--- EXPERIMENT NOTES
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken.
#
### General parameters ###
#
# The maximum number of sequences to use for the master file
sequence_limit=90
# The random seed
random_seed=3976763
#
### Alignment ###
#
# The alignment method: clustalw, muscle, kalign, t_coffee, or amap
align_method=muscle
# Minimum support value for amino acid positions in the alignment
tcoffee_min_score=3
#
### MrBayes ###
#
# Number of iterations in MrBayes
mrbayes_generations=1000000
# MrBayes burnin
mrbayes_burnin=2500
#
### FUBAR ###
#
# The maximum number of sequences to be used by FUBAR.
fubar_sequence_limit=90
# The number of FUBAR runs
fubar_runs=1
#
### codeML ###
#
# The maximum number of sequences to be used by CodeML
codeml_sequence_limit=30
# The number of CodeML runs
codeml_runs=1
# The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'.
codeml_models=1 2 7 8
#
### OmegaMap ###
#
# The maximum number of sequences to use in OmegaMap
omegamap_sequence_limit=90
# The number of OmegaMap runs
omegamap_runs=1
# The number of OmegaMap iterations
omegamap_iterations=2500
--- EXPERIMENT PROPERTIES
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -141.73 -152.56
2 -141.72 -154.91
--------------------------------------
TOTAL -141.73 -154.31
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.324707 0.022122 0.110791 0.607763 0.297195 1271.40 1386.20 1.000
r(A<->C){all} 0.063787 0.003933 0.000012 0.192315 0.044259 284.09 289.43 1.005
r(A<->G){all} 0.342964 0.017076 0.093315 0.591816 0.339198 93.45 133.24 1.010
r(A<->T){all} 0.077452 0.004119 0.000008 0.208162 0.062552 204.26 224.26 1.000
r(C<->G){all} 0.064250 0.003871 0.000002 0.184231 0.045722 194.15 214.29 1.000
r(C<->T){all} 0.352910 0.015936 0.117457 0.594664 0.345420 113.65 139.43 1.015
r(G<->T){all} 0.098637 0.004746 0.000317 0.234816 0.083536 183.80 253.12 1.010
pi(A){all} 0.241663 0.002641 0.144656 0.346215 0.239310 669.24 749.83 1.000
pi(C){all} 0.196624 0.002295 0.103435 0.284129 0.194183 645.99 762.79 1.004
pi(G){all} 0.276434 0.002825 0.182206 0.386350 0.274207 872.33 893.15 1.001
pi(T){all} 0.285279 0.003089 0.180605 0.394718 0.283671 821.25 855.12 1.001
alpha{1,2} 0.582281 0.528540 0.000224 1.982054 0.327552 780.91 827.42 1.001
alpha{3} 1.509678 1.261131 0.001708 3.829231 1.216155 1136.70 1168.23 1.000
pinvar{all} 0.325199 0.038307 0.001402 0.665188 0.312099 593.74 659.56 1.002
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
--- CODEML SUMMARY
Model 1: NearlyNeutral -129.073300
Model 2: PositiveSelection -127.570905
Model 7: beta -129.084400
Model 8: beta&w>1 -127.570896
Model 2 vs 1 3.004790
Model 8 vs 7 3.027008
-- Starting log on Wed Nov 09 22:46:01 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
C1 GTTIDQSYLNECGVLVQLD
C2 GTTIDQSYLNECGVLVQLD
C3 SSTVDQSYLNECGVLVQLD
C4 GTTIDQSYLNECGVLVQLD
C5 STTIDQSYLNECGVLVQLD
C6 GTTIDQSYLNECGVLVQLD
C7 GATMDQSYLNECGVLVQLD
C8 SSTVDQSYLNECGVLVQLD
C9 SSTVDQSYLNECGVLVQLD
C10 SFTVDQSYLNECGVLVQLD
C11 SSTVDQSYLNECGVLVQLD
. *:***************
-- Starting log on Wed Nov 09 22:47:03 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
C1 GTTIDQSYLNECGVLVQLD
C2 GTTIDQSYLNECGVLVQLD
C3 SSTVDQSYLNECGVLVQLD
C4 GTTIDQSYLNECGVLVQLD
C5 STTIDQSYLNECGVLVQLD
C6 GTTIDQSYLNECGVLVQLD
C7 GATMDQSYLNECGVLVQLD
C8 SSTVDQSYLNECGVLVQLD
C9 SSTVDQSYLNECGVLVQLD
C10 SFTVDQSYLNECGVLVQLD
C11 SSTVDQSYLNECGVLVQLD
. *:***************
-- Starting log on Thu Nov 10 01:17:51 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/gapped_alignment/codeml,A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1--
MrBayes v3.2.6 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/mrbayes_input.nex"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 11 taxa and 57 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C10
Taxon 3 -> C11
Taxon 4 -> C2
Taxon 5 -> C3
Taxon 6 -> C4
Taxon 7 -> C5
Taxon 8 -> C6
Taxon 9 -> C7
Taxon 10 -> C8
Taxon 11 -> C9
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1668043073
Setting output file names to "/data/mrbayes_input.nex.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called 'first_pos'
Defining charset called 'second_pos'
Defining charset called 'third_pos'
Defining partition called 'by_codon'
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1211862263
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 7364801424
Seed = 1812656927
Swapseed = 1668043073
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
The distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Shape parameter is exponentially
distributed with parameter (1.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Active parameters:
Partition(s)
Parameters 1 2 3
---------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
---------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(1.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:GammaDir(1.0,0.1000,1.0,1.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
0.91 % Dirichlet(Revmat{all})
0.91 % Slider(Revmat{all})
0.91 % Dirichlet(Pi{all})
0.91 % Slider(Pi{all})
1.82 % Multiplier(Alpha{1,2})
1.82 % Multiplier(Alpha{3})
1.82 % Slider(Pinvar{all})
9.09 % ExtSPR(Tau{all},V{all})
9.09 % ExtTBR(Tau{all},V{all})
9.09 % NNI(Tau{all},V{all})
9.09 % ParsSPR(Tau{all},V{all})
36.36 % Multiplier(V{all})
12.73 % Nodeslider(V{all})
5.45 % TLMultiplier(V{all})
Division 1 has 7 unique site patterns
Division 2 has 5 unique site patterns
Division 3 has 8 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -228.425866 -- 38.695331
Chain 2 -- -227.591552 -- 38.695331
Chain 3 -- -233.788881 -- 38.695331
Chain 4 -- -247.446539 -- 38.695331
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -238.092999 -- 38.695331
Chain 2 -- -215.163956 -- 38.695331
Chain 3 -- -240.653481 -- 38.695331
Chain 4 -- -239.887308 -- 38.695331
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-228.426] (-227.592) (-233.789) (-247.447) * [-238.093] (-215.164) (-240.653) (-239.887)
1000 -- (-149.565) [-153.225] (-157.867) (-149.597) * (-145.339) [-153.535] (-153.540) (-162.845) -- 0:00:00
2000 -- (-156.312) (-153.352) [-150.841] (-151.910) * [-146.905] (-145.119) (-148.090) (-160.185) -- 0:00:00
3000 -- (-154.613) [-148.436] (-151.314) (-151.071) * (-147.314) [-144.812] (-157.359) (-149.005) -- 0:00:00
4000 -- (-167.784) [-156.163] (-151.275) (-150.216) * (-153.851) (-140.634) [-150.649] (-149.968) -- 0:04:09
5000 -- (-155.967) [-142.056] (-147.789) (-148.262) * (-147.161) [-144.320] (-153.552) (-148.461) -- 0:03:19
Average standard deviation of split frequencies: 0.091357
6000 -- (-152.399) (-150.751) (-153.572) [-142.598] * (-155.962) (-151.841) [-146.189] (-150.453) -- 0:02:45
7000 -- (-157.034) (-146.424) (-148.537) [-143.314] * (-149.321) (-151.671) [-155.103] (-149.122) -- 0:02:21
8000 -- (-154.079) (-145.080) (-147.308) [-145.249] * (-146.304) (-156.749) [-153.501] (-153.093) -- 0:02:04
9000 -- (-152.903) (-151.389) [-148.929] (-150.615) * [-148.211] (-152.992) (-152.388) (-150.033) -- 0:03:40
10000 -- (-148.320) (-148.759) (-158.446) [-144.931] * [-143.348] (-160.693) (-160.947) (-143.304) -- 0:03:18
Average standard deviation of split frequencies: 0.081889
11000 -- (-141.969) [-146.806] (-157.196) (-150.809) * [-146.435] (-163.893) (-160.610) (-147.377) -- 0:02:59
12000 -- [-141.995] (-153.810) (-162.924) (-152.650) * (-150.252) (-152.540) (-154.919) [-150.348] -- 0:02:44
13000 -- [-146.189] (-144.453) (-156.372) (-142.475) * (-146.724) (-166.453) (-160.574) [-155.612] -- 0:02:31
14000 -- (-151.356) (-154.546) [-149.161] (-149.904) * (-145.852) (-156.092) [-148.696] (-160.856) -- 0:03:31
15000 -- [-151.651] (-155.480) (-165.065) (-142.661) * (-147.551) (-161.983) [-141.319] (-161.567) -- 0:03:17
Average standard deviation of split frequencies: 0.064125
16000 -- [-147.950] (-151.959) (-166.859) (-148.122) * [-144.836] (-168.728) (-146.338) (-165.120) -- 0:03:04
17000 -- (-140.024) (-152.986) (-165.962) [-148.464] * (-153.842) (-160.603) [-146.391] (-153.397) -- 0:02:53
18000 -- [-145.577] (-157.479) (-164.578) (-139.841) * (-149.382) (-169.203) [-145.310] (-157.829) -- 0:02:43
19000 -- (-153.758) (-148.951) (-162.927) [-144.993] * [-156.399] (-161.751) (-151.471) (-149.188) -- 0:03:26
20000 -- (-153.980) (-150.117) (-165.711) [-146.959] * [-146.697] (-156.428) (-147.895) (-147.409) -- 0:03:16
Average standard deviation of split frequencies: 0.055185
21000 -- (-150.483) (-144.258) (-165.176) [-146.478] * (-151.332) (-159.859) (-148.245) [-141.970] -- 0:03:06
22000 -- (-146.600) [-139.934] (-163.367) (-152.682) * [-144.533] (-157.641) (-154.487) (-149.085) -- 0:02:57
23000 -- (-153.217) (-151.608) (-172.300) [-144.243] * [-149.090] (-155.241) (-145.272) (-149.486) -- 0:02:49
24000 -- (-145.477) (-160.152) (-169.790) [-141.678] * (-147.351) (-161.390) (-153.883) [-148.404] -- 0:02:42
25000 -- (-149.505) (-143.717) (-166.087) [-142.933] * [-149.636] (-159.627) (-146.289) (-145.612) -- 0:03:15
Average standard deviation of split frequencies: 0.041987
26000 -- (-148.799) (-145.360) (-163.552) [-143.168] * (-149.227) (-167.153) (-145.532) [-150.019] -- 0:03:07
27000 -- (-144.844) (-157.503) (-162.913) [-143.296] * (-157.218) (-170.033) (-151.313) [-138.375] -- 0:03:00
28000 -- (-146.843) (-155.028) (-165.496) [-144.997] * (-151.570) (-164.542) [-143.377] (-146.498) -- 0:02:53
29000 -- [-146.388] (-157.087) (-167.565) (-145.167) * (-151.686) (-162.210) [-146.824] (-146.248) -- 0:02:47
30000 -- [-150.669] (-156.423) (-154.750) (-144.658) * (-153.819) (-165.960) (-150.556) [-143.306] -- 0:03:14
Average standard deviation of split frequencies: 0.034711
31000 -- [-144.264] (-165.466) (-146.560) (-149.946) * [-147.681] (-168.986) (-153.449) (-148.825) -- 0:03:07
32000 -- (-149.959) (-161.543) (-141.938) [-147.589] * [-144.236] (-165.446) (-149.668) (-142.458) -- 0:03:01
33000 -- (-147.241) (-159.668) (-148.927) [-150.426] * [-149.084] (-167.321) (-147.370) (-152.202) -- 0:02:55
34000 -- (-153.218) (-152.426) (-145.213) [-140.381] * [-147.890] (-163.244) (-151.052) (-148.281) -- 0:02:50
35000 -- (-147.945) (-160.269) [-138.465] (-145.119) * [-143.838] (-167.051) (-167.267) (-146.291) -- 0:03:13
Average standard deviation of split frequencies: 0.038847
36000 -- (-153.330) (-158.742) (-149.338) [-139.918] * (-148.581) (-163.618) (-161.702) [-146.496] -- 0:03:07
37000 -- (-149.900) (-156.106) [-148.787] (-144.359) * (-152.367) (-163.379) (-149.523) [-144.187] -- 0:03:02
38000 -- [-152.569] (-153.841) (-148.204) (-148.135) * [-145.786] (-161.469) (-150.012) (-147.223) -- 0:02:57
39000 -- [-144.479] (-165.971) (-146.487) (-150.831) * (-142.795) (-167.011) (-165.140) [-148.345] -- 0:02:52
40000 -- (-149.441) (-166.096) [-146.051] (-143.645) * (-147.612) (-162.430) (-167.680) [-143.741] -- 0:03:12
Average standard deviation of split frequencies: 0.036432
41000 -- [-148.218] (-162.703) (-141.039) (-148.289) * (-143.946) (-169.228) (-155.339) [-142.634] -- 0:03:07
42000 -- [-146.908] (-152.507) (-141.715) (-149.003) * [-146.837] (-170.417) (-160.795) (-147.819) -- 0:03:02
43000 -- (-147.119) (-163.628) [-145.149] (-147.773) * [-149.378] (-164.330) (-154.385) (-153.745) -- 0:02:58
44000 -- (-150.468) (-157.711) (-147.822) [-150.573] * [-140.764] (-155.293) (-158.139) (-148.671) -- 0:02:53
45000 -- (-150.262) (-156.648) [-144.423] (-146.518) * (-149.139) (-167.139) (-166.817) [-143.386] -- 0:02:49
Average standard deviation of split frequencies: 0.034050
46000 -- (-154.539) (-157.201) (-151.602) [-141.652] * (-152.964) [-141.261] (-161.930) (-142.023) -- 0:03:06
47000 -- (-157.871) (-158.071) [-149.928] (-145.870) * (-151.518) [-147.716] (-153.442) (-143.162) -- 0:03:02
48000 -- (-165.090) (-162.278) (-147.429) [-144.210] * [-157.913] (-145.307) (-163.994) (-146.072) -- 0:02:58
49000 -- (-152.090) (-159.152) [-151.329] (-145.294) * [-146.886] (-145.958) (-159.809) (-153.367) -- 0:02:54
50000 -- (-158.380) (-162.297) (-149.737) [-146.890] * (-149.595) [-149.716] (-163.557) (-157.983) -- 0:02:51
Average standard deviation of split frequencies: 0.037216
51000 -- (-165.341) (-163.939) (-150.781) [-145.811] * [-148.146] (-152.517) (-158.518) (-161.037) -- 0:03:06
52000 -- (-157.760) (-161.485) (-151.659) [-143.215] * (-149.723) (-146.666) [-144.963] (-169.838) -- 0:03:02
53000 -- (-159.034) (-159.162) [-150.368] (-147.844) * (-149.979) (-148.242) [-146.423] (-161.601) -- 0:02:58
54000 -- (-156.144) (-163.000) (-148.309) [-144.082] * [-144.405] (-147.022) (-152.820) (-159.940) -- 0:02:55
55000 -- (-157.067) (-166.227) (-147.818) [-143.527] * (-155.340) (-150.102) (-156.522) [-143.755] -- 0:02:51
Average standard deviation of split frequencies: 0.033672
56000 -- (-158.592) (-166.745) [-153.483] (-145.690) * (-150.041) [-146.707] (-165.557) (-148.000) -- 0:03:05
57000 -- (-156.529) (-154.757) (-144.439) [-144.791] * (-149.377) (-151.647) (-158.370) [-146.880] -- 0:03:01
58000 -- (-168.605) (-156.440) (-150.042) [-148.760] * [-142.814] (-150.892) (-161.681) (-149.883) -- 0:02:58
59000 -- (-164.248) (-155.728) (-141.840) [-141.625] * [-140.914] (-146.007) (-153.027) (-153.890) -- 0:02:55
60000 -- (-160.259) (-160.008) (-146.251) [-147.600] * (-152.852) [-142.531] (-158.220) (-147.849) -- 0:02:52
Average standard deviation of split frequencies: 0.026919
61000 -- (-154.531) (-159.457) (-147.753) [-143.661] * [-146.082] (-142.651) (-156.472) (-147.411) -- 0:02:49
62000 -- (-158.680) (-160.101) [-142.068] (-144.155) * (-146.120) (-149.392) (-156.392) [-145.808] -- 0:03:01
63000 -- (-158.081) (-170.682) [-143.796] (-146.479) * (-150.574) [-148.275] (-165.941) (-145.914) -- 0:02:58
64000 -- (-159.837) (-159.784) (-144.102) [-145.109] * (-153.192) (-151.519) (-155.366) [-149.147] -- 0:02:55
65000 -- (-165.806) (-157.237) [-148.559] (-153.302) * (-144.797) (-149.386) (-158.693) [-146.637] -- 0:02:52
Average standard deviation of split frequencies: 0.025254
66000 -- (-172.811) (-152.886) [-141.499] (-143.181) * [-146.401] (-153.220) (-159.107) (-141.136) -- 0:02:49
67000 -- (-164.897) (-152.686) (-143.076) [-144.663] * [-145.268] (-146.052) (-159.734) (-145.323) -- 0:03:01
68000 -- (-167.213) (-151.761) [-142.476] (-150.201) * [-142.653] (-159.079) (-161.417) (-143.501) -- 0:02:58
69000 -- (-162.985) (-163.239) (-150.044) [-141.920] * [-152.748] (-154.871) (-159.095) (-141.454) -- 0:02:55
70000 -- (-162.052) (-167.658) (-156.164) [-149.611] * [-142.025] (-156.650) (-157.519) (-146.275) -- 0:02:52
Average standard deviation of split frequencies: 0.026683
71000 -- (-161.040) (-156.971) (-142.372) [-148.952] * (-140.929) (-160.721) (-158.619) [-144.523] -- 0:02:50
72000 -- (-161.842) (-159.495) (-146.455) [-142.880] * [-144.026] (-164.518) (-164.846) (-143.911) -- 0:03:00
73000 -- (-159.451) (-163.189) (-155.005) [-143.046] * [-143.244] (-168.994) (-154.531) (-144.140) -- 0:02:57
74000 -- (-159.017) (-157.590) [-150.399] (-148.655) * [-147.043] (-172.418) (-166.600) (-148.647) -- 0:02:55
75000 -- [-152.754] (-158.845) (-148.603) (-144.612) * (-142.020) (-168.240) (-162.201) [-151.713] -- 0:02:52
Average standard deviation of split frequencies: 0.024589
76000 -- (-158.589) (-157.545) [-146.762] (-146.864) * (-148.243) (-162.231) (-156.354) [-148.459] -- 0:02:50
77000 -- [-142.846] (-160.133) (-150.992) (-144.927) * [-142.880] (-162.661) (-159.224) (-154.840) -- 0:02:59
78000 -- [-145.660] (-157.310) (-150.504) (-151.908) * [-145.666] (-163.587) (-158.107) (-144.877) -- 0:02:57
79000 -- [-139.734] (-162.297) (-146.842) (-149.684) * (-147.609) (-162.480) (-154.319) [-147.921] -- 0:02:54
80000 -- [-142.862] (-159.555) (-148.436) (-150.346) * (-147.126) (-158.316) (-163.923) [-142.988] -- 0:02:52
Average standard deviation of split frequencies: 0.024988
81000 -- (-148.468) (-155.719) [-151.334] (-148.925) * [-147.707] (-156.875) (-162.724) (-149.162) -- 0:02:50
82000 -- (-141.893) (-157.122) [-153.473] (-153.054) * (-141.644) (-162.362) (-153.234) [-145.112] -- 0:02:59
83000 -- [-149.968] (-163.561) (-157.209) (-154.395) * [-146.402] (-164.694) (-159.638) (-141.089) -- 0:02:56
84000 -- [-142.689] (-162.705) (-157.289) (-153.490) * (-148.614) (-159.960) (-156.608) [-144.818] -- 0:02:54
85000 -- [-143.691] (-161.893) (-152.617) (-146.314) * [-142.176] (-163.562) (-156.710) (-152.336) -- 0:02:52
Average standard deviation of split frequencies: 0.024301
86000 -- (-157.443) (-160.874) [-145.161] (-155.220) * [-145.854] (-162.148) (-157.402) (-148.421) -- 0:02:50
87000 -- (-148.539) (-163.027) (-149.575) [-146.794] * [-146.441] (-162.298) (-153.061) (-151.070) -- 0:02:47
88000 -- (-145.733) (-162.594) (-144.571) [-144.819] * (-142.431) (-159.799) (-154.463) [-145.949] -- 0:02:56
89000 -- (-151.114) (-166.803) (-140.867) [-148.194] * (-150.514) (-157.131) (-160.095) [-151.222] -- 0:02:54
90000 -- (-151.316) (-154.852) (-147.592) [-148.263] * [-143.168] (-166.005) (-158.859) (-147.222) -- 0:02:51
Average standard deviation of split frequencies: 0.022411
91000 -- (-150.504) (-163.368) [-150.454] (-163.348) * [-142.354] (-160.009) (-164.924) (-148.993) -- 0:02:49
92000 -- (-152.488) (-163.290) [-144.935] (-160.125) * [-148.437] (-149.129) (-158.351) (-148.433) -- 0:02:47
93000 -- (-150.852) (-158.654) [-144.477] (-161.875) * (-148.875) (-168.859) (-158.664) [-146.496] -- 0:02:55
94000 -- (-153.714) (-169.103) [-145.635] (-160.649) * [-140.222] (-163.216) (-160.897) (-146.878) -- 0:02:53
95000 -- [-150.636] (-159.445) (-145.561) (-158.010) * [-146.478] (-157.243) (-160.920) (-147.466) -- 0:02:51
Average standard deviation of split frequencies: 0.025605
96000 -- [-153.960] (-170.971) (-145.687) (-160.861) * (-143.816) (-165.930) (-152.534) [-143.166] -- 0:02:49
97000 -- (-143.882) [-144.316] (-148.160) (-159.859) * [-146.464] (-158.199) (-161.660) (-149.210) -- 0:02:47
98000 -- (-152.972) (-150.489) [-140.608] (-162.839) * [-147.840] (-155.568) (-158.806) (-153.906) -- 0:02:54
99000 -- (-143.279) (-153.409) [-147.966] (-156.385) * (-147.724) (-167.021) (-162.865) [-146.232] -- 0:02:52
100000 -- (-146.375) [-147.909] (-148.102) (-165.182) * (-147.755) (-157.683) (-158.765) [-147.898] -- 0:02:51
Average standard deviation of split frequencies: 0.024675
101000 -- (-151.177) [-146.762] (-147.391) (-165.282) * [-141.570] (-161.656) (-164.155) (-145.651) -- 0:02:49
102000 -- (-149.594) (-148.461) [-142.471] (-165.434) * [-146.697] (-157.327) (-160.251) (-145.467) -- 0:02:47
103000 -- [-145.332] (-154.788) (-146.930) (-160.351) * (-141.204) (-159.637) (-164.474) [-146.727] -- 0:02:54
104000 -- [-144.986] (-145.484) (-151.892) (-157.311) * (-146.881) (-159.241) (-163.218) [-148.465] -- 0:02:52
105000 -- (-152.396) [-148.762] (-143.238) (-168.203) * (-146.539) (-158.013) (-165.099) [-147.959] -- 0:02:50
Average standard deviation of split frequencies: 0.024460
106000 -- (-140.777) (-143.732) [-144.948] (-164.650) * (-141.650) (-162.888) (-160.775) [-151.169] -- 0:02:48
107000 -- (-141.883) (-151.847) [-146.414] (-160.112) * (-144.419) (-158.409) (-162.848) [-148.160] -- 0:02:46
108000 -- (-145.441) (-142.424) [-141.880] (-153.263) * [-143.670] (-165.944) (-147.975) (-148.326) -- 0:02:45
109000 -- (-145.206) (-161.041) [-142.680] (-156.113) * (-147.382) (-159.708) (-144.399) [-144.172] -- 0:02:51
110000 -- (-147.331) (-148.372) [-144.656] (-166.947) * [-142.860] (-167.313) (-146.986) (-141.820) -- 0:02:49
Average standard deviation of split frequencies: 0.023795
111000 -- [-147.014] (-162.079) (-148.273) (-168.088) * [-139.005] (-162.863) (-145.816) (-147.005) -- 0:02:48
112000 -- (-149.312) (-161.453) [-144.193] (-161.980) * [-146.513] (-167.310) (-144.645) (-144.660) -- 0:02:46
113000 -- [-147.772] (-146.642) (-153.703) (-154.983) * (-147.796) (-161.587) [-145.239] (-151.833) -- 0:02:44
114000 -- (-149.780) (-142.085) [-145.606] (-152.639) * [-148.438] (-166.537) (-146.579) (-153.060) -- 0:02:50
115000 -- (-147.417) (-149.317) [-138.578] (-152.876) * (-146.657) (-162.598) (-149.049) [-140.762] -- 0:02:49
Average standard deviation of split frequencies: 0.021580
116000 -- (-145.337) (-158.081) [-145.941] (-161.153) * (-143.907) (-163.648) (-147.638) [-138.766] -- 0:02:47
117000 -- (-145.928) (-158.714) [-149.697] (-156.136) * (-142.936) (-156.809) [-145.447] (-151.094) -- 0:02:46
118000 -- [-144.170] (-154.217) (-147.770) (-162.974) * (-144.185) (-164.556) [-150.120] (-144.334) -- 0:02:44
119000 -- (-150.882) (-160.491) [-149.619] (-156.406) * (-150.755) (-165.823) (-145.143) [-146.864] -- 0:02:50
120000 -- [-143.292] (-164.497) (-151.458) (-161.003) * (-142.391) (-164.061) (-157.084) [-145.354] -- 0:02:48
Average standard deviation of split frequencies: 0.022268
121000 -- (-149.956) (-167.876) [-148.279] (-159.695) * (-150.369) (-164.365) (-161.141) [-147.271] -- 0:02:47
122000 -- [-151.257] (-165.769) (-147.498) (-157.261) * (-150.746) (-161.890) (-165.412) [-144.084] -- 0:02:45
123000 -- (-146.707) (-159.109) [-146.807] (-159.328) * (-149.763) (-168.440) (-162.006) [-142.270] -- 0:02:43
124000 -- (-152.317) (-172.464) [-156.756] (-159.381) * [-144.960] (-157.540) (-162.760) (-149.434) -- 0:02:42
125000 -- [-141.791] (-157.772) (-151.359) (-163.130) * (-148.111) (-164.681) (-161.692) [-146.324] -- 0:02:48
Average standard deviation of split frequencies: 0.022573
126000 -- [-141.963] (-164.786) (-153.363) (-159.006) * (-145.440) (-160.845) (-152.842) [-146.965] -- 0:02:46
127000 -- (-143.844) (-165.249) [-149.446] (-152.695) * [-139.945] (-163.862) (-158.316) (-149.838) -- 0:02:44
128000 -- [-145.161] (-160.933) (-147.332) (-160.375) * [-137.931] (-158.932) (-161.649) (-151.783) -- 0:02:43
129000 -- (-148.896) (-159.348) [-147.385] (-156.281) * (-146.459) (-158.488) (-162.844) [-140.136] -- 0:02:42
130000 -- [-148.583] (-161.189) (-146.123) (-162.088) * [-147.816] (-157.343) (-157.149) (-152.492) -- 0:02:47
Average standard deviation of split frequencies: 0.024223
131000 -- [-145.793] (-156.976) (-148.872) (-160.174) * [-146.010] (-152.633) (-164.761) (-153.549) -- 0:02:45
132000 -- [-141.969] (-167.486) (-153.477) (-169.853) * [-146.223] (-157.711) (-162.057) (-146.229) -- 0:02:44
133000 -- [-152.739] (-160.316) (-153.413) (-159.247) * (-146.143) (-173.525) (-158.884) [-140.774] -- 0:02:42
134000 -- [-144.954] (-160.582) (-157.776) (-163.832) * (-147.017) (-153.957) (-143.804) [-144.226] -- 0:02:41
135000 -- (-150.016) (-154.371) [-144.822] (-167.400) * (-146.123) (-152.723) (-146.434) [-143.550] -- 0:02:46
Average standard deviation of split frequencies: 0.022035
136000 -- [-151.189] (-165.918) (-152.513) (-158.010) * [-148.003] (-161.757) (-136.435) (-142.514) -- 0:02:45
137000 -- [-144.472] (-163.938) (-152.817) (-160.494) * (-153.715) (-155.369) (-140.729) [-144.000] -- 0:02:43
138000 -- [-148.366] (-155.702) (-149.681) (-161.756) * (-156.399) (-157.169) [-141.881] (-147.609) -- 0:02:42
139000 -- [-148.750] (-161.387) (-146.002) (-162.391) * [-151.022] (-156.844) (-142.936) (-152.227) -- 0:02:41
140000 -- [-151.111] (-159.870) (-148.901) (-161.153) * (-141.528) (-157.623) (-154.507) [-146.225] -- 0:02:45
Average standard deviation of split frequencies: 0.022501
141000 -- [-142.840] (-159.798) (-146.563) (-158.799) * (-162.628) (-161.589) [-142.215] (-143.055) -- 0:02:44
142000 -- (-146.327) (-160.578) [-149.112] (-166.871) * (-166.060) (-161.996) (-152.680) [-141.323] -- 0:02:43
143000 -- [-155.359] (-162.498) (-144.329) (-159.367) * (-168.239) (-162.223) (-143.933) [-143.668] -- 0:02:41
144000 -- (-156.785) (-157.530) [-148.835] (-163.943) * (-155.298) (-157.535) [-142.129] (-141.719) -- 0:02:40
145000 -- (-147.779) (-164.777) [-145.773] (-166.561) * (-155.688) (-161.885) (-150.100) [-146.778] -- 0:02:45
Average standard deviation of split frequencies: 0.020987
146000 -- [-145.626] (-161.037) (-149.135) (-157.563) * (-158.420) (-163.608) (-146.306) [-148.155] -- 0:02:43
147000 -- [-145.282] (-154.522) (-148.305) (-158.552) * (-162.936) (-168.720) (-149.896) [-145.518] -- 0:02:42
148000 -- [-149.094] (-156.674) (-150.522) (-161.280) * (-167.621) (-167.173) (-145.821) [-145.393] -- 0:02:41
149000 -- (-144.014) (-161.486) [-146.223] (-168.184) * (-162.867) (-157.849) [-144.463] (-147.219) -- 0:02:39
150000 -- [-140.899] (-158.461) (-144.217) (-166.549) * (-167.344) (-160.967) (-154.621) [-149.112] -- 0:02:44
Average standard deviation of split frequencies: 0.021902
151000 -- (-147.522) (-159.151) [-142.954] (-168.550) * (-151.124) (-170.755) (-142.660) [-146.958] -- 0:02:43
152000 -- (-148.357) (-149.329) [-146.969] (-159.675) * [-148.051] (-165.574) (-156.580) (-141.957) -- 0:02:41
153000 -- [-145.095] (-148.312) (-146.659) (-152.476) * [-146.498] (-168.983) (-153.057) (-147.778) -- 0:02:40
154000 -- (-145.470) [-146.765] (-146.813) (-164.302) * (-148.383) (-165.233) (-157.360) [-146.064] -- 0:02:39
155000 -- (-146.780) [-146.173] (-149.685) (-159.976) * [-143.896] (-157.898) (-159.815) (-145.468) -- 0:02:38
Average standard deviation of split frequencies: 0.019798
156000 -- [-147.684] (-149.879) (-155.353) (-166.871) * [-144.981] (-166.822) (-150.984) (-147.780) -- 0:02:42
157000 -- (-153.118) (-139.917) [-151.548] (-164.468) * [-147.228] (-170.608) (-156.320) (-143.636) -- 0:02:41
158000 -- (-145.449) (-149.387) [-146.097] (-166.479) * [-145.170] (-159.816) (-163.940) (-149.969) -- 0:02:39
159000 -- [-140.731] (-139.744) (-147.827) (-166.690) * [-143.964] (-156.421) (-152.460) (-153.507) -- 0:02:38
160000 -- (-153.804) (-147.528) [-145.894] (-162.831) * [-146.703] (-163.027) (-159.692) (-148.660) -- 0:02:37
Average standard deviation of split frequencies: 0.019176
161000 -- (-157.542) (-151.816) [-145.084] (-160.703) * [-149.349] (-160.234) (-154.952) (-149.441) -- 0:02:41
162000 -- [-147.996] (-148.953) (-148.383) (-157.028) * (-147.374) (-159.282) (-154.057) [-146.221] -- 0:02:40
163000 -- (-152.300) [-145.853] (-159.030) (-155.785) * [-149.982] (-162.905) (-158.875) (-143.177) -- 0:02:39
164000 -- (-150.663) [-143.230] (-146.305) (-160.412) * (-152.162) (-161.454) (-154.126) [-149.128] -- 0:02:38
165000 -- (-152.589) [-147.289] (-140.806) (-171.727) * [-146.604] (-163.165) (-155.385) (-153.747) -- 0:02:36
Average standard deviation of split frequencies: 0.017822
166000 -- (-158.639) [-145.816] (-144.947) (-162.392) * [-144.561] (-166.479) (-154.970) (-154.404) -- 0:02:40
167000 -- (-169.011) [-153.810] (-145.715) (-159.895) * (-148.102) (-170.494) (-164.461) [-153.722] -- 0:02:39
168000 -- (-158.589) (-148.591) [-148.787] (-165.977) * (-149.811) (-153.502) (-154.677) [-152.091] -- 0:02:38
169000 -- (-164.682) [-141.960] (-145.292) (-167.975) * [-155.154] (-159.950) (-158.908) (-149.874) -- 0:02:37
170000 -- (-157.603) [-142.794] (-147.962) (-154.722) * [-153.495] (-165.376) (-159.289) (-149.221) -- 0:02:36
Average standard deviation of split frequencies: 0.019335
171000 -- (-159.537) (-154.014) [-144.481] (-161.748) * (-157.129) (-159.938) (-157.044) [-144.283] -- 0:02:39
172000 -- (-158.586) (-150.225) [-143.607] (-157.946) * (-145.413) (-165.933) (-159.925) [-148.822] -- 0:02:38
173000 -- (-161.581) [-144.416] (-140.101) (-156.581) * [-153.558] (-156.118) (-161.960) (-143.185) -- 0:02:37
174000 -- (-157.108) [-151.675] (-145.009) (-157.043) * (-145.867) (-158.189) (-163.628) [-144.010] -- 0:02:36
175000 -- (-164.107) (-141.350) [-147.357] (-156.303) * [-147.543] (-155.202) (-164.850) (-150.653) -- 0:02:35
Average standard deviation of split frequencies: 0.018657
176000 -- (-165.009) [-145.384] (-146.569) (-157.613) * [-153.968] (-157.071) (-164.804) (-153.276) -- 0:02:39
177000 -- (-164.384) [-146.693] (-145.017) (-158.531) * [-145.336] (-162.691) (-166.960) (-152.191) -- 0:02:38
178000 -- (-161.883) [-144.501] (-146.937) (-158.240) * (-145.581) (-161.064) (-161.407) [-150.005] -- 0:02:37
179000 -- (-161.371) [-146.573] (-144.112) (-159.625) * (-147.417) (-159.718) (-164.108) [-146.720] -- 0:02:35
180000 -- (-168.200) (-144.162) [-145.007] (-152.524) * (-148.576) (-155.824) (-164.850) [-147.904] -- 0:02:34
Average standard deviation of split frequencies: 0.018445
181000 -- (-155.212) [-141.733] (-145.020) (-162.479) * (-155.104) (-153.053) (-160.401) [-148.417] -- 0:02:33
182000 -- (-158.174) (-150.784) [-145.990] (-159.878) * (-149.316) (-160.946) (-158.633) [-142.659] -- 0:02:37
183000 -- (-157.843) [-142.012] (-144.348) (-160.161) * [-146.430] (-159.599) (-157.942) (-143.305) -- 0:02:36
184000 -- (-160.517) (-141.596) [-144.377] (-157.055) * [-148.709] (-160.385) (-162.862) (-142.830) -- 0:02:35
185000 -- (-156.552) [-142.508] (-152.822) (-157.452) * [-149.692] (-159.003) (-160.840) (-152.938) -- 0:02:34
Average standard deviation of split frequencies: 0.018586
186000 -- (-159.066) [-149.421] (-146.396) (-153.240) * (-154.136) (-158.248) (-154.369) [-146.037] -- 0:02:33
187000 -- (-162.657) [-142.184] (-146.893) (-158.858) * [-151.789] (-156.292) (-157.832) (-153.720) -- 0:02:36
188000 -- (-161.789) [-143.830] (-145.460) (-153.428) * (-144.584) (-160.799) (-161.409) [-148.158] -- 0:02:35
189000 -- (-156.273) [-143.727] (-148.889) (-162.068) * [-143.852] (-157.034) (-158.741) (-148.001) -- 0:02:34
190000 -- (-153.846) [-142.387] (-141.435) (-152.292) * (-149.805) (-156.016) (-164.862) [-146.727] -- 0:02:33
Average standard deviation of split frequencies: 0.019012
191000 -- (-161.854) (-143.484) [-149.210] (-158.477) * [-147.253] (-152.138) (-157.599) (-145.193) -- 0:02:32
192000 -- (-155.731) [-142.531] (-144.004) (-163.628) * [-142.009] (-151.306) (-162.893) (-145.362) -- 0:02:35
193000 -- (-160.078) [-143.558] (-148.981) (-155.381) * (-147.579) (-158.132) (-156.563) [-140.292] -- 0:02:34
194000 -- (-161.955) [-142.415] (-149.614) (-156.501) * (-147.823) (-163.663) (-156.957) [-142.922] -- 0:02:33
195000 -- (-163.842) [-142.159] (-153.344) (-153.556) * (-148.837) (-167.318) (-164.942) [-146.893] -- 0:02:32
Average standard deviation of split frequencies: 0.018743
196000 -- (-151.157) [-147.726] (-145.475) (-161.008) * (-149.529) (-173.840) (-156.960) [-149.074] -- 0:02:31
197000 -- (-157.801) [-142.750] (-149.740) (-147.459) * [-143.074] (-157.985) (-156.251) (-150.448) -- 0:02:34
198000 -- (-153.821) (-155.162) [-144.516] (-157.833) * [-151.629] (-164.867) (-155.212) (-146.055) -- 0:02:33
199000 -- (-163.546) (-149.761) (-143.919) [-148.407] * (-145.599) (-161.043) (-164.876) [-142.735] -- 0:02:32
200000 -- (-155.843) [-139.508] (-148.229) (-157.573) * (-150.541) (-159.086) (-162.265) [-148.642] -- 0:02:32
Average standard deviation of split frequencies: 0.020304
201000 -- (-157.029) [-144.999] (-150.922) (-156.755) * [-145.724] (-147.567) (-156.154) (-149.702) -- 0:02:31
202000 -- (-155.785) (-146.276) [-143.600] (-155.153) * (-154.946) [-146.296] (-159.675) (-144.717) -- 0:02:34
203000 -- (-160.722) [-147.934] (-142.323) (-151.277) * (-170.470) (-147.890) (-150.737) [-145.172] -- 0:02:33
204000 -- (-155.991) [-148.197] (-150.956) (-155.241) * (-157.415) (-145.673) (-159.980) [-146.819] -- 0:02:32
205000 -- (-156.339) (-146.191) (-141.065) [-144.862] * (-156.852) (-151.540) (-160.106) [-146.904] -- 0:02:31
Average standard deviation of split frequencies: 0.020367
206000 -- (-154.072) (-171.418) (-153.241) [-145.021] * (-163.568) (-149.852) (-154.611) [-147.332] -- 0:02:30
207000 -- (-156.164) (-165.267) [-148.389] (-147.923) * (-155.908) (-149.667) (-162.406) [-148.427] -- 0:02:33
208000 -- (-162.681) (-156.980) [-141.789] (-147.058) * (-162.229) [-153.043] (-148.383) (-150.041) -- 0:02:32
209000 -- (-155.692) (-162.545) [-144.304] (-154.855) * (-165.915) (-153.921) (-150.547) [-144.358] -- 0:02:31
210000 -- (-151.197) (-159.517) (-144.536) [-146.042] * (-159.106) (-150.953) (-163.567) [-140.584] -- 0:02:30
Average standard deviation of split frequencies: 0.018519
211000 -- (-158.969) (-159.938) (-148.119) [-151.482] * (-159.498) (-149.330) (-160.076) [-143.641] -- 0:02:29
212000 -- (-163.186) [-145.872] (-150.078) (-144.100) * (-169.691) [-143.535] (-158.832) (-148.187) -- 0:02:28
213000 -- (-157.653) [-143.157] (-143.614) (-144.900) * (-168.094) (-148.864) (-157.531) [-140.445] -- 0:02:31
214000 -- (-152.769) [-148.156] (-149.666) (-150.825) * (-159.962) (-151.422) (-165.841) [-142.984] -- 0:02:30
215000 -- (-162.396) (-146.705) [-144.281] (-154.660) * (-163.706) (-146.364) (-162.000) [-148.107] -- 0:02:29
Average standard deviation of split frequencies: 0.020127
216000 -- (-152.751) (-152.741) (-147.423) [-140.579] * (-163.609) [-144.068] (-162.930) (-149.747) -- 0:02:28
217000 -- (-158.839) (-151.570) (-144.194) [-146.341] * (-152.985) [-147.254] (-162.684) (-148.111) -- 0:02:27
218000 -- (-156.682) [-145.021] (-156.549) (-150.696) * (-156.097) [-150.031] (-157.143) (-148.324) -- 0:02:30
219000 -- (-163.302) (-147.152) [-150.816] (-155.658) * (-166.898) (-152.088) (-162.267) [-148.470] -- 0:02:29
220000 -- (-155.053) (-144.241) [-146.637] (-152.148) * (-157.936) (-146.219) (-152.132) [-142.406] -- 0:02:28
Average standard deviation of split frequencies: 0.019761
221000 -- (-152.553) (-147.747) (-151.056) [-145.673] * (-159.872) (-148.942) (-150.156) [-142.786] -- 0:02:28
222000 -- (-159.083) (-144.299) (-144.338) [-145.848] * (-160.230) [-145.611] (-164.440) (-153.143) -- 0:02:27
223000 -- (-160.017) (-142.760) (-139.662) [-146.343] * (-158.125) (-147.199) (-152.590) [-157.413] -- 0:02:29
224000 -- (-158.211) (-144.711) (-147.235) [-147.634] * (-159.910) [-140.980] (-159.505) (-143.255) -- 0:02:28
225000 -- (-155.690) (-163.321) [-144.577] (-145.238) * (-162.480) (-144.853) (-154.969) [-150.611] -- 0:02:28
Average standard deviation of split frequencies: 0.018912
226000 -- (-156.101) (-154.190) (-146.913) [-144.824] * (-158.198) [-142.495] (-157.760) (-143.838) -- 0:02:27
227000 -- (-157.991) (-160.503) [-148.235] (-146.459) * (-161.625) (-142.946) (-165.421) [-144.585] -- 0:02:26
228000 -- (-156.347) (-156.524) (-149.086) [-145.399] * (-162.553) (-143.433) (-159.953) [-146.863] -- 0:02:28
229000 -- (-161.994) (-161.054) (-147.249) [-145.200] * (-163.081) [-150.745] (-156.028) (-146.318) -- 0:02:28
230000 -- (-171.348) (-156.374) (-153.515) [-151.603] * (-161.262) [-148.396] (-153.507) (-143.493) -- 0:02:27
Average standard deviation of split frequencies: 0.018685
231000 -- (-161.317) (-158.969) (-152.783) [-143.024] * (-161.337) [-146.363] (-156.909) (-146.702) -- 0:02:26
232000 -- (-153.371) (-158.894) (-157.006) [-147.812] * (-157.935) [-143.192] (-155.974) (-141.650) -- 0:02:25
233000 -- (-153.067) (-165.307) (-151.368) [-143.666] * (-157.395) (-142.236) (-157.849) [-142.218] -- 0:02:24
234000 -- [-142.857] (-161.726) (-148.524) (-148.569) * (-164.089) (-149.729) (-150.469) [-145.277] -- 0:02:27
235000 -- [-143.549] (-154.403) (-166.057) (-146.379) * (-161.366) (-143.854) (-157.040) [-141.638] -- 0:02:26
Average standard deviation of split frequencies: 0.017692
236000 -- [-148.426] (-163.315) (-162.708) (-147.160) * (-156.068) (-148.428) (-156.461) [-141.299] -- 0:02:25
237000 -- (-142.971) (-154.563) (-167.034) [-141.618] * (-167.579) [-147.496] (-158.747) (-149.240) -- 0:02:24
238000 -- [-152.155] (-164.000) (-156.201) (-145.570) * (-163.078) [-143.553] (-165.654) (-143.605) -- 0:02:24
239000 -- [-139.675] (-155.817) (-164.349) (-147.728) * (-160.519) (-154.062) (-162.255) [-140.860] -- 0:02:26
240000 -- [-143.775] (-160.884) (-155.394) (-143.702) * (-156.610) (-144.490) (-158.431) [-140.222] -- 0:02:25
Average standard deviation of split frequencies: 0.017774
241000 -- (-143.383) (-157.100) (-154.183) [-144.077] * (-157.935) (-154.321) (-159.217) [-143.758] -- 0:02:24
242000 -- [-148.420] (-160.881) (-166.317) (-147.028) * (-151.913) [-151.007] (-167.309) (-144.420) -- 0:02:24
243000 -- (-152.035) (-162.061) (-162.224) [-139.791] * (-157.453) (-156.166) (-167.108) [-144.473] -- 0:02:23
244000 -- (-152.015) (-164.972) (-162.976) [-145.368] * (-153.792) [-156.926] (-160.708) (-149.976) -- 0:02:25
245000 -- [-146.410] (-160.781) (-163.168) (-144.041) * [-141.920] (-161.945) (-162.651) (-146.944) -- 0:02:24
Average standard deviation of split frequencies: 0.016494
246000 -- (-156.151) (-157.296) (-157.459) [-146.283] * [-143.255] (-166.197) (-161.380) (-152.351) -- 0:02:24
247000 -- [-152.396] (-159.931) (-160.358) (-142.079) * [-147.379] (-158.215) (-158.644) (-148.357) -- 0:02:23
248000 -- (-146.458) (-160.961) (-165.379) [-147.280] * (-157.693) (-160.433) (-163.985) [-144.633] -- 0:02:22
249000 -- [-149.406] (-164.420) (-161.397) (-148.127) * [-142.024] (-159.792) (-162.622) (-145.857) -- 0:02:24
250000 -- [-144.644] (-172.585) (-153.044) (-142.426) * [-146.098] (-161.087) (-160.872) (-154.743) -- 0:02:24
Average standard deviation of split frequencies: 0.016791
251000 -- (-148.604) (-157.858) (-152.393) [-142.975] * (-150.664) (-159.496) [-149.530] (-148.806) -- 0:02:23
252000 -- (-148.740) (-162.561) (-160.561) [-146.038] * (-142.483) (-157.327) (-156.853) [-142.220] -- 0:02:22
253000 -- (-151.475) (-161.854) (-167.091) [-147.802] * [-142.228] (-166.244) (-160.480) (-160.226) -- 0:02:21
254000 -- (-149.578) (-157.278) (-160.515) [-140.988] * [-144.646] (-161.929) (-164.142) (-148.685) -- 0:02:23
255000 -- (-141.404) (-159.447) (-157.604) [-139.570] * [-141.718] (-164.866) (-165.544) (-147.810) -- 0:02:23
Average standard deviation of split frequencies: 0.017050
256000 -- (-145.540) (-165.576) (-158.894) [-145.728] * (-143.347) (-158.905) (-159.510) [-146.031] -- 0:02:22
257000 -- (-145.208) (-162.865) (-160.143) [-145.580] * (-144.145) (-166.630) (-147.717) [-148.862] -- 0:02:21
258000 -- [-147.363] (-167.462) (-162.714) (-147.871) * [-146.865] (-158.423) (-158.584) (-140.441) -- 0:02:20
259000 -- [-150.153] (-163.455) (-167.855) (-151.134) * [-144.413] (-160.469) (-155.484) (-152.762) -- 0:02:23
260000 -- [-140.150] (-164.869) (-169.074) (-147.256) * (-148.777) (-159.718) (-159.636) [-140.911] -- 0:02:22
Average standard deviation of split frequencies: 0.015740
261000 -- [-144.435] (-166.083) (-167.825) (-145.935) * (-147.646) (-154.836) (-151.950) [-146.293] -- 0:02:21
262000 -- [-148.320] (-167.379) (-165.398) (-143.706) * (-146.884) (-156.305) [-147.956] (-152.615) -- 0:02:20
263000 -- [-142.212] (-163.771) (-159.420) (-146.074) * (-146.945) (-156.181) (-156.941) [-145.868] -- 0:02:20
264000 -- [-151.756] (-162.102) (-152.751) (-146.359) * [-153.995] (-155.247) (-162.024) (-149.274) -- 0:02:19
265000 -- (-150.652) (-168.189) (-157.961) [-145.157] * (-149.051) (-163.216) (-147.358) [-138.849] -- 0:02:21
Average standard deviation of split frequencies: 0.015400
266000 -- (-146.303) (-164.224) (-152.316) [-144.525] * [-149.751] (-157.700) (-152.607) (-146.467) -- 0:02:20
267000 -- (-143.236) (-156.796) (-156.968) [-152.838] * (-153.552) (-161.014) (-154.017) [-141.708] -- 0:02:20
268000 -- (-146.366) (-153.576) (-159.482) [-152.299] * (-145.938) (-166.786) (-154.426) [-151.442] -- 0:02:19
269000 -- (-147.637) (-152.553) (-158.839) [-144.976] * (-160.355) (-156.797) (-148.787) [-150.400] -- 0:02:18
270000 -- [-140.681] (-157.630) (-158.076) (-150.150) * (-152.040) (-159.494) [-141.086] (-147.855) -- 0:02:20
Average standard deviation of split frequencies: 0.014894
271000 -- (-151.586) [-147.986] (-156.342) (-143.642) * (-147.518) (-167.610) (-147.978) [-146.753] -- 0:02:19
272000 -- (-149.932) (-146.422) (-157.383) [-145.518] * (-147.839) (-164.659) (-143.565) [-147.468] -- 0:02:19
273000 -- (-145.980) (-144.292) (-161.850) [-145.237] * [-142.830] (-161.234) (-151.076) (-150.016) -- 0:02:18
274000 -- (-149.256) [-147.826] (-160.379) (-141.097) * (-147.865) (-164.343) [-140.156] (-142.557) -- 0:02:17
275000 -- (-153.501) [-142.407] (-155.638) (-142.111) * (-147.581) (-164.726) [-140.181] (-149.364) -- 0:02:19
Average standard deviation of split frequencies: 0.015189
276000 -- (-145.301) [-145.558] (-158.838) (-151.065) * (-139.530) (-171.241) [-139.595] (-146.634) -- 0:02:19
277000 -- (-143.200) [-143.559] (-156.922) (-152.674) * (-154.196) (-164.503) [-144.959] (-142.559) -- 0:02:18
278000 -- (-146.789) (-150.728) (-154.602) [-142.324] * (-147.433) (-155.423) [-152.771] (-148.693) -- 0:02:17
279000 -- (-149.393) [-149.664] (-155.951) (-150.107) * [-151.796] (-166.839) (-142.776) (-160.597) -- 0:02:16
280000 -- (-151.161) [-142.860] (-153.863) (-154.259) * (-162.052) (-164.453) [-142.123] (-144.443) -- 0:02:18
Average standard deviation of split frequencies: 0.014217
281000 -- (-145.300) [-142.775] (-162.690) (-150.473) * (-156.966) (-159.637) (-150.381) [-145.386] -- 0:02:18
282000 -- (-149.731) [-152.007] (-163.514) (-153.425) * (-149.902) (-161.720) [-145.579] (-149.997) -- 0:02:17
283000 -- [-143.691] (-143.553) (-153.264) (-151.093) * (-161.012) (-168.573) [-141.177] (-140.073) -- 0:02:16
284000 -- (-159.149) [-142.736] (-166.135) (-145.980) * (-162.044) (-162.817) (-142.142) [-142.997] -- 0:02:16
285000 -- (-156.333) [-140.489] (-163.274) (-141.913) * (-157.401) (-157.176) [-145.414] (-151.860) -- 0:02:15
Average standard deviation of split frequencies: 0.013868
286000 -- (-162.031) (-147.553) (-162.003) [-148.430] * (-158.921) (-154.029) [-144.489] (-156.390) -- 0:02:17
287000 -- [-141.481] (-143.685) (-164.589) (-154.591) * (-164.016) (-158.896) [-147.034] (-145.779) -- 0:02:16
288000 -- (-146.403) (-149.243) (-158.892) [-143.670] * (-160.843) (-161.531) [-138.646] (-150.618) -- 0:02:15
289000 -- (-146.586) (-154.932) (-163.438) [-142.963] * (-166.554) (-166.221) [-143.931] (-160.854) -- 0:02:15
290000 -- (-150.008) [-144.638] (-160.238) (-150.326) * (-151.533) (-157.775) [-143.120] (-153.356) -- 0:02:14
Average standard deviation of split frequencies: 0.014828
291000 -- [-144.505] (-148.212) (-158.098) (-148.138) * (-159.120) (-162.813) (-142.718) [-148.166] -- 0:02:16
292000 -- (-147.757) (-153.663) (-161.128) [-143.063] * (-149.838) (-153.478) [-140.401] (-143.905) -- 0:02:15
293000 -- (-154.529) [-142.013] (-159.731) (-142.314) * (-143.129) (-160.343) [-148.683] (-142.343) -- 0:02:15
294000 -- (-160.234) (-150.884) (-160.386) [-144.020] * [-146.910] (-157.686) (-143.489) (-152.021) -- 0:02:14
295000 -- (-158.556) (-146.867) (-159.108) [-147.299] * (-148.424) (-158.146) (-143.528) [-143.822] -- 0:02:13
Average standard deviation of split frequencies: 0.015218
296000 -- (-159.912) (-150.511) (-158.644) [-148.296] * (-149.598) (-161.875) [-141.263] (-153.109) -- 0:02:15
297000 -- (-153.408) [-149.186] (-163.492) (-148.252) * (-142.212) (-161.174) [-147.795] (-158.905) -- 0:02:14
298000 -- (-157.562) (-153.708) (-157.323) [-151.008] * (-151.425) (-156.710) [-137.717] (-150.016) -- 0:02:14
299000 -- (-155.535) (-149.957) (-163.101) [-155.087] * (-148.754) (-158.747) (-144.447) [-148.541] -- 0:02:13
300000 -- (-156.507) (-154.084) (-157.417) [-148.166] * (-149.796) (-158.122) [-141.700] (-148.015) -- 0:02:13
Average standard deviation of split frequencies: 0.013995
301000 -- (-156.758) (-147.173) (-158.899) [-155.795] * (-147.797) (-153.319) (-148.424) [-144.821] -- 0:02:14
302000 -- (-152.046) [-147.205] (-159.649) (-149.863) * (-146.904) (-157.540) (-150.907) [-148.642] -- 0:02:14
303000 -- (-149.737) (-156.569) (-153.940) [-148.960] * [-146.568] (-164.516) (-151.726) (-143.963) -- 0:02:13
304000 -- (-157.400) (-148.715) (-158.872) [-152.123] * [-141.253] (-167.822) (-145.773) (-148.261) -- 0:02:12
305000 -- (-158.982) [-147.763] (-153.136) (-144.514) * (-152.260) (-160.349) (-150.485) [-141.116] -- 0:02:12
Average standard deviation of split frequencies: 0.014195
306000 -- (-162.480) [-149.514] (-160.733) (-145.032) * (-157.406) (-161.220) (-145.364) [-149.024] -- 0:02:13
307000 -- (-159.298) [-147.299] (-167.314) (-149.150) * (-158.165) (-161.385) [-154.676] (-146.874) -- 0:02:13
308000 -- (-155.808) (-146.482) (-163.747) [-141.926] * (-153.128) (-162.967) (-153.662) [-144.448] -- 0:02:12
309000 -- (-148.737) (-169.913) (-160.830) [-139.858] * (-162.532) (-161.183) (-151.020) [-147.309] -- 0:02:11
310000 -- (-164.168) (-154.380) (-169.908) [-145.499] * (-161.327) (-160.211) [-142.316] (-148.034) -- 0:02:11
Average standard deviation of split frequencies: 0.013928
311000 -- (-154.388) [-140.329] (-152.717) (-150.841) * (-155.537) (-159.122) [-141.004] (-148.425) -- 0:02:10
312000 -- (-160.399) (-147.330) (-155.196) [-142.002] * (-163.373) (-159.372) [-145.310] (-154.954) -- 0:02:12
313000 -- (-165.069) (-151.077) (-156.384) [-139.378] * (-159.080) (-159.592) [-147.085] (-146.376) -- 0:02:11
314000 -- (-160.649) (-148.513) (-160.186) [-145.712] * (-162.035) (-151.926) (-141.252) [-148.667] -- 0:02:11
315000 -- (-157.885) [-142.065] (-159.118) (-143.142) * (-162.966) (-160.255) (-141.595) [-142.227] -- 0:02:10
Average standard deviation of split frequencies: 0.012840
316000 -- (-157.858) [-141.900] (-157.498) (-143.337) * (-164.519) (-151.682) (-149.789) [-143.906] -- 0:02:09
317000 -- (-164.068) [-144.953] (-149.533) (-148.739) * (-163.333) (-158.031) (-150.443) [-147.397] -- 0:02:11
318000 -- (-163.008) [-147.539] (-148.336) (-150.947) * (-156.020) (-160.287) [-144.249] (-153.898) -- 0:02:10
319000 -- (-154.916) (-152.876) (-151.406) [-148.988] * (-153.363) (-169.664) [-152.836] (-146.349) -- 0:02:10
320000 -- (-164.186) [-142.303] (-148.398) (-152.499) * (-159.333) (-157.983) [-141.736] (-150.132) -- 0:02:09
Average standard deviation of split frequencies: 0.013178
321000 -- (-156.527) (-147.344) [-146.947] (-146.135) * (-158.564) (-163.294) (-145.779) [-138.143] -- 0:02:09
322000 -- (-162.805) (-153.510) [-142.357] (-145.938) * (-147.387) (-166.211) [-143.137] (-148.529) -- 0:02:10
323000 -- (-160.619) (-152.646) [-140.852] (-147.852) * (-165.541) [-142.769] (-146.886) (-149.604) -- 0:02:09
324000 -- (-157.342) (-158.744) (-145.108) [-152.849] * (-165.152) [-143.369] (-144.384) (-146.275) -- 0:02:09
325000 -- (-157.374) (-163.207) [-145.256] (-148.780) * (-156.103) (-150.066) (-145.537) [-142.551] -- 0:02:08
Average standard deviation of split frequencies: 0.013221
326000 -- (-161.328) (-158.384) [-143.044] (-145.554) * (-155.098) (-149.641) (-149.394) [-142.742] -- 0:02:08
327000 -- (-151.430) (-165.769) (-143.742) [-140.629] * (-163.337) (-150.913) [-141.399] (-144.827) -- 0:02:09
328000 -- (-151.383) (-159.890) (-142.594) [-145.111] * (-160.458) (-153.711) [-145.137] (-140.769) -- 0:02:09
329000 -- [-149.710] (-140.976) (-143.842) (-163.839) * (-156.239) (-158.881) (-149.383) [-139.033] -- 0:02:08
330000 -- (-147.610) [-144.000] (-149.010) (-169.659) * (-163.857) (-158.465) (-151.494) [-140.889] -- 0:02:07
Average standard deviation of split frequencies: 0.012016
331000 -- (-150.566) (-164.175) [-143.267] (-159.927) * (-166.877) [-148.345] (-146.031) (-145.022) -- 0:02:07
332000 -- [-151.345] (-148.699) (-144.973) (-161.830) * (-161.888) (-156.271) (-147.465) [-141.145] -- 0:02:06
333000 -- (-146.888) (-156.624) [-145.004] (-164.114) * (-166.616) (-152.355) (-152.538) [-147.525] -- 0:02:08
334000 -- (-148.686) (-161.674) [-141.542] (-169.493) * (-160.333) (-152.223) (-146.047) [-148.543] -- 0:02:07
335000 -- [-144.201] (-156.261) (-146.469) (-164.736) * (-166.082) (-152.248) (-144.072) [-143.661] -- 0:02:07
Average standard deviation of split frequencies: 0.012477
336000 -- [-148.384] (-156.349) (-147.958) (-154.144) * (-162.844) (-153.942) [-144.065] (-151.971) -- 0:02:06
337000 -- (-150.278) (-157.229) [-156.028] (-159.771) * (-157.518) (-165.877) (-144.156) [-145.136] -- 0:02:05
338000 -- [-147.612] (-159.599) (-143.346) (-164.689) * (-158.840) (-160.157) [-148.591] (-146.415) -- 0:02:07
339000 -- [-146.610] (-160.006) (-152.745) (-154.720) * (-161.340) (-161.712) (-145.668) [-141.469] -- 0:02:06
340000 -- [-144.965] (-162.034) (-151.878) (-149.670) * (-162.373) (-157.552) [-151.988] (-145.647) -- 0:02:06
Average standard deviation of split frequencies: 0.012652
341000 -- [-146.459] (-155.224) (-145.983) (-149.533) * (-162.978) (-157.847) [-150.153] (-149.638) -- 0:02:05
342000 -- (-145.484) (-165.715) (-149.051) [-153.040] * (-165.573) (-152.436) [-139.506] (-148.762) -- 0:02:05
343000 -- (-150.102) (-158.699) [-143.883] (-146.009) * (-157.980) (-161.927) (-142.079) [-142.782] -- 0:02:06
344000 -- (-154.192) (-162.984) (-149.585) [-145.727] * (-167.984) (-157.529) (-148.778) [-140.210] -- 0:02:05
345000 -- (-159.299) (-158.279) (-149.506) [-142.053] * (-164.128) [-151.025] (-147.943) (-172.339) -- 0:02:05
Average standard deviation of split frequencies: 0.012408
346000 -- (-155.400) (-162.956) (-148.705) [-144.040] * (-169.846) [-147.623] (-146.150) (-155.409) -- 0:02:04
347000 -- (-163.958) (-164.587) (-142.047) [-139.641] * (-164.821) (-149.892) [-146.788] (-159.029) -- 0:02:04
348000 -- (-169.174) (-167.609) [-147.313] (-140.959) * (-161.258) (-142.846) [-141.526] (-158.610) -- 0:02:05
349000 -- (-160.560) (-164.776) [-151.033] (-144.286) * (-165.727) [-147.605] (-146.213) (-160.906) -- 0:02:04
350000 -- (-161.779) (-153.230) [-143.350] (-144.672) * (-156.383) [-142.089] (-143.417) (-157.901) -- 0:02:04
Average standard deviation of split frequencies: 0.012723
351000 -- (-169.095) (-155.404) [-140.434] (-150.893) * (-158.840) (-145.163) [-139.956] (-154.144) -- 0:02:03
352000 -- (-162.430) (-146.195) [-146.443] (-148.452) * (-157.384) [-147.455] (-151.683) (-166.271) -- 0:02:03
353000 -- (-159.644) (-158.444) [-150.526] (-146.797) * (-152.384) (-153.095) [-143.064] (-161.034) -- 0:02:04
354000 -- (-154.692) (-157.566) (-143.563) [-142.632] * (-152.924) [-150.350] (-143.139) (-162.322) -- 0:02:04
355000 -- (-161.888) (-150.994) [-144.489] (-148.364) * (-150.575) (-144.707) [-142.665] (-167.674) -- 0:02:03
Average standard deviation of split frequencies: 0.012769
356000 -- (-165.317) (-151.672) (-141.569) [-145.104] * (-155.269) [-147.903] (-146.679) (-178.429) -- 0:02:03
357000 -- (-166.961) (-151.983) (-145.350) [-150.124] * (-153.088) (-142.289) [-145.832] (-157.741) -- 0:02:02
358000 -- (-161.632) (-152.109) [-143.704] (-146.291) * (-151.381) [-143.638] (-157.950) (-153.189) -- 0:02:01
359000 -- (-159.171) (-157.006) [-141.248] (-145.320) * (-156.612) (-147.653) [-144.869] (-154.786) -- 0:02:03
360000 -- (-156.541) (-155.498) (-149.250) [-141.455] * (-159.624) [-140.220] (-153.617) (-146.643) -- 0:02:02
Average standard deviation of split frequencies: 0.011857
361000 -- (-162.326) (-160.874) [-144.094] (-142.883) * (-160.572) [-149.218] (-147.697) (-147.121) -- 0:02:02
362000 -- (-165.481) (-157.050) [-146.383] (-151.495) * (-161.770) [-146.137] (-147.414) (-148.773) -- 0:02:01
363000 -- (-164.701) (-140.649) (-145.589) [-155.313] * (-158.126) (-151.938) (-147.348) [-146.456] -- 0:02:01
364000 -- (-154.582) [-145.861] (-147.313) (-148.829) * (-157.999) (-146.472) [-144.416] (-145.685) -- 0:02:02
365000 -- (-158.711) [-141.045] (-147.449) (-169.311) * (-158.896) [-142.386] (-157.881) (-148.254) -- 0:02:01
Average standard deviation of split frequencies: 0.011500
366000 -- (-155.678) (-150.664) [-146.595] (-165.288) * (-170.931) [-145.285] (-145.680) (-142.327) -- 0:02:01
367000 -- (-165.798) [-141.255] (-149.664) (-167.154) * (-161.708) (-151.155) (-150.359) [-148.142] -- 0:02:00
368000 -- (-154.225) (-148.595) [-147.631] (-153.603) * (-164.263) (-148.364) [-145.303] (-149.957) -- 0:02:00
369000 -- (-162.765) (-145.700) [-146.878] (-161.981) * (-157.493) (-152.264) [-150.252] (-147.615) -- 0:02:01
370000 -- (-155.480) [-141.192] (-143.681) (-155.969) * (-163.803) (-147.719) (-150.119) [-143.646] -- 0:02:00
Average standard deviation of split frequencies: 0.012445
371000 -- (-163.845) [-141.387] (-146.141) (-163.114) * (-162.109) (-154.848) [-147.965] (-143.261) -- 0:02:00
372000 -- (-162.148) [-143.517] (-154.979) (-165.058) * (-156.485) (-151.693) [-140.159] (-145.230) -- 0:01:59
373000 -- (-162.373) [-145.000] (-148.247) (-164.186) * (-156.235) (-149.054) [-142.614] (-147.805) -- 0:01:59
374000 -- (-162.491) [-141.694] (-151.796) (-154.197) * (-164.159) (-148.140) (-153.733) [-149.035] -- 0:02:00
375000 -- (-161.723) [-150.809] (-143.388) (-166.614) * (-150.795) [-148.885] (-144.195) (-141.747) -- 0:02:00
Average standard deviation of split frequencies: 0.012134
376000 -- (-157.775) (-154.401) [-145.932] (-165.284) * (-159.763) [-139.838] (-142.953) (-148.355) -- 0:01:59
377000 -- (-158.239) (-154.662) [-150.027] (-162.788) * (-161.638) [-143.684] (-156.153) (-144.571) -- 0:01:58
378000 -- (-154.998) [-149.475] (-147.323) (-165.555) * (-151.930) [-140.999] (-145.463) (-153.582) -- 0:01:58
379000 -- (-159.295) [-150.441] (-140.655) (-168.751) * (-157.028) (-151.927) [-141.383] (-148.080) -- 0:01:59
380000 -- (-160.455) (-148.747) [-142.700] (-165.876) * (-159.061) (-143.310) [-145.069] (-162.282) -- 0:01:59
Average standard deviation of split frequencies: 0.012295
381000 -- (-155.096) (-151.287) [-145.756] (-162.161) * (-156.286) (-150.390) (-149.161) [-148.710] -- 0:01:58
382000 -- (-158.673) (-148.596) [-143.973] (-165.595) * (-152.554) (-140.915) [-144.154] (-141.066) -- 0:01:58
383000 -- (-157.510) [-149.827] (-145.177) (-169.555) * (-162.996) (-142.252) [-143.843] (-162.152) -- 0:01:57
384000 -- (-160.098) [-144.194] (-150.525) (-156.495) * (-153.970) (-148.240) [-145.929] (-147.141) -- 0:01:57
385000 -- (-159.427) [-146.407] (-148.057) (-162.073) * (-154.808) [-142.850] (-148.729) (-150.723) -- 0:01:58
Average standard deviation of split frequencies: 0.013434
386000 -- (-161.954) [-146.926] (-148.360) (-159.356) * (-148.789) [-150.773] (-170.002) (-149.712) -- 0:01:57
387000 -- (-157.467) (-143.350) (-154.403) [-140.924] * (-158.818) (-152.825) (-164.864) [-145.253] -- 0:01:57
388000 -- (-161.004) [-145.644] (-151.237) (-162.412) * (-162.385) (-152.956) (-159.074) [-144.443] -- 0:01:56
389000 -- (-161.010) [-142.242] (-149.379) (-152.616) * (-163.518) [-146.104] (-158.463) (-143.715) -- 0:01:56
390000 -- (-167.293) (-149.408) (-160.448) [-153.668] * [-151.210] (-155.678) (-163.972) (-144.812) -- 0:01:57
Average standard deviation of split frequencies: 0.013101
391000 -- (-160.030) [-149.428] (-148.738) (-149.248) * [-148.833] (-160.839) (-157.479) (-141.919) -- 0:01:56
392000 -- (-161.192) (-149.740) [-147.277] (-142.342) * [-141.629] (-160.805) (-152.833) (-143.668) -- 0:01:56
393000 -- (-159.203) (-144.602) (-150.432) [-141.522] * [-142.151] (-169.399) (-164.368) (-148.491) -- 0:01:55
394000 -- (-163.388) (-146.321) (-146.903) [-144.071] * [-142.350] (-166.244) (-154.212) (-147.218) -- 0:01:55
395000 -- (-160.301) [-141.536] (-148.281) (-150.503) * [-144.349] (-163.300) (-152.578) (-150.992) -- 0:01:56
Average standard deviation of split frequencies: 0.012669
396000 -- (-173.029) [-141.061] (-145.330) (-154.554) * [-150.063] (-162.660) (-163.687) (-148.882) -- 0:01:55
397000 -- (-147.861) (-161.692) (-148.838) [-141.677] * [-144.053] (-163.832) (-152.566) (-145.673) -- 0:01:55
398000 -- (-158.729) (-164.580) [-148.267] (-146.921) * [-143.391] (-157.448) (-156.256) (-147.356) -- 0:01:54
399000 -- (-157.219) (-159.851) [-141.957] (-146.236) * [-145.289] (-161.803) (-146.957) (-144.216) -- 0:01:54
400000 -- (-153.324) (-160.569) (-152.604) [-149.195] * [-144.403] (-161.174) (-149.995) (-152.110) -- 0:01:55
Average standard deviation of split frequencies: 0.012900
401000 -- (-161.611) (-145.717) [-149.658] (-143.040) * (-146.071) (-163.635) [-145.804] (-145.646) -- 0:01:55
402000 -- (-169.677) (-144.082) [-148.106] (-151.689) * (-164.589) (-158.041) [-151.277] (-146.491) -- 0:01:54
403000 -- (-150.735) (-145.899) (-149.050) [-145.284] * (-146.738) (-168.376) (-149.527) [-145.567] -- 0:01:54
404000 -- (-155.733) (-141.382) [-149.234] (-141.506) * (-154.991) (-163.670) (-150.933) [-143.684] -- 0:01:53
405000 -- (-155.326) (-143.126) [-147.298] (-145.903) * [-147.248] (-159.651) (-143.689) (-149.675) -- 0:01:54
Average standard deviation of split frequencies: 0.012482
406000 -- (-161.721) [-146.878] (-151.047) (-157.424) * (-157.556) (-160.224) (-150.477) [-145.648] -- 0:01:54
407000 -- (-157.211) (-149.460) [-147.504] (-142.789) * [-146.463] (-164.165) (-163.599) (-140.393) -- 0:01:53
408000 -- (-166.926) (-153.185) (-148.538) [-146.228] * (-149.578) (-166.177) [-150.939] (-138.998) -- 0:01:53
409000 -- (-158.751) (-168.667) [-152.011] (-145.004) * (-149.591) (-157.023) [-146.135] (-153.761) -- 0:01:52
410000 -- [-149.667] (-159.952) (-146.304) (-143.381) * (-156.799) (-158.061) (-152.586) [-150.103] -- 0:01:52
Average standard deviation of split frequencies: 0.012389
411000 -- (-152.495) (-161.331) (-158.459) [-142.040] * (-148.954) (-159.527) (-155.088) [-145.135] -- 0:01:53
412000 -- [-148.710] (-162.083) (-158.807) (-147.435) * (-144.434) (-163.434) (-159.184) [-141.334] -- 0:01:52
413000 -- (-148.784) (-158.393) (-157.292) [-147.896] * (-166.517) (-145.456) [-146.012] (-143.295) -- 0:01:52
414000 -- (-143.311) (-160.833) (-162.912) [-145.507] * (-161.339) (-163.447) [-146.327] (-145.001) -- 0:01:51
415000 -- (-156.524) (-162.652) (-147.734) [-146.571] * (-158.978) (-159.866) [-143.404] (-143.619) -- 0:01:51
Average standard deviation of split frequencies: 0.012582
416000 -- (-180.411) (-159.566) (-142.168) [-145.619] * (-153.334) (-165.170) (-152.303) [-143.981] -- 0:01:52
417000 -- (-161.118) (-161.047) (-142.494) [-143.221] * (-164.093) (-159.711) (-140.380) [-146.042] -- 0:01:51
418000 -- (-157.679) (-156.401) (-147.695) [-144.929] * (-163.240) (-168.382) [-144.852] (-147.773) -- 0:01:51
419000 -- (-162.485) (-160.914) (-149.934) [-142.640] * (-164.076) (-157.897) [-146.047] (-148.015) -- 0:01:50
420000 -- [-144.119] (-156.585) (-145.907) (-143.087) * (-167.559) (-164.548) (-153.217) [-144.525] -- 0:01:50
Average standard deviation of split frequencies: 0.012663
421000 -- (-150.979) (-166.137) (-149.821) [-143.454] * (-166.005) (-160.706) [-143.399] (-147.573) -- 0:01:51
422000 -- (-147.754) (-169.446) (-152.985) [-144.250] * (-154.379) (-157.331) (-148.297) [-138.596] -- 0:01:50
423000 -- (-148.401) (-171.771) [-141.318] (-148.305) * (-159.375) (-160.148) [-141.579] (-137.583) -- 0:01:50
424000 -- (-152.554) (-165.567) [-144.806] (-143.848) * (-154.568) (-153.272) (-144.553) [-142.371] -- 0:01:50
425000 -- (-151.057) (-164.609) (-146.685) [-149.533] * [-151.072] (-160.488) (-148.086) (-151.886) -- 0:01:49
Average standard deviation of split frequencies: 0.012062
426000 -- (-145.063) (-162.742) (-150.660) [-145.930] * [-144.161] (-158.996) (-147.272) (-147.141) -- 0:01:50
427000 -- (-145.916) (-164.471) [-146.061] (-151.072) * (-145.737) (-157.894) (-140.959) [-152.134] -- 0:01:50
428000 -- (-147.328) (-158.852) [-147.363] (-150.582) * [-149.180] (-156.773) (-150.038) (-154.835) -- 0:01:49
429000 -- [-141.727] (-151.013) (-151.126) (-153.276) * [-147.238] (-158.552) (-143.597) (-153.492) -- 0:01:49
430000 -- (-141.251) (-155.980) (-149.273) [-149.386] * [-143.321] (-153.417) (-146.360) (-165.331) -- 0:01:48
Average standard deviation of split frequencies: 0.012267
431000 -- [-141.838] (-155.529) (-168.927) (-149.154) * [-146.365] (-158.993) (-144.955) (-157.396) -- 0:01:48
432000 -- (-145.493) (-153.725) (-146.161) [-145.934] * (-140.629) (-159.156) [-142.204] (-162.128) -- 0:01:49
433000 -- (-141.539) (-165.455) (-151.395) [-142.760] * [-145.912] (-156.993) (-141.448) (-159.932) -- 0:01:48
434000 -- (-146.786) (-167.198) (-152.223) [-142.163] * [-142.402] (-170.215) (-146.504) (-158.609) -- 0:01:48
435000 -- (-147.898) (-161.713) (-157.383) [-142.723] * [-142.229] (-159.969) (-143.169) (-153.503) -- 0:01:47
Average standard deviation of split frequencies: 0.011707
436000 -- (-146.064) (-160.523) (-161.511) [-148.221] * (-147.601) (-152.398) [-139.687] (-160.371) -- 0:01:47
437000 -- [-139.844] (-165.103) (-155.833) (-152.883) * (-142.723) (-161.982) [-141.413] (-164.015) -- 0:01:48
438000 -- [-147.822] (-163.846) (-167.903) (-144.828) * (-143.834) (-157.143) [-141.449] (-163.043) -- 0:01:47
439000 -- [-140.338] (-159.368) (-162.868) (-143.817) * (-144.053) (-155.281) [-143.925] (-156.456) -- 0:01:47
440000 -- [-139.604] (-159.921) (-166.288) (-142.082) * [-151.473] (-156.337) (-144.189) (-157.289) -- 0:01:46
Average standard deviation of split frequencies: 0.012062
441000 -- (-144.613) (-168.664) (-151.758) [-142.687] * [-150.242] (-155.142) (-147.413) (-158.948) -- 0:01:46
442000 -- (-155.768) (-159.722) (-151.935) [-139.617] * (-141.347) (-162.588) [-153.527] (-155.800) -- 0:01:47
443000 -- (-148.444) (-161.670) [-147.263] (-150.181) * [-144.105] (-154.054) (-144.950) (-156.985) -- 0:01:46
444000 -- [-147.001] (-162.020) (-152.327) (-150.829) * [-145.028] (-155.319) (-149.059) (-162.134) -- 0:01:46
445000 -- (-145.162) (-172.020) (-148.734) [-141.408] * (-142.625) (-163.664) [-148.249] (-159.203) -- 0:01:46
Average standard deviation of split frequencies: 0.011627
446000 -- (-147.439) (-161.760) [-144.906] (-144.364) * [-143.250] (-165.219) (-142.760) (-166.741) -- 0:01:45
447000 -- (-152.715) (-164.173) [-144.987] (-146.772) * [-140.704] (-158.805) (-146.825) (-157.735) -- 0:01:45
448000 -- (-152.430) (-168.327) [-148.145] (-149.152) * [-143.703] (-163.884) (-144.291) (-159.066) -- 0:01:45
449000 -- (-156.212) (-174.730) [-145.241] (-145.788) * [-144.229] (-163.192) (-142.592) (-152.421) -- 0:01:45
450000 -- (-157.898) (-144.967) [-146.492] (-146.937) * [-141.778] (-156.305) (-143.548) (-154.429) -- 0:01:45
Average standard deviation of split frequencies: 0.012378
451000 -- (-163.778) (-146.417) [-141.210] (-164.658) * [-143.564] (-157.980) (-145.670) (-153.889) -- 0:01:44
452000 -- (-155.462) (-146.297) [-147.889] (-148.646) * (-140.842) (-170.157) [-143.528] (-167.480) -- 0:01:44
453000 -- (-163.810) (-146.499) [-145.104] (-145.543) * [-144.717] (-164.313) (-146.781) (-152.297) -- 0:01:45
454000 -- (-164.874) (-148.470) [-143.835] (-146.326) * [-141.572] (-157.245) (-145.095) (-157.335) -- 0:01:44
455000 -- (-159.320) (-148.678) [-148.455] (-149.671) * [-149.706] (-169.299) (-150.698) (-161.838) -- 0:01:44
Average standard deviation of split frequencies: 0.012061
456000 -- (-167.671) (-170.311) (-154.942) [-145.480] * (-143.737) (-160.733) [-147.565] (-160.780) -- 0:01:43
457000 -- [-147.277] (-163.757) (-147.293) (-147.474) * [-144.350] (-170.384) (-140.905) (-164.240) -- 0:01:43
458000 -- (-143.578) (-157.015) [-146.354] (-143.264) * [-144.647] (-152.484) (-143.687) (-159.075) -- 0:01:44
459000 -- (-166.564) (-162.623) (-146.294) [-147.823] * [-143.942] (-162.817) (-149.061) (-169.995) -- 0:01:43
460000 -- (-161.445) (-167.797) (-156.128) [-138.609] * [-145.361] (-151.797) (-151.471) (-163.720) -- 0:01:43
Average standard deviation of split frequencies: 0.012109
461000 -- (-164.159) (-159.219) [-144.916] (-143.477) * [-152.809] (-161.037) (-146.922) (-162.993) -- 0:01:42
462000 -- (-162.677) (-155.449) (-149.950) [-145.094] * (-145.395) (-149.127) [-142.628] (-162.842) -- 0:01:42
463000 -- (-164.894) (-150.699) [-146.667] (-143.183) * (-144.999) [-142.857] (-151.230) (-162.453) -- 0:01:43
464000 -- (-163.944) (-156.050) [-145.272] (-154.704) * (-158.082) (-143.627) [-140.477] (-168.002) -- 0:01:42
465000 -- (-157.445) (-159.368) [-144.471] (-147.333) * (-161.650) [-143.123] (-148.611) (-170.574) -- 0:01:42
Average standard deviation of split frequencies: 0.011160
466000 -- (-157.001) (-160.185) (-143.798) [-147.659] * (-160.551) [-143.136] (-143.835) (-163.468) -- 0:01:41
467000 -- (-163.571) (-150.443) (-152.371) [-144.528] * (-160.673) [-147.848] (-142.861) (-160.363) -- 0:01:41
468000 -- (-159.954) [-142.473] (-151.589) (-146.681) * (-162.516) [-147.162] (-153.808) (-161.994) -- 0:01:41
469000 -- (-172.826) (-161.730) [-146.358] (-147.403) * (-166.250) [-142.837] (-148.411) (-162.265) -- 0:01:41
470000 -- (-154.843) (-167.578) [-143.616] (-160.265) * (-162.332) [-142.525] (-151.219) (-171.029) -- 0:01:41
Average standard deviation of split frequencies: 0.011340
471000 -- (-157.735) (-167.674) (-146.928) [-145.199] * (-164.713) [-146.996] (-146.365) (-163.202) -- 0:01:41
472000 -- (-157.197) (-156.804) [-141.643] (-146.384) * (-155.163) [-142.748] (-156.206) (-170.555) -- 0:01:40
473000 -- (-166.067) (-154.490) (-142.508) [-148.990] * (-160.122) [-149.325] (-151.617) (-156.793) -- 0:01:40
474000 -- (-155.593) (-166.118) (-151.945) [-145.031] * (-153.611) (-156.814) [-146.735] (-164.997) -- 0:01:40
475000 -- (-159.473) (-158.819) [-142.394] (-142.735) * (-157.220) [-143.643] (-149.191) (-162.725) -- 0:01:40
Average standard deviation of split frequencies: 0.011424
476000 -- (-167.192) (-159.841) (-145.688) [-147.883] * (-161.939) (-146.307) [-144.799] (-166.441) -- 0:01:40
477000 -- (-158.721) (-160.342) [-138.913] (-142.494) * (-162.015) [-149.577] (-147.418) (-163.603) -- 0:01:39
478000 -- (-157.759) (-163.474) [-149.276] (-150.471) * [-145.307] (-157.015) (-153.072) (-162.887) -- 0:01:39
479000 -- (-146.555) (-154.518) [-144.305] (-155.039) * [-144.818] (-158.782) (-149.768) (-160.702) -- 0:01:40
480000 -- (-162.155) (-158.827) (-148.493) [-147.256] * [-143.247] (-152.879) (-164.760) (-162.428) -- 0:01:39
Average standard deviation of split frequencies: 0.010963
481000 -- (-147.719) (-155.394) (-150.548) [-143.632] * (-148.143) [-146.228] (-155.605) (-152.326) -- 0:01:39
482000 -- (-143.492) (-162.427) [-146.665] (-149.182) * (-140.971) [-144.463] (-159.984) (-164.007) -- 0:01:38
483000 -- (-148.391) (-157.737) (-159.777) [-152.683] * [-148.456] (-144.160) (-154.767) (-159.321) -- 0:01:38
484000 -- (-155.687) (-162.408) (-147.711) [-140.775] * [-144.990] (-156.121) (-149.914) (-161.035) -- 0:01:39
485000 -- (-157.504) (-164.078) (-150.718) [-145.354] * (-145.408) (-142.464) [-147.532] (-166.470) -- 0:01:38
Average standard deviation of split frequencies: 0.011038
486000 -- (-152.622) (-169.079) [-147.117] (-150.431) * [-146.222] (-144.369) (-151.659) (-157.278) -- 0:01:38
487000 -- (-148.257) (-163.488) [-148.431] (-150.906) * [-140.718] (-147.930) (-148.689) (-166.200) -- 0:01:37
488000 -- (-152.389) (-160.453) (-149.919) [-144.634] * [-148.939] (-143.293) (-157.265) (-165.055) -- 0:01:37
489000 -- (-153.126) (-157.518) (-156.562) [-144.875] * [-140.566] (-148.987) (-149.027) (-165.344) -- 0:01:37
490000 -- (-144.449) (-158.840) [-153.360] (-140.161) * [-144.606] (-153.388) (-152.350) (-159.384) -- 0:01:37
Average standard deviation of split frequencies: 0.010601
491000 -- [-142.423] (-159.876) (-145.052) (-140.620) * [-149.446] (-158.873) (-144.178) (-158.580) -- 0:01:37
492000 -- (-153.175) (-164.342) (-143.602) [-147.510] * (-146.707) (-174.041) [-141.128] (-156.153) -- 0:01:37
493000 -- (-144.044) (-160.964) (-153.153) [-147.346] * (-143.446) (-168.479) [-148.273] (-160.403) -- 0:01:36
494000 -- [-143.287] (-167.380) (-144.963) (-148.264) * (-150.140) (-156.767) [-142.434] (-158.056) -- 0:01:36
495000 -- (-151.587) (-154.130) (-150.444) [-143.273] * (-146.962) (-158.932) [-138.448] (-165.896) -- 0:01:36
Average standard deviation of split frequencies: 0.010522
496000 -- (-148.088) (-165.883) [-143.712] (-144.833) * (-144.484) (-157.660) [-144.876] (-160.033) -- 0:01:36
497000 -- [-144.976] (-161.305) (-141.977) (-161.069) * (-149.042) (-154.728) [-140.420] (-150.148) -- 0:01:36
498000 -- [-144.626] (-165.737) (-146.581) (-149.924) * (-154.403) (-159.599) (-139.045) [-147.022] -- 0:01:35
499000 -- [-147.096] (-161.402) (-156.616) (-146.569) * [-149.322] (-159.964) (-142.295) (-147.747) -- 0:01:35
500000 -- (-149.577) (-164.270) (-165.946) [-152.039] * [-151.628] (-155.064) (-146.033) (-146.288) -- 0:01:36
Average standard deviation of split frequencies: 0.010626
501000 -- [-153.052] (-155.219) (-161.035) (-144.827) * (-152.136) (-164.100) [-144.396] (-154.323) -- 0:01:35
502000 -- (-153.142) (-162.750) (-137.015) [-144.010] * (-146.211) (-162.691) [-142.671] (-146.550) -- 0:01:35
503000 -- (-145.909) (-165.471) [-144.034] (-144.058) * [-144.851] (-154.575) (-146.949) (-148.108) -- 0:01:34
504000 -- (-156.098) (-170.579) [-150.659] (-151.187) * (-159.949) (-159.751) (-144.924) [-145.345] -- 0:01:34
505000 -- (-158.372) (-172.735) (-149.102) [-142.510] * (-172.115) (-163.667) [-147.455] (-160.681) -- 0:01:35
Average standard deviation of split frequencies: 0.010547
506000 -- (-149.544) (-159.823) [-143.666] (-154.368) * (-167.553) (-158.959) [-144.724] (-148.410) -- 0:01:34
507000 -- (-165.139) (-159.077) [-147.496] (-146.979) * (-164.633) (-162.873) (-141.844) [-145.964] -- 0:01:34
508000 -- (-160.588) (-163.371) (-143.931) [-148.942] * (-160.605) (-160.361) [-144.814] (-145.677) -- 0:01:33
509000 -- (-146.580) (-160.749) (-144.586) [-148.761] * (-157.413) (-158.562) [-148.543] (-141.749) -- 0:01:33
510000 -- [-147.041] (-164.296) (-156.133) (-153.495) * (-154.399) (-167.213) [-143.673] (-154.111) -- 0:01:33
Average standard deviation of split frequencies: 0.010286
511000 -- (-149.132) (-158.983) [-144.502] (-146.897) * (-152.268) (-160.708) (-147.475) [-147.277] -- 0:01:33
512000 -- (-148.252) (-155.491) (-149.278) [-142.473] * [-147.796] (-160.692) (-145.247) (-149.991) -- 0:01:33
513000 -- (-155.898) (-156.214) [-143.177] (-143.840) * (-148.488) (-162.457) [-140.061] (-146.265) -- 0:01:33
514000 -- (-162.872) (-162.510) [-148.262] (-145.283) * (-153.526) (-158.452) [-142.953] (-149.040) -- 0:01:32
515000 -- (-163.664) (-156.277) (-144.130) [-142.349] * (-146.556) (-156.731) [-145.448] (-148.055) -- 0:01:32
Average standard deviation of split frequencies: 0.010669
516000 -- (-158.835) (-156.522) [-141.386] (-140.093) * (-145.623) (-157.659) [-147.654] (-152.150) -- 0:01:32
517000 -- (-162.207) (-159.086) (-140.670) [-140.817] * (-149.550) (-155.791) [-144.762] (-159.062) -- 0:01:32
518000 -- (-161.626) (-161.725) [-145.468] (-146.517) * (-147.689) (-158.159) [-148.212] (-165.204) -- 0:01:32
519000 -- (-161.514) (-162.937) (-145.238) [-144.435] * [-144.382] (-156.815) (-148.739) (-153.866) -- 0:01:31
520000 -- (-154.671) (-157.127) (-142.180) [-142.834] * (-143.768) (-163.636) (-150.327) [-142.208] -- 0:01:31
Average standard deviation of split frequencies: 0.010768
521000 -- (-167.648) (-157.531) (-148.112) [-141.975] * [-147.702] (-170.096) (-149.071) (-147.667) -- 0:01:31
522000 -- (-161.263) (-159.595) [-142.442] (-157.565) * (-144.427) (-164.985) [-144.199] (-152.571) -- 0:01:31
523000 -- (-157.160) (-157.399) [-142.937] (-142.022) * (-148.930) (-158.776) [-148.458] (-142.911) -- 0:01:31
524000 -- (-168.557) [-150.121] (-156.112) (-142.595) * (-150.157) (-160.124) [-138.423] (-149.687) -- 0:01:30
525000 -- (-159.079) (-145.074) (-164.086) [-147.102] * (-159.417) (-158.975) (-149.618) [-142.828] -- 0:01:30
Average standard deviation of split frequencies: 0.010569
526000 -- (-162.212) (-146.123) (-155.568) [-143.088] * [-146.090] (-167.515) (-144.445) (-139.000) -- 0:01:31
527000 -- [-149.076] (-149.102) (-164.581) (-146.329) * (-146.240) (-165.594) [-144.770] (-153.133) -- 0:01:30
528000 -- (-157.049) [-141.177] (-163.529) (-146.307) * (-148.749) (-160.959) (-150.620) [-140.966] -- 0:01:30
529000 -- (-155.373) (-147.826) (-159.426) [-143.600] * (-157.789) (-159.014) (-154.570) [-144.912] -- 0:01:29
530000 -- (-156.273) [-149.905] (-166.317) (-148.688) * (-148.990) (-160.170) (-150.045) [-148.999] -- 0:01:29
Average standard deviation of split frequencies: 0.010397
531000 -- (-160.875) (-149.490) (-161.665) [-147.649] * (-150.436) (-165.861) (-146.282) [-142.462] -- 0:01:29
532000 -- (-156.212) (-149.081) (-161.433) [-144.208] * [-146.611] (-166.176) (-146.677) (-148.040) -- 0:01:29
533000 -- (-162.891) [-151.650] (-166.688) (-149.670) * (-146.870) (-159.812) (-149.828) [-143.120] -- 0:01:29
534000 -- (-158.475) [-141.350] (-157.094) (-148.578) * [-146.247] (-160.250) (-151.296) (-144.307) -- 0:01:29
535000 -- (-161.583) (-148.854) (-171.967) [-145.830] * [-144.362] (-166.792) (-151.867) (-142.788) -- 0:01:28
Average standard deviation of split frequencies: 0.010196
536000 -- (-160.139) (-149.252) (-167.640) [-143.447] * (-146.362) (-154.909) (-155.776) [-150.681] -- 0:01:28
537000 -- (-163.003) (-147.306) (-153.478) [-147.926] * (-147.213) (-157.653) (-158.809) [-151.186] -- 0:01:28
538000 -- (-157.372) [-149.403] (-165.356) (-144.789) * [-146.250] (-153.096) (-165.635) (-148.853) -- 0:01:28
539000 -- (-160.742) (-141.041) (-158.586) [-146.586] * (-141.591) (-161.445) (-161.971) [-145.119] -- 0:01:28
540000 -- (-154.900) [-143.491] (-155.900) (-148.045) * [-145.788] (-147.682) (-165.488) (-147.177) -- 0:01:27
Average standard deviation of split frequencies: 0.010172
541000 -- (-157.271) [-141.272] (-155.757) (-143.004) * [-150.006] (-156.543) (-160.393) (-144.563) -- 0:01:27
542000 -- (-166.442) (-144.700) (-167.197) [-145.573] * (-148.946) (-157.178) (-167.366) [-146.653] -- 0:01:27
543000 -- (-165.689) (-145.835) [-148.353] (-155.953) * (-156.132) (-153.741) (-162.365) [-144.616] -- 0:01:27
544000 -- (-160.832) [-144.069] (-144.459) (-154.426) * (-158.974) (-160.276) (-161.649) [-148.557] -- 0:01:27
545000 -- (-170.997) [-144.994] (-151.855) (-149.807) * (-154.612) (-148.673) (-170.673) [-145.449] -- 0:01:26
Average standard deviation of split frequencies: 0.010009
546000 -- (-158.041) (-155.262) (-154.421) [-141.193] * (-160.465) (-150.982) (-161.320) [-150.397] -- 0:01:26
547000 -- (-171.483) [-146.547] (-149.990) (-147.364) * (-154.346) (-149.656) (-161.834) [-146.626] -- 0:01:26
548000 -- (-156.916) (-158.438) [-151.523] (-144.869) * (-153.569) (-154.836) (-160.738) [-148.380] -- 0:01:26
549000 -- (-164.437) [-143.980] (-147.658) (-143.844) * (-155.022) [-153.866] (-163.042) (-158.611) -- 0:01:26
550000 -- (-158.556) (-147.380) (-150.034) [-142.867] * (-169.047) [-152.018] (-158.673) (-145.193) -- 0:01:25
Average standard deviation of split frequencies: 0.010364
551000 -- (-156.154) [-145.947] (-151.851) (-145.222) * (-161.772) [-147.247] (-151.389) (-150.192) -- 0:01:25
552000 -- (-157.796) (-148.642) [-147.390] (-158.150) * (-151.217) (-149.592) [-147.237] (-148.146) -- 0:01:25
553000 -- (-160.058) (-149.359) [-150.708] (-152.201) * (-159.836) [-148.117] (-142.380) (-153.871) -- 0:01:25
554000 -- (-159.135) (-170.000) (-160.678) [-148.492] * (-154.997) [-150.497] (-154.644) (-142.439) -- 0:01:25
555000 -- (-152.582) (-148.444) (-149.108) [-144.716] * (-164.696) (-162.752) (-159.336) [-141.538] -- 0:01:24
Average standard deviation of split frequencies: 0.010457
556000 -- (-160.997) (-150.573) (-146.707) [-144.992] * (-160.081) (-152.769) (-162.759) [-148.449] -- 0:01:24
557000 -- (-160.927) [-147.290] (-150.089) (-146.565) * (-159.349) [-154.059] (-160.461) (-146.985) -- 0:01:24
558000 -- (-159.094) (-142.543) (-155.557) [-141.894] * (-163.314) [-141.855] (-164.270) (-144.619) -- 0:01:24
559000 -- (-173.505) (-140.866) (-156.385) [-149.349] * (-164.460) [-141.734] (-160.997) (-147.081) -- 0:01:24
560000 -- (-168.630) (-147.340) (-159.396) [-146.028] * (-154.560) [-147.173] (-161.413) (-160.693) -- 0:01:24
Average standard deviation of split frequencies: 0.010245
561000 -- (-155.020) (-147.068) (-169.032) [-147.155] * (-145.391) [-149.021] (-168.991) (-157.224) -- 0:01:23
562000 -- (-159.958) [-147.541] (-150.120) (-152.781) * [-148.298] (-146.812) (-145.806) (-161.438) -- 0:01:23
563000 -- (-166.280) (-155.009) (-157.346) [-147.467] * [-147.289] (-149.380) (-150.376) (-159.413) -- 0:01:23
564000 -- (-168.788) (-145.349) (-156.212) [-147.772] * (-151.313) (-144.422) [-149.938] (-156.933) -- 0:01:23
565000 -- (-160.369) [-142.934] (-162.206) (-142.734) * [-145.902] (-148.851) (-146.352) (-161.666) -- 0:01:23
Average standard deviation of split frequencies: 0.010488
566000 -- (-161.670) (-151.077) (-164.060) [-149.819] * [-149.010] (-150.601) (-153.254) (-162.040) -- 0:01:22
567000 -- (-157.950) (-142.585) (-160.571) [-144.764] * [-146.441] (-151.776) (-144.943) (-155.835) -- 0:01:22
568000 -- (-165.814) (-148.421) (-160.981) [-141.394] * (-161.151) (-155.162) [-144.488] (-169.538) -- 0:01:22
569000 -- (-157.245) (-149.101) (-150.292) [-143.332] * (-153.268) (-149.082) [-143.930] (-158.491) -- 0:01:22
570000 -- (-155.582) (-148.173) (-155.134) [-146.273] * (-143.852) (-154.308) [-146.281] (-173.163) -- 0:01:22
Average standard deviation of split frequencies: 0.010555
571000 -- (-156.701) (-144.179) (-161.993) [-147.924] * (-152.408) (-157.206) [-142.827] (-162.803) -- 0:01:21
572000 -- (-163.073) (-149.392) (-148.657) [-147.600] * (-158.160) (-144.464) [-144.272] (-157.258) -- 0:01:21
573000 -- (-158.045) (-153.413) (-143.602) [-140.262] * (-150.453) [-145.675] (-142.826) (-157.292) -- 0:01:21
574000 -- (-165.134) (-153.852) (-151.159) [-143.796] * (-144.374) (-159.324) [-143.977] (-161.601) -- 0:01:21
575000 -- (-161.084) (-161.029) [-148.746] (-142.386) * (-146.896) [-147.732] (-152.164) (-162.438) -- 0:01:21
Average standard deviation of split frequencies: 0.010552
576000 -- (-161.100) (-163.844) (-145.579) [-144.498] * (-145.022) [-147.274] (-148.748) (-160.965) -- 0:01:20
577000 -- (-164.145) (-155.976) [-138.974] (-150.362) * [-147.292] (-148.286) (-144.875) (-159.221) -- 0:01:20
578000 -- (-157.282) [-148.100] (-145.962) (-149.739) * (-154.197) (-145.618) [-145.545] (-163.490) -- 0:01:20
579000 -- (-171.091) (-147.603) (-149.250) [-143.309] * (-156.373) [-142.260] (-149.484) (-165.763) -- 0:01:20
580000 -- (-158.358) [-142.774] (-154.309) (-144.139) * (-154.729) [-142.243] (-146.513) (-167.735) -- 0:01:20
Average standard deviation of split frequencies: 0.010496
581000 -- (-161.831) (-149.420) [-148.972] (-154.952) * (-163.360) (-148.864) [-157.030] (-157.780) -- 0:01:20
582000 -- (-152.515) (-142.473) (-155.825) [-141.329] * (-167.156) [-143.217] (-142.834) (-161.970) -- 0:01:19
583000 -- [-148.094] (-148.196) (-160.644) (-151.187) * (-156.096) [-146.047] (-141.306) (-164.748) -- 0:01:19
584000 -- (-164.830) [-149.792] (-150.444) (-155.745) * (-164.181) [-151.118] (-142.607) (-168.119) -- 0:01:19
585000 -- (-157.233) (-144.884) (-158.143) [-144.493] * (-157.532) (-150.376) [-151.798] (-168.657) -- 0:01:19
Average standard deviation of split frequencies: 0.010659
586000 -- (-154.000) (-156.168) (-163.075) [-148.089] * (-166.950) [-149.749] (-147.932) (-158.158) -- 0:01:19
587000 -- (-148.354) (-148.095) (-161.519) [-141.888] * (-161.281) [-147.031] (-151.445) (-166.363) -- 0:01:18
588000 -- (-149.893) (-147.546) (-156.697) [-147.763] * (-159.565) [-144.423] (-146.838) (-164.927) -- 0:01:18
589000 -- (-149.699) [-148.137] (-158.939) (-168.443) * (-157.051) (-150.930) [-159.540] (-166.758) -- 0:01:18
590000 -- [-143.764] (-145.716) (-153.735) (-155.322) * (-158.674) (-143.320) [-149.628] (-164.039) -- 0:01:18
Average standard deviation of split frequencies: 0.010603
591000 -- [-147.652] (-144.702) (-164.788) (-152.942) * (-156.242) (-149.309) [-146.640] (-161.653) -- 0:01:18
592000 -- [-150.499] (-148.439) (-155.363) (-159.659) * (-164.959) (-145.794) [-143.299] (-155.111) -- 0:01:17
593000 -- (-147.254) [-141.101] (-158.094) (-157.715) * (-155.743) (-147.435) [-147.409] (-162.977) -- 0:01:17
594000 -- [-151.565] (-153.987) (-165.434) (-155.808) * (-161.639) (-144.840) [-146.382] (-162.057) -- 0:01:17
595000 -- [-144.822] (-146.071) (-150.477) (-156.605) * (-169.466) (-147.267) [-146.516] (-152.333) -- 0:01:17
Average standard deviation of split frequencies: 0.010508
596000 -- [-154.013] (-151.676) (-152.736) (-162.460) * (-144.509) (-155.888) [-142.834] (-165.535) -- 0:01:17
597000 -- (-148.375) (-157.065) [-142.466] (-163.810) * (-152.675) [-145.355] (-143.982) (-155.851) -- 0:01:16
598000 -- (-149.177) (-164.840) [-143.959] (-168.120) * (-147.195) [-143.982] (-149.711) (-165.042) -- 0:01:16
599000 -- (-145.481) (-165.259) [-151.551] (-160.759) * (-147.678) [-144.880] (-151.531) (-165.511) -- 0:01:16
600000 -- (-153.944) (-167.436) [-149.435] (-170.660) * [-143.409] (-146.985) (-141.965) (-165.196) -- 0:01:16
Average standard deviation of split frequencies: 0.010735
601000 -- (-139.792) (-163.623) [-144.060] (-159.918) * (-142.660) (-149.630) [-145.496] (-168.600) -- 0:01:16
602000 -- (-155.858) (-164.403) [-142.411] (-164.557) * [-149.666] (-144.658) (-141.067) (-160.319) -- 0:01:16
603000 -- [-153.946] (-152.276) (-141.315) (-157.201) * (-145.427) [-146.788] (-151.617) (-176.041) -- 0:01:15
604000 -- [-137.795] (-152.434) (-141.366) (-169.445) * [-142.221] (-141.274) (-160.950) (-165.852) -- 0:01:15
605000 -- [-144.811] (-148.276) (-141.419) (-173.120) * [-149.011] (-146.067) (-153.238) (-172.771) -- 0:01:15
Average standard deviation of split frequencies: 0.010557
606000 -- [-146.951] (-154.697) (-155.739) (-159.658) * [-145.155] (-145.021) (-161.524) (-163.217) -- 0:01:15
607000 -- (-143.249) (-160.070) [-145.437] (-159.081) * (-149.047) [-151.672] (-157.402) (-169.515) -- 0:01:15
608000 -- [-146.923] (-148.633) (-154.133) (-162.186) * (-142.455) [-144.559] (-163.755) (-164.431) -- 0:01:14
609000 -- [-148.837] (-144.670) (-147.207) (-161.823) * (-142.272) [-145.749] (-165.788) (-159.699) -- 0:01:14
610000 -- (-144.850) [-144.733] (-144.967) (-169.686) * [-145.344] (-151.181) (-162.550) (-160.986) -- 0:01:14
Average standard deviation of split frequencies: 0.010835
611000 -- (-145.444) (-149.975) [-143.094] (-162.487) * (-143.140) [-145.931] (-156.108) (-155.039) -- 0:01:14
612000 -- (-150.547) (-143.479) [-144.449] (-158.952) * [-145.296] (-146.149) (-157.937) (-161.355) -- 0:01:14
613000 -- (-150.706) [-142.958] (-150.623) (-162.173) * (-146.873) [-144.323] (-152.633) (-155.645) -- 0:01:13
614000 -- (-141.453) (-148.562) [-145.985] (-175.567) * [-145.468] (-145.246) (-156.478) (-160.218) -- 0:01:13
615000 -- (-151.406) (-150.833) [-145.015] (-160.854) * (-149.858) [-150.188] (-142.675) (-158.071) -- 0:01:13
Average standard deviation of split frequencies: 0.010222
616000 -- (-147.215) [-141.905] (-152.180) (-161.954) * (-144.023) [-145.441] (-143.481) (-166.966) -- 0:01:13
617000 -- (-150.210) (-160.074) [-152.401] (-165.828) * (-143.254) (-155.219) [-151.024] (-164.467) -- 0:01:13
618000 -- (-147.304) [-144.282] (-152.811) (-156.789) * (-146.342) (-162.853) [-149.936] (-156.396) -- 0:01:12
619000 -- [-150.521] (-154.872) (-145.756) (-156.108) * (-153.171) (-155.788) [-146.791] (-170.494) -- 0:01:12
620000 -- (-149.812) (-155.779) [-146.316] (-160.493) * (-148.337) (-156.092) [-144.461] (-165.542) -- 0:01:12
Average standard deviation of split frequencies: 0.009955
621000 -- (-147.282) (-167.699) [-146.099] (-163.940) * [-155.977] (-156.699) (-148.081) (-167.004) -- 0:01:12
622000 -- [-143.616] (-159.869) (-147.093) (-155.858) * (-151.455) (-157.384) [-146.205] (-164.057) -- 0:01:12
623000 -- [-147.316] (-162.773) (-150.077) (-168.038) * [-148.056] (-156.815) (-152.498) (-163.288) -- 0:01:12
624000 -- (-145.204) (-158.603) [-144.709] (-168.226) * [-159.037] (-165.169) (-157.000) (-158.604) -- 0:01:11
625000 -- [-146.282] (-172.842) (-154.975) (-159.408) * (-153.206) [-152.884] (-169.912) (-161.846) -- 0:01:11
Average standard deviation of split frequencies: 0.009628
626000 -- [-144.849] (-159.273) (-147.750) (-166.699) * (-152.609) [-145.571] (-159.695) (-160.522) -- 0:01:11
627000 -- (-143.611) (-155.849) [-144.281] (-166.828) * [-150.566] (-151.702) (-154.828) (-158.836) -- 0:01:11
628000 -- (-142.494) (-156.023) [-143.026] (-159.503) * (-145.619) [-145.520] (-159.257) (-156.405) -- 0:01:11
629000 -- [-153.165] (-155.937) (-147.987) (-162.722) * (-144.528) [-146.675] (-157.813) (-161.622) -- 0:01:10
630000 -- [-147.414] (-157.516) (-147.540) (-160.205) * (-144.790) [-142.556] (-150.064) (-166.964) -- 0:01:10
Average standard deviation of split frequencies: 0.009664
631000 -- [-140.203] (-163.837) (-144.638) (-159.699) * (-147.169) [-144.660] (-158.368) (-161.403) -- 0:01:10
632000 -- (-147.134) (-153.943) [-142.107] (-164.023) * [-147.411] (-144.754) (-157.328) (-158.793) -- 0:01:10
633000 -- (-146.196) (-167.281) [-140.521] (-165.079) * (-141.766) [-146.037] (-160.357) (-153.300) -- 0:01:10
634000 -- [-150.366] (-160.604) (-143.023) (-164.394) * [-145.269] (-147.909) (-159.348) (-156.045) -- 0:01:09
635000 -- (-153.936) (-157.402) [-149.620] (-158.408) * [-145.286] (-143.185) (-158.458) (-155.155) -- 0:01:09
Average standard deviation of split frequencies: 0.009742
636000 -- (-156.891) (-160.963) [-143.750] (-162.055) * (-144.442) (-146.079) (-162.344) [-147.543] -- 0:01:09
637000 -- (-146.823) (-154.139) [-143.513] (-166.652) * (-145.784) [-144.993] (-162.046) (-151.039) -- 0:01:09
638000 -- (-145.829) (-161.130) [-150.291] (-165.289) * (-149.360) [-153.993] (-163.773) (-151.768) -- 0:01:09
639000 -- [-145.513] (-161.113) (-141.659) (-156.257) * [-140.051] (-153.533) (-159.715) (-146.886) -- 0:01:08
640000 -- (-154.743) [-147.130] (-155.807) (-170.183) * [-147.112] (-149.074) (-157.566) (-147.759) -- 0:01:08
Average standard deviation of split frequencies: 0.009618
641000 -- [-148.322] (-146.720) (-156.996) (-163.797) * (-139.622) [-148.865] (-159.608) (-152.373) -- 0:01:08
642000 -- (-150.855) [-144.105] (-163.964) (-155.497) * (-142.721) (-166.661) (-168.144) [-147.825] -- 0:01:08
643000 -- [-147.027] (-144.942) (-165.335) (-158.106) * (-152.446) (-157.734) (-157.748) [-147.252] -- 0:01:08
644000 -- [-144.959] (-146.737) (-156.063) (-161.191) * (-145.307) (-153.171) (-152.260) [-142.100] -- 0:01:07
645000 -- (-142.290) [-145.626] (-161.741) (-164.787) * (-149.523) (-159.805) (-160.333) [-152.256] -- 0:01:07
Average standard deviation of split frequencies: 0.009565
646000 -- [-151.730] (-144.971) (-157.648) (-153.380) * [-143.992] (-160.702) (-160.904) (-152.004) -- 0:01:07
647000 -- [-145.856] (-152.560) (-164.405) (-159.641) * [-145.296] (-161.688) (-155.746) (-146.412) -- 0:01:07
648000 -- [-143.915] (-142.744) (-156.282) (-161.534) * [-140.415] (-157.842) (-163.538) (-150.495) -- 0:01:07
649000 -- [-146.142] (-145.943) (-159.741) (-162.431) * (-151.512) (-158.612) (-168.385) [-143.803] -- 0:01:07
650000 -- [-150.586] (-142.203) (-158.813) (-159.232) * [-146.717] (-158.753) (-159.258) (-144.796) -- 0:01:06
Average standard deviation of split frequencies: 0.009600
651000 -- (-144.630) [-141.694] (-156.875) (-166.770) * [-148.483] (-160.268) (-166.341) (-146.044) -- 0:01:07
652000 -- (-144.800) [-143.541] (-160.071) (-166.409) * [-142.501] (-157.154) (-169.410) (-149.155) -- 0:01:06
653000 -- [-145.188] (-143.823) (-157.766) (-159.646) * (-148.160) (-157.309) (-158.147) [-153.318] -- 0:01:06
654000 -- [-145.444] (-141.783) (-162.521) (-167.929) * [-144.167] (-161.848) (-162.731) (-147.956) -- 0:01:06
655000 -- (-150.734) [-148.422] (-165.353) (-172.560) * (-149.280) (-165.682) (-155.541) [-145.603] -- 0:01:05
Average standard deviation of split frequencies: 0.009547
656000 -- [-143.427] (-147.045) (-165.953) (-159.734) * (-147.179) (-168.790) (-148.417) [-151.601] -- 0:01:05
657000 -- (-158.353) [-147.496] (-147.542) (-166.174) * [-145.609] (-154.212) (-144.946) (-149.953) -- 0:01:05
658000 -- (-154.288) [-141.002] (-146.836) (-160.322) * (-152.341) (-158.418) [-149.487] (-147.590) -- 0:01:05
659000 -- [-151.467] (-142.397) (-160.631) (-161.394) * (-149.286) (-160.459) (-163.657) [-145.377] -- 0:01:05
660000 -- (-150.113) (-146.632) [-143.019] (-161.836) * (-158.252) (-151.394) [-146.207] (-152.995) -- 0:01:04
Average standard deviation of split frequencies: 0.009862
661000 -- (-152.576) [-147.631] (-144.186) (-163.926) * [-141.991] (-158.205) (-148.649) (-158.838) -- 0:01:04
662000 -- (-145.558) [-146.909] (-152.239) (-166.961) * [-146.729] (-163.640) (-158.936) (-161.948) -- 0:01:04
663000 -- [-146.961] (-152.420) (-145.829) (-163.192) * (-149.005) (-158.244) (-146.866) [-149.874] -- 0:01:04
664000 -- (-146.267) (-143.849) [-143.358] (-164.909) * (-155.572) (-162.420) [-147.560] (-142.088) -- 0:01:04
665000 -- (-155.174) (-145.555) [-142.059] (-166.336) * (-158.741) (-159.759) [-153.133] (-144.987) -- 0:01:03
Average standard deviation of split frequencies: 0.009834
666000 -- [-149.647] (-154.833) (-152.439) (-163.501) * (-160.743) (-159.001) (-143.701) [-144.704] -- 0:01:03
667000 -- (-147.056) (-156.555) [-143.360] (-162.252) * (-164.633) (-159.525) (-150.414) [-145.468] -- 0:01:03
668000 -- (-143.441) (-148.662) [-148.761] (-161.481) * (-167.714) (-159.130) [-146.669] (-165.898) -- 0:01:03
669000 -- (-146.217) (-151.373) [-146.827] (-170.490) * (-143.090) (-159.861) (-144.418) [-147.310] -- 0:01:03
670000 -- [-144.446] (-151.962) (-145.794) (-161.286) * [-149.578] (-160.443) (-145.858) (-146.188) -- 0:01:03
Average standard deviation of split frequencies: 0.009574
671000 -- (-148.131) (-148.805) [-146.013] (-163.407) * (-154.131) (-166.591) [-145.529] (-147.679) -- 0:01:02
672000 -- (-147.905) (-149.958) [-145.192] (-158.596) * (-160.621) (-160.423) [-148.340] (-145.824) -- 0:01:02
673000 -- (-155.699) (-141.270) [-141.558] (-161.204) * (-147.347) (-155.015) [-142.378] (-152.565) -- 0:01:02
674000 -- (-150.728) (-143.439) (-154.219) [-145.149] * [-148.797] (-156.090) (-151.662) (-156.655) -- 0:01:02
675000 -- (-160.607) [-145.877] (-158.868) (-138.971) * (-143.613) (-159.316) [-151.646] (-152.956) -- 0:01:02
Average standard deviation of split frequencies: 0.009763
676000 -- (-164.933) (-152.707) (-163.897) [-146.969] * [-147.143] (-155.743) (-146.558) (-154.343) -- 0:01:01
677000 -- (-160.283) [-149.700] (-157.721) (-148.136) * [-146.254] (-155.043) (-147.070) (-161.146) -- 0:01:01
678000 -- (-154.828) (-152.525) (-168.688) [-146.870] * (-146.493) (-159.535) [-146.056] (-157.836) -- 0:01:01
679000 -- (-158.249) (-147.981) (-158.679) [-147.088] * [-149.911] (-155.236) (-152.991) (-157.803) -- 0:01:01
680000 -- (-155.931) [-142.296] (-161.803) (-150.997) * [-139.602] (-163.956) (-151.676) (-145.692) -- 0:01:01
Average standard deviation of split frequencies: 0.009672
681000 -- (-155.628) (-144.671) (-161.129) [-145.263] * (-148.050) (-159.384) (-145.975) [-139.339] -- 0:01:00
682000 -- (-156.744) [-142.706] (-161.228) (-142.456) * (-151.759) (-154.564) [-154.383] (-141.327) -- 0:01:00
683000 -- (-159.625) [-145.429] (-164.386) (-152.936) * (-157.527) (-157.060) [-143.120] (-146.938) -- 0:01:00
684000 -- (-156.367) (-147.101) (-142.409) [-149.182] * (-143.881) (-167.639) [-144.610] (-160.956) -- 0:01:00
685000 -- (-162.157) (-147.954) (-167.565) [-144.286] * (-144.582) (-160.590) [-143.395] (-161.659) -- 0:01:00
Average standard deviation of split frequencies: 0.010047
686000 -- (-142.163) (-146.796) (-155.716) [-146.160] * (-143.629) (-146.415) [-146.987] (-159.969) -- 0:00:59
687000 -- [-155.613] (-152.027) (-161.849) (-145.612) * (-155.264) (-143.150) [-145.299] (-158.286) -- 0:00:59
688000 -- [-149.878] (-148.337) (-154.942) (-167.518) * (-145.991) (-159.491) [-142.889] (-157.709) -- 0:00:59
689000 -- (-157.091) [-147.291] (-163.895) (-161.840) * (-143.836) [-142.931] (-142.484) (-167.452) -- 0:00:59
690000 -- (-158.923) [-141.336] (-155.771) (-152.654) * (-139.718) (-149.949) [-145.458] (-157.645) -- 0:00:59
Average standard deviation of split frequencies: 0.010144
691000 -- (-151.011) (-145.548) (-155.397) [-150.483] * (-143.753) [-147.936] (-145.249) (-165.898) -- 0:00:59
692000 -- (-151.593) [-147.745] (-159.936) (-149.014) * (-142.411) (-152.475) [-144.660] (-169.354) -- 0:00:58
693000 -- (-153.406) (-150.054) (-161.041) [-144.955] * [-145.502] (-158.394) (-147.174) (-159.884) -- 0:00:58
694000 -- (-147.353) (-149.127) (-161.624) [-147.559] * (-144.895) (-153.509) [-142.506] (-153.875) -- 0:00:58
695000 -- [-154.605] (-145.607) (-159.480) (-147.983) * (-149.139) (-150.270) [-142.518] (-160.023) -- 0:00:58
Average standard deviation of split frequencies: 0.010487
696000 -- [-149.825] (-146.879) (-154.177) (-154.660) * (-143.744) (-151.473) [-138.545] (-159.971) -- 0:00:58
697000 -- (-144.308) (-155.823) (-157.146) [-146.239] * [-145.098] (-167.523) (-148.628) (-158.425) -- 0:00:57
698000 -- [-146.742] (-144.764) (-156.243) (-153.486) * [-143.868] (-169.769) (-150.952) (-158.340) -- 0:00:57
699000 -- (-151.790) (-149.000) (-166.296) [-144.128] * [-143.847] (-159.719) (-142.808) (-161.065) -- 0:00:57
700000 -- [-145.211] (-153.363) (-164.885) (-137.565) * [-145.786] (-168.295) (-147.012) (-160.763) -- 0:00:57
Average standard deviation of split frequencies: 0.010881
701000 -- (-152.410) [-143.202] (-154.201) (-150.385) * [-145.299] (-166.066) (-151.840) (-142.589) -- 0:00:57
702000 -- (-146.304) (-144.917) (-160.482) [-143.310] * (-154.022) (-163.488) (-147.651) [-142.997] -- 0:00:56
703000 -- [-150.731] (-148.467) (-164.919) (-146.508) * (-153.752) (-160.381) [-144.040] (-143.889) -- 0:00:56
704000 -- (-153.412) (-159.929) (-166.278) [-149.218] * [-143.018] (-166.030) (-145.926) (-148.396) -- 0:00:56
705000 -- (-154.879) (-143.444) (-159.328) [-145.186] * [-149.346] (-164.739) (-153.484) (-146.646) -- 0:00:56
Average standard deviation of split frequencies: 0.010614
706000 -- (-158.174) [-147.715] (-145.376) (-169.904) * (-144.069) (-162.113) (-155.099) [-143.906] -- 0:00:56
707000 -- (-155.687) [-146.425] (-158.910) (-162.328) * (-140.623) (-157.310) [-146.798] (-149.330) -- 0:00:55
708000 -- (-145.014) [-144.700] (-147.848) (-162.332) * (-144.488) (-165.571) [-145.493] (-146.296) -- 0:00:55
709000 -- (-151.355) (-148.892) [-144.716] (-166.909) * [-146.831] (-160.131) (-142.564) (-145.336) -- 0:00:55
710000 -- [-148.909] (-157.186) (-145.487) (-169.184) * (-151.855) (-151.041) (-146.010) [-141.866] -- 0:00:55
Average standard deviation of split frequencies: 0.010545
711000 -- (-166.963) [-143.954] (-147.826) (-158.978) * [-144.443] (-154.655) (-144.268) (-144.199) -- 0:00:55
712000 -- (-166.438) (-147.981) [-147.824] (-167.218) * (-148.123) (-168.491) [-144.198] (-142.894) -- 0:00:55
713000 -- (-158.444) (-146.580) [-142.437] (-159.976) * [-141.181] (-154.939) (-147.879) (-147.192) -- 0:00:54
714000 -- (-164.605) [-152.164] (-146.103) (-164.645) * (-147.887) (-160.727) [-142.207] (-142.891) -- 0:00:54
715000 -- (-162.045) (-144.800) [-145.382] (-155.275) * (-143.792) (-162.255) [-139.869] (-142.436) -- 0:00:54
Average standard deviation of split frequencies: 0.010511
716000 -- (-163.777) [-139.290] (-147.717) (-161.743) * (-159.037) (-161.210) (-141.018) [-148.116] -- 0:00:54
717000 -- (-171.816) [-145.314] (-154.601) (-159.874) * (-142.326) (-164.206) (-145.052) [-144.598] -- 0:00:54
718000 -- (-169.404) (-141.575) [-152.314] (-155.766) * [-142.992] (-159.149) (-158.947) (-152.892) -- 0:00:53
719000 -- (-158.064) (-153.106) [-151.762] (-155.417) * (-145.074) (-156.826) (-171.324) [-139.930] -- 0:00:53
720000 -- (-143.852) (-154.910) [-144.971] (-157.255) * (-147.348) (-157.737) (-161.491) [-140.699] -- 0:00:53
Average standard deviation of split frequencies: 0.010849
721000 -- [-144.886] (-168.447) (-147.451) (-156.978) * (-149.019) [-144.699] (-164.009) (-150.796) -- 0:00:53
722000 -- [-144.417] (-146.881) (-149.610) (-156.859) * [-150.921] (-143.464) (-168.575) (-143.132) -- 0:00:53
723000 -- (-151.019) (-147.845) [-151.664] (-155.693) * (-152.177) [-143.159] (-159.355) (-161.193) -- 0:00:52
724000 -- (-146.569) (-152.393) [-145.428] (-165.258) * [-146.107] (-145.226) (-156.713) (-157.596) -- 0:00:52
725000 -- (-147.639) (-153.159) [-147.161] (-162.632) * [-146.347] (-143.880) (-155.176) (-162.371) -- 0:00:52
Average standard deviation of split frequencies: 0.011016
726000 -- (-150.377) (-157.954) [-146.636] (-155.945) * (-147.713) [-145.343] (-154.009) (-157.653) -- 0:00:52
727000 -- [-141.901] (-154.181) (-153.439) (-155.835) * (-151.772) [-150.786] (-155.712) (-156.786) -- 0:00:52
728000 -- (-144.057) [-141.028] (-162.758) (-157.350) * [-143.101] (-145.421) (-163.671) (-161.837) -- 0:00:51
729000 -- (-145.616) (-150.570) [-153.025] (-156.698) * (-142.299) [-140.731] (-161.264) (-155.599) -- 0:00:51
730000 -- (-144.648) (-162.000) [-149.153] (-157.839) * [-146.806] (-145.940) (-160.822) (-160.309) -- 0:00:51
Average standard deviation of split frequencies: 0.010879
731000 -- [-148.125] (-159.645) (-153.316) (-152.763) * (-143.205) [-144.742] (-159.382) (-159.361) -- 0:00:51
732000 -- [-149.047] (-142.414) (-146.614) (-157.982) * [-144.363] (-141.708) (-160.701) (-149.457) -- 0:00:51
733000 -- (-148.520) [-142.908] (-153.327) (-157.677) * [-142.662] (-144.199) (-155.968) (-161.789) -- 0:00:50
734000 -- (-146.632) (-142.071) [-149.135] (-158.593) * (-147.444) [-142.841] (-164.165) (-158.856) -- 0:00:50
735000 -- (-151.391) (-146.203) [-148.323] (-165.503) * (-141.299) [-148.531] (-146.482) (-168.873) -- 0:00:50
Average standard deviation of split frequencies: 0.010712
736000 -- [-144.927] (-149.193) (-150.431) (-158.359) * [-142.253] (-149.652) (-138.868) (-168.863) -- 0:00:50
737000 -- [-144.501] (-168.110) (-149.353) (-158.815) * (-161.353) (-144.038) [-146.637] (-170.095) -- 0:00:50
738000 -- (-145.343) (-162.319) [-140.814] (-157.975) * (-156.519) (-147.242) [-143.516] (-167.257) -- 0:00:50
739000 -- (-145.590) (-157.641) [-143.144] (-157.890) * (-159.604) (-147.814) [-141.521] (-162.644) -- 0:00:49
740000 -- [-145.774] (-160.813) (-145.530) (-164.599) * (-160.169) (-152.154) [-145.564] (-162.209) -- 0:00:49
Average standard deviation of split frequencies: 0.010864
741000 -- (-145.313) (-159.128) [-151.811] (-164.097) * (-154.830) [-140.255] (-154.856) (-168.947) -- 0:00:49
742000 -- [-145.232] (-155.766) (-147.305) (-158.528) * (-158.442) (-141.109) [-143.950] (-163.977) -- 0:00:49
743000 -- [-150.586] (-163.367) (-147.019) (-163.356) * (-164.740) (-146.413) [-148.867] (-164.033) -- 0:00:49
744000 -- (-146.221) (-158.254) [-145.873] (-164.324) * (-158.295) (-153.680) [-144.576] (-161.394) -- 0:00:48
745000 -- (-157.095) (-160.903) (-141.021) [-147.630] * (-160.902) [-147.196] (-147.504) (-158.517) -- 0:00:48
Average standard deviation of split frequencies: 0.010616
746000 -- (-157.586) (-158.668) [-147.431] (-150.122) * (-152.892) (-152.635) (-156.870) [-144.389] -- 0:00:48
747000 -- (-166.913) (-159.667) (-147.735) [-148.572] * (-156.356) (-155.959) (-160.826) [-146.491] -- 0:00:48
748000 -- (-180.099) (-155.343) [-148.910] (-146.036) * (-163.019) [-144.739] (-161.328) (-147.059) -- 0:00:48
749000 -- (-165.464) (-153.990) (-146.030) [-147.518] * (-156.989) (-143.585) (-157.506) [-143.190] -- 0:00:47
750000 -- (-167.274) (-158.171) (-146.373) [-146.806] * (-148.721) [-143.233] (-163.177) (-145.714) -- 0:00:47
Average standard deviation of split frequencies: 0.010257
751000 -- (-172.887) (-162.501) (-145.204) [-147.738] * (-150.643) [-145.143] (-159.024) (-146.415) -- 0:00:47
752000 -- (-172.611) (-160.054) (-148.163) [-146.006] * (-156.822) (-141.875) (-158.044) [-145.717] -- 0:00:47
753000 -- [-150.187] (-163.164) (-141.777) (-150.863) * [-145.279] (-144.889) (-156.646) (-144.610) -- 0:00:47
754000 -- (-151.051) (-155.263) [-145.250] (-153.136) * [-148.969] (-147.257) (-156.278) (-151.277) -- 0:00:46
755000 -- (-149.327) (-173.015) [-144.050] (-150.392) * [-140.550] (-152.433) (-160.865) (-150.908) -- 0:00:46
Average standard deviation of split frequencies: 0.010330
756000 -- [-146.867] (-169.161) (-167.025) (-147.075) * [-150.527] (-143.698) (-156.862) (-150.067) -- 0:00:46
757000 -- (-153.282) (-164.718) (-151.682) [-146.722] * (-148.947) [-142.708] (-162.214) (-150.185) -- 0:00:46
758000 -- (-166.089) (-163.453) (-148.915) [-148.318] * [-146.115] (-154.576) (-158.672) (-163.808) -- 0:00:46
759000 -- (-161.113) (-165.024) [-146.492] (-150.075) * [-147.296] (-144.027) (-167.090) (-166.236) -- 0:00:46
760000 -- [-143.119] (-162.766) (-151.145) (-149.335) * (-152.844) [-145.292] (-155.891) (-161.982) -- 0:00:45
Average standard deviation of split frequencies: 0.010407
761000 -- (-148.635) (-158.380) [-146.080] (-164.544) * [-146.241] (-146.527) (-158.903) (-158.007) -- 0:00:45
762000 -- [-140.983] (-163.654) (-144.202) (-171.439) * (-151.262) [-154.457] (-167.089) (-160.441) -- 0:00:45
763000 -- [-146.936] (-162.831) (-143.228) (-162.757) * (-148.269) [-148.632] (-161.619) (-154.420) -- 0:00:45
764000 -- [-150.989] (-164.894) (-150.275) (-158.479) * (-143.203) [-141.831] (-158.767) (-156.012) -- 0:00:45
765000 -- (-141.891) (-162.020) [-144.823] (-152.037) * (-150.045) [-145.979] (-158.601) (-154.324) -- 0:00:44
Average standard deviation of split frequencies: 0.010547
766000 -- [-148.815] (-167.306) (-151.452) (-158.888) * [-143.446] (-145.116) (-152.694) (-165.257) -- 0:00:44
767000 -- [-145.526] (-162.021) (-153.770) (-165.686) * (-142.918) [-145.960] (-160.607) (-159.661) -- 0:00:44
768000 -- [-149.334] (-159.079) (-144.502) (-156.656) * (-150.644) [-140.760] (-154.576) (-164.119) -- 0:00:44
769000 -- (-145.799) (-164.171) [-145.651] (-149.980) * (-147.195) [-149.707] (-152.737) (-165.128) -- 0:00:44
770000 -- [-145.928] (-158.749) (-146.693) (-147.420) * [-146.477] (-151.784) (-161.374) (-163.273) -- 0:00:43
Average standard deviation of split frequencies: 0.010504
771000 -- [-149.042] (-157.575) (-149.010) (-163.433) * [-148.735] (-144.972) (-160.027) (-158.668) -- 0:00:43
772000 -- [-145.915] (-165.551) (-147.028) (-165.010) * (-143.862) [-142.837] (-155.562) (-156.476) -- 0:00:43
773000 -- (-144.318) (-165.541) (-162.048) [-145.888] * (-148.557) [-144.682] (-159.024) (-154.005) -- 0:00:43
774000 -- [-142.147] (-158.062) (-166.991) (-148.677) * (-148.100) [-150.078] (-163.693) (-166.584) -- 0:00:43
775000 -- [-141.884] (-158.242) (-154.592) (-151.360) * [-148.791] (-151.572) (-161.228) (-153.306) -- 0:00:42
Average standard deviation of split frequencies: 0.010327
776000 -- [-147.128] (-162.004) (-157.366) (-148.442) * (-147.658) [-146.586] (-152.893) (-162.706) -- 0:00:42
777000 -- [-148.604] (-160.979) (-165.182) (-145.882) * (-147.500) [-142.723] (-154.011) (-157.378) -- 0:00:42
778000 -- (-151.124) (-154.838) (-165.121) [-143.147] * [-143.902] (-156.210) (-155.196) (-161.657) -- 0:00:42
779000 -- (-151.115) (-160.798) (-163.936) [-144.130] * (-150.440) [-146.187] (-153.097) (-160.529) -- 0:00:42
780000 -- (-157.565) (-157.100) (-156.999) [-144.121] * (-161.294) [-144.838] (-148.982) (-165.960) -- 0:00:42
Average standard deviation of split frequencies: 0.010057
781000 -- (-158.618) (-164.392) (-148.881) [-148.694] * (-158.014) (-149.373) [-145.127] (-147.234) -- 0:00:41
782000 -- (-152.895) (-159.731) [-143.644] (-144.191) * (-170.634) (-158.771) (-145.448) [-148.847] -- 0:00:41
783000 -- [-146.218] (-166.874) (-146.142) (-149.859) * (-157.716) (-142.417) [-148.963] (-160.366) -- 0:00:41
784000 -- [-143.765] (-156.658) (-146.276) (-144.999) * (-160.564) (-146.976) [-152.056] (-159.594) -- 0:00:41
785000 -- (-163.465) (-156.366) [-147.080] (-151.279) * (-158.102) [-142.823] (-148.393) (-160.631) -- 0:00:41
Average standard deviation of split frequencies: 0.010036
786000 -- [-147.860] (-163.647) (-145.688) (-151.223) * [-142.588] (-142.222) (-153.936) (-164.440) -- 0:00:40
787000 -- [-143.880] (-163.521) (-151.456) (-145.201) * (-156.695) [-143.748] (-149.560) (-160.016) -- 0:00:40
788000 -- (-143.392) (-165.594) (-150.799) [-144.082] * (-148.803) (-142.599) [-142.530] (-151.033) -- 0:00:40
789000 -- [-145.186] (-156.964) (-158.040) (-145.291) * (-157.875) (-152.129) [-143.652] (-171.433) -- 0:00:40
790000 -- (-148.794) (-160.701) (-160.346) [-142.609] * (-148.482) (-142.160) [-150.999] (-171.072) -- 0:00:40
Average standard deviation of split frequencies: 0.009937
791000 -- (-142.464) (-165.178) (-156.280) [-142.295] * (-161.025) [-141.767] (-155.556) (-165.669) -- 0:00:39
792000 -- (-146.072) (-157.458) (-157.732) [-146.429] * (-162.447) (-143.361) [-145.801] (-156.820) -- 0:00:39
793000 -- [-145.826] (-154.153) (-168.351) (-150.594) * (-162.625) [-150.972] (-148.408) (-158.371) -- 0:00:39
794000 -- (-144.872) (-166.602) (-159.455) [-147.851] * (-167.546) (-148.929) [-150.576] (-152.542) -- 0:00:39
795000 -- [-146.679] (-161.863) (-149.941) (-152.818) * (-157.983) (-145.729) [-148.527] (-146.284) -- 0:00:39
Average standard deviation of split frequencies: 0.009851
796000 -- [-146.265] (-161.961) (-151.675) (-155.490) * (-157.840) (-159.185) [-142.635] (-152.390) -- 0:00:38
797000 -- (-150.168) (-160.927) (-158.692) [-145.846] * (-168.693) [-143.910] (-152.700) (-150.946) -- 0:00:38
798000 -- [-145.289] (-173.147) (-160.215) (-140.231) * (-152.981) (-155.640) [-146.441] (-151.122) -- 0:00:38
799000 -- (-152.014) (-161.000) (-158.906) [-143.106] * (-162.228) (-147.919) (-153.990) [-149.475] -- 0:00:38
800000 -- [-142.409] (-167.354) (-163.571) (-144.409) * (-164.215) [-149.046] (-154.008) (-149.660) -- 0:00:38
Average standard deviation of split frequencies: 0.010245
801000 -- [-150.864] (-161.285) (-158.197) (-145.003) * (-165.523) [-138.449] (-159.436) (-145.562) -- 0:00:38
802000 -- (-145.535) (-170.934) (-153.953) [-145.824] * (-154.422) [-142.771] (-169.683) (-146.552) -- 0:00:37
803000 -- [-145.224] (-160.151) (-159.627) (-149.824) * (-150.188) (-146.670) (-164.800) [-153.551] -- 0:00:37
804000 -- [-145.050] (-161.299) (-160.548) (-145.697) * (-140.113) [-147.042] (-159.562) (-158.939) -- 0:00:37
805000 -- (-149.066) (-163.813) (-157.773) [-143.157] * (-147.773) [-145.312] (-164.635) (-161.109) -- 0:00:37
Average standard deviation of split frequencies: 0.010245
806000 -- (-149.488) (-171.107) (-161.767) [-150.997] * [-144.685] (-149.090) (-161.840) (-165.071) -- 0:00:37
807000 -- [-151.722] (-164.273) (-154.439) (-149.754) * (-146.163) [-143.498] (-152.701) (-149.994) -- 0:00:36
808000 -- (-142.284) (-164.296) (-152.454) [-142.280] * (-144.215) [-145.523] (-161.043) (-164.334) -- 0:00:36
809000 -- (-142.480) (-168.441) (-159.581) [-143.866] * (-142.240) (-153.300) (-159.668) [-144.092] -- 0:00:36
810000 -- [-142.335] (-156.968) (-155.830) (-148.293) * [-143.918] (-149.712) (-166.269) (-155.886) -- 0:00:36
Average standard deviation of split frequencies: 0.010242
811000 -- (-146.700) (-161.991) (-157.918) [-147.017] * [-147.660] (-149.808) (-156.840) (-148.413) -- 0:00:36
812000 -- [-144.509] (-168.470) (-162.652) (-151.008) * (-148.279) [-147.440] (-157.337) (-153.815) -- 0:00:35
813000 -- (-157.897) (-158.924) (-159.656) [-147.786] * [-151.156] (-144.821) (-155.472) (-150.507) -- 0:00:35
814000 -- (-153.779) (-164.915) (-166.747) [-144.219] * (-149.267) [-150.826] (-157.687) (-152.257) -- 0:00:35
815000 -- (-153.323) (-164.996) (-153.540) [-142.528] * [-154.146] (-146.500) (-158.705) (-158.086) -- 0:00:35
Average standard deviation of split frequencies: 0.010343
816000 -- (-149.393) (-158.808) (-154.768) [-146.431] * [-144.578] (-152.120) (-168.482) (-146.865) -- 0:00:35
817000 -- [-150.268] (-160.469) (-144.799) (-146.860) * (-155.435) (-146.331) (-162.382) [-146.384] -- 0:00:34
818000 -- [-147.519] (-168.436) (-157.309) (-147.949) * [-140.549] (-159.500) (-163.825) (-153.150) -- 0:00:34
819000 -- (-148.980) (-162.727) [-149.259] (-139.252) * [-145.950] (-152.595) (-169.636) (-144.308) -- 0:00:34
820000 -- [-142.790] (-168.114) (-162.900) (-144.124) * (-151.165) [-143.671] (-166.142) (-149.221) -- 0:00:34
Average standard deviation of split frequencies: 0.010493
821000 -- (-145.455) (-164.978) (-162.678) [-140.777] * (-146.132) (-141.234) (-157.591) [-139.143] -- 0:00:34
822000 -- [-144.118] (-150.556) (-157.580) (-145.193) * [-143.901] (-150.268) (-157.714) (-151.640) -- 0:00:33
823000 -- [-145.381] (-158.759) (-159.977) (-155.686) * (-147.387) [-146.345] (-157.126) (-165.133) -- 0:00:33
824000 -- [-144.800] (-156.531) (-163.415) (-143.698) * (-149.807) [-150.136] (-163.249) (-161.829) -- 0:00:33
825000 -- (-146.081) (-157.823) (-162.248) [-144.298] * [-141.642] (-145.846) (-157.309) (-154.276) -- 0:00:33
Average standard deviation of split frequencies: 0.010311
826000 -- (-149.647) (-154.278) (-158.036) [-145.819] * (-142.013) [-152.618] (-157.452) (-161.651) -- 0:00:33
827000 -- (-148.429) (-163.979) (-159.195) [-143.513] * [-141.879] (-156.257) (-166.235) (-159.791) -- 0:00:33
828000 -- (-151.301) (-159.846) (-154.721) [-141.122] * (-144.082) [-151.707] (-165.171) (-144.291) -- 0:00:32
829000 -- (-151.100) (-168.567) (-147.018) [-145.736] * (-158.638) (-149.331) (-162.467) [-143.117] -- 0:00:32
830000 -- (-143.659) (-159.016) (-156.623) [-143.591] * (-166.056) [-146.691] (-160.798) (-143.130) -- 0:00:32
Average standard deviation of split frequencies: 0.010920
831000 -- [-145.982] (-156.517) (-147.514) (-143.180) * (-159.360) (-145.206) (-154.604) [-144.635] -- 0:00:32
832000 -- (-148.821) (-151.892) [-141.343] (-144.971) * (-161.338) (-150.597) (-162.151) [-147.067] -- 0:00:32
833000 -- [-149.803] (-155.594) (-149.010) (-146.227) * (-158.771) [-147.587] (-158.940) (-142.547) -- 0:00:31
834000 -- [-140.181] (-158.455) (-145.852) (-147.904) * (-158.234) (-155.074) (-159.764) [-139.052] -- 0:00:31
835000 -- [-142.868] (-158.713) (-166.355) (-153.967) * (-157.456) [-144.764] (-164.572) (-145.296) -- 0:00:31
Average standard deviation of split frequencies: 0.011025
836000 -- [-147.752] (-157.875) (-163.576) (-146.077) * (-152.095) [-141.081] (-163.754) (-144.189) -- 0:00:31
837000 -- (-144.045) (-165.490) (-155.143) [-148.277] * (-166.648) [-152.940] (-162.483) (-148.201) -- 0:00:31
838000 -- [-139.684] (-156.946) (-157.831) (-144.856) * (-165.522) (-147.693) (-163.713) [-156.659] -- 0:00:30
839000 -- [-145.350] (-158.033) (-157.409) (-148.017) * (-159.211) [-144.848] (-161.695) (-149.641) -- 0:00:30
840000 -- (-153.190) (-154.410) (-167.975) [-146.578] * (-159.292) (-148.986) (-165.071) [-146.215] -- 0:00:30
Average standard deviation of split frequencies: 0.010674
841000 -- (-150.934) (-156.451) [-144.981] (-149.927) * (-159.446) (-145.361) (-161.048) [-143.615] -- 0:00:30
842000 -- [-144.745] (-163.133) (-154.806) (-141.539) * (-164.971) (-144.720) (-159.369) [-143.975] -- 0:00:30
843000 -- (-146.828) (-161.053) [-143.385] (-143.814) * (-158.827) [-151.681] (-167.154) (-156.779) -- 0:00:29
844000 -- [-149.544] (-149.020) (-149.761) (-160.843) * (-157.346) [-144.932] (-164.138) (-151.636) -- 0:00:29
845000 -- (-152.557) (-160.921) [-153.256] (-163.438) * (-166.191) [-144.237] (-157.546) (-149.101) -- 0:00:29
Average standard deviation of split frequencies: 0.010376
846000 -- (-147.987) (-148.046) [-146.517] (-165.906) * (-167.080) [-146.579] (-158.404) (-144.828) -- 0:00:29
847000 -- (-144.404) (-147.562) [-143.104] (-160.924) * (-166.985) (-153.968) (-163.752) [-139.023] -- 0:00:29
848000 -- (-142.319) (-154.960) [-151.522] (-162.430) * (-156.140) [-142.601] (-157.697) (-151.089) -- 0:00:29
849000 -- (-149.095) (-160.548) [-149.151] (-157.288) * (-158.222) [-142.109] (-155.508) (-142.480) -- 0:00:28
850000 -- (-150.113) (-165.512) [-147.172] (-160.403) * (-155.376) (-143.780) (-156.873) [-151.135] -- 0:00:28
Average standard deviation of split frequencies: 0.010414
851000 -- (-153.123) [-146.784] (-147.965) (-160.129) * (-155.471) [-145.116] (-156.403) (-144.884) -- 0:00:28
852000 -- (-155.450) (-163.396) [-150.358] (-156.096) * (-154.400) (-143.584) (-167.405) [-148.195] -- 0:00:28
853000 -- (-144.370) (-157.513) [-141.389] (-162.179) * (-158.284) (-146.118) (-157.047) [-145.585] -- 0:00:28
854000 -- (-141.119) (-155.906) [-142.514] (-158.360) * (-150.703) (-149.122) (-161.119) [-151.754] -- 0:00:27
855000 -- (-146.733) (-164.251) (-143.222) [-144.848] * (-160.895) [-145.350] (-154.996) (-148.617) -- 0:00:27
Average standard deviation of split frequencies: 0.010027
856000 -- (-158.265) (-163.511) [-143.262] (-148.838) * (-160.633) (-149.152) (-160.772) [-140.897] -- 0:00:27
857000 -- (-145.227) (-157.488) (-151.434) [-140.501] * (-155.742) (-153.350) (-165.283) [-144.920] -- 0:00:27
858000 -- (-140.845) (-158.945) [-147.473] (-154.438) * (-159.802) (-148.499) (-161.133) [-146.671] -- 0:00:27
859000 -- (-162.857) (-156.117) (-152.333) [-144.141] * [-148.918] (-142.196) (-163.585) (-147.575) -- 0:00:26
860000 -- [-143.041] (-157.899) (-150.936) (-147.285) * (-152.975) [-142.127] (-163.075) (-151.143) -- 0:00:26
Average standard deviation of split frequencies: 0.009859
861000 -- [-147.599] (-157.654) (-148.626) (-154.501) * [-150.341] (-151.603) (-154.596) (-150.408) -- 0:00:26
862000 -- (-146.919) (-160.418) [-146.150] (-162.995) * [-142.343] (-146.943) (-161.630) (-162.277) -- 0:00:26
863000 -- [-151.970] (-158.116) (-143.558) (-156.652) * [-141.614] (-142.891) (-164.139) (-164.042) -- 0:00:26
864000 -- [-143.468] (-168.784) (-144.650) (-163.059) * [-145.582] (-163.204) (-146.371) (-159.343) -- 0:00:25
865000 -- (-146.499) (-162.958) [-143.617] (-166.522) * [-141.735] (-158.076) (-150.976) (-165.491) -- 0:00:25
Average standard deviation of split frequencies: 0.010090
866000 -- [-147.302] (-159.660) (-143.403) (-162.692) * [-145.020] (-153.856) (-145.677) (-166.708) -- 0:00:25
867000 -- [-153.112] (-160.385) (-158.206) (-151.608) * [-149.788] (-162.972) (-155.235) (-165.413) -- 0:00:25
868000 -- (-149.640) (-161.091) [-147.906] (-157.938) * (-147.115) [-146.745] (-146.354) (-164.302) -- 0:00:25
869000 -- [-145.345] (-159.676) (-148.558) (-145.057) * (-149.220) [-138.134] (-140.704) (-166.936) -- 0:00:25
870000 -- (-145.911) (-158.547) (-156.449) [-146.456] * (-145.536) (-147.615) [-138.418] (-170.037) -- 0:00:24
Average standard deviation of split frequencies: 0.009958
871000 -- [-145.850] (-151.029) (-147.382) (-151.964) * [-149.611] (-147.395) (-144.669) (-164.860) -- 0:00:24
872000 -- [-143.532] (-163.985) (-147.493) (-157.800) * (-147.661) [-144.692] (-142.005) (-160.220) -- 0:00:24
873000 -- (-146.814) (-164.101) (-155.183) [-144.972] * (-166.211) [-145.688] (-140.836) (-155.949) -- 0:00:24
874000 -- (-147.217) (-163.303) (-157.899) [-148.690] * (-161.594) (-145.174) [-147.316] (-156.496) -- 0:00:24
875000 -- (-145.456) (-170.206) [-145.380] (-152.175) * (-161.218) [-152.165] (-145.623) (-160.477) -- 0:00:23
Average standard deviation of split frequencies: 0.009821
876000 -- (-144.804) (-165.669) (-143.460) [-140.916] * (-158.865) (-149.287) [-140.164] (-160.984) -- 0:00:23
877000 -- [-150.819] (-159.691) (-152.968) (-148.318) * (-161.276) [-154.467] (-152.022) (-161.721) -- 0:00:23
878000 -- (-153.407) (-162.211) (-144.497) [-152.776] * (-160.144) (-150.149) [-152.244] (-151.540) -- 0:00:23
879000 -- [-144.449] (-166.911) (-151.817) (-147.935) * (-167.534) [-144.381] (-148.313) (-153.575) -- 0:00:23
880000 -- (-144.985) (-161.422) [-143.785] (-159.544) * (-159.769) (-149.317) [-143.391] (-151.530) -- 0:00:22
Average standard deviation of split frequencies: 0.009672
881000 -- (-158.980) (-161.250) [-142.317] (-165.352) * (-158.479) (-160.850) [-145.824] (-152.694) -- 0:00:22
882000 -- [-140.796] (-163.687) (-145.942) (-160.793) * (-164.267) (-158.802) (-142.924) [-147.608] -- 0:00:22
883000 -- [-148.327] (-158.881) (-144.707) (-163.921) * (-164.173) (-165.102) (-151.394) [-145.863] -- 0:00:22
884000 -- (-144.644) (-166.347) [-145.469] (-157.929) * (-162.615) (-158.270) (-148.350) [-146.100] -- 0:00:22
885000 -- [-144.953] (-160.278) (-159.720) (-149.745) * (-160.135) (-151.060) [-140.627] (-144.286) -- 0:00:21
Average standard deviation of split frequencies: 0.009630
886000 -- (-146.976) (-156.973) (-153.043) [-143.745] * (-166.584) (-164.326) [-144.251] (-147.674) -- 0:00:21
887000 -- (-138.582) (-160.894) [-141.501] (-153.708) * (-166.799) (-161.206) (-140.470) [-146.847] -- 0:00:21
888000 -- (-140.650) (-161.317) [-145.869] (-147.541) * (-152.052) (-159.901) (-144.797) [-142.784] -- 0:00:21
889000 -- (-157.848) (-157.808) (-147.347) [-144.531] * (-144.431) (-161.469) [-145.975] (-158.090) -- 0:00:21
890000 -- (-164.669) (-153.471) [-152.841] (-147.910) * (-152.329) (-164.791) [-142.110] (-158.733) -- 0:00:21
Average standard deviation of split frequencies: 0.009756
891000 -- (-158.309) (-158.851) [-148.466] (-144.225) * (-140.537) (-158.339) [-145.114] (-151.161) -- 0:00:20
892000 -- (-151.564) (-157.854) (-143.988) [-148.972] * (-154.333) (-162.051) [-148.094] (-149.646) -- 0:00:20
893000 -- (-160.566) (-160.874) (-148.216) [-144.784] * (-150.831) (-154.861) (-144.483) [-140.660] -- 0:00:20
894000 -- (-153.106) (-164.396) (-156.904) [-147.495] * (-153.459) (-163.365) [-149.440] (-156.412) -- 0:00:20
895000 -- (-160.085) (-167.760) [-147.075] (-146.466) * (-149.627) (-161.490) [-145.972] (-163.476) -- 0:00:20
Average standard deviation of split frequencies: 0.010141
896000 -- (-158.116) (-161.803) (-147.076) [-144.038] * (-156.185) (-159.939) [-143.173] (-157.992) -- 0:00:19
897000 -- (-163.764) (-159.056) (-150.409) [-145.920] * (-152.045) (-159.473) [-146.586] (-161.826) -- 0:00:19
898000 -- (-161.600) (-157.413) [-144.868] (-146.717) * (-143.500) (-160.135) [-148.596] (-161.509) -- 0:00:19
899000 -- (-151.922) (-148.058) (-149.907) [-147.701] * [-144.558] (-155.014) (-145.479) (-159.781) -- 0:00:19
900000 -- (-157.299) [-145.554] (-149.690) (-153.986) * [-145.255] (-154.478) (-146.222) (-162.697) -- 0:00:19
Average standard deviation of split frequencies: 0.010057
901000 -- (-163.471) (-144.651) [-145.015] (-151.814) * (-149.454) (-153.438) [-142.286] (-163.008) -- 0:00:18
902000 -- (-157.084) (-159.251) (-144.037) [-145.983] * (-146.583) (-147.115) [-143.812] (-170.254) -- 0:00:18
903000 -- (-155.108) (-150.339) (-151.500) [-145.052] * [-143.547] (-169.869) (-152.171) (-160.839) -- 0:00:18
904000 -- (-161.285) (-149.691) [-143.518] (-147.488) * (-150.905) (-156.003) [-144.068] (-158.239) -- 0:00:18
905000 -- (-156.317) (-150.615) (-144.432) [-158.599] * [-147.125] (-154.658) (-143.962) (-166.057) -- 0:00:18
Average standard deviation of split frequencies: 0.009960
906000 -- (-156.780) (-149.322) (-148.243) [-146.108] * (-145.342) [-142.587] (-151.134) (-158.566) -- 0:00:17
907000 -- (-162.405) (-151.160) [-143.427] (-141.872) * [-145.267] (-148.980) (-146.578) (-164.400) -- 0:00:17
908000 -- (-157.805) (-158.954) (-150.469) [-142.324] * [-147.498] (-150.990) (-151.132) (-152.300) -- 0:00:17
909000 -- (-159.034) (-152.384) [-147.564] (-148.414) * (-143.998) (-144.211) [-140.004] (-162.770) -- 0:00:17
910000 -- (-155.234) (-159.110) [-147.344] (-147.915) * [-140.519] (-154.049) (-153.561) (-156.634) -- 0:00:17
Average standard deviation of split frequencies: 0.010261
911000 -- [-148.000] (-157.709) (-148.890) (-158.646) * (-147.985) [-143.060] (-144.566) (-162.023) -- 0:00:16
912000 -- (-149.970) (-173.188) (-143.840) [-141.470] * (-143.631) (-152.601) [-144.081] (-157.781) -- 0:00:16
913000 -- [-143.235] (-159.373) (-145.956) (-144.839) * (-159.181) (-145.732) [-149.460] (-152.450) -- 0:00:16
914000 -- [-139.627] (-162.205) (-146.141) (-163.223) * (-153.772) (-150.796) [-145.663] (-168.517) -- 0:00:16
915000 -- [-144.572] (-165.137) (-147.856) (-162.030) * (-152.257) (-139.377) [-154.138] (-139.248) -- 0:00:16
Average standard deviation of split frequencies: 0.010752
916000 -- (-146.348) [-145.085] (-147.569) (-158.387) * (-162.341) [-142.005] (-142.114) (-148.849) -- 0:00:16
917000 -- [-144.973] (-145.406) (-150.842) (-171.332) * (-165.297) (-158.525) [-142.242] (-152.090) -- 0:00:15
918000 -- [-146.327] (-145.765) (-165.760) (-162.722) * (-165.856) (-153.267) [-139.378] (-143.082) -- 0:00:15
919000 -- [-147.837] (-147.888) (-160.635) (-167.782) * (-158.155) (-157.198) [-150.494] (-151.438) -- 0:00:15
920000 -- [-142.330] (-151.084) (-161.991) (-165.651) * (-157.656) (-158.077) (-145.241) [-147.216] -- 0:00:15
Average standard deviation of split frequencies: 0.010716
921000 -- (-141.882) [-147.324] (-156.480) (-162.413) * (-162.780) (-159.283) (-145.037) [-142.908] -- 0:00:15
922000 -- (-148.831) [-153.662] (-157.919) (-169.569) * (-154.732) (-147.556) (-146.745) [-146.385] -- 0:00:14
923000 -- (-151.163) [-147.751] (-158.213) (-160.212) * (-158.345) [-143.621] (-151.641) (-152.622) -- 0:00:14
924000 -- [-147.750] (-146.547) (-159.136) (-165.421) * (-158.838) (-142.918) (-147.896) [-144.057] -- 0:00:14
925000 -- [-147.157] (-145.862) (-174.901) (-150.718) * (-158.794) (-142.693) (-140.083) [-148.844] -- 0:00:14
Average standard deviation of split frequencies: 0.010527
926000 -- (-144.464) (-151.259) (-162.624) [-145.284] * (-169.357) [-151.098] (-149.112) (-158.726) -- 0:00:14
927000 -- (-146.180) (-175.782) (-163.282) [-147.747] * (-161.841) (-150.864) [-151.122] (-164.956) -- 0:00:13
928000 -- [-148.708] (-161.927) (-157.587) (-147.564) * (-160.378) (-145.291) (-151.631) [-142.693] -- 0:00:13
929000 -- [-144.832] (-159.574) (-142.272) (-158.307) * (-155.833) (-145.952) (-150.409) [-145.662] -- 0:00:13
930000 -- [-145.358] (-156.726) (-148.844) (-144.023) * (-157.105) (-160.694) (-144.672) [-146.210] -- 0:00:13
Average standard deviation of split frequencies: 0.010673
931000 -- [-146.547] (-161.473) (-143.692) (-148.370) * (-162.924) [-151.532] (-162.404) (-143.732) -- 0:00:13
932000 -- (-157.167) (-163.888) [-141.097] (-142.647) * (-155.813) [-149.990] (-147.917) (-136.638) -- 0:00:12
933000 -- (-148.239) (-162.763) [-148.772] (-153.111) * (-158.066) [-151.346] (-148.453) (-150.115) -- 0:00:12
934000 -- (-143.922) (-161.483) (-146.014) [-151.797] * (-171.025) (-148.016) (-149.118) [-145.603] -- 0:00:12
935000 -- (-146.269) (-159.452) [-149.273] (-155.755) * (-167.317) (-144.909) (-147.166) [-146.241] -- 0:00:12
Average standard deviation of split frequencies: 0.010918
936000 -- [-143.973] (-158.610) (-143.625) (-154.332) * (-165.084) (-148.674) [-144.955] (-151.098) -- 0:00:12
937000 -- (-165.907) (-158.027) (-147.335) [-145.556] * (-159.027) (-142.744) (-148.139) [-147.116] -- 0:00:12
938000 -- (-149.810) (-168.692) (-148.038) [-150.663] * (-166.029) (-152.303) (-169.090) [-145.524] -- 0:00:11
939000 -- (-142.381) (-158.856) (-151.593) [-148.058] * (-159.688) (-147.097) (-160.711) [-145.966] -- 0:00:11
940000 -- [-143.046] (-160.787) (-150.758) (-157.601) * (-167.963) [-148.851] (-165.831) (-147.024) -- 0:00:11
Average standard deviation of split frequencies: 0.010739
941000 -- [-144.204] (-158.610) (-143.095) (-150.051) * (-155.832) (-149.598) (-169.788) [-145.969] -- 0:00:11
942000 -- [-149.144] (-155.011) (-150.163) (-147.334) * (-162.317) [-140.573] (-161.917) (-145.875) -- 0:00:11
943000 -- [-141.827] (-152.598) (-152.822) (-147.607) * (-151.702) [-151.631] (-155.031) (-147.403) -- 0:00:10
944000 -- (-149.393) (-165.971) (-149.648) [-142.042] * (-161.012) [-150.013] (-157.767) (-149.020) -- 0:00:10
945000 -- (-148.013) (-161.134) (-145.317) [-145.870] * (-159.909) [-146.742] (-159.224) (-151.865) -- 0:00:10
Average standard deviation of split frequencies: 0.010821
946000 -- (-153.605) (-162.652) (-156.253) [-141.230] * (-155.556) [-142.193] (-159.472) (-148.568) -- 0:00:10
947000 -- (-144.779) (-159.386) (-148.326) [-144.533] * (-165.006) [-151.426] (-156.673) (-158.505) -- 0:00:10
948000 -- (-146.596) (-159.642) (-148.799) [-147.437] * (-158.386) (-143.328) (-155.325) [-154.644] -- 0:00:09
949000 -- (-145.508) (-154.852) (-145.377) [-145.208] * (-161.517) (-145.910) (-162.518) [-151.418] -- 0:00:09
950000 -- [-136.994] (-157.347) (-148.875) (-153.203) * (-145.954) [-152.211] (-161.794) (-152.630) -- 0:00:09
Average standard deviation of split frequencies: 0.011015
951000 -- [-147.657] (-154.843) (-140.382) (-154.292) * [-149.150] (-149.622) (-160.406) (-165.444) -- 0:00:09
952000 -- [-146.115] (-159.814) (-145.879) (-147.647) * [-151.070] (-142.726) (-154.978) (-155.965) -- 0:00:09
953000 -- (-145.176) (-158.207) (-153.083) [-147.462] * [-151.312] (-144.171) (-154.945) (-156.037) -- 0:00:08
954000 -- (-148.526) (-156.034) (-149.845) [-143.560] * [-146.885] (-150.502) (-161.417) (-149.739) -- 0:00:08
955000 -- [-146.866] (-156.379) (-159.727) (-148.869) * [-145.077] (-158.121) (-140.680) (-160.058) -- 0:00:08
Average standard deviation of split frequencies: 0.010989
956000 -- (-144.321) (-157.299) (-158.575) [-147.348] * [-151.269] (-151.945) (-143.108) (-161.338) -- 0:00:08
957000 -- [-143.080] (-164.389) (-153.798) (-149.123) * (-152.136) (-149.200) [-147.099] (-165.852) -- 0:00:08
958000 -- (-142.983) (-169.003) (-150.318) [-143.714] * (-147.046) [-149.621] (-151.947) (-172.321) -- 0:00:08
959000 -- [-148.122] (-163.610) (-157.887) (-150.665) * [-147.087] (-149.125) (-152.744) (-162.446) -- 0:00:07
960000 -- [-141.355] (-153.028) (-162.069) (-147.977) * (-164.900) (-148.212) [-143.681] (-154.452) -- 0:00:07
Average standard deviation of split frequencies: 0.010813
961000 -- [-142.412] (-160.155) (-164.867) (-150.365) * (-158.938) (-151.162) [-142.291] (-156.637) -- 0:00:07
962000 -- (-149.859) (-160.573) [-144.460] (-164.264) * (-161.258) (-138.119) [-150.966] (-153.714) -- 0:00:07
963000 -- (-152.795) (-161.301) [-149.654] (-157.250) * (-167.028) [-144.759] (-145.230) (-146.085) -- 0:00:07
964000 -- (-145.040) (-151.881) (-161.351) [-147.813] * (-155.538) [-155.951] (-148.969) (-159.992) -- 0:00:06
965000 -- [-145.057] (-166.456) (-157.668) (-149.451) * (-154.436) [-144.080] (-144.516) (-160.322) -- 0:00:06
Average standard deviation of split frequencies: 0.010871
966000 -- (-148.084) (-163.649) (-152.768) [-145.953] * (-161.822) [-138.749] (-154.027) (-156.564) -- 0:00:06
967000 -- [-147.364] (-164.596) (-153.336) (-154.243) * (-152.179) (-144.350) [-145.750] (-157.885) -- 0:00:06
968000 -- (-143.493) (-161.439) (-143.953) [-145.883] * (-150.249) (-152.233) [-144.355] (-157.661) -- 0:00:06
969000 -- (-145.855) (-157.558) [-153.310] (-146.768) * (-151.320) (-141.430) [-151.376] (-158.726) -- 0:00:05
970000 -- [-150.237] (-157.531) (-141.198) (-153.203) * (-161.555) (-143.757) [-156.462] (-161.555) -- 0:00:05
Average standard deviation of split frequencies: 0.010601
971000 -- (-150.086) (-159.317) [-149.745] (-159.973) * (-157.479) [-146.684] (-148.255) (-161.033) -- 0:00:05
972000 -- (-157.216) (-161.512) [-144.417] (-153.593) * (-157.111) (-148.909) [-144.982] (-157.863) -- 0:00:05
973000 -- (-146.385) (-156.552) [-149.148] (-142.946) * (-158.603) [-146.403] (-143.589) (-160.637) -- 0:00:05
974000 -- (-163.320) (-159.533) (-148.888) [-149.644] * (-154.400) (-149.447) [-145.031] (-159.668) -- 0:00:04
975000 -- (-167.466) (-169.300) [-148.004] (-146.977) * (-161.667) (-146.040) [-148.172] (-152.454) -- 0:00:04
Average standard deviation of split frequencies: 0.010298
976000 -- [-154.218] (-166.754) (-153.417) (-165.901) * (-155.416) [-147.367] (-146.720) (-161.329) -- 0:00:04
977000 -- (-153.911) (-160.330) (-141.247) [-146.469] * (-158.965) [-141.378] (-152.575) (-154.414) -- 0:00:04
978000 -- [-146.780] (-157.479) (-149.572) (-146.310) * (-161.565) (-142.229) [-147.084] (-164.204) -- 0:00:04
979000 -- (-145.900) (-155.702) [-139.560] (-143.242) * (-160.382) (-145.586) [-146.056] (-165.998) -- 0:00:04
980000 -- (-145.759) (-163.600) [-150.521] (-148.743) * (-156.394) (-146.332) [-146.529] (-170.277) -- 0:00:03
Average standard deviation of split frequencies: 0.010438
981000 -- [-143.683] (-155.922) (-144.674) (-154.786) * (-162.428) (-148.785) [-148.510] (-161.132) -- 0:00:03
982000 -- [-147.988] (-156.664) (-147.874) (-153.521) * (-154.394) (-148.395) [-144.048] (-157.863) -- 0:00:03
983000 -- [-146.098] (-166.976) (-149.997) (-146.944) * (-161.190) [-141.377] (-149.965) (-172.014) -- 0:00:03
984000 -- (-149.265) (-160.389) (-154.103) [-140.657] * (-151.007) (-148.474) [-140.756] (-153.776) -- 0:00:03
985000 -- [-143.344] (-152.352) (-155.372) (-148.503) * (-148.550) (-145.642) [-141.060] (-155.613) -- 0:00:02
Average standard deviation of split frequencies: 0.010057
986000 -- (-147.240) (-158.910) (-161.557) [-141.846] * [-148.437] (-146.817) (-143.902) (-158.655) -- 0:00:02
987000 -- (-154.987) (-156.520) (-167.808) [-148.990] * (-152.735) (-144.574) [-145.086] (-160.638) -- 0:00:02
988000 -- [-148.411] (-159.566) (-160.362) (-145.903) * (-150.015) [-141.043] (-152.016) (-158.303) -- 0:00:02
989000 -- [-147.351] (-168.539) (-168.486) (-147.842) * (-148.934) (-152.104) [-147.205] (-160.816) -- 0:00:02
990000 -- [-144.096] (-162.393) (-160.173) (-145.331) * (-155.892) (-151.227) [-145.585] (-166.491) -- 0:00:01
Average standard deviation of split frequencies: 0.010112
991000 -- [-151.588] (-168.787) (-154.405) (-141.823) * (-159.758) [-148.830] (-141.576) (-162.261) -- 0:00:01
992000 -- [-146.127] (-174.988) (-166.341) (-149.514) * (-163.703) (-143.582) [-146.400] (-166.627) -- 0:00:01
993000 -- (-154.117) (-168.133) (-161.886) [-145.920] * (-160.796) (-149.502) [-144.342] (-164.417) -- 0:00:01
994000 -- (-150.355) (-170.494) (-160.475) [-141.848] * (-154.945) [-143.791] (-145.938) (-156.075) -- 0:00:01
995000 -- [-148.358] (-157.748) (-166.310) (-149.084) * (-153.177) [-139.515] (-143.976) (-156.782) -- 0:00:00
Average standard deviation of split frequencies: 0.010151
996000 -- [-146.826] (-162.902) (-158.285) (-153.144) * (-158.747) [-151.343] (-149.480) (-163.832) -- 0:00:00
997000 -- [-143.260] (-167.770) (-160.838) (-155.945) * (-154.121) [-145.640] (-148.719) (-158.124) -- 0:00:00
998000 -- [-142.396] (-166.361) (-166.154) (-148.450) * (-157.317) [-143.862] (-144.401) (-161.219) -- 0:00:00
999000 -- [-145.958] (-174.506) (-157.816) (-145.467) * (-161.271) (-159.880) [-143.704] (-154.675) -- 0:00:00
1000000 -- (-151.753) (-164.635) (-161.159) [-147.673] * (-162.045) [-144.054] (-150.577) (-161.490) -- 0:00:00
Average standard deviation of split frequencies: 0.010162
Analysis completed in 3 mins 11 seconds
Analysis used 191.15 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -135.40
Likelihood of best state for "cold" chain of run 2 was -135.43
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
70.3 % ( 68 %) Dirichlet(Revmat{all})
89.2 % ( 82 %) Slider(Revmat{all})
66.9 % ( 62 %) Dirichlet(Pi{all})
64.1 % ( 51 %) Slider(Pi{all})
79.8 % ( 58 %) Multiplier(Alpha{1,2})
71.9 % ( 35 %) Multiplier(Alpha{3})
90.1 % ( 84 %) Slider(Pinvar{all})
65.6 % ( 72 %) ExtSPR(Tau{all},V{all})
47.6 % ( 48 %) ExtTBR(Tau{all},V{all})
66.7 % ( 62 %) NNI(Tau{all},V{all})
55.0 % ( 71 %) ParsSPR(Tau{all},V{all})
27.7 % ( 24 %) Multiplier(V{all})
78.3 % ( 80 %) Nodeslider(V{all})
30.1 % ( 23 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
69.7 % ( 56 %) Dirichlet(Revmat{all})
89.4 % ( 81 %) Slider(Revmat{all})
66.6 % ( 59 %) Dirichlet(Pi{all})
63.3 % ( 56 %) Slider(Pi{all})
80.1 % ( 52 %) Multiplier(Alpha{1,2})
71.8 % ( 45 %) Multiplier(Alpha{3})
90.5 % ( 74 %) Slider(Pinvar{all})
65.3 % ( 72 %) ExtSPR(Tau{all},V{all})
47.4 % ( 37 %) ExtTBR(Tau{all},V{all})
66.4 % ( 65 %) NNI(Tau{all},V{all})
54.4 % ( 55 %) ParsSPR(Tau{all},V{all})
27.7 % ( 32 %) Multiplier(V{all})
78.5 % ( 82 %) Nodeslider(V{all})
29.9 % ( 24 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.55 0.10 0.00
2 | 166865 0.25 0.01
3 | 167553 165502 0.27
4 | 167173 166712 166195
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.55 0.09 0.00
2 | 166611 0.22 0.00
3 | 166344 166641 0.30
4 | 166805 167007 166592
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/mrbayes_input.nex.run1.p and /data/mrbayes_input.nex.run2.p
Writing summary statistics to file /data/mrbayes_input.nex.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -143.87
| 2 2 2 |
| 1 * 1 1 |
|1 2 2 *1 |
| 22 1 121 1 2 11 21 * |
| 1 2 2 1 1 2 12 2 |
|2 2 *221111 1 1 *2 11 121 1 *|
| 2 1 2 2 1 2 2 1 2 2 221 2 2 2 |
| 2 1 2 1 11 1 12 1 1 |
| 1 11 1 2 2 2 11 1 2 2 1 1 |
| 1 2 22 1 2 2 1 2 |
| 1 2 2 2 1 22 1 |
| 2 |
| |
| |
| 2 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -148.37
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -141.73 -152.56
2 -141.72 -154.91
--------------------------------------
TOTAL -141.73 -154.31
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.324707 0.022122 0.110791 0.607763 0.297195 1271.40 1386.20 1.000
r(A<->C){all} 0.063787 0.003933 0.000012 0.192315 0.044259 284.09 289.43 1.005
r(A<->G){all} 0.342964 0.017076 0.093315 0.591816 0.339198 93.45 133.24 1.010
r(A<->T){all} 0.077452 0.004119 0.000008 0.208162 0.062552 204.26 224.26 1.000
r(C<->G){all} 0.064250 0.003871 0.000002 0.184231 0.045722 194.15 214.29 1.000
r(C<->T){all} 0.352910 0.015936 0.117457 0.594664 0.345420 113.65 139.43 1.015
r(G<->T){all} 0.098637 0.004746 0.000317 0.234816 0.083536 183.80 253.12 1.010
pi(A){all} 0.241663 0.002641 0.144656 0.346215 0.239310 669.24 749.83 1.000
pi(C){all} 0.196624 0.002295 0.103435 0.284129 0.194183 645.99 762.79 1.004
pi(G){all} 0.276434 0.002825 0.182206 0.386350 0.274207 872.33 893.15 1.001
pi(T){all} 0.285279 0.003089 0.180605 0.394718 0.283671 821.25 855.12 1.001
alpha{1,2} 0.582281 0.528540 0.000224 1.982054 0.327552 780.91 827.42 1.001
alpha{3} 1.509678 1.261131 0.001708 3.829231 1.216155 1136.70 1168.23 1.000
pinvar{all} 0.325199 0.038307 0.001402 0.665188 0.312099 593.74 659.56 1.002
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/mrbayes_input.nex.run1.t" and "/data/mrbayes_input.nex.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/mrbayes_input.nex.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/mrbayes_input.nex.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a parameter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C10
3 -- C11
4 -- C2
5 -- C3
6 -- C4
7 -- C5
8 -- C6
9 -- C7
10 -- C8
11 -- C9
Key to taxon bipartitions (saved to file "/data/mrbayes_input.nex.parts"):
ID -- Partition
-----------------
1 -- .**********
2 -- .*.........
3 -- ..*........
4 -- ...*.......
5 -- ....*......
6 -- .....*.....
7 -- ......*....
8 -- .......*...
9 -- ........*..
10 -- .........*.
11 -- ..........*
12 -- .**.*....**
13 -- .**.*...***
14 -- .**......**
15 -- .**.*.*.***
16 -- ..*......*.
17 -- .........**
18 -- .*........*
19 -- ..*.......*
20 -- ..*......**
21 -- .*.......*.
22 -- .**........
23 -- .*.......**
24 -- .**.......*
25 -- .**......*.
26 -- .....*.*...
27 -- ...*...*...
28 -- .**.*.*..**
29 -- .******.***
30 -- .****.*****
31 -- .**.*******
32 -- ...*.*.....
33 -- .....**....
34 -- ...*.*.*...
35 -- .*****.****
36 -- .**.***.***
37 -- .****.*.***
38 -- ...*..*....
39 -- .****...***
-----------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/mrbayes_input.nex.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
12 2826 0.941372 0.001884 0.940040 0.942705 2
13 2252 0.750167 0.041456 0.720853 0.779480 2
14 2109 0.702532 0.015546 0.691539 0.713524 2
15 759 0.252831 0.016488 0.241173 0.264490 2
16 563 0.187542 0.005182 0.183877 0.191206 2
17 558 0.185876 0.003769 0.183211 0.188541 2
18 552 0.183877 0.013191 0.174550 0.193205 2
19 529 0.176216 0.020257 0.161892 0.190540 2
20 515 0.171552 0.012719 0.162558 0.180546 2
21 511 0.170220 0.003298 0.167888 0.172552 2
22 499 0.166223 0.001413 0.165223 0.167222 2
23 489 0.162891 0.024968 0.145237 0.180546 2
24 480 0.159893 0.009422 0.153231 0.166556 2
25 473 0.157562 0.005182 0.153897 0.161226 2
26 465 0.154897 0.000471 0.154564 0.155230 2
27 456 0.151899 0.008480 0.145903 0.157895 2
28 444 0.147901 0.031092 0.125916 0.169887 2
29 436 0.145237 0.001884 0.143904 0.146569 2
30 429 0.142905 0.020257 0.128581 0.157229 2
31 412 0.137242 0.001884 0.135909 0.138574 2
32 407 0.135576 0.004240 0.132578 0.138574 2
33 333 0.110926 0.008009 0.105263 0.116589 2
34 321 0.106929 0.005182 0.103264 0.110593 2
35 317 0.105596 0.005182 0.101932 0.109260 2
36 317 0.105596 0.000471 0.105263 0.105929 2
37 307 0.102265 0.002355 0.100600 0.103931 2
38 302 0.100600 0.009422 0.093937 0.107262 2
39 287 0.095603 0.010835 0.087941 0.103264 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/mrbayes_input.nex.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.009672 0.000117 0.000003 0.029853 0.006302 1.000 2
length{all}[2] 0.019693 0.000287 0.000178 0.050626 0.015209 1.000 2
length{all}[3] 0.009825 0.000136 0.000003 0.033334 0.006082 1.000 2
length{all}[4] 0.009939 0.000151 0.000001 0.031834 0.006260 1.000 2
length{all}[5] 0.013308 0.000219 0.000001 0.041013 0.008511 1.002 2
length{all}[6] 0.009615 0.000120 0.000002 0.030150 0.006178 1.000 2
length{all}[7] 0.016057 0.000238 0.000006 0.046483 0.011711 1.000 2
length{all}[8] 0.009951 0.000144 0.000006 0.031416 0.006211 1.000 2
length{all}[9] 0.059867 0.001810 0.006245 0.141516 0.050244 1.000 2
length{all}[10] 0.010025 0.000130 0.000002 0.031561 0.006249 1.000 2
length{all}[11] 0.010221 0.000136 0.000001 0.032512 0.006494 1.000 2
length{all}[12] 0.046757 0.001300 0.000732 0.111639 0.038684 1.001 2
length{all}[13] 0.040289 0.001087 0.000066 0.099415 0.031263 1.000 2
length{all}[14] 0.018618 0.000254 0.000083 0.048223 0.014314 1.000 2
length{all}[15] 0.014817 0.000192 0.000094 0.041672 0.010809 1.000 2
length{all}[16] 0.009599 0.000114 0.000006 0.031760 0.006010 1.001 2
length{all}[17] 0.010794 0.000143 0.000007 0.033469 0.006633 0.998 2
length{all}[18] 0.010099 0.000136 0.000002 0.031950 0.006358 0.998 2
length{all}[19] 0.010378 0.000174 0.000011 0.030370 0.006563 1.001 2
length{all}[20] 0.010443 0.000146 0.000002 0.033114 0.006780 1.000 2
length{all}[21] 0.010387 0.000161 0.000001 0.029991 0.006726 0.999 2
length{all}[22] 0.009777 0.000157 0.000029 0.032244 0.005628 0.998 2
length{all}[23] 0.010323 0.000145 0.000015 0.032873 0.006778 1.011 2
length{all}[24] 0.009575 0.000118 0.000019 0.028956 0.006087 0.998 2
length{all}[25] 0.009079 0.000104 0.000006 0.027306 0.006141 0.998 2
length{all}[26] 0.009971 0.000175 0.000024 0.034186 0.005900 0.998 2
length{all}[27] 0.009591 0.000150 0.000034 0.031827 0.005762 0.999 2
length{all}[28] 0.019543 0.000293 0.000518 0.051998 0.014981 0.999 2
length{all}[29] 0.009547 0.000101 0.000012 0.029999 0.006766 0.998 2
length{all}[30] 0.009587 0.000149 0.000010 0.028429 0.005756 0.998 2
length{all}[31] 0.009441 0.000107 0.000010 0.027398 0.006265 1.000 2
length{all}[32] 0.009077 0.000107 0.000000 0.026729 0.005989 1.002 2
length{all}[33] 0.009253 0.000088 0.000010 0.027056 0.006064 0.997 2
length{all}[34] 0.009415 0.000105 0.000022 0.030528 0.005765 0.997 2
length{all}[35] 0.009294 0.000115 0.000004 0.035368 0.005483 1.004 2
length{all}[36] 0.010509 0.000139 0.000000 0.032295 0.007331 0.997 2
length{all}[37] 0.010809 0.000163 0.000027 0.031418 0.006337 0.998 2
length{all}[38] 0.010443 0.000135 0.000021 0.031024 0.007085 1.015 2
length{all}[39] 0.009801 0.000154 0.000012 0.030284 0.005846 1.000 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.010162
Maximum standard deviation of split frequencies = 0.041456
Average PSRF for parameter values (excluding NA and >10.0) = 1.000
Maximum PSRF for parameter values = 1.015
Clade credibility values:
/----------------------------------------------------------------------- C1 (1)
|
|----------------------------------------------------------------------- C2 (4)
|
|----------------------------------------------------------------------- C4 (6)
|
|----------------------------------------------------------------------- C5 (7)
|
|----------------------------------------------------------------------- C6 (8)
+
| /------------------ C10 (2)
| |
| |------------------ C11 (3)
| /-------70-------+
| | |------------------ C8 (10)
| | |
| /--------94-------+ \------------------ C9 (11)
| | |
\--------75-------+ \----------------------------------- C3 (5)
|
\----------------------------------------------------- C7 (9)
Phylogram (based on average branch lengths):
/---- C1 (1)
|
|---- C2 (4)
|
|---- C4 (6)
|
|-------- C5 (7)
|
|---- C6 (8)
+
| /----------- C10 (2)
| |
| |---- C11 (3)
| /---------+
| | |----- C8 (10)
| | |
| /---------------------------+ \----- C9 (11)
| | |
\---------------------+ \------ C3 (5)
|
\------------------------------------ C7 (9)
|-------------| 0.020 expected changes per site
Calculating tree probabilities...
Credible sets of trees (2370 trees sampled):
50 % credible set contains 869 trees
90 % credible set contains 2070 trees
95 % credible set contains 2220 trees
99 % credible set contains 2340 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
-- Starting log on Wed Nov 09 22:46:01 GMT 2022 --
-- Iteration: /working_dir/input/2_modified/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result--
CLUSTAL FORMAT for T-COFFEE Version_12.00.7fb08c2 [http://www.tcoffee.org] [MODE: ], CPU=0.06 sec, SCORE=1000, Nseq=11, Len=19
C1 GTTIDQSYLNECGVLVQLD
C2 GTTIDQSYLNECGVLVQLD
C3 SSTVDQSYLNECGVLVQLD
C4 GTTIDQSYLNECGVLVQLD
C5 STTIDQSYLNECGVLVQLD
C6 GTTIDQSYLNECGVLVQLD
C7 GATMDQSYLNECGVLVQLD
C8 SSTVDQSYLNECGVLVQLD
C9 SSTVDQSYLNECGVLVQLD
C10 SFTVDQSYLNECGVLVQLD
C11 SSTVDQSYLNECGVLVQLD
. *:***************
-- Starting log on Thu Nov 10 16:37:11 GMT 2022 --
-- Iteration: /working_dir/pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/codeml,A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1--
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 1 2 7 8
processing fasta file
reading seq# 1 C1 57 sites
reading seq# 2 C2 57 sites
reading seq# 3 C3 57 sites
reading seq# 4 C4 57 sites
reading seq# 5 C5 57 sites
reading seq# 6 C6 57 sites
reading seq# 7 C7 57 sites
reading seq# 8 C8 57 sites
reading seq# 9 C9 57 sites
reading seq#10 C10 57 sites
reading seq#11 C11 57 sitesns = 11 ls = 57
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Reading seq # 7: C7
Reading seq # 8: C8
Reading seq # 9: C9
Reading seq #10: C10
Reading seq #11: C11
Sequences read..
Counting site patterns.. 0:00
Compressing, 19 patterns at 19 / 19 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 19 patterns at 19 / 19 sites (100.0%), 0:00
Counting codons..
440 bytes for distance
18544 bytes for conP
1672 bytes for fhK
5000000 bytes for space
Model 1: NearlyNeutral
TREE # 1
(1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
37088 bytes for conP, adjusted
0.051169 0.024288 0.064713 0.096772 0.072207 0.083797 0.020247 0.026107 0.087257 0.097839 0.075438 0.029244 0.099667 0.106837 0.300000 0.746040 0.312474
ntime & nrate & np: 14 2 17
Bounds (np=17):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 13.279409
np = 17
lnL0 = -157.496213
Iterating by ming2
Initial: fx= 157.496213
x= 0.05117 0.02429 0.06471 0.09677 0.07221 0.08380 0.02025 0.02611 0.08726 0.09784 0.07544 0.02924 0.09967 0.10684 0.30000 0.74604 0.31247
1 h-m-p 0.0000 0.0014 108.0654 ++++ 149.671595 m 0.0014 24 | 1/17
2 h-m-p 0.0000 0.0002 71.8253 ++ 148.922703 m 0.0002 44 | 2/17
3 h-m-p 0.0000 0.0001 681.1197 ++ 146.019863 m 0.0001 64 | 3/17
4 h-m-p 0.0000 0.0001 346.2884 ++ 144.321152 m 0.0001 84 | 4/17
5 h-m-p 0.0000 0.0002 105.3394 ++ 143.528693 m 0.0002 104 | 5/17
6 h-m-p 0.0000 0.0000 137.0591 ++ 143.337562 m 0.0000 124 | 6/17
7 h-m-p 0.0000 0.0000 1466.6855 ++ 141.970218 m 0.0000 144 | 7/17
8 h-m-p 0.0000 0.0001 32.4903 ++ 141.869991 m 0.0001 164 | 8/17
9 h-m-p 0.0003 0.0334 10.6314 ++++ 138.019837 m 0.0334 186 | 9/17
10 h-m-p 0.0007 0.0036 36.1527 YCCCCC 137.607476 5 0.0016 215 | 9/17
11 h-m-p 0.0040 0.0496 14.5813 +CYYYYYC 133.389152 6 0.0324 243 | 9/17
12 h-m-p 0.3284 1.6418 0.7059 CYCCC 133.216036 4 0.1086 270 | 9/17
13 h-m-p 0.2487 2.4045 0.3083 +YCYCCCC 131.792167 6 1.4695 310 | 9/17
14 h-m-p 0.6362 3.1810 0.6449 YYCCC 130.840227 4 0.9108 344 | 9/17
15 h-m-p 1.6000 8.0000 0.2415 +YCCC 129.988716 3 4.2786 378 | 9/17
16 h-m-p 1.6000 8.0000 0.3860 CCYC 129.607342 3 1.6104 411 | 9/17
17 h-m-p 1.0736 5.3681 0.3154 CYCCC 129.438107 4 1.8076 446 | 9/17
18 h-m-p 1.5240 8.0000 0.3740 CCCC 129.294200 3 2.1582 480 | 9/17
19 h-m-p 1.6000 8.0000 0.2930 YCCC 129.198295 3 3.0006 513 | 9/17
20 h-m-p 1.6000 8.0000 0.2145 CCCC 129.157789 3 2.6217 547 | 9/17
21 h-m-p 1.6000 8.0000 0.0269 +YCCC 129.108174 3 4.2976 581 | 9/17
22 h-m-p 0.7282 8.0000 0.1588 +YCC 129.082353 2 2.0738 613 | 9/17
23 h-m-p 1.6000 8.0000 0.1041 CCC 129.075078 2 1.7818 645 | 9/17
24 h-m-p 1.6000 8.0000 0.0620 C 129.073764 0 1.6000 673 | 9/17
25 h-m-p 1.6000 8.0000 0.0365 CC 129.073433 1 1.9038 703 | 9/17
26 h-m-p 1.6000 8.0000 0.0236 CC 129.073318 1 2.0407 733 | 9/17
27 h-m-p 1.6000 8.0000 0.0011 C 129.073301 0 1.3867 761 | 9/17
28 h-m-p 1.1073 8.0000 0.0013 C 129.073300 0 1.4204 789 | 9/17
29 h-m-p 1.6000 8.0000 0.0008 C 129.073300 0 1.5009 817 | 9/17
30 h-m-p 1.6000 8.0000 0.0000 Y 129.073300 0 0.9983 845 | 9/17
31 h-m-p 1.6000 8.0000 0.0000 Y 129.073300 0 1.2620 873 | 9/17
32 h-m-p 1.6000 8.0000 0.0000 -C 129.073300 0 0.1488 902
Out..
lnL = -129.073300
903 lfun, 2709 eigenQcodon, 25284 P(t)
end of tree file.
Time used: 0:07
Model 2: PositiveSelection
TREE # 1
(1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
0.082998 0.099302 0.013113 0.100615 0.078655 0.023542 0.049100 0.032651 0.010990 0.057874 0.020013 0.106125 0.087077 0.012764 7.368116 0.969421 0.452460 0.153367 1.308690
ntime & nrate & np: 14 3 19
Bounds (np=19):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 2.440873
np = 19
lnL0 = -152.044952
Iterating by ming2
Initial: fx= 152.044952
x= 0.08300 0.09930 0.01311 0.10061 0.07865 0.02354 0.04910 0.03265 0.01099 0.05787 0.02001 0.10613 0.08708 0.01276 7.36812 0.96942 0.45246 0.15337 1.30869
1 h-m-p 0.0000 0.0008 277.0221 ++++ 139.282124 m 0.0008 26 | 1/19
2 h-m-p 0.0001 0.0004 49.9050 ++ 138.328033 m 0.0004 48 | 2/19
3 h-m-p 0.0001 0.0003 344.1659 ++ 134.299706 m 0.0003 70 | 3/19
4 h-m-p 0.0000 0.0002 274.8563 ++ 132.406005 m 0.0002 92 | 4/19
5 h-m-p 0.0001 0.0003 51.6605 ++ 132.040882 m 0.0003 114 | 5/19
6 h-m-p 0.0001 0.0005 81.5924 ++ 131.151720 m 0.0005 136 | 6/19
7 h-m-p 0.0000 0.0000 1007.2140 ++ 131.060817 m 0.0000 158 | 7/19
8 h-m-p 0.0001 0.0004 27.0723 ++ 130.903585 m 0.0004 180 | 8/19
9 h-m-p 0.0015 0.0153 5.2160 ++ 130.438221 m 0.0153 202 | 9/19
10 h-m-p 0.0243 2.0649 1.2768 ++CCCC 129.483286 3 0.5592 232 | 9/19
11 h-m-p 0.1782 0.8912 1.2170 YCYCCC 128.767670 5 0.4703 262 | 9/19
12 h-m-p 0.5837 4.8645 0.9804 CCCC 128.367931 3 0.8155 290 | 9/19
13 h-m-p 1.1173 5.5864 0.4209 YCYCCC 128.020012 5 2.5157 330 | 9/19
14 h-m-p 0.8228 4.1138 0.5116 CCCCC 127.892879 4 0.9037 370 | 9/19
15 h-m-p 1.6000 8.0000 0.2642 YCCC 127.838659 3 1.1201 407 | 9/19
16 h-m-p 1.2797 8.0000 0.2312 +CCC 127.751721 2 4.7585 444 | 9/19
17 h-m-p 1.6000 8.0000 0.5327 CYCC 127.669646 3 2.2377 481 | 9/19
18 h-m-p 1.6000 8.0000 0.4406 CYCC 127.608928 3 2.1636 518 | 9/19
19 h-m-p 1.6000 8.0000 0.3988 CC 127.594925 1 1.3662 552 | 9/19
20 h-m-p 1.6000 8.0000 0.2143 CCC 127.581788 2 1.9938 588 | 9/19
21 h-m-p 1.6000 8.0000 0.0510 CC 127.580101 1 1.8417 622 | 9/19
22 h-m-p 1.6000 8.0000 0.0507 +YC 127.578930 1 4.5005 656 | 9/19
23 h-m-p 1.6000 8.0000 0.0382 YC 127.578276 1 2.6943 689 | 9/19
24 h-m-p 1.6000 8.0000 0.0537 +YC 127.576444 1 7.1544 723 | 9/19
25 h-m-p 1.6000 8.0000 0.0886 YC 127.574396 1 3.6401 756 | 9/19
26 h-m-p 1.6000 8.0000 0.1599 C 127.573963 0 1.6000 788 | 9/19
27 h-m-p 1.6000 8.0000 0.0164 C 127.573939 0 1.6039 820 | 9/19
28 h-m-p 1.6000 8.0000 0.0046 ++ 127.573823 m 8.0000 852 | 9/19
29 h-m-p 0.0502 8.0000 0.7286 ++YCC 127.572103 2 1.6668 889 | 9/19
30 h-m-p 1.6000 8.0000 0.3016 YC 127.571337 1 2.5548 922 | 9/19
31 h-m-p 1.6000 8.0000 0.3428 CC 127.571108 1 2.2491 956 | 9/19
32 h-m-p 1.6000 8.0000 0.3071 YC 127.570978 1 3.6853 989 | 9/19
33 h-m-p 1.6000 8.0000 0.3556 CC 127.570936 1 2.0108 1023 | 9/19
34 h-m-p 1.6000 8.0000 0.3506 YC 127.570916 1 3.7015 1056 | 9/19
35 h-m-p 1.6000 8.0000 0.3395 C 127.570910 0 1.9149 1088 | 9/19
36 h-m-p 1.6000 8.0000 0.3282 Y 127.570907 0 3.7240 1120 | 9/19
37 h-m-p 1.6000 8.0000 0.3474 C 127.570906 0 1.9416 1152 | 9/19
38 h-m-p 1.6000 8.0000 0.3330 Y 127.570906 0 3.5610 1184 | 9/19
39 h-m-p 1.6000 8.0000 0.3468 C 127.570906 0 1.9772 1216 | 9/19
40 h-m-p 1.6000 8.0000 0.3354 Y 127.570905 0 3.4721 1248 | 9/19
41 h-m-p 1.6000 8.0000 0.3473 C 127.570905 0 2.0045 1280 | 9/19
42 h-m-p 1.6000 8.0000 0.3364 Y 127.570905 0 3.3963 1312 | 9/19
43 h-m-p 1.6000 8.0000 0.3469 C 127.570905 0 2.0348 1344 | 9/19
44 h-m-p 1.6000 8.0000 0.3401 Y 127.570905 0 3.3438 1376 | 9/19
45 h-m-p 1.6000 8.0000 0.3730 C 127.570905 0 2.1255 1408 | 9/19
46 h-m-p 1.6000 8.0000 0.2925 Y 127.570905 0 2.6474 1440 | 9/19
47 h-m-p 1.6000 8.0000 0.4069 Y 127.570905 0 3.2726 1472 | 9/19
48 h-m-p 1.2563 8.0000 1.0599 +Y 127.570905 0 3.9516 1505 | 9/19
49 h-m-p 1.6000 8.0000 0.7403 -C 127.570905 0 0.1397 1528 | 9/19
50 h-m-p 1.6000 8.0000 0.0168 Y 127.570905 0 1.6000 1560 | 9/19
51 h-m-p 0.0751 8.0000 0.3580 ----------C 127.570905 0 0.0000 1602 | 9/19
52 h-m-p 0.0160 8.0000 0.0001 --Y 127.570905 0 0.0003 1636 | 9/19
53 h-m-p 0.0160 8.0000 0.0001 -------------.. | 9/19
54 h-m-p 0.0160 8.0000 0.0000 ---------Y 127.570905 0 0.0000 1720
Out..
lnL = -127.570905
1721 lfun, 6884 eigenQcodon, 72282 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -131.880161 S = -119.605372 -13.562914
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 19 patterns 0:28
did 19 / 19 patterns 0:28end of tree file.
Time used: 0:28
Model 7: beta
TREE # 1
(1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
0.051469 0.065817 0.016235 0.085723 0.031371 0.077603 0.049135 0.045575 0.071766 0.033708 0.102668 0.062373 0.046407 0.104293 10.312482 0.206332 1.377667
ntime & nrate & np: 14 1 17
Bounds (np=17):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 3.369340
np = 17
lnL0 = -142.808554
Iterating by ming2
Initial: fx= 142.808554
x= 0.05147 0.06582 0.01624 0.08572 0.03137 0.07760 0.04914 0.04558 0.07177 0.03371 0.10267 0.06237 0.04641 0.10429 10.31248 0.20633 1.37767
1 h-m-p 0.0000 0.0008 71.8068 ++++ 139.000064 m 0.0008 24 | 1/17
2 h-m-p 0.0001 0.0003 125.6834 ++ 136.851366 m 0.0003 44 | 2/17
3 h-m-p 0.0000 0.0000 11119.9525 ++ 136.573825 m 0.0000 64 | 3/17
4 h-m-p 0.0001 0.0004 100.6298 ++ 134.712693 m 0.0004 84 | 4/17
5 h-m-p 0.0000 0.0000 650.6557 ++ 134.646022 m 0.0000 104 | 5/17
6 h-m-p 0.0000 0.0000 1206.2981 ++ 133.961603 m 0.0000 124 | 6/17
7 h-m-p 0.0000 0.0000 226.9730 ++ 133.801655 m 0.0000 144 | 7/17
8 h-m-p 0.0000 0.0005 90.1644 ++ 132.913486 m 0.0005 164 | 8/17
9 h-m-p 0.0031 0.0201 5.1179 YCCCC 132.821019 4 0.0062 191 | 8/17
10 h-m-p 0.0128 0.2891 2.4905 CYC 132.767865 2 0.0158 214 | 8/17
11 h-m-p 0.0117 0.4007 3.3631 ++CYCYCCC 130.667120 6 0.3311 247 | 8/17
12 h-m-p 0.0559 0.2797 0.9128 YCYCCCC 130.394730 6 0.1522 277 | 8/17
13 h-m-p 0.0043 0.0217 5.3566 +YYCCCCC 129.740965 6 0.0177 317 | 8/17
14 h-m-p 0.0079 0.0397 0.6531 CCC 129.737551 2 0.0032 341 | 8/17
15 h-m-p 0.0059 0.2947 0.3592 ++YCCCC 129.483713 4 0.1584 379 | 8/17
16 h-m-p 0.0962 0.4812 0.1273 ++ 129.292571 m 0.4812 408 | 9/17
17 h-m-p 0.6712 5.7767 0.0909 -YCYCYYY 129.280604 6 0.0859 447 | 8/17
18 h-m-p 0.0001 0.0080 65.6164 +CCCC 129.240243 3 0.0007 482 | 8/17
19 h-m-p 0.2252 1.1261 0.1017 ++ 129.167185 m 1.1261 502 | 9/17
20 h-m-p 0.2518 1.2590 0.0580 YYYCC 129.161456 4 0.2344 536 | 9/17
21 h-m-p 0.0205 1.3517 0.6643 +YYCCC 129.148562 4 0.0907 571 | 9/17
22 h-m-p 0.8020 8.0000 0.0751 +YCC 129.136436 2 2.1447 603 | 9/17
23 h-m-p 1.6000 8.0000 0.0697 YC 129.131578 1 2.8502 632 | 9/17
24 h-m-p 1.6000 8.0000 0.1048 ++ 129.110066 m 8.0000 660 | 9/17
25 h-m-p 1.1304 8.0000 0.7417 CCCC 129.093898 3 1.5055 694 | 9/17
26 h-m-p 1.6000 8.0000 0.0171 CCC 129.085675 2 1.7866 726 | 9/17
27 h-m-p 0.4018 8.0000 0.0759 +CC 129.084589 1 1.5299 757 | 9/17
28 h-m-p 1.6000 8.0000 0.0275 YC 129.084407 1 1.2434 786 | 9/17
29 h-m-p 1.6000 8.0000 0.0150 YC 129.084401 1 0.9572 815 | 9/17
30 h-m-p 1.6000 8.0000 0.0021 Y 129.084401 0 1.0424 843 | 8/17
31 h-m-p 0.0922 8.0000 0.0232 -C 129.084401 0 0.0058 872 | 8/17
32 h-m-p 1.6000 8.0000 0.0000 Y 129.084401 0 1.1901 901 | 8/17
33 h-m-p 1.6000 8.0000 0.0000 Y 129.084401 0 3.6335 930 | 8/17
34 h-m-p 1.6000 8.0000 0.0000 ++ 129.084401 m 8.0000 959 | 8/17
35 h-m-p 0.6081 4.4668 0.0000 ++ 129.084401 m 4.4668 988 | 8/17
36 h-m-p -0.0000 -0.0000 0.0001
h-m-p: -0.00000000e+00 -0.00000000e+00 1.42560385e-04 129.084401
.. | 8/17
37 h-m-p 0.0058 2.8751 0.0047 C 129.084400 0 0.0061 1043 | 8/17
38 h-m-p 0.0150 5.4669 0.0019 C 129.084400 0 0.0050 1072 | 8/17
39 h-m-p 0.0081 0.0568 0.0012 ++ 129.084400 m 0.0568 1101 | 9/17
40 h-m-p 0.0073 0.8070 0.0086 Y 129.084400 0 0.0031 1130 | 9/17
41 h-m-p 0.0215 6.4650 0.0012 C 129.084400 0 0.0068 1158 | 9/17
42 h-m-p 0.1648 8.0000 0.0001 Y 129.084400 0 0.0769 1186 | 9/17
43 h-m-p 0.0160 8.0000 0.0006 C 129.084400 0 0.0139 1214 | 9/17
44 h-m-p 0.0388 8.0000 0.0002 C 129.084400 0 0.0570 1242 | 9/17
45 h-m-p 0.0738 8.0000 0.0002 C 129.084400 0 0.0237 1270 | 9/17
46 h-m-p 1.6000 8.0000 0.0000 C 129.084400 0 1.4573 1298 | 9/17
47 h-m-p 1.0366 8.0000 0.0000 ++ 129.084400 m 8.0000 1326 | 9/17
48 h-m-p 0.4659 8.0000 0.0000 Y 129.084400 0 0.9932 1354 | 9/17
49 h-m-p 1.6000 8.0000 0.0000 Y 129.084400 0 1.6000 1382 | 9/17
50 h-m-p 1.6000 8.0000 0.0000 ----C 129.084400 0 0.0016 1414
Out..
lnL = -129.084400
1415 lfun, 15565 eigenQcodon, 198100 P(t)
end of tree file.
Time used: 1:23
Model 8: beta&w>1
TREE # 1
(1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
0.018790 0.100726 0.078728 0.091518 0.087778 0.064401 0.058242 0.043425 0.037427 0.091386 0.041928 0.014683 0.045693 0.103851 7.498066 0.900000 0.342225 1.371175 1.300000
ntime & nrate & np: 14 2 19
Bounds (np=19):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 3.419861
np = 19
lnL0 = -141.818123
Iterating by ming2
Initial: fx= 141.818123
x= 0.01879 0.10073 0.07873 0.09152 0.08778 0.06440 0.05824 0.04342 0.03743 0.09139 0.04193 0.01468 0.04569 0.10385 7.49807 0.90000 0.34223 1.37118 1.30000
1 h-m-p 0.0000 0.0008 67.5802 ++++ 138.519221 m 0.0008 26 | 1/19
2 h-m-p 0.0000 0.0001 119.2447 ++ 137.973796 m 0.0001 48 | 2/19
3 h-m-p 0.0000 0.0001 852.6348 ++ 135.255555 m 0.0001 70 | 3/19
4 h-m-p 0.0001 0.0003 77.8493 ++ 134.390489 m 0.0003 92 | 4/19
5 h-m-p 0.0002 0.0010 72.6291 ++ 132.189157 m 0.0010 114 | 5/19
6 h-m-p 0.0000 0.0002 107.7588 ++ 131.645552 m 0.0002 136 | 6/19
7 h-m-p 0.0000 0.0000 411.0216 ++ 131.485684 m 0.0000 158 | 7/19
8 h-m-p 0.0000 0.0000 292.5509 ++ 131.301651 m 0.0000 180 | 8/19
9 h-m-p 0.0010 0.0274 4.3824 +YCCCC 131.182677 4 0.0100 210 | 8/19
10 h-m-p 0.0057 0.0464 7.6782 ++ 129.579830 m 0.0464 232 | 9/19
11 h-m-p 0.0823 0.5338 1.8951 +YCCCC 129.049637 4 0.2262 262 | 9/19
12 h-m-p 0.0505 1.0200 8.4793 +YCCCCC 128.015728 5 0.1322 294 | 9/19
13 h-m-p 0.3197 1.5985 0.5640 YYCC 127.838090 3 0.2881 320 | 9/19
14 h-m-p 0.7225 8.0000 0.2249 +YC 127.685087 1 1.8133 354 | 9/19
15 h-m-p 1.6000 8.0000 0.1336 CYC 127.632599 2 1.4035 389 | 9/19
16 h-m-p 1.6000 8.0000 0.0858 CC 127.621993 1 2.1484 423 | 9/19
17 h-m-p 1.6000 8.0000 0.0870 YC 127.611418 1 3.7163 456 | 9/19
18 h-m-p 1.6000 8.0000 0.1332 YC 127.600928 1 3.2648 489 | 9/19
19 h-m-p 1.6000 8.0000 0.2160 +YCC 127.581888 2 4.6630 525 | 9/19
20 h-m-p 1.6000 8.0000 0.1209 YC 127.576275 1 2.7351 558 | 9/19
21 h-m-p 1.6000 8.0000 0.1516 YCC 127.572039 2 2.7805 593 | 9/19
22 h-m-p 1.6000 8.0000 0.0245 YC 127.571429 1 2.7976 626 | 9/19
23 h-m-p 1.6000 8.0000 0.0158 CC 127.571057 1 2.5594 660 | 9/19
24 h-m-p 1.6000 8.0000 0.0091 C 127.570982 0 1.7715 692 | 9/19
25 h-m-p 1.6000 8.0000 0.0029 YC 127.570954 1 2.5668 725 | 9/19
26 h-m-p 1.6000 8.0000 0.0018 C 127.570952 0 1.5601 757 | 9/19
27 h-m-p 1.6000 8.0000 0.0004 C 127.570952 0 1.8071 789 | 9/19
28 h-m-p 1.6000 8.0000 0.0002 ++ 127.570952 m 8.0000 821 | 9/19
29 h-m-p 0.1279 8.0000 0.0111 ++C 127.570950 0 1.8960 855 | 9/19
30 h-m-p 1.6000 8.0000 0.0074 ++ 127.570943 m 8.0000 887 | 9/19
31 h-m-p 0.2873 8.0000 0.2050 ++
QuantileBeta(0.15, 0.00500, 2.45736) = 1.040653e-160 2000 rounds
YC 127.570918 1 3.5895 922 | 9/19
32 h-m-p 1.6000 8.0000 0.1029
QuantileBeta(0.15, 0.00500, 2.20169) = 1.192956e-160 2000 rounds
C 127.570911 0 1.4244 954 | 9/19
33 h-m-p 1.2616 8.0000 0.1162
QuantileBeta(0.15, 0.00500, 2.28446) = 1.139044e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
+ 127.570905 m 8.0000 986
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.924497e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62771) = 9.589136e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62744) = 9.590310e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.62758) = 9.589723e-161 2000 rounds
| 9/19
34 h-m-p 1.6000 8.0000 0.4601
QuantileBeta(0.15, 0.00500, 3.36376) = 7.154451e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.57232) = 4.054453e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 6.30850) = 3.542146e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
Y 127.570901 0 4.9762 1019
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.815493e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91740) = 4.652863e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91703) = 4.653249e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.91721) = 4.653056e-161 2000 rounds
| 9/19
35 h-m-p 1.6000 8.0000 0.4771
QuantileBeta(0.15, 0.00500, 5.68059) = 3.970018e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.97072) = 2.755621e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
C 127.570900 0 1.7607 1051
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 4.048904e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75746) = 3.912176e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75705) = 3.912475e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 5.75725) = 3.912326e-161 2000 rounds
| 9/19
36 h-m-p 1.3855 8.0000 0.6063
QuantileBeta(0.15, 0.00500, 6.59735) = 3.374795e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 9.11763) = 2.389428e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
+ 127.570898 m 8.0000 1083
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.108671e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60817) = 2.037482e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60759) = 2.037599e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.60788) = 2.037541e-161 2000 rounds
| 9/19
37 h-m-p 1.6000 8.0000 1.4609
QuantileBeta(0.15, 0.00500, 12.94528) = 1.655168e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 19.95747) = 1.058914e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
C 127.570898 0 2.0236 1115
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.631874e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576826e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.56404) = 1.576827e-161 2000 rounds
| 9/19
38 h-m-p 1.6000 8.0000 1.5922
QuantileBeta(0.15, 0.00500, 16.11150) = 1.319660e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 23.75389) = 8.860836e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 26.30136) = 7.986172e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
Y 127.570897 0 5.3205 1138
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.901864e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03510) = 9.567849e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.03509) = 9.567853e-162 2000 rounds
| 9/19
39 h-m-p 1.6000 8.0000 3.0868
QuantileBeta(0.15, 0.00500, 26.97395) = 7.783322e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 41.79054) = 4.020761e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
C 127.570897 0 2.4118 1160
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.358685e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47971) = 7.110457e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.47969) = 7.110461e-162 2000 rounds
| 9/19
40 h-m-p 1.6000 8.0000 4.1426
QuantileBeta(0.15, 0.00500, 36.10779) = 4.662361e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 55.99207) = 7.568712e-163 2000 rounds
+
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
Y 127.570896 0 4.6261 1183
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 3.566412e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64343) = 2.063511e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 48.64341) = 2.063512e-162 2000 rounds
| 9/19
41 h-m-p 1.6000 8.0000 5.4397
QuantileBeta(0.15, 0.00500, 57.34694) = 7.388334e-163 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
C 127.570896 0 2.1258 1205
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 7.281007e-163 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20741) = 9.203332e-164 2000 rounds
QuantileBeta(0.15, 0.00500, 60.20738) = 9.203336e-164 2000 rounds
| 9/19
42 h-m-p 0.9078 4.5390 8.5466 ++ 127.570896 m 4.5390 1227 | 10/19
43 h-m-p 1.6000 8.0000 0.0004 Y 127.570896 0 1.0159 1249 | 10/19
44 h-m-p 1.6000 8.0000 0.0000 Y 127.570896 0 0.9180 1280 | 10/19
45 h-m-p 1.6000 8.0000 0.0000 Y 127.570896 0 1.0696 1311 | 10/19
46 h-m-p 1.6000 8.0000 0.0000 Y 127.570896 0 3.7750 1342 | 10/19
47 h-m-p 1.3714 8.0000 0.0000 C 127.570896 0 0.3429 1373
Out..
lnL = -127.570896
1374 lfun, 16488 eigenQcodon, 211596 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -131.440625 S = -119.605373 -15.784165
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 19 patterns 2:34
did 19 / 19 patterns 2:34end of tree file.
Time used: 2:34
The loglikelihoods for models M1, M2, M7 and M8 are -129.073300 -127.570905 -129.084400 -127.570896 respectively
CLUSTAL W (1.8) multiple sequence alignment (ALTER 1.3.3)
171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1 STTIDQSYLNECGVLVQLD
FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD
Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1 GATMDQSYLNECGVLVQLD
K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1 SFTVDQSYLNECGVLVQLD
partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
. *:***************
>171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1 AGTTCTACTGTTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1 AGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1 GGCACCACTATTGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1 GGTGCTACCATGGACCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 AGTTCTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 AGTTCTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1 AGTTTTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC >partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1 AGTTCTACTGTTGATCAAAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGAC
>171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD >Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1 STTIDQSYLNECGVLVQLD >FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1 GTTIDQSYLNECGVLVQLD >Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1 GATMDQSYLNECGVLVQLD >K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD >S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD >UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1 SFTVDQSYLNECGVLVQLD >partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1 SSTVDQSYLNECGVLVQLD
Reading sequence file /data//pss_subsets/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result/original_alignment/codeml/fasta/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1 Found 11 sequences of length 57 Alignment looks like a valid DNA alignment. Estimated diversity is (pairwise deletion - ignoring missing/ambig): 7.1% Found 6 informative sites. Writing alignment of informative sites to: Phi.inf.sites Writing list of informative sites to: Phi.inf.list Calculating all pairwise incompatibilities... Done: 0.0%100.0% Using a window size of 80 with k as 8 Too few informative sites to use normal approximation. Try doing a permutation test or increasing alignment length Can also try decreasing windowsize.
#NEXUS
[ID: 7364801424]
begin taxa;
dimensions ntax=11;
taxlabels
171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1
UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1
partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1
79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1
A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1
Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1
DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1
FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1
Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1
K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1
S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1
;
end;
begin trees;
translate
1 171_1a_VIPR_ALG1_422313311_12355_12411_1_1971_Germany_Dog_Alphacoronavirus_1,
2 UNKNOWN_AX154950_NA_VIPR_P_14536504_12309_12368_1_NA_NA_Unknown_Alphacoronavirus_1,
3 partially_attenuated_Miller_M60_NA_VIPR_P_110746810_12284_12343_1_1987_USA_Swine_Alphacoronavirus_1,
4 79_1146_ORF_1a_1b_VIPR_P_62836706_12380_12439_1_NA_USA_Unknown_Alphacoronavirus_1,
5 A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1,
6 Black_1_VIPR_P_161213709_12348_12404_1_NA_USA_Unknown_Alphacoronavirus_1,
7 DF_2_NA_VIPR_P_87242672_12374_12433_1_NA_NA_Unknown_Alphacoronavirus_1,
8 FIPV_79_1146_NA_VIPR_ALG1_63098798_12150_12206_1_NA_NA_Cat_Alphacoronavirus_1,
9 Felis_catus_NLD_UU88_2010_Pp1a_VIPR_ALG1_530803157_12195_12251_1_2010_08_17_Netherlands_Cat_Alphacoronavirus_1,
10 K378_1a_VIPR_ALG1_422313319_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1,
11 S378_1a_VIPR_ALG1_422313330_12264_12320_1_1978_USA_Dog_Alphacoronavirus_1
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:6.302210e-03,4:6.259587e-03,6:6.177854e-03,7:1.171137e-02,8:6.210757e-03,(((2:1.520944e-02,3:6.081596e-03,10:6.249131e-03,11:6.493642e-03)0.703:1.431422e-02,5:8.510694e-03)0.941:3.868355e-02,9:5.024355e-02)0.750:3.126285e-02);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:6.302210e-03,4:6.259587e-03,6:6.177854e-03,7:1.171137e-02,8:6.210757e-03,(((2:1.520944e-02,3:6.081596e-03,10:6.249131e-03,11:6.493642e-03):1.431422e-02,5:8.510694e-03):3.868355e-02,9:5.024355e-02):3.126285e-02);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/mrbayes_input.nex.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -141.73 -152.56
2 -141.72 -154.91
--------------------------------------
TOTAL -141.73 -154.31
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/mrbayes_input.nex.run1.p" and "/data/mrbayes_input.nex.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/mrbayes_input.nex.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.324707 0.022122 0.110791 0.607763 0.297195 1271.40 1386.20 1.000
r(A<->C){all} 0.063787 0.003933 0.000012 0.192315 0.044259 284.09 289.43 1.005
r(A<->G){all} 0.342964 0.017076 0.093315 0.591816 0.339198 93.45 133.24 1.010
r(A<->T){all} 0.077452 0.004119 0.000008 0.208162 0.062552 204.26 224.26 1.000
r(C<->G){all} 0.064250 0.003871 0.000002 0.184231 0.045722 194.15 214.29 1.000
r(C<->T){all} 0.352910 0.015936 0.117457 0.594664 0.345420 113.65 139.43 1.015
r(G<->T){all} 0.098637 0.004746 0.000317 0.234816 0.083536 183.80 253.12 1.010
pi(A){all} 0.241663 0.002641 0.144656 0.346215 0.239310 669.24 749.83 1.000
pi(C){all} 0.196624 0.002295 0.103435 0.284129 0.194183 645.99 762.79 1.004
pi(G){all} 0.276434 0.002825 0.182206 0.386350 0.274207 872.33 893.15 1.001
pi(T){all} 0.285279 0.003089 0.180605 0.394718 0.283671 821.25 855.12 1.001
alpha{1,2} 0.582281 0.528540 0.000224 1.982054 0.327552 780.91 827.42 1.001
alpha{3} 1.509678 1.261131 0.001708 3.829231 1.216155 1136.70 1168.23 1.000
pinvar{all} 0.325199 0.038307 0.001402 0.665188 0.312099 593.74 659.56 1.002
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
CODONML (in paml version 4.9h, March 2018) /data/fasta_checked/A76_1a_VIPR_ALG1_418470984_12268_12324_1_1976_USA_Dog_Alphacoronavirus_1.result.1
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 11 ls = 19
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 0 0 0 0 0 0 | Ser TCT 0 0 1 0 0 0 | Tyr TAT 1 1 1 1 1 1 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 0 0 0 0 0 0 | TAC 0 0 0 0 0 0 | TGC 1 1 1 1 1 1
Leu TTA 1 1 1 1 1 1 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 0 0 0 0 0 0 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 0 0 0
CTC 1 1 1 1 1 1 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 2 2 2 2 2 2 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 1 1 0 1 1 1 | Thr ACT 1 1 1 1 1 1 | Asn AAT 0 0 0 0 0 0 | Ser AGT 1 1 2 1 1 1
ATC 0 0 0 0 0 0 | ACC 1 1 0 1 1 1 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 1 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 0 0 0 0 0 0 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 1 1 2 1 1 1 | Ala GCT 0 0 0 0 0 0 | Asp GAT 1 1 1 1 1 1 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 1 1 1 1 1 1 | GGC 1 1 0 1 0 1
GTA 0 0 0 0 0 0 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 1 1 1 1 1 1 | GCG 0 0 0 0 0 0 | GAG 1 1 1 1 1 1 | GGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------------------------
Phe TTT 0 0 0 1 0 | Ser TCT 0 1 1 0 1 | Tyr TAT 1 1 1 1 1 | Cys TGT 0 0 0 0 0
TTC 0 0 0 0 0 | TCC 0 0 0 0 0 | TAC 0 0 0 0 0 | TGC 1 1 1 1 1
Leu TTA 1 1 1 1 1 | TCA 0 0 0 0 0 | *** TAA 0 0 0 0 0 | *** TGA 0 0 0 0 0
TTG 0 0 0 0 0 | TCG 0 0 0 0 0 | TAG 0 0 0 0 0 | Trp TGG 0 0 0 0 0
----------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 | Pro CCT 0 0 0 0 0 | His CAT 0 0 0 0 0 | Arg CGT 0 0 0 0 0
CTC 1 1 1 1 1 | CCC 0 0 0 0 0 | CAC 0 0 0 0 0 | CGC 0 0 0 0 0
CTA 1 1 1 1 1 | CCA 0 0 0 0 0 | Gln CAA 0 1 1 1 1 | CGA 0 0 0 0 0
CTG 0 0 0 0 0 | CCG 0 0 0 0 0 | CAG 2 1 1 1 1 | CGG 0 0 0 0 0
----------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 | Thr ACT 0 1 1 1 1 | Asn AAT 0 0 0 0 0 | Ser AGT 1 2 2 2 2
ATC 0 0 0 0 0 | ACC 1 0 0 0 0 | AAC 1 1 1 1 1 | AGC 0 0 0 0 0
ATA 0 0 0 0 0 | ACA 0 0 0 0 0 | Lys AAA 0 0 0 0 0 | Arg AGA 0 0 0 0 0
Met ATG 1 0 0 0 0 | ACG 0 0 0 0 0 | AAG 0 0 0 0 0 | AGG 0 0 0 0 0
----------------------------------------------------------------------------------------------------------------------
Val GTT 1 2 2 2 2 | Ala GCT 1 0 0 0 0 | Asp GAT 0 1 1 1 1 | Gly GGT 1 0 0 0 0
GTC 0 0 0 0 0 | GCC 0 0 0 0 0 | GAC 2 1 1 1 1 | GGC 0 0 0 0 0
GTA 0 0 0 0 0 | GCA 0 0 0 0 0 | Glu GAA 0 0 0 0 0 | GGA 0 0 0 0 0
GTG 1 1 1 1 1 | GCG 0 0 0 0 0 | GAG 1 1 1 1 1 | GGG 1 1 1 1 1
----------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: C1
position 1: T:0.15789 C:0.21053 A:0.26316 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.31579 C:0.31579 A:0.10526 G:0.26316
Average T:0.26316 C:0.21053 A:0.24561 G:0.28070
#2: C2
position 1: T:0.15789 C:0.21053 A:0.26316 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.31579 C:0.31579 A:0.10526 G:0.26316
Average T:0.26316 C:0.21053 A:0.24561 G:0.28070
#3: C3
position 1: T:0.21053 C:0.21053 A:0.21053 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.42105 C:0.21053 A:0.10526 G:0.26316
Average T:0.31579 C:0.17544 A:0.22807 G:0.28070
#4: C4
position 1: T:0.15789 C:0.21053 A:0.26316 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.31579 C:0.31579 A:0.10526 G:0.26316
Average T:0.26316 C:0.21053 A:0.24561 G:0.28070
#5: C5
position 1: T:0.15789 C:0.21053 A:0.31579 G:0.31579
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.31579 C:0.31579 A:0.10526 G:0.26316
Average T:0.26316 C:0.21053 A:0.26316 G:0.26316
#6: C6
position 1: T:0.15789 C:0.21053 A:0.26316 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.31579 C:0.31579 A:0.10526 G:0.26316
Average T:0.26316 C:0.21053 A:0.24561 G:0.28070
#7: C7
position 1: T:0.15789 C:0.21053 A:0.21053 G:0.42105
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.26316 C:0.31579 A:0.10526 G:0.31579
Average T:0.24561 C:0.21053 A:0.22807 G:0.31579
#8: C8
position 1: T:0.21053 C:0.21053 A:0.21053 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.42105 C:0.21053 A:0.15789 G:0.21053
Average T:0.31579 C:0.17544 A:0.24561 G:0.26316
#9: C9
position 1: T:0.21053 C:0.21053 A:0.21053 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.42105 C:0.21053 A:0.15789 G:0.21053
Average T:0.31579 C:0.17544 A:0.24561 G:0.26316
#10: C10
position 1: T:0.21053 C:0.21053 A:0.21053 G:0.36842
position 2: T:0.36842 C:0.05263 A:0.36842 G:0.21053
position 3: T:0.42105 C:0.21053 A:0.15789 G:0.21053
Average T:0.33333 C:0.15789 A:0.24561 G:0.26316
#11: C11
position 1: T:0.21053 C:0.21053 A:0.21053 G:0.36842
position 2: T:0.31579 C:0.10526 A:0.36842 G:0.21053
position 3: T:0.42105 C:0.21053 A:0.15789 G:0.21053
Average T:0.31579 C:0.17544 A:0.24561 G:0.26316
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 1 | Ser S TCT 4 | Tyr Y TAT 11 | Cys C TGT 0
TTC 0 | TCC 0 | TAC 0 | TGC 11
Leu L TTA 11 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 0 | TCG 0 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 0 | Pro P CCT 0 | His H CAT 0 | Arg R CGT 0
CTC 11 | CCC 0 | CAC 0 | CGC 0
CTA 11 | CCA 0 | Gln Q CAA 4 | CGA 0
CTG 0 | CCG 0 | CAG 18 | CGG 0
------------------------------------------------------------------------------
Ile I ATT 5 | Thr T ACT 10 | Asn N AAT 0 | Ser S AGT 16
ATC 0 | ACC 6 | AAC 11 | AGC 1
ATA 0 | ACA 0 | Lys K AAA 0 | Arg R AGA 0
Met M ATG 1 | ACG 0 | AAG 0 | AGG 0
------------------------------------------------------------------------------
Val V GTT 16 | Ala A GCT 1 | Asp D GAT 10 | Gly G GGT 1
GTC 0 | GCC 0 | GAC 12 | GGC 4
GTA 0 | GCA 0 | Glu E GAA 0 | GGA 0
GTG 11 | GCG 0 | GAG 11 | GGG 11
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.18182 C:0.21053 A:0.23923 G:0.36842
position 2: T:0.32057 C:0.10048 A:0.36842 G:0.21053
position 3: T:0.35885 C:0.26794 A:0.12440 G:0.24880
Average T:0.28708 C:0.19298 A:0.24402 G:0.27592
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
lnL(ntime: 14 np: 17): -129.073300 +0.000000
12..1 12..2 12..4 12..5 12..6 12..13 13..14 14..15 15..10 15..11 15..8 15..9 14..3 13..7
0.000004 0.000004 0.000004 0.056186 0.000004 0.155080 0.188935 0.055478 0.054297 0.000004 0.000004 0.000004 0.000004 0.241983 7.368116 0.723888 0.000001
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.751990
(1: 0.000004, 2: 0.000004, 4: 0.000004, 5: 0.056186, 6: 0.000004, (((10: 0.054297, 11: 0.000004, 8: 0.000004, 9: 0.000004): 0.055478, 3: 0.000004): 0.188935, 7: 0.241983): 0.155080);
(C1: 0.000004, C2: 0.000004, C4: 0.000004, C5: 0.056186, C6: 0.000004, (((C10: 0.054297, C11: 0.000004, C8: 0.000004, C9: 0.000004): 0.055478, C3: 0.000004): 0.188935, C7: 0.241983): 0.155080);
Detailed output identifying parameters
kappa (ts/tv) = 7.36812
MLEs of dN/dS (w) for site classes (K=2)
p: 0.72389 0.27611
w: 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
12..1 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
12..2 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
12..4 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
12..5 0.056 39.1 17.9 0.2761 0.0103 0.0372 0.4 0.7
12..6 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
12..13 0.155 39.1 17.9 0.2761 0.0283 0.1026 1.1 1.8
13..14 0.189 39.1 17.9 0.2761 0.0345 0.1250 1.3 2.2
14..15 0.055 39.1 17.9 0.2761 0.0101 0.0367 0.4 0.7
15..10 0.054 39.1 17.9 0.2761 0.0099 0.0359 0.4 0.6
15..11 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
15..8 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
15..9 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
14..3 0.000 39.1 17.9 0.2761 0.0000 0.0000 0.0 0.0
13..7 0.242 39.1 17.9 0.2761 0.0442 0.1601 1.7 2.9
Time used: 0:07
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
lnL(ntime: 14 np: 19): -127.570905 +0.000000
12..1 12..2 12..4 12..5 12..6 12..13 13..14 14..15 15..10 15..11 15..8 15..9 14..3 13..7
0.000004 0.000004 0.000004 0.055902 0.000004 0.205407 0.163085 0.055391 0.054070 0.000004 0.000004 0.000004 0.000004 0.288243 10.312482 0.805159 0.000000 0.000001 3.976894
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.822131
(1: 0.000004, 2: 0.000004, 4: 0.000004, 5: 0.055902, 6: 0.000004, (((10: 0.054070, 11: 0.000004, 8: 0.000004, 9: 0.000004): 0.055391, 3: 0.000004): 0.163085, 7: 0.288243): 0.205407);
(C1: 0.000004, C2: 0.000004, C4: 0.000004, C5: 0.055902, C6: 0.000004, (((C10: 0.054070, C11: 0.000004, C8: 0.000004, C9: 0.000004): 0.055391, C3: 0.000004): 0.163085, C7: 0.288243): 0.205407);
Detailed output identifying parameters
kappa (ts/tv) = 10.31248
MLEs of dN/dS (w) for site classes (K=3)
p: 0.80516 0.00000 0.19484
w: 0.00000 1.00000 3.97689
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
12..1 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..2 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..4 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..5 0.056 38.5 18.5 0.7749 0.0170 0.0220 0.7 0.4
12..6 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..13 0.205 38.5 18.5 0.7749 0.0626 0.0807 2.4 1.5
13..14 0.163 38.5 18.5 0.7749 0.0497 0.0641 1.9 1.2
14..15 0.055 38.5 18.5 0.7749 0.0169 0.0218 0.6 0.4
15..10 0.054 38.5 18.5 0.7749 0.0165 0.0213 0.6 0.4
15..11 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
15..8 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
15..9 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
14..3 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
13..7 0.288 38.5 18.5 0.7749 0.0878 0.1133 3.4 2.1
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
1 G 1.000** 3.977
2 T 1.000** 3.977
4 I 1.000** 3.977
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
2 T 0.838 5.073 +- 3.037
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.422 0.221 0.129 0.080 0.052 0.035 0.024 0.017 0.012 0.009
w2: 0.084 0.112 0.124 0.123 0.114 0.104 0.095 0.087 0.081 0.076
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.003
0.002 0.003 0.004
0.001 0.002 0.003 0.005 0.007
0.000 0.001 0.002 0.003 0.005 0.008 0.010
0.000 0.000 0.001 0.001 0.003 0.006 0.010 0.013 0.016
0.000 0.000 0.000 0.001 0.002 0.003 0.006 0.010 0.016 0.020 0.021
0.000 0.000 0.000 0.000 0.001 0.002 0.003 0.006 0.011 0.017 0.026 0.028 0.027
0.000 0.000 0.000 0.000 0.000 0.001 0.002 0.003 0.006 0.011 0.019 0.028 0.037 0.036 0.029
0.000 0.000 0.000 0.000 0.000 0.001 0.001 0.002 0.004 0.007 0.012 0.020 0.031 0.040 0.048 0.040 0.025
0.000 0.000 0.000 0.000 0.000 0.000 0.001 0.001 0.002 0.004 0.008 0.013 0.022 0.032 0.045 0.053 0.054 0.036 0.016
sum of density on p0-p1 = 1.000000
Time used: 0:28
Model 7: beta (10 categories)
TREE # 1: (1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
lnL(ntime: 14 np: 17): -129.084400 +0.000000
12..1 12..2 12..4 12..5 12..6 12..13 13..14 14..15 15..10 15..11 15..8 15..9 14..3 13..7
0.000004 0.000004 0.000004 0.057028 0.000004 0.157001 0.191407 0.056339 0.055169 0.000004 0.000004 0.000004 0.000004 0.244891 7.498066 0.005000 0.011801
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.761867
(1: 0.000004, 2: 0.000004, 4: 0.000004, 5: 0.057028, 6: 0.000004, (((10: 0.055169, 11: 0.000004, 8: 0.000004, 9: 0.000004): 0.056339, 3: 0.000004): 0.191407, 7: 0.244891): 0.157001);
(C1: 0.000004, C2: 0.000004, C4: 0.000004, C5: 0.057028, C6: 0.000004, (((C10: 0.055169, C11: 0.000004, C8: 0.000004, C9: 0.000004): 0.056339, C3: 0.000004): 0.191407, C7: 0.244891): 0.157001);
Detailed output identifying parameters
kappa (ts/tv) = 7.49807
Parameters in M7 (beta):
p = 0.00500 q = 0.01180
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 1.00000 1.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
12..1 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
12..2 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
12..4 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
12..5 0.057 39.0 18.0 0.3000 0.0110 0.0365 0.4 0.7
12..6 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
12..13 0.157 39.0 18.0 0.3000 0.0302 0.1005 1.2 1.8
13..14 0.191 39.0 18.0 0.3000 0.0368 0.1226 1.4 2.2
14..15 0.056 39.0 18.0 0.3000 0.0108 0.0361 0.4 0.6
15..10 0.055 39.0 18.0 0.3000 0.0106 0.0353 0.4 0.6
15..11 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
15..8 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
15..9 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
14..3 0.000 39.0 18.0 0.3000 0.0000 0.0000 0.0 0.0
13..7 0.245 39.0 18.0 0.3000 0.0470 0.1568 1.8 2.8
Time used: 1:23
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 4, 5, 6, (((10, 11, 8, 9), 3), 7)); MP score: 11
lnL(ntime: 14 np: 19): -127.570896 +0.000000
12..1 12..2 12..4 12..5 12..6 12..13 13..14 14..15 15..10 15..11 15..8 15..9 14..3 13..7
0.000004 0.000004 0.000004 0.055902 0.000004 0.205407 0.163085 0.055391 0.054070 0.000004 0.000004 0.000004 0.000004 0.288243 10.312470 0.805159 0.005000 99.000000 3.976885
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.822131
(1: 0.000004, 2: 0.000004, 4: 0.000004, 5: 0.055902, 6: 0.000004, (((10: 0.054070, 11: 0.000004, 8: 0.000004, 9: 0.000004): 0.055391, 3: 0.000004): 0.163085, 7: 0.288243): 0.205407);
(C1: 0.000004, C2: 0.000004, C4: 0.000004, C5: 0.055902, C6: 0.000004, (((C10: 0.054070, C11: 0.000004, C8: 0.000004, C9: 0.000004): 0.055391, C3: 0.000004): 0.163085, C7: 0.288243): 0.205407);
Detailed output identifying parameters
kappa (ts/tv) = 10.31247
Parameters in M8 (beta&w>1):
p0 = 0.80516 p = 0.00500 q = 99.00000
(p1 = 0.19484) w = 3.97688
MLEs of dN/dS (w) for site classes (K=11)
p: 0.08052 0.08052 0.08052 0.08052 0.08052 0.08052 0.08052 0.08052 0.08052 0.08052 0.19484
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 3.97688
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
12..1 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..2 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..4 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..5 0.056 38.5 18.5 0.7749 0.0170 0.0220 0.7 0.4
12..6 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
12..13 0.205 38.5 18.5 0.7749 0.0626 0.0807 2.4 1.5
13..14 0.163 38.5 18.5 0.7749 0.0497 0.0641 1.9 1.2
14..15 0.055 38.5 18.5 0.7749 0.0169 0.0218 0.6 0.4
15..10 0.054 38.5 18.5 0.7749 0.0165 0.0213 0.6 0.4
15..11 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
15..8 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
15..9 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
14..3 0.000 38.5 18.5 0.7749 0.0000 0.0000 0.0 0.0
13..7 0.288 38.5 18.5 0.7749 0.0878 0.1133 3.4 2.1
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
1 G 1.000** 3.977
2 T 1.000** 3.977
4 I 1.000** 3.977
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: C1)
Pr(w>1) post mean +- SE for w
1 G 0.633 3.510 +- 2.952
2 T 0.926 5.238 +- 2.828
4 I 0.640 3.521 +- 2.928
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.000 0.001 0.002 0.004 0.012 0.038 0.107 0.241 0.361 0.235
p : 0.328 0.196 0.130 0.092 0.068 0.053 0.042 0.035 0.029 0.025
q : 0.018 0.047 0.067 0.085 0.100 0.114 0.126 0.137 0.148 0.158
ws: 0.083 0.121 0.136 0.131 0.118 0.104 0.091 0.080 0.071 0.064
Time used: 2:34
Model 1: NearlyNeutral -129.073300 Model 2: PositiveSelection -127.570905 Model 7: beta -129.084400 Model 8: beta&w>1 -127.570896 Model 2 vs 1 3.004790 Model 8 vs 7 3.027008
Not all of the following information may be relevant for the case being handled, since this project may be part of a much larger auto-PSS-genome project where several methods of detection of positively selected sites have been used. As such the aligned.score_ascii file may have more sequences than the file effectively used to detect positively selected codons, since the content of this file reflects the content of the file used for the master alignment, from which a subsample may have been taken. # ### General parameters ### # # The maximum number of sequences to use for the master file sequence_limit=90 # The random seed random_seed=3976763 # ### Alignment ### # # The alignment method: clustalw, muscle, kalign, t_coffee, or amap align_method=muscle # Minimum support value for amino acid positions in the alignment tcoffee_min_score=3 # ### MrBayes ### # # Number of iterations in MrBayes mrbayes_generations=1000000 # MrBayes burnin mrbayes_burnin=2500 # ### FUBAR ### # # The maximum number of sequences to be used by FUBAR. fubar_sequence_limit=90 # The number of FUBAR runs fubar_runs=1 # ### codeML ### # # The maximum number of sequences to be used by CodeML codeml_sequence_limit=30 # The number of CodeML runs codeml_runs=1 # The CodeML models to be run, one or more of: '1', '2', '7', and/or '8'. codeml_models=1 2 7 8 # ### OmegaMap ### # # The maximum number of sequences to use in OmegaMap omegamap_sequence_limit=90 # The number of OmegaMap runs omegamap_runs=1 # The number of OmegaMap iterations omegamap_iterations=2500
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
