.21569 A:0.25490 G:0.29412
#4: C4
position 1: T:0.11765 C:0.29412 A:0.17647 G:0.41176
position 2: T:0.23529 C:0.17647 A:0.41176 G:0.17647
position 3: T:0.35294 C:0.17647 A:0.17647 G:0.29412
Average T:0.23529 C:0.21569 A:0.25490 G:0.29412
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 0 | Ser S TCT 0 | Tyr Y TAT 4 | Cys C TGT 0
TTC 0 | TCC 0 | TAC 0 | TGC 0
Leu L TTA 4 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 0 | TCG 0 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 0 | Pro P CCT 0 | His H CAT 0 | Arg R CGT 0
CTC 4 | CCC 0 | CAC 0 | CGC 0
CTA 4 | CCA 0 | Gln Q CAA 4 | CGA 0
CTG 0 | CCG 0 | CAG 8 | CGG 0
------------------------------------------------------------------------------
Ile I ATT 0 | Thr T ACT 4 | Asn N AAT 0 | Ser S AGT 4
ATC 0 | ACC 0 | AAC 4 | AGC 0
ATA 0 | ACA 0 | Lys K AAA 0 | Arg R AGA 0
Met M ATG 0 | ACG 0 | AAG 0 | AGG 0
------------------------------------------------------------------------------
Val V GTT 0 | Ala A GCT 8 | Asp D GAT 4 | Gly G GGT 0
GTC 0 | GCC 0 | GAC 4 | GGC 0
GTA 0 | GCA 0 | Glu E GAA 0 | GGA 0
GTG 4 | GCG 0 | GAG 0 | GGG 8
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.11765 C:0.29412 A:0.17647 G:0.41176
position 2: T:0.23529 C:0.17647 A:0.41176 G:0.17647
position 3: T:0.35294 C:0.17647 A:0.17647 G:0.29412
Average T:0.23529 C:0.21569 A:0.25490 G:0.29412
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, 4); MP score: 0
lnL(ntime: 4 np: 7): -66.539930 +0.000000
5..1 5..2 5..3 5..4
0.000004 0.000004 0.000004 0.000004 0.273185 0.688078 0.000001
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000016
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004);
(C1: 0.000004, C2: 0.000004, C3: 0.000004, C4: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.27319
MLEs of dN/dS (w) for site classes (K=2)
p: 0.68808 0.31192
w: 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
5..1 0.000 42.5 8.5 0.3119 0.0000 0.0000 0.0 0.0
5..2 0.000 42.5 8.5 0.3119 0.0000 0.0000 0.0 0.0
5..3 0.000 42.5 8.5 0.3119 0.0000 0.0000 0.0 0.0
5..4 0.000 42.5 8.5 0.3119 0.0000 0.0000 0.0 0.0
Time used: 0:00
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, 4); MP score: 0
lnL(ntime: 4 np: 9): -66.539930 +0.000000
5..1 5..2 5..3 5..4
0.000004 0.000004 0.000004 0.000004 0.257547 0.627444 0.207040 0.000001 1.464234
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000016
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004);
(C1: 0.000004, C2: 0.000004, C3: 0.000004, C4: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.25755
MLEs of dN/dS (w) for site classes (K=3)
p: 0.62744 0.20704 0.16552
w: 0.00000 1.00000 1.46423
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
5..1 0.000 42.6 8.4 0.4494 0.0000 0.0000 0.0 0.0
5..2 0.000 42.6 8.4 0.4494 0.0000 0.0000 0.0 0.0
5..3 0.000 42.6 8.4 0.4494 0.0000 0.0000 0.0 0.0
5..4 0.000 42.6 8.4 0.4494 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
w2: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.010
0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
sum of density on p0-p1 = 1.000000
Time used: 0:01
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, 4); MP score: 0
lnL(ntime: 4 np: 7): -66.539927 +0.000000
5..1 5..2 5..3 5..4
0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 1.940508
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000016
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004);
(C1: 0.000004, C2: 0.000004, C3: 0.000004, C4: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M7 (beta):
p = 0.00500 q = 1.94051
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00001
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
5..1 0.000 43.8 7.2 0.0000 0.0000 0.0000 0.0 0.0
5..2 0.000 43.8 7.2 0.0000 0.0000 0.0000 0.0 0.0
5..3 0.000 43.8 7.2 0.0000 0.0000 0.0000 0.0 0.0
5..4 0.000 43.8 7.2 0.0000 0.0000 0.0000 0.0 0.0
Time used: 0:04
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, 4); MP score: 0
lnL(ntime: 4 np: 9): -66.539930 +0.000000
5..1 5..2 5..3 5..4
0.000004 0.000004 0.000004 0.000004 0.000100 0.919324 0.876831 1.314131 1.301317
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000016
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004);
(C1: 0.000004, C2: 0.000004, C3: 0.000004, C4: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M8 (beta&w>1):
p0 = 0.91932 p = 0.87683 q = 1.31413
(p1 = 0.08068) w = 1.30132
MLEs of dN/dS (w) for site classes (K=11)
p: 0.09193 0.09193 0.09193 0.09193 0.09193 0.09193 0.09193 0.09193 0.09193 0.09193 0.08068
w: 0.02480 0.08776 0.15919 0.23715 0.32127 0.41188 0.50995 0.61742 0.73843 0.88559 1.30132
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
5..1 0.000 43.8 7.2 0.4721 0.0000 0.0000 0.0 0.0
5..2 0.000 43.8 7.2 0.4721 0.0000 0.0000 0.0 0.0
5..3 0.000 43.8 7.2 0.4721 0.0000 0.0000 0.0 0.0
5..4 0.000 43.8 7.2 0.4721 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
p : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
q : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
ws: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Time used: 0:14
Model 1: NearlyNeutral -66.539930 Model 2: PositiveSelection -66.539930 Model 7: beta -66.539927 Model 8: beta&w>1 -66.539930 Model 2 vs 1 0 Model 8 vs 7 -.000006
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken. # ### General parameters ### # # The maximum number of sequences to use for the master file sequence_limit=90 # The random seed random_seed=3976763 # ### Alignment ### # # The alignment method: clustalw, muscle, kalign, t_coffee, or amap align_method=muscle # Minimum support value for amino acid positions in the alignment tcoffee_min_score=3 # ### MrBayes ### # # Number of iterations in MrBayes mrbayes_generations=1000000 # MrBayes burnin mrbayes_burnin=2500 # ### FUBAR ### # # The maximum number of sequences to be used by FUBAR. fubar_sequence_limit=90 # The number of FUBAR runs fubar_runs=1 # ### codeML ### # # The maximum number of sequences to be used by CodeML codeml_sequence_limit=30 # The number of CodeML runs codeml_runs=1 # The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'. codeml_models=1 2 7 8 # ### OmegaMap ### # # The maximum number of sequences to use in OmegaMap omegamap_sequence_limit=90 # The number of OmegaMap runs omegamap_runs=1 # The number of OmegaMap iterations omegamap_iterations=2500
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
