--- EXPERIMENT NOTES




 --- EXPERIMENT PROPERTIES

#Thu Jan 23 14:43:09 GMT 2020
codeml.models=0 1 2 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=MUSCLE
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/11res/rplR/input.fasta
input.names=
mrbayes.params=
codeml.params=



 --- PSRF SUMMARY

      Estimated marginal likelihoods for runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)

(Values are saved to the file /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)

Run   Arithmetic mean   Harmonic mean
--------------------------------------
1       -495.83          -499.27
2       -495.85          -499.02
--------------------------------------
TOTAL     -495.84          -499.16
--------------------------------------


Model parameter summaries over the runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".

95% HPD Interval
--------------------
Parameter         Mean      Variance     Lower       Upper       Median    min ESS*  avg ESS    PSRF+
------------------------------------------------------------------------------------------------------
TL{all}         0.894794    0.090541    0.366590    1.486165    0.867773   1501.00   1501.00    1.000
r(A<->C){all}   0.172540    0.019885    0.000008    0.451878    0.136883    196.25    249.93    1.006
r(A<->G){all}   0.164748    0.018710    0.000031    0.433407    0.129447    164.97    188.57    1.000
r(A<->T){all}   0.166116    0.020165    0.000082    0.446244    0.129437    141.84    184.71    1.000
r(C<->G){all}   0.164659    0.020992    0.000002    0.468278    0.122273    198.94    227.56    1.007
r(C<->T){all}   0.167516    0.020705    0.000072    0.447906    0.129617    180.73    203.31    1.000
r(G<->T){all}   0.164422    0.017665    0.000030    0.418061    0.133910    274.30    354.31    1.000
pi(A){all}      0.183652    0.000410    0.145234    0.222549    0.183123   1334.06   1354.12    1.001
pi(C){all}      0.276282    0.000541    0.232389    0.323024    0.276021   1137.29   1150.81    1.000
pi(G){all}      0.348832    0.000599    0.299571    0.396177    0.348527   1142.41   1162.18    1.000
pi(T){all}      0.191233    0.000434    0.150742    0.232149    0.191058    864.14   1084.96    1.000
alpha{1,2}      0.420395    0.236149    0.000135    1.444660    0.244740   1055.58   1150.89    1.000
alpha{3}        0.456416    0.249838    0.000168    1.505327    0.281660   1102.65   1118.90    1.000
pinvar{all}     0.995548    0.000027    0.985239    1.000000    0.997274   1303.10   1402.05    1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.


Setting sumt conformat to Simple



 --- CODEML SUMMARY

Model 1: NearlyNeutral	-476.708168
Model 2: PositiveSelection	-476.708133
Model 0: one-ratio	-476.708129
Model 7: beta	-476.708168
Model 8: beta&w>1	-476.708129


Model 0 vs 1	7.80000000304426E-5

Model 2 vs 1	7.000000005064066E-5

Model 8 vs 7	7.80000000304426E-5
>C1
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C2
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C3
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C4
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C5
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C6
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=123 

C1              -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C2              -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C3              -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C4              -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C5              VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C6              VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
                 *************************************************

C1              TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C2              TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C3              TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C4              TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C5              TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C6              TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
                **************************************************

C1              GYTYGGRIAALADSVRENGLNFo
C2              GYTYGGRIAALADSVRENGLNFo
C3              GYTYGGRIAALADSVRENGLNFo
C4              GYTYGGRIAALADSVRENGLNFo
C5              GYTYGGRIAALADSVRENGLNF-
C6              GYTYGGRIAALADSVRENGLNF-
                ********************** 




PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log      	S	[0] 
-genepred_score	S	[0] 	nsd
-run_name      	S	[0] 
-mem_mode      	S	[0] 	mem
-extend        	D	[1] 	1 
-extend_mode   	S	[0] 	very_fast_triplet
-max_n_pair    	D	[0] 	10 
-seq_name_for_quadruplet	S	[0] 	all
-compact       	S	[0] 	default
-clean         	S	[0] 	no
-do_self       	FL	[0] 	0
-do_normalise  	D	[0] 	1000 
-template_file 	S	[0] 
-setenv        	S	[0] 	0
-template_mode 	S	[0] 
-flip          	D	[0] 	0 
-remove_template_file	D	[0] 	0 
-profile_template_file	S	[0] 
-in            	S	[0] 
-seq           	S	[0] 
-aln           	S	[0] 
-method_limits 	S	[0] 
-method        	S	[0] 
-lib           	S	[0] 
-profile       	S	[0] 
-profile1      	S	[0] 
-profile2      	S	[0] 
-pdb           	S	[0] 
-relax_lib     	D	[0] 	1 
-filter_lib    	D	[0] 	0 
-shrink_lib    	D	[0] 	0 
-out_lib       	W_F	[0] 	no
-out_lib_mode  	S	[0] 	primary
-lib_only      	D	[0] 	0 
-outseqweight  	W_F	[0] 	no
-dpa           	FL	[0] 	0
-seq_source    	S	[0] 	ANY
-cosmetic_penalty	D	[0] 	0 
-gapopen       	D	[0] 	0 
-gapext        	D	[0] 	0 
-fgapopen      	D	[0] 	0 
-fgapext       	D	[0] 	0 
-nomatch       	D	[0] 	0 
-newtree       	W_F	[0] 	default
-tree          	W_F	[0] 	NO
-usetree       	R_F	[0] 
-tree_mode     	S	[0] 	nj
-distance_matrix_mode	S	[0] 	ktup
-distance_matrix_sim_mode	S	[0] 	idmat_sim1
-quicktree     	FL	[0] 	0
-outfile       	W_F	[0] 	default
-maximise      	FL	[1] 	1
-output        	S	[1] 	score_ascii	html	score_ascii
-len           	D	[0] 	0 
-infile        	R_F	[1] 	input.prot.fasta.muscle_rs_0_0.fasta.aln
-matrix        	S	[0] 	default
-tg_mode       	D	[0] 	1 
-profile_mode  	S	[0] 	cw_profile_profile
-profile_comparison	S	[0] 	profile
-dp_mode       	S	[0] 	linked_pair_wise
-ktuple        	D	[0] 	1 
-ndiag         	D	[0] 	0 
-diag_threshold	D	[0] 	0 
-diag_mode     	D	[0] 	0 
-sim_matrix    	S	[0] 	vasiliky
-transform     	S	[0] 
-extend_seq    	FL	[0] 	0
-outorder      	S	[0] 	input
-inorder       	S	[0] 	aligned
-seqnos        	S	[0] 	off
-case          	S	[0] 	keep
-cpu           	D	[0] 	0 
-maxnseq       	D	[0] 	1000 
-maxlen        	D	[0] 	-1 
-sample_dp     	D	[0] 	0 
-weight        	S	[0] 	default
-seq_weight    	S	[0] 	no
-align         	FL	[1] 	1
-mocca         	FL	[0] 	0
-domain        	FL	[0] 	0
-start         	D	[0] 	0 
-len           	D	[0] 	0 
-scale         	D	[0] 	0 
-mocca_interactive	FL	[0] 	0
-method_evaluate_mode	S	[0] 	default
-evaluate_mode 	S	[1] 	t_coffee_fast
-get_type      	FL	[0] 	0
-clean_aln     	D	[0] 	0 
-clean_threshold	D	[1] 	1 
-clean_iteration	D	[1] 	1 
-clean_evaluate_mode	S	[0] 	t_coffee_fast
-extend_matrix 	FL	[0] 	0
-prot_min_sim  	D	[40] 	40 
-prot_max_sim  	D	[90] 	90 
-prot_min_cov  	D	[40] 	40 
-pdb_type      	S	[0] 	d
-pdb_min_sim   	D	[35] 	35 
-pdb_max_sim   	D	[100] 	100 
-pdb_min_cov   	D	[50] 	50 
-pdb_blast_server	W_F	[0] 	EBI
-blast         	W_F	[0] 
-blast_server  	W_F	[0] 	EBI
-pdb_db        	W_F	[0] 	pdb
-protein_db    	W_F	[0] 	uniprot
-method_log    	W_F	[0] 	no
-struc_to_use  	S	[0] 
-cache         	W_F	[0] 	use
-align_pdb_param_file	W_F	[0] 	no
-align_pdb_hasch_mode	W_F	[0] 	hasch_ca_trace_bubble
-external_aligner	S	[0] 	NO
-msa_mode      	S	[0] 	tree
-master        	S	[0] 	no
-blast_nseq    	D	[0] 	0 
-lalign_n_top  	D	[0] 	10 
-iterate       	D	[1] 	0 
-trim          	D	[0] 	0 
-split         	D	[0] 	0 
-trimfile      	S	[0] 	default
-split         	D	[0] 	0 
-split_nseq_thres	D	[0] 	0 
-split_score_thres	D	[0] 	0 
-check_pdb_status	D	[0] 	0 
-clean_seq_name	D	[0] 	0 
-seq_to_keep   	S	[0] 
-dpa_master_aln	S	[0] 
-dpa_maxnseq   	D	[0] 	0 
-dpa_min_score1	D	[0] 
-dpa_min_score2	D	[0] 
-dpa_keep_tmpfile	FL	[0] 	0
-dpa_debug     	D	[0] 	0 
-multi_core    	S	[0] 	templates_jobs_relax_msa_evaluate
-n_core        	D	[0] 	0 
-max_n_proc    	D	[0] 	0 
-lib_list      	S	[0] 
-prune_lib_mode	S	[0] 	5
-tip           	S	[0] 	none
-rna_lib       	S	[0] 
-no_warning    	D	[0] 	0 
-run_local_script	D	[0] 	0 
-plugins       	S	[0] 	default
-proxy         	S	[0] 	unset
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length  122 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length  122 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [3708]

Library Relaxation: Multi_proc [96]
 
Relaxation Summary: [3708]--->[3708]



UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1


OUTPUT RESULTS
	#### File Type= MSA             Format= score_ascii     Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
	#### File Type= MSA             Format= html            Name= input.prot.fasta.muscle_rs_0_0.fasta.html
	#### File Type= MSA             Format= score_ascii     Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii

# Command Line: t_coffee -infile input.prot.fasta.muscle_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast  [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.460 Mb, Max= 30.652 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/

FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment

C1              VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C2              VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C3              VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C4              VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C5              VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C6              VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
                **************************************************

C1              GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C2              GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C3              GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C4              GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C5              GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C6              GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
                **************************************************

C1              YTYGGRIAALADSVRENGLNF
C2              YTYGGRIAALADSVRENGLNF
C3              YTYGGRIAALADSVRENGLNF
C4              YTYGGRIAALADSVRENGLNF
C5              YTYGGRIAALADSVRENGLNF
C6              YTYGGRIAALADSVRENGLNF
                *********************




FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.muscle_rs_0_0.fasta.aln I:93 S:99 BS:94
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES 
BOT	    0    1	 100.00 C1	 C2	 100.00
TOP	    1    0	 100.00 C2	 C1	 100.00
BOT	    0    2	 100.00 C1	 C3	 100.00
TOP	    2    0	 100.00 C3	 C1	 100.00
BOT	    0    3	 100.00 C1	 C4	 100.00
TOP	    3    0	 100.00 C4	 C1	 100.00
BOT	    0    4	 100.00 C1	 C5	 100.00
TOP	    4    0	 100.00 C5	 C1	 100.00
BOT	    0    5	 100.00 C1	 C6	 100.00
TOP	    5    0	 100.00 C6	 C1	 100.00
BOT	    1    2	 100.00 C2	 C3	 100.00
TOP	    2    1	 100.00 C3	 C2	 100.00
BOT	    1    3	 100.00 C2	 C4	 100.00
TOP	    3    1	 100.00 C4	 C2	 100.00
BOT	    1    4	 100.00 C2	 C5	 100.00
TOP	    4    1	 100.00 C5	 C2	 100.00
BOT	    1    5	 100.00 C2	 C6	 100.00
TOP	    5    1	 100.00 C6	 C2	 100.00
BOT	    2    3	 100.00 C3	 C4	 100.00
TOP	    3    2	 100.00 C4	 C3	 100.00
BOT	    2    4	 100.00 C3	 C5	 100.00
TOP	    4    2	 100.00 C5	 C3	 100.00
BOT	    2    5	 100.00 C3	 C6	 100.00
TOP	    5    2	 100.00 C6	 C3	 100.00
BOT	    3    4	 100.00 C4	 C5	 100.00
TOP	    4    3	 100.00 C5	 C4	 100.00
BOT	    3    5	 100.00 C4	 C6	 100.00
TOP	    5    3	 100.00 C6	 C4	 100.00
BOT	    4    5	 100.00 C5	 C6	 100.00
TOP	    5    4	 100.00 C6	 C5	 100.00
AVG	 0	 C1	  *	 100.00
AVG	 1	 C2	  *	 100.00
AVG	 2	 C3	  *	 100.00
AVG	 3	 C4	  *	 100.00
AVG	 4	 C5	  *	 100.00
AVG	 5	 C6	  *	 100.00
TOT	 TOT	  *	 100.00
CLUSTAL W (1.83) multiple sequence alignment

C1              ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C2              ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C3              ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C4              ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C5              GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C6              GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
                   ***********************************************

C1              CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C2              CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C3              CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C4              CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C5              CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C6              CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
                **************************************************

C1              TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C2              TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C3              TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C4              TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C5              TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C6              TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
                **************************************************

C1              ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C2              ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C3              ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C4              ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C5              ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C6              ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
                **************************************************

C1              TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C2              TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C3              TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C4              TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C5              TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C6              TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
                **************************************************

C1              CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C2              CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C3              CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C4              CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C5              CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C6              CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
                **************************************************

C1              GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C2              GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C3              GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C4              GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C5              GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C6              GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
                **************************************************

C1              GAACGGATTGAATTTC---
C2              GAACGGATTGAATTTC---
C3              GAACGGATTGAATTTC---
C4              GAACGGATTGAATTTC---
C5              GAACGGATTGAATTTC---
C6              GAACGGATTGAATTTC---
                ****************   



>C1
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C2
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C3
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C4
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C5
GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C6
GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C1
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C2
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C3
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C4
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C5
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C6
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF


                            MrBayes v3.2.2 x64

                      (Bayesian Analysis of Phylogeny)

              Distributed under the GNU General Public License


               Type "help" or "help <command>" for information
                     on the commands that are available.

                   Type "about" for authorship and general
                       information about the program.



   Executing file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
   UNIX line termination
   Longest line length = 63
   Parsing file
   Expecting NEXUS formatted file
   Reading data block
      Allocated taxon set
      Allocated matrix
      Defining new matrix with 6 taxa and 369 characters
      Missing data coded as ?
      Data matrix is interleaved
      Data is Dna
      Gaps coded as -
      Matching characters coded as .
      Taxon 1 -> C1
      Taxon 2 -> C2
      Taxon 3 -> C3
      Taxon 4 -> C4
      Taxon 5 -> C5
      Taxon 6 -> C6
      Successfully read matrix
      Setting default partition (does not divide up characters)
      Setting model defaults
      Seed (for generating default start values) = 1579790505
      Setting output file names to "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
   Exiting data block
   Reading mrbayes block
      Setting autoclose to yes
      Setting nowarnings to yes
      Defining charset called first_pos
      Defining charset called second_pos
      Defining charset called third_pos
      Defining partition called by_codon
      Setting by_codon as the partition, dividing characters into 3 parts.
      Setting model defaults
      Seed (for generating default start values) = 1882261152
      Setting Nst to 6 for partition 1
      Setting Nst to 6 for partition 2
      Setting Nst to 6 for partition 3
      Setting Rates to Invgamma for partition 1
      Setting Rates to Invgamma for partition 2
      Setting Rates to Invgamma for partition 3
      Successfully set likelihood model parameters to all
         applicable data partitions 
      Unlinking
      Setting number of generations to 1000000
      Running Markov chain
      MCMC stamp = 0755050800
      Seed = 143950338
      Swapseed = 1579790505
      Model settings:

         Settings for partition 1 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

         Settings for partition 2 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

         Settings for partition 3 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

      Active parameters: 

                          Partition(s)
         Parameters       1  2  3
         ------------------------
         Revmat           1  1  1
         Statefreq        2  2  2
         Shape            3  3  4
         Pinvar           5  5  5
         Ratemultiplier   6  6  6
         Topology         7  7  7
         Brlens           8  8  8
         ------------------------

         Parameters can be linked or unlinked across partitions using 'link' and 'unlink'

         1 --  Parameter  = Revmat{all}
               Type       = Rates of reversible rate matrix
               Prior      = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
               Partitions = All

         2 --  Parameter  = Pi{all}
               Type       = Stationary state frequencies
               Prior      = Dirichlet
               Partitions = All

         3 --  Parameter  = Alpha{1,2}
               Type       = Shape of scaled gamma distribution of site rates
               Prior      = Exponential(2.00)
               Partitions = 1 and 2

         4 --  Parameter  = Alpha{3}
               Type       = Shape of scaled gamma distribution of site rates
               Prior      = Exponential(2.00)
               Partition  = 3

         5 --  Parameter  = Pinvar{all}
               Type       = Proportion of invariable sites
               Prior      = Uniform(0.00,1.00)
               Partitions = All

         6 --  Parameter  = Ratemultiplier{all}
               Type       = Partition-specific rate multiplier
               Prior      = Fixed(1.0)
               Partitions = All

         7 --  Parameter  = Tau{all}
               Type       = Topology
               Prior      = All topologies equally probable a priori
               Partitions = All
               Subparam.  = V{all}

         8 --  Parameter  = V{all}
               Type       = Branch lengths
               Prior      = Unconstrained:Exponential(10.0)
               Partitions = All



      The MCMC sampler will use the following moves:
         With prob.  Chain will use move
            1.06 %   Dirichlet(Revmat{all})
            1.06 %   Slider(Revmat{all})
            1.06 %   Dirichlet(Pi{all})
            1.06 %   Slider(Pi{all})
            2.13 %   Multiplier(Alpha{1,2})
            2.13 %   Multiplier(Alpha{3})
            2.13 %   Slider(Pinvar{all})
           10.64 %   ExtSPR(Tau{all},V{all})
           10.64 %   ExtTBR(Tau{all},V{all})
           10.64 %   NNI(Tau{all},V{all})
           10.64 %   ParsSPR(Tau{all},V{all})
           31.91 %   Multiplier(V{all})
           10.64 %   Nodeslider(V{all})
            4.26 %   TLMultiplier(V{all})

      Division 1 has 6 unique site patterns
      Division 2 has 6 unique site patterns
      Division 3 has 6 unique site patterns
      Initializing conditional likelihoods
      Using standard SSE likelihood calculator for division 1 (single-precision)
      Using standard SSE likelihood calculator for division 2 (single-precision)
      Using standard SSE likelihood calculator for division 3 (single-precision)
      Initializing invariable-site conditional likelihoods

      Initial log likelihoods and log prior probs for run 1:
         Chain 1 -- -817.898725 -- -24.965149
         Chain 2 -- -817.408960 -- -24.965149
         Chain 3 -- -817.408960 -- -24.965149
         Chain 4 -- -817.408960 -- -24.965149

      Initial log likelihoods and log prior probs for run 2:
         Chain 1 -- -817.660696 -- -24.965149
         Chain 2 -- -817.898678 -- -24.965149
         Chain 3 -- -817.408960 -- -24.965149
         Chain 4 -- -817.408960 -- -24.965149


      Using a relative burnin of 25.0 % for diagnostics

      Chain results (1000000 generations requested):

          0 -- [-817.899] (-817.409) (-817.409) (-817.409) * [-817.661] (-817.899) (-817.409) (-817.409) 
        500 -- (-502.614) [-503.692] (-504.198) (-504.371) * (-515.039) (-506.196) (-513.910) [-505.808] -- 0:00:00
       1000 -- (-505.531) [-507.763] (-505.515) (-504.750) * [-511.335] (-504.250) (-503.403) (-514.318) -- 0:00:00
       1500 -- (-512.436) (-508.493) (-505.715) [-504.185] * (-502.553) (-504.332) (-511.753) [-501.551] -- 0:00:00
       2000 -- (-502.712) (-504.359) [-504.980] (-502.463) * (-514.776) [-505.787] (-508.178) (-508.026) -- 0:00:00
       2500 -- (-507.617) [-514.817] (-506.470) (-508.815) * (-500.526) (-506.992) [-510.250] (-506.057) -- 0:00:00
       3000 -- (-503.490) [-502.689] (-503.050) (-508.159) * (-505.243) (-509.457) [-500.996] (-506.372) -- 0:00:00
       3500 -- (-513.297) [-500.025] (-513.157) (-511.593) * (-510.008) (-506.547) (-504.845) [-509.367] -- 0:00:00
       4000 -- (-502.460) (-505.485) (-508.205) [-497.498] * (-505.207) [-508.536] (-510.089) (-502.590) -- 0:00:00
       4500 -- (-501.910) (-504.319) [-510.587] (-515.433) * (-505.003) (-512.271) [-508.232] (-501.883) -- 0:00:00
       5000 -- [-499.048] (-507.803) (-504.423) (-499.322) * (-503.524) (-500.505) [-507.074] (-509.939) -- 0:00:00

      Average standard deviation of split frequencies: 0.061488

       5500 -- (-501.809) (-505.416) (-511.680) [-506.415] * (-519.434) (-496.817) [-503.244] (-510.138) -- 0:00:00
       6000 -- (-507.583) (-505.181) (-503.276) [-501.367] * [-507.354] (-496.881) (-508.752) (-510.363) -- 0:00:00
       6500 -- (-504.301) (-503.608) [-501.356] (-501.292) * (-510.297) (-498.549) (-507.913) [-501.144] -- 0:00:00
       7000 -- (-504.028) (-504.240) (-511.292) [-502.165] * (-501.092) (-497.930) [-506.400] (-513.631) -- 0:00:00
       7500 -- (-504.944) (-507.572) (-509.362) [-504.476] * [-505.220] (-499.513) (-504.999) (-508.779) -- 0:00:00
       8000 -- (-501.819) (-511.073) [-506.116] (-504.436) * (-509.395) [-496.309] (-507.703) (-512.819) -- 0:00:00
       8500 -- (-502.858) (-500.869) (-512.688) [-502.323] * (-511.906) [-496.603] (-502.040) (-510.973) -- 0:00:00
       9000 -- (-507.885) (-501.933) (-508.284) [-501.411] * (-513.704) (-496.693) [-507.807] (-503.102) -- 0:00:00
       9500 -- [-506.839] (-505.961) (-508.069) (-512.928) * (-505.758) (-498.813) (-502.702) [-507.575] -- 0:00:00
      10000 -- (-507.379) (-511.022) [-508.184] (-502.631) * [-504.235] (-496.763) (-504.127) (-510.990) -- 0:00:00

      Average standard deviation of split frequencies: 0.062392

      10500 -- (-502.603) (-509.515) [-503.383] (-506.378) * [-505.230] (-499.324) (-505.043) (-508.517) -- 0:00:00
      11000 -- [-498.295] (-506.575) (-510.188) (-508.361) * (-505.093) (-500.313) [-502.663] (-510.873) -- 0:00:00
      11500 -- (-501.325) (-507.813) [-503.838] (-522.142) * (-511.615) [-495.823] (-498.587) (-502.642) -- 0:00:00
      12000 -- (-508.001) (-510.845) (-507.848) [-495.864] * (-505.671) [-497.021] (-508.496) (-502.700) -- 0:00:00
      12500 -- (-508.904) (-502.323) [-503.800] (-494.396) * (-505.052) [-497.970] (-502.535) (-506.020) -- 0:00:00
      13000 -- (-506.712) (-510.931) (-509.310) [-495.228] * (-500.485) (-497.062) (-502.087) [-502.387] -- 0:01:15
      13500 -- [-511.521] (-515.905) (-509.592) (-499.495) * (-502.086) (-494.612) [-507.623] (-503.958) -- 0:01:13
      14000 -- [-507.916] (-507.682) (-518.437) (-498.528) * (-503.110) (-498.604) [-507.137] (-508.793) -- 0:01:10
      14500 -- [-502.842] (-511.938) (-496.303) (-496.586) * (-500.585) [-502.345] (-506.585) (-508.469) -- 0:01:07
      15000 -- (-514.389) (-518.605) [-496.397] (-496.344) * (-504.024) (-497.340) (-504.923) [-504.136] -- 0:01:05

      Average standard deviation of split frequencies: 0.058926

      15500 -- [-506.485] (-499.313) (-499.339) (-500.543) * [-505.240] (-497.601) (-501.428) (-519.957) -- 0:01:03
      16000 -- [-500.414] (-500.450) (-496.601) (-499.222) * [-507.973] (-496.430) (-502.492) (-515.870) -- 0:01:01
      16500 -- (-506.290) (-506.630) [-495.725] (-496.506) * (-504.220) (-501.901) [-507.292] (-501.045) -- 0:00:59
      17000 -- (-509.823) (-510.757) [-498.105] (-497.033) * [-506.631] (-501.224) (-501.480) (-504.728) -- 0:00:57
      17500 -- (-511.952) (-512.171) [-499.714] (-499.479) * [-498.567] (-499.910) (-504.352) (-495.148) -- 0:00:56
      18000 -- (-501.208) (-513.093) (-497.322) [-496.189] * (-504.766) [-494.403] (-508.712) (-499.889) -- 0:00:54
      18500 -- (-501.784) (-513.130) (-496.969) [-496.557] * (-508.281) (-497.778) (-512.879) [-496.278] -- 0:00:53
      19000 -- [-508.067] (-503.223) (-497.657) (-495.723) * [-503.321] (-502.348) (-512.937) (-499.032) -- 0:00:51
      19500 -- (-507.250) (-507.224) (-496.363) [-497.538] * (-506.530) [-497.120] (-506.300) (-501.026) -- 0:00:50
      20000 -- [-502.691] (-508.764) (-494.911) (-495.935) * [-503.128] (-497.843) (-505.701) (-495.549) -- 0:00:49

      Average standard deviation of split frequencies: 0.044479

      20500 -- (-505.766) (-516.062) (-497.212) [-501.222] * (-504.098) [-496.287] (-505.366) (-496.809) -- 0:00:47
      21000 -- [-502.109] (-500.940) (-497.675) (-497.754) * (-509.414) [-496.504] (-507.798) (-498.681) -- 0:00:46
      21500 -- (-506.775) [-494.842] (-497.673) (-500.349) * (-514.193) [-496.938] (-506.272) (-496.282) -- 0:00:45
      22000 -- (-510.171) (-496.486) [-494.649] (-498.928) * [-503.765] (-497.250) (-505.533) (-495.459) -- 0:00:44
      22500 -- (-503.324) (-497.444) [-494.958] (-497.970) * [-502.836] (-496.550) (-509.542) (-495.998) -- 0:00:43
      23000 -- [-507.050] (-495.914) (-496.148) (-499.130) * (-508.276) (-495.117) [-509.053] (-497.942) -- 0:00:42
      23500 -- (-507.025) (-496.006) (-494.173) [-497.168] * (-513.202) [-494.638] (-519.704) (-498.925) -- 0:00:41
      24000 -- (-505.199) (-498.664) [-495.560] (-498.960) * (-507.466) (-494.666) [-504.557] (-495.211) -- 0:00:40
      24500 -- (-510.270) [-496.960] (-495.737) (-494.265) * [-505.780] (-495.236) (-510.684) (-496.138) -- 0:00:39
      25000 -- (-504.501) [-494.971] (-496.293) (-495.484) * [-510.769] (-495.483) (-508.059) (-495.410) -- 0:00:39

      Average standard deviation of split frequencies: 0.033109

      25500 -- (-523.411) [-496.534] (-496.067) (-495.877) * (-508.764) [-502.519] (-505.048) (-499.348) -- 0:00:38
      26000 -- (-503.311) (-498.663) [-495.100] (-495.227) * (-502.043) [-496.803] (-499.739) (-499.103) -- 0:00:37
      26500 -- (-495.623) [-499.834] (-497.051) (-497.224) * (-512.167) (-496.617) (-496.726) [-497.121] -- 0:00:36
      27000 -- (-498.268) (-497.143) [-496.000] (-494.629) * [-502.418] (-499.726) (-494.897) (-497.598) -- 0:00:36
      27500 -- (-496.017) [-494.466] (-494.751) (-494.443) * (-505.162) (-494.606) (-494.422) [-495.883] -- 0:01:10
      28000 -- (-498.525) [-496.968] (-497.939) (-495.060) * (-504.128) (-495.951) (-494.768) [-499.146] -- 0:01:09
      28500 -- [-496.227] (-497.800) (-498.998) (-495.814) * (-508.902) (-498.140) (-495.915) [-497.768] -- 0:01:08
      29000 -- (-495.274) (-495.506) (-498.995) [-497.236] * [-508.207] (-495.862) (-497.034) (-496.758) -- 0:01:06
      29500 -- (-495.457) [-494.519] (-496.990) (-497.181) * [-503.777] (-496.633) (-499.940) (-495.674) -- 0:01:05
      30000 -- [-495.227] (-499.623) (-498.849) (-497.617) * (-507.454) (-495.975) (-500.739) [-495.650] -- 0:01:04

      Average standard deviation of split frequencies: 0.035868

      30500 -- (-495.001) (-499.754) (-497.998) [-496.571] * (-506.859) (-496.293) (-495.835) [-497.092] -- 0:01:03
      31000 -- (-496.406) (-498.449) [-497.496] (-496.748) * (-504.566) [-495.014] (-496.798) (-495.407) -- 0:01:02
      31500 -- (-496.452) [-495.956] (-494.601) (-498.595) * (-502.486) (-496.132) [-494.787] (-497.788) -- 0:01:01
      32000 -- (-496.987) (-496.399) (-502.772) [-495.093] * (-512.117) (-496.813) [-495.053] (-497.474) -- 0:01:00
      32500 -- (-498.175) (-497.051) (-497.807) [-495.267] * (-509.884) (-497.181) [-498.275] (-496.803) -- 0:00:59
      33000 -- (-498.485) (-496.052) [-495.366] (-499.647) * [-508.564] (-499.181) (-497.249) (-498.625) -- 0:00:58
      33500 -- [-499.713] (-496.317) (-496.879) (-499.506) * (-504.043) (-496.886) [-496.337] (-498.860) -- 0:00:57
      34000 -- (-498.519) (-495.415) (-496.615) [-499.584] * (-501.851) (-500.307) [-494.393] (-496.386) -- 0:00:56
      34500 -- (-498.752) (-495.645) (-494.875) [-496.287] * [-507.886] (-496.588) (-494.373) (-495.590) -- 0:00:55
      35000 -- (-498.601) [-494.335] (-497.264) (-499.127) * [-497.537] (-495.776) (-496.513) (-496.610) -- 0:00:55

      Average standard deviation of split frequencies: 0.039284

      35500 -- (-496.021) [-495.189] (-496.649) (-494.531) * (-494.967) [-498.043] (-495.403) (-497.283) -- 0:00:54
      36000 -- [-494.920] (-496.185) (-498.379) (-496.563) * (-498.105) [-496.876] (-499.811) (-497.332) -- 0:00:53
      36500 -- (-496.250) [-497.584] (-497.395) (-498.073) * (-498.385) (-496.129) [-497.129] (-496.269) -- 0:00:52
      37000 -- (-495.930) (-498.076) (-494.605) [-500.321] * (-499.554) [-497.284] (-498.022) (-494.467) -- 0:00:52
      37500 -- (-495.735) (-498.056) (-497.474) [-498.867] * [-495.177] (-498.693) (-497.052) (-494.446) -- 0:00:51
      38000 -- (-496.196) [-496.968] (-498.688) (-496.611) * (-496.415) (-494.667) (-495.400) [-497.222] -- 0:00:50
      38500 -- (-500.675) (-498.133) [-494.772] (-499.612) * [-496.020] (-496.058) (-497.101) (-496.192) -- 0:00:49
      39000 -- (-499.161) (-498.877) [-496.576] (-497.661) * (-501.833) [-498.250] (-494.518) (-496.249) -- 0:00:49
      39500 -- (-498.357) (-495.478) [-495.620] (-495.815) * [-502.895] (-496.969) (-497.938) (-495.971) -- 0:00:48
      40000 -- (-497.559) (-495.009) [-494.850] (-497.572) * (-500.503) (-495.337) (-495.145) [-498.166] -- 0:00:48

      Average standard deviation of split frequencies: 0.042097

      40500 -- (-497.240) [-498.824] (-497.449) (-496.045) * [-500.510] (-495.547) (-494.618) (-497.888) -- 0:00:47
      41000 -- (-496.047) (-497.019) [-499.077] (-496.411) * (-498.072) (-496.248) (-496.834) [-496.170] -- 0:00:46
      41500 -- [-494.870] (-496.058) (-497.696) (-497.346) * (-498.182) (-495.445) (-495.103) [-495.414] -- 0:00:46
      42000 -- (-496.080) (-498.800) (-498.702) [-497.294] * (-501.396) (-498.574) [-496.647] (-497.338) -- 0:01:08
      42500 -- (-495.736) (-498.457) (-497.405) [-495.624] * (-499.852) [-495.359] (-497.654) (-496.829) -- 0:01:07
      43000 -- (-498.498) (-498.105) (-496.752) [-495.159] * (-497.404) (-494.627) [-496.236] (-495.396) -- 0:01:06
      43500 -- (-497.482) (-496.803) [-495.720] (-498.003) * (-496.392) [-498.217] (-497.992) (-496.259) -- 0:01:05
      44000 -- (-498.693) (-495.962) [-495.054] (-496.783) * (-499.964) [-498.598] (-498.632) (-498.101) -- 0:01:05
      44500 -- (-495.814) (-497.056) [-495.976] (-497.131) * (-497.440) (-496.709) (-496.757) [-496.302] -- 0:01:04
      45000 -- [-496.331] (-496.938) (-498.175) (-497.052) * (-494.936) (-496.348) [-497.998] (-496.621) -- 0:01:03

      Average standard deviation of split frequencies: 0.042016

      45500 -- (-495.302) (-495.958) (-498.500) [-496.534] * (-497.020) [-498.690] (-497.809) (-495.139) -- 0:01:02
      46000 -- (-498.474) (-495.703) (-498.685) [-497.945] * (-496.209) (-495.061) (-503.100) [-495.675] -- 0:01:02
      46500 -- (-495.703) [-494.940] (-496.515) (-497.012) * [-498.368] (-497.418) (-495.158) (-495.935) -- 0:01:01
      47000 -- (-498.294) (-496.259) (-501.017) [-496.638] * (-498.567) [-497.239] (-495.129) (-494.760) -- 0:01:00
      47500 -- (-495.620) [-497.445] (-496.231) (-495.166) * (-496.060) (-496.291) (-497.092) [-495.797] -- 0:01:00
      48000 -- (-498.196) (-496.951) (-498.482) [-494.758] * (-499.652) [-496.551] (-497.497) (-496.960) -- 0:00:59
      48500 -- (-500.040) (-498.744) [-497.726] (-496.263) * (-499.734) (-495.425) [-497.682] (-499.584) -- 0:00:58
      49000 -- (-497.960) (-497.223) (-496.462) [-495.294] * (-497.129) [-494.621] (-494.548) (-495.323) -- 0:00:58
      49500 -- (-498.469) [-497.497] (-496.861) (-496.092) * (-494.390) (-494.601) [-495.070] (-496.569) -- 0:00:57
      50000 -- (-495.131) [-497.243] (-497.373) (-497.552) * (-497.577) (-497.544) [-495.582] (-495.113) -- 0:00:57

      Average standard deviation of split frequencies: 0.039874

      50500 -- [-495.779] (-496.804) (-496.395) (-497.503) * (-502.389) [-496.082] (-496.744) (-495.239) -- 0:00:56
      51000 -- (-496.420) (-494.711) (-498.689) [-496.100] * (-499.761) [-496.180] (-497.186) (-495.714) -- 0:00:55
      51500 -- (-496.997) [-496.024] (-499.050) (-495.932) * (-497.397) (-498.371) [-494.855] (-496.107) -- 0:00:55
      52000 -- (-496.311) [-496.231] (-496.122) (-494.764) * (-496.806) (-499.888) [-495.386] (-495.432) -- 0:00:54
      52500 -- (-495.757) (-497.937) (-494.576) [-495.971] * [-494.852] (-495.245) (-498.297) (-494.482) -- 0:00:54
      53000 -- (-495.065) (-502.960) (-498.095) [-495.640] * (-496.657) [-495.813] (-497.157) (-496.461) -- 0:00:53
      53500 -- (-496.243) (-497.838) [-494.490] (-495.521) * [-494.247] (-495.252) (-496.222) (-499.710) -- 0:00:53
      54000 -- (-500.003) (-498.841) (-495.039) [-497.886] * (-495.425) (-496.617) (-495.998) [-496.580] -- 0:00:52
      54500 -- (-497.751) [-497.297] (-497.488) (-496.621) * (-498.332) [-496.386] (-497.752) (-497.938) -- 0:00:52
      55000 -- (-495.547) [-495.636] (-502.355) (-500.484) * (-498.056) [-494.760] (-495.326) (-497.198) -- 0:00:51

      Average standard deviation of split frequencies: 0.038482

      55500 -- (-498.641) (-498.510) [-498.406] (-499.268) * (-496.555) (-494.877) [-497.629] (-496.260) -- 0:00:51
      56000 -- (-496.481) [-495.349] (-497.437) (-496.243) * [-497.951] (-496.934) (-496.777) (-495.889) -- 0:00:50
      56500 -- (-497.597) [-497.678] (-500.102) (-497.069) * [-498.372] (-497.771) (-496.758) (-496.067) -- 0:01:06
      57000 -- (-496.065) [-494.280] (-496.581) (-500.033) * (-497.560) (-496.245) (-496.191) [-494.587] -- 0:01:06
      57500 -- (-499.712) (-494.681) [-498.095] (-498.040) * [-495.106] (-494.709) (-497.400) (-495.230) -- 0:01:05
      58000 -- (-497.333) (-496.625) [-498.233] (-497.132) * (-495.344) [-494.809] (-503.198) (-496.153) -- 0:01:04
      58500 -- (-499.953) (-497.682) (-498.031) [-494.906] * (-495.100) (-497.561) (-495.730) [-499.787] -- 0:01:04
      59000 -- (-498.859) (-495.938) (-494.338) [-494.799] * (-499.985) (-495.457) (-496.990) [-498.991] -- 0:01:03
      59500 -- (-497.935) (-498.744) [-495.817] (-494.617) * (-496.892) (-497.610) [-496.283] (-495.792) -- 0:01:03
      60000 -- (-496.193) (-499.666) (-497.952) [-497.513] * (-499.912) (-498.107) (-497.057) [-498.083] -- 0:01:02

      Average standard deviation of split frequencies: 0.039261

      60500 -- (-496.292) (-495.539) [-495.944] (-498.219) * [-495.459] (-499.255) (-494.330) (-497.713) -- 0:01:02
      61000 -- [-497.095] (-496.604) (-495.487) (-494.683) * (-499.339) [-495.774] (-496.660) (-497.302) -- 0:01:01
      61500 -- (-494.853) [-496.179] (-498.346) (-496.271) * (-498.803) [-496.096] (-496.846) (-494.981) -- 0:01:01
      62000 -- (-497.999) [-496.386] (-495.782) (-499.808) * (-496.750) (-496.695) (-497.906) [-495.610] -- 0:01:00
      62500 -- (-496.531) (-496.386) [-495.768] (-495.384) * (-497.250) (-499.681) (-499.304) [-495.500] -- 0:01:00
      63000 -- (-495.246) [-495.480] (-497.739) (-495.329) * (-496.749) [-495.434] (-497.455) (-496.602) -- 0:00:59
      63500 -- (-496.676) (-495.480) [-498.774] (-494.604) * (-499.975) [-496.167] (-499.951) (-497.774) -- 0:00:58
      64000 -- [-496.724] (-497.450) (-498.627) (-496.598) * (-496.913) (-496.098) [-497.017] (-497.536) -- 0:00:58
      64500 -- [-497.350] (-496.367) (-495.802) (-498.513) * (-497.429) (-495.347) (-494.505) [-495.236] -- 0:00:58
      65000 -- [-495.170] (-497.488) (-495.015) (-495.168) * (-496.725) [-500.102] (-495.272) (-495.980) -- 0:00:57

      Average standard deviation of split frequencies: 0.038927

      65500 -- [-496.317] (-495.565) (-494.926) (-495.991) * (-496.392) (-496.938) (-496.978) [-494.927] -- 0:00:57
      66000 -- (-495.167) (-497.339) (-495.301) [-499.480] * (-496.763) (-497.653) [-494.995] (-495.162) -- 0:00:56
      66500 -- (-497.732) (-495.870) (-496.941) [-495.140] * (-497.299) (-494.522) [-497.199] (-498.554) -- 0:00:56
      67000 -- (-497.362) (-496.410) (-496.440) [-494.723] * (-499.952) (-502.325) (-499.732) [-495.402] -- 0:00:55
      67500 -- (-497.592) [-494.908] (-495.934) (-498.757) * [-501.378] (-498.959) (-497.727) (-496.131) -- 0:00:55
      68000 -- (-497.624) (-496.841) (-494.947) [-495.130] * (-497.052) (-497.518) [-495.578] (-495.734) -- 0:00:54
      68500 -- (-497.411) [-496.666] (-494.831) (-496.789) * (-498.090) (-495.804) [-496.967] (-494.514) -- 0:00:54
      69000 -- (-496.658) (-496.223) [-496.791] (-498.153) * [-494.615] (-502.113) (-496.971) (-495.576) -- 0:00:53
      69500 -- (-499.681) [-495.120] (-496.063) (-495.346) * (-494.640) (-495.465) [-495.644] (-497.813) -- 0:00:53
      70000 -- (-497.199) [-496.388] (-501.327) (-496.534) * (-498.545) (-497.648) (-494.716) [-500.424] -- 0:00:53

      Average standard deviation of split frequencies: 0.035461

      70500 -- (-497.441) (-495.774) [-500.342] (-494.962) * (-495.811) (-494.594) (-496.277) [-495.376] -- 0:00:52
      71000 -- (-496.948) [-495.418] (-496.428) (-500.044) * (-495.922) (-494.941) [-495.275] (-495.558) -- 0:00:52
      71500 -- (-496.878) (-495.948) (-495.303) [-496.023] * (-494.964) (-494.865) [-494.645] (-497.174) -- 0:01:04
      72000 -- [-496.066] (-498.293) (-494.970) (-495.027) * (-496.298) [-499.051] (-496.251) (-496.168) -- 0:01:04
      72500 -- (-496.957) [-496.636] (-495.966) (-494.918) * (-496.321) (-498.563) [-494.633] (-497.059) -- 0:01:03
      73000 -- (-498.088) [-497.672] (-496.396) (-496.955) * (-495.898) (-496.762) [-495.152] (-494.772) -- 0:01:03
      73500 -- (-495.424) [-497.155] (-495.183) (-496.850) * (-496.119) (-499.230) [-495.549] (-494.449) -- 0:01:03
      74000 -- (-495.351) [-495.127] (-501.182) (-495.872) * (-496.482) (-496.606) [-496.667] (-496.413) -- 0:01:02
      74500 -- [-494.593] (-496.047) (-500.770) (-498.407) * [-496.435] (-497.096) (-495.938) (-494.814) -- 0:01:02
      75000 -- (-496.125) [-496.697] (-501.756) (-495.217) * (-495.510) [-495.228] (-496.386) (-497.569) -- 0:01:01

      Average standard deviation of split frequencies: 0.035976

      75500 -- (-497.755) [-495.556] (-498.140) (-498.976) * (-496.076) [-496.913] (-497.691) (-496.437) -- 0:01:01
      76000 -- (-501.623) (-496.443) (-494.843) [-496.967] * (-503.254) (-494.829) [-497.918] (-496.591) -- 0:01:00
      76500 -- (-497.659) [-495.795] (-495.353) (-495.853) * (-499.350) [-494.508] (-499.859) (-497.417) -- 0:01:00
      77000 -- (-498.547) (-498.176) (-497.790) [-495.473] * (-496.276) (-495.010) [-495.231] (-496.849) -- 0:00:59
      77500 -- (-501.222) (-498.692) (-495.049) [-496.458] * (-496.281) (-495.762) [-494.720] (-497.840) -- 0:00:59
      78000 -- (-495.629) (-497.162) [-496.005] (-500.598) * (-495.686) (-494.772) (-498.297) [-500.468] -- 0:00:59
      78500 -- (-497.519) (-496.189) [-495.613] (-496.286) * (-496.871) (-496.161) [-498.133] (-495.257) -- 0:00:58
      79000 -- (-495.557) (-500.144) [-496.232] (-498.499) * (-496.416) (-498.178) (-501.732) [-495.176] -- 0:00:58
      79500 -- [-495.470] (-497.031) (-494.510) (-494.686) * (-495.415) [-498.760] (-501.714) (-495.132) -- 0:00:57
      80000 -- (-495.567) (-498.992) [-495.058] (-497.205) * (-497.627) (-497.817) [-495.818] (-495.736) -- 0:00:57

      Average standard deviation of split frequencies: 0.036909

      80500 -- (-497.143) (-497.607) [-494.856] (-495.122) * [-498.272] (-498.030) (-494.534) (-497.094) -- 0:00:57
      81000 -- [-496.823] (-495.965) (-498.581) (-495.614) * (-498.454) [-498.681] (-497.208) (-498.256) -- 0:00:56
      81500 -- (-495.336) (-498.389) (-499.345) [-495.510] * [-495.064] (-497.847) (-495.738) (-501.918) -- 0:00:56
      82000 -- (-495.542) [-495.304] (-495.754) (-499.086) * (-495.395) (-500.611) (-497.285) [-496.929] -- 0:00:55
      82500 -- [-498.521] (-497.954) (-496.407) (-495.349) * (-494.965) (-499.004) [-495.524] (-495.537) -- 0:00:55
      83000 -- [-495.947] (-496.272) (-495.418) (-497.018) * (-495.635) [-494.194] (-494.572) (-495.448) -- 0:00:55
      83500 -- [-495.526] (-497.971) (-496.774) (-496.723) * [-494.994] (-495.760) (-502.148) (-497.666) -- 0:00:54
      84000 -- [-495.347] (-499.339) (-498.236) (-494.903) * [-496.294] (-496.228) (-497.881) (-500.548) -- 0:00:54
      84500 -- [-495.253] (-499.512) (-496.551) (-495.815) * [-498.309] (-497.244) (-495.229) (-497.428) -- 0:00:54
      85000 -- [-495.213] (-499.647) (-497.189) (-496.517) * (-494.695) (-499.836) [-496.120] (-497.051) -- 0:00:53

      Average standard deviation of split frequencies: 0.035629

      85500 -- (-501.269) (-499.065) [-496.228] (-499.872) * (-500.514) (-503.824) (-495.979) [-494.446] -- 0:00:53
      86000 -- (-496.297) (-498.033) [-495.757] (-500.911) * (-495.835) (-498.182) (-495.952) [-494.775] -- 0:01:03
      86500 -- [-496.084] (-495.355) (-495.690) (-496.688) * (-496.187) (-496.447) (-497.323) [-495.360] -- 0:01:03
      87000 -- (-499.104) (-499.325) (-497.869) [-497.330] * [-494.934] (-496.854) (-494.909) (-496.504) -- 0:01:02
      87500 -- (-496.560) [-499.497] (-497.712) (-497.984) * (-494.826) (-497.417) (-494.845) [-499.246] -- 0:01:02
      88000 -- [-495.963] (-496.593) (-497.217) (-495.335) * [-497.752] (-495.730) (-495.458) (-504.595) -- 0:01:02
      88500 -- (-494.693) (-496.565) [-495.358] (-505.851) * (-499.954) [-498.118] (-495.030) (-495.961) -- 0:01:01
      89000 -- [-494.619] (-495.044) (-496.823) (-499.268) * (-499.326) (-495.330) (-495.768) [-498.280] -- 0:01:01
      89500 -- [-496.011] (-494.494) (-494.817) (-498.719) * [-496.896] (-496.814) (-495.165) (-496.858) -- 0:01:01
      90000 -- (-502.816) (-497.063) (-495.525) [-495.616] * (-495.408) (-494.512) [-498.156] (-498.024) -- 0:01:00

      Average standard deviation of split frequencies: 0.033385

      90500 -- (-497.476) [-494.690] (-495.748) (-499.317) * [-496.476] (-497.669) (-496.343) (-498.618) -- 0:01:00
      91000 -- (-495.498) (-497.716) (-499.065) [-495.773] * (-499.388) (-499.446) (-496.122) [-499.116] -- 0:00:59
      91500 -- (-495.113) (-495.147) (-499.138) [-494.696] * (-497.771) (-495.091) (-495.635) [-496.774] -- 0:00:59
      92000 -- (-500.238) [-495.255] (-496.849) (-497.527) * (-495.668) (-494.912) [-495.506] (-496.089) -- 0:00:59
      92500 -- (-496.778) [-494.679] (-497.601) (-497.355) * (-496.195) [-494.811] (-499.324) (-499.511) -- 0:00:58
      93000 -- [-498.697] (-494.537) (-495.655) (-495.443) * [-496.538] (-494.960) (-498.872) (-495.783) -- 0:00:58
      93500 -- (-499.237) (-495.349) (-495.947) [-495.769] * (-503.968) (-494.588) (-496.896) [-496.242] -- 0:00:58
      94000 -- (-496.388) (-497.365) [-496.725] (-495.967) * (-498.257) (-494.453) (-498.533) [-498.754] -- 0:00:57
      94500 -- (-498.066) [-496.455] (-495.531) (-495.418) * (-499.716) [-495.541] (-496.995) (-496.899) -- 0:00:57
      95000 -- (-502.250) (-495.000) (-498.028) [-495.305] * (-495.482) [-496.894] (-496.326) (-495.958) -- 0:00:57

      Average standard deviation of split frequencies: 0.030008

      95500 -- (-496.193) (-496.966) (-495.693) [-496.448] * [-495.827] (-498.266) (-497.902) (-495.247) -- 0:00:56
      96000 -- (-494.802) (-498.323) (-495.449) [-495.785] * (-496.441) (-495.207) [-494.920] (-494.593) -- 0:00:56
      96500 -- (-498.080) (-496.741) [-496.203] (-496.094) * (-497.185) (-495.613) (-499.673) [-494.686] -- 0:00:56
      97000 -- (-499.302) [-496.037] (-494.646) (-496.224) * (-496.174) (-500.547) [-495.445] (-496.841) -- 0:00:55
      97500 -- (-496.702) [-494.570] (-495.522) (-496.255) * [-499.424] (-497.753) (-497.449) (-495.162) -- 0:00:55
      98000 -- (-497.619) (-497.476) [-495.659] (-501.184) * (-496.060) [-498.129] (-495.550) (-495.238) -- 0:00:55
      98500 -- (-497.502) (-497.476) [-495.727] (-495.731) * (-496.356) [-498.422] (-494.726) (-496.234) -- 0:00:54
      99000 -- (-497.746) (-498.763) [-499.840] (-496.865) * [-494.868] (-497.882) (-498.881) (-496.931) -- 0:00:54
      99500 -- (-497.468) (-495.415) (-498.303) [-495.362] * [-495.632] (-495.577) (-498.675) (-496.887) -- 0:00:54
      100000 -- (-498.373) (-496.876) [-496.575] (-494.666) * [-497.115] (-501.607) (-495.135) (-494.911) -- 0:00:54

      Average standard deviation of split frequencies: 0.027358

      100500 -- [-496.748] (-498.521) (-498.241) (-495.877) * [-495.358] (-501.423) (-495.689) (-497.797) -- 0:01:02
      101000 -- (-495.336) (-501.838) (-496.059) [-498.804] * [-496.797] (-495.038) (-495.674) (-500.527) -- 0:01:02
      101500 -- (-501.224) (-497.045) [-494.590] (-497.677) * (-495.436) (-499.677) (-496.405) [-494.913] -- 0:01:01
      102000 -- (-497.861) [-495.399] (-494.759) (-497.881) * (-499.143) (-494.455) [-496.972] (-496.953) -- 0:01:01
      102500 -- [-494.894] (-495.744) (-498.562) (-496.615) * (-498.272) (-496.932) [-495.876] (-495.764) -- 0:01:01
      103000 -- (-497.079) (-496.892) [-496.484] (-496.447) * [-495.939] (-497.025) (-494.956) (-496.455) -- 0:01:00
      103500 -- (-498.213) (-499.250) [-494.596] (-495.865) * (-496.835) [-498.350] (-497.112) (-494.927) -- 0:01:00
      104000 -- (-496.497) [-496.297] (-497.806) (-498.984) * [-496.820] (-494.698) (-494.353) (-495.720) -- 0:01:00
      104500 -- (-496.684) [-497.185] (-497.546) (-497.653) * (-496.096) (-496.095) [-495.299] (-498.727) -- 0:00:59
      105000 -- (-494.858) (-494.664) [-498.797] (-495.368) * [-495.183] (-497.424) (-501.124) (-495.647) -- 0:00:59

      Average standard deviation of split frequencies: 0.025747

      105500 -- (-495.115) (-494.381) (-499.130) [-495.208] * (-495.878) (-498.057) (-496.925) [-494.773] -- 0:00:59
      106000 -- [-496.869] (-497.634) (-496.102) (-495.078) * [-496.335] (-499.245) (-497.328) (-495.096) -- 0:00:59
      106500 -- (-495.543) (-495.968) [-496.313] (-497.226) * (-499.464) (-496.312) [-495.169] (-495.066) -- 0:00:58
      107000 -- [-496.336] (-497.229) (-495.172) (-496.740) * [-495.604] (-497.738) (-497.564) (-495.346) -- 0:00:58
      107500 -- [-494.993] (-496.876) (-495.929) (-496.169) * (-499.064) [-500.493] (-498.330) (-497.307) -- 0:00:58
      108000 -- (-498.196) (-497.547) (-497.662) [-495.334] * [-494.608] (-494.808) (-498.337) (-501.313) -- 0:00:57
      108500 -- (-495.210) (-496.838) (-497.551) [-495.370] * (-498.155) (-496.915) [-497.264] (-495.468) -- 0:00:57
      109000 -- (-496.582) (-497.155) (-494.844) [-496.032] * (-495.894) (-499.795) (-495.839) [-495.542] -- 0:00:57
      109500 -- (-497.190) (-497.134) [-495.853] (-497.044) * [-496.644] (-496.875) (-497.436) (-495.475) -- 0:00:56
      110000 -- (-497.089) (-497.819) [-496.093] (-498.663) * (-496.140) [-496.343] (-498.673) (-497.263) -- 0:00:56

      Average standard deviation of split frequencies: 0.023804

      110500 -- [-496.215] (-496.411) (-498.286) (-497.053) * (-498.438) [-497.143] (-495.928) (-496.386) -- 0:00:56
      111000 -- [-496.082] (-496.612) (-495.322) (-499.223) * [-495.753] (-497.180) (-497.526) (-496.393) -- 0:00:56
      111500 -- (-497.894) (-497.102) [-498.566] (-497.461) * (-494.200) [-497.998] (-497.836) (-497.111) -- 0:00:55
      112000 -- (-498.616) [-500.027] (-495.832) (-497.593) * (-497.418) (-498.637) (-495.733) [-497.123] -- 0:00:55
      112500 -- (-499.170) (-496.658) (-496.804) [-501.644] * (-497.423) [-496.429] (-499.079) (-498.097) -- 0:00:55
      113000 -- (-496.774) (-498.628) (-497.008) [-497.418] * [-496.571] (-496.525) (-495.402) (-494.336) -- 0:00:54
      113500 -- (-495.954) [-496.900] (-495.685) (-495.080) * [-497.095] (-497.998) (-496.528) (-495.478) -- 0:00:54
      114000 -- [-495.507] (-497.672) (-500.995) (-495.152) * (-498.782) (-495.296) (-496.371) [-495.887] -- 0:00:54
      114500 -- (-498.805) (-498.366) (-496.945) [-495.762] * (-500.576) (-497.157) [-494.848] (-495.887) -- 0:00:54
      115000 -- [-496.357] (-500.943) (-496.394) (-497.017) * (-496.008) (-494.776) [-496.194] (-494.946) -- 0:01:01

      Average standard deviation of split frequencies: 0.023480

      115500 -- (-498.836) (-494.563) (-495.798) [-498.497] * (-496.876) (-494.787) (-498.531) [-496.697] -- 0:01:01
      116000 -- [-501.819] (-496.271) (-495.178) (-495.651) * (-496.882) (-495.173) (-496.610) [-496.767] -- 0:01:00
      116500 -- (-499.185) [-496.421] (-494.809) (-499.897) * (-494.787) (-496.958) [-496.110] (-496.337) -- 0:01:00
      117000 -- (-494.583) (-495.072) (-495.018) [-495.954] * [-495.359] (-504.353) (-496.274) (-495.031) -- 0:01:00
      117500 -- (-495.224) (-499.923) (-497.046) [-495.190] * (-503.197) (-496.759) (-495.587) [-494.684] -- 0:01:00
      118000 -- (-496.244) (-494.775) [-494.209] (-496.153) * [-496.404] (-495.629) (-498.664) (-497.070) -- 0:00:59
      118500 -- (-494.945) [-494.477] (-495.295) (-496.465) * (-496.981) (-498.049) [-496.420] (-494.459) -- 0:00:59
      119000 -- [-496.142] (-495.674) (-495.067) (-496.859) * [-497.653] (-496.744) (-496.897) (-495.453) -- 0:00:59
      119500 -- [-501.498] (-496.064) (-497.904) (-498.403) * [-500.362] (-499.691) (-495.324) (-494.752) -- 0:00:58
      120000 -- (-495.793) (-495.755) (-497.621) [-498.516] * (-495.932) (-498.865) (-497.381) [-494.623] -- 0:00:58

      Average standard deviation of split frequencies: 0.024589

      120500 -- (-495.263) (-495.825) [-497.517] (-496.998) * (-495.152) (-497.293) [-495.675] (-497.078) -- 0:00:58
      121000 -- (-495.184) (-496.013) [-498.132] (-499.641) * (-495.552) (-495.942) [-496.626] (-494.901) -- 0:00:58
      121500 -- (-496.277) (-497.722) [-498.617] (-495.219) * (-495.145) [-495.429] (-498.782) (-495.288) -- 0:00:57
      122000 -- (-497.104) (-494.974) [-498.621] (-494.654) * (-497.913) (-502.135) (-496.789) [-495.498] -- 0:00:57
      122500 -- (-497.751) [-497.574] (-496.162) (-496.155) * (-496.249) [-496.470] (-495.123) (-495.107) -- 0:00:57
      123000 -- (-502.618) [-496.096] (-499.177) (-499.365) * (-495.739) [-496.788] (-497.211) (-496.631) -- 0:00:57
      123500 -- [-496.874] (-497.117) (-500.726) (-496.689) * (-496.547) (-498.023) [-499.760] (-503.552) -- 0:00:56
      124000 -- (-495.198) (-497.823) [-499.521] (-495.706) * [-495.001] (-498.287) (-500.527) (-501.430) -- 0:00:56
      124500 -- (-497.905) (-496.434) (-496.362) [-496.753] * (-494.844) (-495.257) [-495.794] (-499.632) -- 0:00:56
      125000 -- [-495.319] (-497.650) (-498.290) (-496.178) * (-496.652) (-499.530) [-495.708] (-497.250) -- 0:00:56

      Average standard deviation of split frequencies: 0.026189

      125500 -- (-496.126) (-495.242) (-495.449) [-496.992] * (-497.196) (-497.531) [-495.002] (-499.917) -- 0:00:55
      126000 -- (-497.596) (-498.679) (-496.286) [-496.194] * (-495.576) (-496.944) [-495.601] (-500.375) -- 0:00:55
      126500 -- (-497.655) [-496.351] (-497.311) (-497.850) * [-494.601] (-497.905) (-495.847) (-494.870) -- 0:00:55
      127000 -- (-495.041) (-495.371) [-496.424] (-497.078) * (-496.463) (-495.245) [-496.451] (-495.175) -- 0:00:54
      127500 -- [-496.424] (-497.734) (-497.342) (-498.046) * (-495.474) (-499.277) (-499.960) [-495.393] -- 0:00:54
      128000 -- (-495.669) (-498.687) (-502.659) [-496.511] * (-498.424) (-494.656) (-498.180) [-496.728] -- 0:00:54
      128500 -- (-495.038) [-500.127] (-496.504) (-497.764) * (-499.830) (-497.840) (-495.844) [-496.811] -- 0:00:54
      129000 -- (-498.830) (-497.195) (-496.523) [-495.648] * (-496.804) (-501.566) [-496.420] (-497.274) -- 0:00:54
      129500 -- [-499.023] (-498.283) (-495.561) (-497.052) * (-498.738) (-494.908) [-498.500] (-500.837) -- 0:01:00
      130000 -- (-497.965) [-494.873] (-495.374) (-494.487) * (-494.449) (-495.406) [-497.956] (-497.065) -- 0:01:00

      Average standard deviation of split frequencies: 0.026857

      130500 -- [-496.718] (-499.238) (-497.784) (-499.208) * (-496.593) (-495.405) (-500.188) [-496.497] -- 0:00:59
      131000 -- (-495.938) (-499.021) [-495.236] (-495.437) * (-496.100) [-495.650] (-499.766) (-498.877) -- 0:00:59
      131500 -- (-498.545) (-504.825) [-497.954] (-497.585) * (-497.328) (-500.303) (-496.085) [-497.711] -- 0:00:59
      132000 -- (-496.142) (-495.931) [-495.633] (-500.603) * (-498.017) (-496.416) [-495.288] (-497.188) -- 0:00:59
      132500 -- (-495.196) [-496.011] (-495.252) (-499.545) * [-496.439] (-496.452) (-494.467) (-496.335) -- 0:00:58
      133000 -- [-497.189] (-495.723) (-495.459) (-498.295) * [-497.786] (-500.062) (-495.607) (-497.860) -- 0:00:58
      133500 -- (-495.414) (-495.240) [-494.707] (-497.043) * (-498.643) (-496.211) (-496.181) [-495.856] -- 0:00:58
      134000 -- (-498.628) (-495.806) (-496.298) [-495.489] * (-497.396) (-499.648) [-496.081] (-496.321) -- 0:00:58
      134500 -- (-499.882) (-500.570) (-496.116) [-495.170] * (-496.551) [-495.085] (-496.311) (-496.190) -- 0:00:57
      135000 -- (-501.956) (-496.636) (-501.716) [-494.957] * (-495.634) (-496.418) [-496.532] (-500.327) -- 0:00:57

      Average standard deviation of split frequencies: 0.024071

      135500 -- [-501.847] (-497.838) (-498.738) (-497.583) * [-497.314] (-495.863) (-497.431) (-494.696) -- 0:00:57
      136000 -- (-494.538) (-498.236) (-498.193) [-496.745] * (-495.925) (-498.142) [-496.184] (-495.141) -- 0:00:57
      136500 -- [-496.436] (-499.001) (-497.760) (-498.630) * [-495.960] (-496.774) (-496.639) (-494.771) -- 0:00:56
      137000 -- (-495.619) [-495.694] (-499.278) (-496.659) * (-498.620) (-498.063) (-495.471) [-497.080] -- 0:00:56
      137500 -- (-498.532) (-496.026) (-496.116) [-494.877] * (-496.468) (-497.625) [-499.558] (-502.398) -- 0:00:56
      138000 -- (-498.502) (-496.087) [-496.825] (-496.659) * (-496.275) (-496.704) (-496.999) [-498.600] -- 0:00:56
      138500 -- (-497.904) (-495.674) (-496.190) [-497.692] * (-497.750) [-497.930] (-497.952) (-498.916) -- 0:00:55
      139000 -- (-495.742) (-496.166) (-496.927) [-496.096] * (-495.996) (-499.070) (-506.877) [-497.437] -- 0:00:55
      139500 -- (-496.336) [-494.599] (-499.587) (-497.283) * [-496.551] (-498.150) (-497.178) (-498.353) -- 0:00:55
      140000 -- (-496.815) (-497.188) (-496.624) [-498.585] * [-496.143] (-496.783) (-496.483) (-497.162) -- 0:00:55

      Average standard deviation of split frequencies: 0.023459

      140500 -- [-495.596] (-501.210) (-496.780) (-501.790) * (-495.719) (-495.974) (-497.044) [-496.305] -- 0:00:55
      141000 -- (-495.623) (-498.778) (-494.823) [-498.394] * (-495.734) (-495.609) [-496.590] (-496.571) -- 0:00:54
      141500 -- (-495.437) (-500.863) (-497.043) [-497.176] * (-496.356) (-498.101) [-495.779] (-496.368) -- 0:00:54
      142000 -- (-496.781) (-495.018) (-496.454) [-497.501] * (-496.386) (-499.442) [-495.492] (-495.588) -- 0:00:54
      142500 -- [-499.891] (-496.112) (-496.520) (-496.839) * (-495.213) (-498.241) (-498.084) [-498.382] -- 0:00:54
      143000 -- [-495.307] (-497.533) (-497.329) (-497.381) * (-495.020) [-498.248] (-495.278) (-502.524) -- 0:00:53
      143500 -- (-495.369) (-500.415) [-496.917] (-495.666) * (-495.675) [-495.421] (-499.254) (-497.045) -- 0:00:59
      144000 -- (-494.659) (-497.957) (-498.297) [-496.055] * (-498.050) [-495.452] (-495.640) (-496.775) -- 0:00:59
      144500 -- (-495.387) (-499.272) (-497.830) [-494.777] * (-497.873) (-494.771) [-496.377] (-495.375) -- 0:00:59
      145000 -- (-499.201) (-499.979) [-497.867] (-497.384) * (-497.221) (-497.268) (-498.765) [-495.667] -- 0:00:58

      Average standard deviation of split frequencies: 0.022063

      145500 -- (-500.228) [-496.653] (-496.662) (-500.620) * [-495.505] (-496.523) (-497.875) (-497.603) -- 0:00:58
      146000 -- (-501.029) (-498.088) [-497.628] (-500.912) * (-496.965) (-498.008) [-497.764] (-496.995) -- 0:00:58
      146500 -- [-497.594] (-499.238) (-500.323) (-503.615) * (-496.373) (-497.549) (-500.509) [-495.755] -- 0:00:58
      147000 -- (-495.951) (-497.809) [-495.255] (-497.451) * (-498.196) (-497.583) [-500.115] (-494.769) -- 0:00:58
      147500 -- (-497.294) [-497.056] (-498.638) (-497.276) * (-495.607) [-498.607] (-495.154) (-496.832) -- 0:00:57
      148000 -- [-495.247] (-498.639) (-496.621) (-495.386) * (-498.046) [-499.182] (-497.473) (-501.445) -- 0:00:57
      148500 -- (-495.702) [-494.534] (-499.868) (-495.116) * (-500.356) (-496.491) (-494.967) [-501.968] -- 0:00:57
      149000 -- (-498.527) (-497.718) [-497.132] (-499.615) * (-495.969) (-496.943) [-497.289] (-495.074) -- 0:00:57
      149500 -- (-495.913) [-496.676] (-499.981) (-500.189) * [-495.975] (-495.317) (-495.178) (-501.353) -- 0:00:56
      150000 -- (-497.025) (-496.349) (-494.798) [-498.265] * (-495.916) (-496.894) (-496.889) [-501.215] -- 0:00:56

      Average standard deviation of split frequencies: 0.020429

      150500 -- (-496.328) (-495.235) (-495.031) [-496.423] * [-497.495] (-496.169) (-497.049) (-496.665) -- 0:00:56
      151000 -- (-498.212) (-497.665) (-495.745) [-497.397] * [-500.684] (-500.465) (-496.063) (-502.938) -- 0:00:56
      151500 -- (-498.828) (-496.227) (-495.957) [-499.590] * (-496.593) (-498.673) (-496.748) [-497.878] -- 0:00:56
      152000 -- (-498.354) (-497.303) [-495.992] (-497.156) * (-498.221) [-495.763] (-495.457) (-497.874) -- 0:00:55
      152500 -- [-495.847] (-496.804) (-498.743) (-497.098) * [-497.319] (-495.059) (-496.426) (-498.859) -- 0:00:55
      153000 -- (-495.146) (-502.171) (-498.281) [-498.239] * [-497.230] (-501.082) (-496.970) (-495.702) -- 0:00:55
      153500 -- (-497.821) (-496.950) [-497.638] (-499.575) * [-498.569] (-499.310) (-496.212) (-497.587) -- 0:00:55
      154000 -- (-496.216) (-497.225) [-498.794] (-497.244) * (-496.877) (-496.069) (-497.365) [-495.580] -- 0:00:54
      154500 -- (-499.362) (-498.370) (-502.196) [-496.031] * (-496.492) (-496.905) [-495.035] (-495.708) -- 0:00:54
      155000 -- (-496.615) (-496.305) (-496.490) [-495.641] * (-498.475) [-496.954] (-496.382) (-495.730) -- 0:00:54

      Average standard deviation of split frequencies: 0.019197

      155500 -- (-499.023) (-498.646) (-497.618) [-496.843] * (-497.258) (-497.197) (-496.143) [-495.887] -- 0:00:54
      156000 -- (-497.652) (-497.827) (-494.924) [-495.859] * (-494.871) (-496.953) (-498.307) [-498.292] -- 0:00:54
      156500 -- [-495.742] (-496.491) (-498.636) (-494.320) * (-497.008) (-497.599) (-497.330) [-495.680] -- 0:00:53
      157000 -- [-495.283] (-499.379) (-496.192) (-497.181) * [-496.354] (-498.158) (-497.903) (-500.779) -- 0:00:53
      157500 -- (-499.339) [-495.841] (-496.277) (-496.485) * [-494.954] (-495.852) (-496.703) (-495.947) -- 0:00:53
      158000 -- (-494.584) (-495.356) (-499.227) [-499.429] * (-497.323) (-495.120) (-494.711) [-495.549] -- 0:00:58
      158500 -- (-499.585) (-497.302) (-496.341) [-496.902] * (-499.097) [-494.855] (-496.000) (-495.240) -- 0:00:58
      159000 -- (-495.033) (-496.194) (-497.400) [-498.338] * [-494.865] (-495.715) (-494.972) (-500.972) -- 0:00:58
      159500 -- (-496.748) (-496.752) [-497.783] (-499.943) * (-497.384) (-494.928) (-499.214) [-498.200] -- 0:00:57
      160000 -- (-495.919) (-495.632) (-498.728) [-498.894] * (-497.179) (-496.333) [-498.280] (-499.734) -- 0:00:57

      Average standard deviation of split frequencies: 0.021401

      160500 -- (-495.897) (-496.423) [-495.532] (-497.955) * (-495.394) (-495.833) (-496.062) [-502.570] -- 0:00:57
      161000 -- [-494.525] (-496.705) (-494.740) (-497.126) * [-497.290] (-500.894) (-498.752) (-494.405) -- 0:00:57
      161500 -- (-498.404) (-494.944) (-494.902) [-496.739] * (-496.369) (-499.431) (-495.910) [-497.070] -- 0:00:57
      162000 -- (-500.480) (-496.371) (-499.258) [-496.735] * [-497.085] (-496.461) (-495.563) (-495.227) -- 0:00:56
      162500 -- [-498.842] (-498.730) (-498.096) (-496.717) * (-498.351) [-496.658] (-495.378) (-495.115) -- 0:00:56
      163000 -- [-495.766] (-497.216) (-499.406) (-496.779) * [-494.556] (-496.124) (-495.068) (-495.955) -- 0:00:56
      163500 -- (-500.442) (-496.432) (-498.723) [-500.331] * (-496.492) (-497.235) (-496.372) [-497.051] -- 0:00:56
      164000 -- (-501.006) (-497.819) (-495.856) [-497.605] * [-497.394] (-497.408) (-495.472) (-496.640) -- 0:00:56
      164500 -- [-500.711] (-497.546) (-497.732) (-494.481) * (-495.561) (-495.801) (-497.242) [-494.445] -- 0:00:55
      165000 -- (-496.069) [-497.269] (-497.767) (-496.979) * (-499.155) [-496.906] (-494.806) (-495.678) -- 0:00:55

      Average standard deviation of split frequencies: 0.019090

      165500 -- (-496.050) [-498.772] (-503.407) (-496.347) * [-497.671] (-495.129) (-495.846) (-495.883) -- 0:00:55
      166000 -- (-496.368) (-496.771) [-495.965] (-497.353) * (-498.166) (-494.280) (-499.484) [-496.148] -- 0:00:55
      166500 -- (-497.147) (-496.136) [-495.009] (-494.544) * (-500.443) (-495.180) (-497.335) [-495.991] -- 0:00:55
      167000 -- (-495.112) (-496.801) [-496.970] (-497.346) * (-505.698) (-496.140) [-496.621] (-497.512) -- 0:00:54
      167500 -- [-498.805] (-494.613) (-499.657) (-495.993) * (-494.569) [-499.925] (-496.065) (-497.649) -- 0:00:54
      168000 -- (-494.263) (-500.204) (-494.786) [-495.063] * [-494.871] (-495.891) (-497.953) (-496.046) -- 0:00:54
      168500 -- (-494.251) (-497.927) (-497.379) [-498.252] * [-494.728] (-496.596) (-495.983) (-496.626) -- 0:00:54
      169000 -- (-497.203) (-495.504) [-495.350] (-496.926) * [-497.581] (-497.910) (-496.606) (-497.727) -- 0:00:54
      169500 -- (-502.727) [-498.531] (-496.552) (-496.543) * [-496.389] (-497.563) (-495.411) (-496.341) -- 0:00:53
      170000 -- [-494.942] (-497.879) (-496.634) (-495.476) * (-495.938) (-495.938) [-498.565] (-494.172) -- 0:00:53

      Average standard deviation of split frequencies: 0.018875

      170500 -- (-496.679) (-496.141) (-495.305) [-495.480] * (-496.749) (-495.823) (-497.174) [-494.431] -- 0:00:53
      171000 -- [-496.376] (-495.761) (-496.568) (-495.981) * (-496.863) [-495.414] (-495.776) (-500.667) -- 0:00:53
      171500 -- (-496.379) (-496.413) (-496.240) [-495.246] * (-497.665) [-498.144] (-496.327) (-495.273) -- 0:00:53
      172000 -- [-497.343] (-496.069) (-495.639) (-495.653) * [-496.146] (-500.724) (-497.156) (-498.742) -- 0:00:52
      172500 -- (-499.322) (-495.478) [-495.182] (-495.046) * (-499.290) (-496.798) [-498.053] (-501.037) -- 0:00:57
      173000 -- (-501.485) [-499.042] (-496.710) (-496.505) * (-496.500) [-495.465] (-496.638) (-495.722) -- 0:00:57
      173500 -- (-497.220) (-498.896) [-494.372] (-496.449) * [-496.684] (-500.040) (-497.090) (-495.724) -- 0:00:57
      174000 -- (-497.297) [-497.452] (-496.051) (-495.867) * (-499.292) [-495.606] (-498.742) (-496.015) -- 0:00:56
      174500 -- (-497.341) (-495.615) (-495.902) [-494.543] * (-496.246) (-497.084) (-497.474) [-497.998] -- 0:00:56
      175000 -- (-498.105) [-495.058] (-496.041) (-502.557) * (-498.737) (-497.602) [-499.615] (-496.404) -- 0:00:56

      Average standard deviation of split frequencies: 0.016963

      175500 -- (-496.979) (-495.325) [-495.638] (-494.777) * (-497.272) (-499.195) (-503.210) [-496.134] -- 0:00:56
      176000 -- [-496.004] (-495.612) (-496.374) (-505.256) * [-494.997] (-495.969) (-499.834) (-498.752) -- 0:00:56
      176500 -- [-495.035] (-496.273) (-495.104) (-496.395) * (-494.566) (-495.748) [-501.733] (-497.557) -- 0:00:55
      177000 -- [-496.450] (-495.655) (-495.000) (-495.202) * [-496.686] (-496.459) (-502.508) (-496.750) -- 0:00:55
      177500 -- [-496.628] (-496.048) (-495.254) (-500.027) * (-495.234) [-495.478] (-495.384) (-500.224) -- 0:00:55
      178000 -- (-495.911) [-494.817] (-497.304) (-497.082) * (-497.378) (-496.514) [-496.218] (-497.777) -- 0:00:55
      178500 -- (-496.004) [-496.180] (-498.573) (-498.238) * (-501.628) (-495.436) [-496.282] (-499.737) -- 0:00:55
      179000 -- (-496.657) [-503.287] (-495.118) (-495.768) * (-504.089) [-494.673] (-494.330) (-496.145) -- 0:00:55
      179500 -- [-496.122] (-498.732) (-495.009) (-497.097) * (-499.959) (-495.984) [-495.759] (-495.665) -- 0:00:54
      180000 -- (-495.262) [-494.691] (-495.929) (-501.337) * (-495.011) [-495.172] (-497.865) (-495.257) -- 0:00:54

      Average standard deviation of split frequencies: 0.018265

      180500 -- (-494.816) (-496.644) (-495.910) [-498.520] * (-496.231) [-494.418] (-497.667) (-495.821) -- 0:00:54
      181000 -- (-497.624) (-500.768) (-497.183) [-496.345] * (-498.116) [-496.610] (-496.560) (-496.368) -- 0:00:54
      181500 -- (-500.378) (-501.809) [-496.242] (-496.050) * (-499.648) (-496.973) [-499.116] (-496.074) -- 0:00:54
      182000 -- (-498.001) (-496.364) [-495.885] (-496.250) * (-498.430) (-497.794) [-495.573] (-495.465) -- 0:00:53
      182500 -- (-496.129) [-495.395] (-496.375) (-495.918) * [-497.382] (-496.817) (-497.441) (-497.638) -- 0:00:53
      183000 -- (-499.072) (-497.983) (-499.331) [-496.034] * [-497.248] (-504.655) (-494.543) (-496.980) -- 0:00:53
      183500 -- (-499.867) (-495.706) (-494.966) [-496.273] * [-496.734] (-495.311) (-494.658) (-496.678) -- 0:00:53
      184000 -- (-494.347) (-495.752) [-494.958] (-496.901) * [-495.563] (-495.123) (-495.485) (-498.728) -- 0:00:53
      184500 -- [-498.611] (-495.399) (-499.397) (-495.686) * (-495.443) [-495.435] (-495.516) (-495.465) -- 0:00:53
      185000 -- (-495.861) [-496.077] (-497.125) (-497.097) * [-495.266] (-495.875) (-496.810) (-494.784) -- 0:00:52

      Average standard deviation of split frequencies: 0.017890

      185500 -- (-497.926) [-495.803] (-496.438) (-498.146) * [-495.920] (-495.552) (-495.106) (-497.381) -- 0:00:52
      186000 -- (-497.958) (-494.400) (-498.150) [-495.728] * (-495.706) (-496.242) [-498.129] (-495.571) -- 0:00:52
      186500 -- [-501.269] (-496.175) (-499.061) (-496.338) * (-498.595) [-495.227] (-498.184) (-495.196) -- 0:00:56
      187000 -- (-496.525) (-495.530) [-496.820] (-496.617) * (-498.059) [-494.534] (-496.439) (-494.970) -- 0:00:56
      187500 -- [-497.034] (-499.724) (-496.748) (-494.982) * (-494.659) [-496.529] (-498.500) (-498.545) -- 0:00:56
      188000 -- (-496.724) (-496.919) (-496.856) [-495.127] * (-494.493) [-496.968] (-499.508) (-498.121) -- 0:00:56
      188500 -- (-495.595) (-494.875) (-495.577) [-494.923] * [-496.937] (-499.982) (-499.801) (-497.508) -- 0:00:55
      189000 -- (-497.292) (-495.139) (-496.456) [-494.934] * (-497.042) (-496.644) [-497.357] (-496.306) -- 0:00:55
      189500 -- (-496.408) (-494.444) (-496.681) [-495.305] * (-496.038) [-496.595] (-499.472) (-497.709) -- 0:00:55
      190000 -- (-497.612) (-497.126) (-501.808) [-494.749] * (-497.206) [-497.827] (-496.950) (-497.482) -- 0:00:55

      Average standard deviation of split frequencies: 0.017161

      190500 -- (-497.909) (-495.996) [-497.614] (-497.047) * (-495.178) (-496.963) (-495.280) [-498.683] -- 0:00:55
      191000 -- [-496.212] (-494.869) (-497.325) (-497.895) * (-495.689) (-497.011) (-500.800) [-497.003] -- 0:00:55
      191500 -- (-496.143) (-494.988) (-498.043) [-498.629] * (-498.205) (-499.377) (-498.411) [-496.944] -- 0:00:54
      192000 -- (-500.175) (-497.069) (-496.339) [-497.473] * (-495.609) (-496.317) [-496.612] (-495.254) -- 0:00:54
      192500 -- (-496.790) (-500.141) [-497.772] (-497.743) * (-498.633) [-494.836] (-496.542) (-495.414) -- 0:00:54
      193000 -- [-497.620] (-497.730) (-499.679) (-494.631) * (-498.445) [-495.787] (-497.313) (-495.870) -- 0:00:54
      193500 -- (-495.893) (-497.818) (-499.826) [-494.874] * (-496.674) (-495.522) (-497.664) [-496.034] -- 0:00:54
      194000 -- (-496.141) (-500.777) (-495.098) [-496.416] * (-495.685) (-497.495) (-499.162) [-495.686] -- 0:00:54
      194500 -- (-500.333) (-503.316) (-497.988) [-495.379] * (-498.399) (-496.350) (-500.984) [-496.496] -- 0:00:53
      195000 -- [-499.458] (-508.205) (-495.426) (-496.105) * [-498.352] (-497.366) (-497.562) (-495.735) -- 0:00:53

      Average standard deviation of split frequencies: 0.017437

      195500 -- (-501.603) (-495.623) (-495.689) [-497.086] * [-496.439] (-497.749) (-496.832) (-494.604) -- 0:00:53
      196000 -- (-495.156) [-499.067] (-495.759) (-495.311) * (-499.490) (-497.683) (-496.532) [-495.763] -- 0:00:53
      196500 -- (-494.828) (-497.894) (-496.959) [-495.856] * (-499.584) (-499.672) [-499.081] (-495.563) -- 0:00:53
      197000 -- (-496.507) [-495.364] (-496.365) (-495.685) * (-495.258) (-502.548) [-496.541] (-495.549) -- 0:00:52
      197500 -- (-495.148) (-498.741) [-498.187] (-498.604) * (-497.274) (-496.887) [-495.803] (-496.156) -- 0:00:52
      198000 -- (-497.302) [-498.467] (-498.231) (-496.109) * (-500.332) [-496.859] (-495.590) (-496.148) -- 0:00:52
      198500 -- [-494.443] (-497.840) (-496.053) (-495.829) * (-494.837) (-497.905) [-496.357] (-499.220) -- 0:00:52
      199000 -- [-495.441] (-496.788) (-496.877) (-495.264) * (-496.674) (-495.908) [-497.556] (-498.733) -- 0:00:52
      199500 -- [-495.417] (-496.883) (-498.092) (-499.309) * (-496.973) [-496.994] (-496.660) (-496.376) -- 0:00:52
      200000 -- (-496.895) [-496.492] (-498.270) (-496.865) * [-496.019] (-496.550) (-499.105) (-495.227) -- 0:00:51

      Average standard deviation of split frequencies: 0.016444

      200500 -- (-494.853) (-498.581) (-496.647) [-498.418] * (-496.101) [-495.394] (-496.909) (-497.069) -- 0:00:51
      201000 -- (-495.140) (-495.764) [-497.463] (-495.560) * (-496.766) [-495.280] (-496.360) (-496.703) -- 0:00:55
      201500 -- (-499.634) (-497.557) [-496.465] (-495.629) * (-497.702) (-497.379) [-498.568] (-494.730) -- 0:00:55
      202000 -- (-497.925) (-500.053) (-496.598) [-496.256] * [-496.607] (-498.720) (-497.728) (-499.327) -- 0:00:55
      202500 -- (-498.057) (-495.508) [-496.513] (-496.788) * [-496.715] (-497.280) (-498.214) (-497.002) -- 0:00:55
      203000 -- (-495.856) (-497.952) [-495.639] (-496.810) * (-496.115) (-496.186) (-495.276) [-495.406] -- 0:00:54
      203500 -- (-496.188) [-495.996] (-496.062) (-498.134) * [-494.950] (-496.100) (-494.851) (-495.366) -- 0:00:54
      204000 -- (-496.335) [-497.723] (-496.019) (-496.050) * [-496.578] (-503.286) (-494.443) (-497.820) -- 0:00:54
      204500 -- [-495.728] (-494.877) (-494.660) (-499.445) * [-495.387] (-497.220) (-497.104) (-501.932) -- 0:00:54
      205000 -- (-495.772) (-494.856) [-496.009] (-497.568) * (-498.979) (-497.682) (-499.976) [-496.955] -- 0:00:54

      Average standard deviation of split frequencies: 0.016422

      205500 -- (-495.150) [-498.704] (-497.853) (-497.585) * (-497.380) (-495.149) [-495.661] (-497.871) -- 0:00:54
      206000 -- (-496.387) (-500.129) (-496.274) [-499.629] * (-500.271) (-496.276) (-496.355) [-494.469] -- 0:00:53
      206500 -- (-497.511) (-498.088) (-496.002) [-496.453] * (-498.743) (-494.677) (-495.484) [-496.360] -- 0:00:53
      207000 -- (-497.169) (-496.407) (-498.665) [-498.740] * (-500.171) (-494.800) (-495.211) [-496.471] -- 0:00:53
      207500 -- (-496.961) (-496.097) [-498.169] (-494.977) * (-495.161) (-498.965) (-497.361) [-495.051] -- 0:00:53
      208000 -- (-496.148) (-496.436) (-495.936) [-495.500] * [-494.943] (-499.329) (-494.768) (-500.548) -- 0:00:53
      208500 -- [-494.946] (-498.005) (-495.540) (-496.272) * [-496.309] (-497.447) (-494.768) (-499.742) -- 0:00:53
      209000 -- (-495.264) (-497.015) (-495.447) [-495.333] * (-497.768) (-494.579) (-496.728) [-496.376] -- 0:00:52
      209500 -- (-498.235) (-495.853) [-498.362] (-495.670) * (-498.387) (-497.930) (-498.223) [-495.263] -- 0:00:52
      210000 -- (-496.503) [-494.911] (-495.985) (-496.841) * (-495.852) [-497.242] (-496.994) (-496.028) -- 0:00:52

      Average standard deviation of split frequencies: 0.014742

      210500 -- (-495.411) (-498.894) (-495.423) [-497.516] * (-495.472) (-495.105) (-496.713) [-497.457] -- 0:00:52
      211000 -- [-498.829] (-505.573) (-495.550) (-496.947) * (-498.519) (-494.522) (-496.964) [-495.024] -- 0:00:52
      211500 -- (-495.965) [-497.954] (-495.816) (-494.957) * [-499.572] (-496.038) (-494.858) (-496.498) -- 0:00:52
      212000 -- (-494.758) (-494.886) [-495.098] (-497.443) * (-496.361) [-497.807] (-495.113) (-497.173) -- 0:00:52
      212500 -- (-496.393) (-495.305) (-496.343) [-494.929] * (-500.739) (-497.698) [-501.279] (-495.314) -- 0:00:51
      213000 -- (-495.440) (-498.499) (-499.085) [-496.460] * (-500.266) (-504.195) (-497.881) [-496.753] -- 0:00:51
      213500 -- (-495.909) [-496.102] (-496.836) (-499.135) * (-495.798) [-496.401] (-500.409) (-496.988) -- 0:00:51
      214000 -- (-494.905) [-495.786] (-495.931) (-504.689) * [-494.906] (-500.076) (-500.629) (-498.949) -- 0:00:51
      214500 -- (-494.938) [-496.694] (-498.487) (-498.508) * [-494.895] (-495.263) (-498.341) (-496.340) -- 0:00:51
      215000 -- (-494.887) [-496.556] (-497.042) (-500.133) * [-496.855] (-495.619) (-494.673) (-495.950) -- 0:00:51

      Average standard deviation of split frequencies: 0.014635

      215500 -- (-498.058) [-497.567] (-498.389) (-498.457) * (-499.387) (-500.373) (-497.690) [-500.148] -- 0:00:54
      216000 -- [-497.170] (-496.566) (-494.671) (-496.266) * (-497.591) (-494.590) (-499.349) [-495.132] -- 0:00:54
      216500 -- [-497.197] (-496.138) (-500.869) (-497.376) * [-495.703] (-495.231) (-497.685) (-495.224) -- 0:00:54
      217000 -- (-498.010) (-496.528) (-494.818) [-499.125] * [-494.884] (-499.158) (-499.380) (-494.980) -- 0:00:54
      217500 -- (-497.177) (-498.405) [-496.405] (-497.293) * (-497.655) (-495.524) (-499.621) [-495.842] -- 0:00:53
      218000 -- (-497.077) (-494.746) [-497.580] (-496.215) * [-496.418] (-496.050) (-496.047) (-495.522) -- 0:00:53
      218500 -- (-496.143) (-495.153) (-501.385) [-497.927] * (-495.884) (-497.571) [-496.820] (-495.315) -- 0:00:53
      219000 -- [-495.595] (-497.062) (-500.675) (-497.440) * (-497.115) (-502.973) (-499.801) [-498.272] -- 0:00:53
      219500 -- (-495.247) (-497.469) (-496.369) [-495.126] * (-497.079) (-497.079) [-496.215] (-498.876) -- 0:00:53
      220000 -- (-497.266) (-498.071) [-494.783] (-498.171) * (-496.213) [-495.497] (-495.204) (-500.260) -- 0:00:53

      Average standard deviation of split frequencies: 0.015622

      220500 -- (-502.026) (-498.462) [-498.570] (-498.969) * (-496.052) (-496.688) (-496.102) [-497.585] -- 0:00:53
      221000 -- (-496.595) [-497.367] (-496.946) (-503.266) * (-499.087) (-495.993) [-497.100] (-496.046) -- 0:00:52
      221500 -- (-496.741) (-497.497) [-495.626] (-499.039) * (-494.852) [-496.932] (-497.757) (-495.666) -- 0:00:52
      222000 -- (-494.750) (-498.697) [-495.537] (-496.459) * (-497.039) (-494.674) (-498.254) [-495.008] -- 0:00:52
      222500 -- (-496.539) [-495.731] (-497.384) (-497.660) * (-497.247) (-498.306) (-494.630) [-497.358] -- 0:00:52
      223000 -- (-496.356) (-495.448) (-496.197) [-497.263] * (-496.602) (-495.804) [-496.192] (-496.276) -- 0:00:52
      223500 -- (-495.124) (-500.722) [-494.625] (-496.653) * [-496.398] (-495.944) (-504.010) (-497.224) -- 0:00:52
      224000 -- (-497.850) (-497.740) [-499.925] (-494.734) * (-497.311) [-496.673] (-500.654) (-498.104) -- 0:00:51
      224500 -- (-495.822) [-494.643] (-496.735) (-499.924) * (-502.719) [-497.477] (-496.753) (-495.011) -- 0:00:51
      225000 -- (-496.045) (-495.825) (-497.940) [-497.542] * (-495.695) [-498.316] (-495.861) (-497.566) -- 0:00:51

      Average standard deviation of split frequencies: 0.015644

      225500 -- [-495.936] (-496.107) (-499.705) (-494.180) * (-495.838) (-495.357) [-494.688] (-498.167) -- 0:00:51
      226000 -- (-498.192) (-496.960) [-496.053] (-496.766) * (-497.375) [-499.384] (-496.680) (-501.160) -- 0:00:51
      226500 -- (-497.708) [-497.131] (-495.468) (-496.294) * [-495.763] (-497.920) (-498.105) (-496.272) -- 0:00:51
      227000 -- (-497.071) (-501.808) (-496.824) [-495.001] * (-494.925) [-495.925] (-496.104) (-495.847) -- 0:00:51
      227500 -- (-496.087) [-496.035] (-495.308) (-495.641) * [-497.912] (-498.741) (-496.927) (-495.004) -- 0:00:50
      228000 -- (-495.966) (-495.096) (-498.246) [-496.760] * (-495.724) (-495.225) (-496.906) [-496.770] -- 0:00:50
      228500 -- (-496.817) (-496.147) [-494.351] (-498.042) * (-498.944) (-494.336) (-500.010) [-497.334] -- 0:00:50
      229000 -- (-494.655) [-496.083] (-494.835) (-495.571) * (-495.800) (-494.945) (-496.541) [-501.735] -- 0:00:50
      229500 -- (-498.377) (-498.666) (-498.534) [-497.198] * (-495.406) (-496.589) (-495.868) [-497.160] -- 0:00:53
      230000 -- [-501.032] (-500.497) (-497.493) (-498.765) * (-497.329) [-496.680] (-497.470) (-499.115) -- 0:00:53

      Average standard deviation of split frequencies: 0.015388

      230500 -- (-497.015) (-499.975) (-495.585) [-496.254] * [-495.824] (-495.864) (-496.926) (-495.677) -- 0:00:53
      231000 -- (-496.442) (-496.364) [-496.295] (-495.398) * (-497.416) [-495.228] (-497.553) (-499.806) -- 0:00:53
      231500 -- (-496.735) (-497.858) (-495.795) [-496.163] * (-496.963) (-504.316) [-495.654] (-497.080) -- 0:00:53
      232000 -- (-497.561) (-498.691) [-496.806] (-495.216) * (-496.312) (-499.687) [-497.174] (-495.884) -- 0:00:52
      232500 -- (-496.216) (-496.784) (-495.700) [-497.031] * (-496.228) (-501.710) [-495.877] (-495.097) -- 0:00:52
      233000 -- (-501.362) [-496.249] (-497.644) (-496.666) * (-495.393) (-497.306) [-497.360] (-496.006) -- 0:00:52
      233500 -- (-498.217) [-501.750] (-496.157) (-500.357) * [-497.107] (-495.500) (-499.100) (-494.770) -- 0:00:52
      234000 -- (-495.583) (-501.777) [-500.229] (-498.563) * (-496.337) [-495.984] (-497.868) (-498.129) -- 0:00:52
      234500 -- (-494.521) (-495.738) [-496.426] (-498.108) * (-503.355) (-495.184) [-494.748] (-497.212) -- 0:00:52
      235000 -- (-497.255) [-495.323] (-495.391) (-497.810) * (-497.477) (-498.935) (-498.643) [-499.105] -- 0:00:52

      Average standard deviation of split frequencies: 0.014731

      235500 -- (-496.845) [-494.726] (-496.658) (-499.382) * [-496.134] (-497.642) (-498.569) (-496.640) -- 0:00:51
      236000 -- (-495.646) (-495.739) [-494.801] (-500.624) * (-498.112) (-497.068) [-495.486] (-495.731) -- 0:00:51
      236500 -- (-497.743) (-498.095) (-496.489) [-494.789] * (-497.583) (-496.522) (-496.383) [-496.343] -- 0:00:51
      237000 -- (-499.894) (-495.774) (-497.242) [-497.051] * (-495.518) (-495.353) [-496.039] (-498.851) -- 0:00:51
      237500 -- [-495.689] (-496.191) (-495.502) (-496.358) * (-494.533) (-499.089) (-495.029) [-496.831] -- 0:00:51
      238000 -- (-496.805) (-497.428) [-495.234] (-496.021) * (-497.445) [-497.549] (-497.974) (-494.900) -- 0:00:51
      238500 -- (-497.651) (-495.217) [-496.794] (-497.370) * [-494.722] (-494.501) (-497.399) (-497.372) -- 0:00:51
      239000 -- (-495.708) (-496.235) [-495.549] (-497.717) * (-497.087) [-494.424] (-495.925) (-503.379) -- 0:00:50
      239500 -- (-494.795) (-496.917) [-495.417] (-495.324) * (-495.274) (-496.803) [-496.424] (-497.984) -- 0:00:50
      240000 -- (-495.791) (-501.239) (-494.793) [-494.881] * (-495.653) (-497.314) [-496.155] (-496.946) -- 0:00:50

      Average standard deviation of split frequencies: 0.015058

      240500 -- (-494.352) [-499.790] (-499.802) (-494.870) * (-494.961) (-495.380) [-496.073] (-495.871) -- 0:00:50
      241000 -- (-496.054) [-495.516] (-497.846) (-496.823) * (-496.629) (-494.842) (-496.392) [-497.862] -- 0:00:50
      241500 -- (-496.536) (-497.302) [-496.359] (-497.975) * [-498.275] (-501.961) (-495.396) (-498.313) -- 0:00:50
      242000 -- (-498.616) (-499.779) (-495.029) [-496.101] * [-495.854] (-497.481) (-497.627) (-500.014) -- 0:00:50
      242500 -- (-496.485) (-498.185) (-504.856) [-494.417] * [-495.770] (-494.159) (-502.419) (-498.020) -- 0:00:49
      243000 -- (-499.418) [-497.766] (-497.332) (-495.484) * [-498.218] (-497.934) (-494.813) (-495.162) -- 0:00:49
      243500 -- [-495.202] (-495.820) (-495.477) (-499.507) * (-495.146) (-496.133) [-494.219] (-499.409) -- 0:00:49
      244000 -- [-495.986] (-495.464) (-502.517) (-500.485) * [-496.389] (-496.590) (-496.816) (-498.516) -- 0:00:52
      244500 -- (-496.683) (-498.111) [-504.885] (-500.808) * [-496.211] (-495.120) (-497.101) (-498.577) -- 0:00:52
      245000 -- (-495.681) (-496.929) [-502.367] (-499.236) * (-496.730) [-495.859] (-497.251) (-497.429) -- 0:00:52

      Average standard deviation of split frequencies: 0.014541

      245500 -- (-497.786) [-495.833] (-498.500) (-498.200) * (-494.664) [-495.440] (-501.744) (-496.288) -- 0:00:52
      246000 -- (-497.912) (-495.283) [-496.576] (-496.048) * (-494.680) (-497.589) [-497.549] (-494.885) -- 0:00:52
      246500 -- (-498.309) [-494.213] (-500.180) (-502.357) * (-495.022) [-495.306] (-494.830) (-499.301) -- 0:00:51
      247000 -- (-497.921) (-494.479) (-497.486) [-499.386] * (-496.912) [-495.854] (-494.809) (-495.884) -- 0:00:51
      247500 -- [-498.617] (-495.412) (-499.234) (-497.083) * (-497.366) (-496.402) (-495.303) [-495.442] -- 0:00:51
      248000 -- (-496.944) (-498.759) [-495.184] (-495.724) * (-495.072) (-502.343) (-499.825) [-495.271] -- 0:00:51
      248500 -- (-497.290) (-498.486) [-497.048] (-495.592) * (-496.066) [-497.465] (-496.355) (-496.276) -- 0:00:51
      249000 -- (-497.026) [-496.110] (-496.321) (-497.832) * (-494.867) (-495.986) (-495.790) [-499.497] -- 0:00:51
      249500 -- [-497.335] (-495.888) (-501.388) (-496.597) * (-495.858) [-495.301] (-497.568) (-498.984) -- 0:00:51
      250000 -- (-498.877) (-496.758) (-495.829) [-495.351] * [-496.270] (-494.677) (-502.933) (-499.899) -- 0:00:51

      Average standard deviation of split frequencies: 0.014457

      250500 -- (-498.322) (-495.008) (-495.954) [-495.256] * (-496.955) [-497.027] (-496.771) (-499.508) -- 0:00:50
      251000 -- [-498.487] (-494.736) (-495.746) (-496.167) * (-496.323) (-497.341) (-497.175) [-494.500] -- 0:00:50
      251500 -- (-495.271) (-495.915) (-500.377) [-496.508] * (-498.506) (-495.420) [-497.136] (-501.990) -- 0:00:50
      252000 -- (-499.714) (-497.659) (-495.749) [-495.314] * [-497.402] (-494.312) (-495.716) (-495.601) -- 0:00:50
      252500 -- (-500.683) (-499.654) (-495.187) [-496.609] * (-498.713) (-497.129) [-498.340] (-495.259) -- 0:00:50
      253000 -- (-504.015) [-495.835] (-496.959) (-496.838) * [-497.031] (-494.541) (-496.523) (-497.576) -- 0:00:50
      253500 -- (-498.658) [-498.367] (-498.630) (-497.689) * (-495.414) (-498.129) (-495.053) [-496.631] -- 0:00:50
      254000 -- (-495.246) (-498.159) (-496.961) [-496.384] * (-495.084) (-496.250) [-494.907] (-497.263) -- 0:00:49
      254500 -- (-495.478) [-502.839] (-497.446) (-495.164) * (-495.208) [-496.577] (-497.035) (-500.013) -- 0:00:49
      255000 -- [-494.330] (-501.338) (-496.948) (-497.715) * (-497.947) (-496.927) (-494.814) [-500.161] -- 0:00:49

      Average standard deviation of split frequencies: 0.014840

      255500 -- (-500.781) (-496.063) [-495.767] (-499.268) * (-497.132) (-496.215) (-496.488) [-496.097] -- 0:00:49
      256000 -- (-500.548) (-495.566) (-498.105) [-494.889] * [-495.481] (-496.040) (-497.186) (-496.027) -- 0:00:49
      256500 -- (-500.047) [-496.172] (-498.447) (-497.842) * [-496.747] (-500.147) (-495.077) (-498.650) -- 0:00:49
      257000 -- (-498.235) (-496.434) [-495.737] (-500.880) * [-497.057] (-497.506) (-495.253) (-497.816) -- 0:00:49
      257500 -- (-498.530) (-497.709) [-496.299] (-498.000) * [-499.054] (-495.616) (-496.854) (-499.444) -- 0:00:49
      258000 -- (-496.392) (-495.740) [-498.163] (-495.057) * (-497.526) (-496.692) (-497.101) [-499.185] -- 0:00:48
      258500 -- [-497.659] (-495.398) (-495.351) (-495.640) * (-497.444) (-497.327) (-495.629) [-497.332] -- 0:00:51
      259000 -- (-495.540) (-495.813) (-495.753) [-495.273] * (-498.998) (-499.096) [-497.742] (-498.525) -- 0:00:51
      259500 -- (-496.355) (-495.637) [-494.930] (-495.676) * [-498.378] (-497.518) (-496.266) (-499.460) -- 0:00:51
      260000 -- (-500.030) (-497.970) [-496.280] (-496.145) * [-496.363] (-495.734) (-495.654) (-498.415) -- 0:00:51

      Average standard deviation of split frequencies: 0.013297

      260500 -- (-497.601) (-494.875) [-496.061] (-496.424) * (-497.696) (-495.901) (-495.127) [-497.284] -- 0:00:51
      261000 -- (-496.175) (-495.615) (-496.759) [-502.857] * (-497.889) [-495.786] (-498.735) (-497.327) -- 0:00:50
      261500 -- (-496.156) (-496.911) [-494.790] (-495.309) * [-495.796] (-495.339) (-500.930) (-495.544) -- 0:00:50
      262000 -- (-496.400) (-496.698) (-499.011) [-496.683] * [-497.193] (-497.172) (-497.700) (-495.729) -- 0:00:50
      262500 -- (-495.579) [-496.935] (-498.975) (-496.974) * (-495.794) (-499.364) (-495.376) [-495.095] -- 0:00:50
      263000 -- (-495.984) [-496.019] (-503.266) (-495.558) * (-496.090) (-498.539) (-496.889) [-494.817] -- 0:00:50
      263500 -- (-498.449) (-495.416) (-497.166) [-495.456] * (-494.867) (-498.114) (-497.802) [-497.118] -- 0:00:50
      264000 -- [-497.289] (-494.873) (-497.332) (-496.298) * (-495.020) [-495.594] (-497.866) (-495.785) -- 0:00:50
      264500 -- (-494.867) (-497.188) [-496.177] (-497.902) * (-495.766) (-501.852) [-497.420] (-500.967) -- 0:00:50
      265000 -- (-494.562) (-495.198) [-495.381] (-499.032) * (-499.135) (-498.507) (-497.496) [-498.068] -- 0:00:49

      Average standard deviation of split frequencies: 0.012197

      265500 -- (-497.174) (-494.924) (-499.072) [-497.670] * (-495.375) (-498.028) (-494.868) [-495.517] -- 0:00:49
      266000 -- (-495.185) (-496.215) (-494.969) [-495.100] * (-495.829) (-500.768) (-494.511) [-495.894] -- 0:00:49
      266500 -- [-497.684] (-495.227) (-496.194) (-495.883) * (-496.577) (-497.677) (-494.957) [-495.351] -- 0:00:49
      267000 -- (-495.050) [-498.023] (-499.044) (-496.502) * (-498.264) (-496.281) [-494.759] (-497.187) -- 0:00:49
      267500 -- (-498.117) (-502.315) [-496.112] (-498.665) * (-496.535) (-495.188) [-496.275] (-496.851) -- 0:00:49
      268000 -- (-497.707) (-497.072) (-497.274) [-495.532] * (-495.932) (-496.436) [-494.312] (-496.935) -- 0:00:49
      268500 -- (-495.503) [-498.095] (-500.243) (-496.864) * (-495.488) [-499.354] (-498.751) (-497.546) -- 0:00:49
      269000 -- (-498.000) [-495.536] (-496.106) (-498.883) * (-495.118) (-502.353) (-495.307) [-498.545] -- 0:00:48
      269500 -- (-495.740) (-497.121) [-495.385] (-498.166) * (-501.860) (-499.480) [-496.832] (-501.262) -- 0:00:48
      270000 -- (-496.762) [-495.626] (-496.066) (-496.160) * (-498.862) (-501.743) [-495.724] (-498.426) -- 0:00:48

      Average standard deviation of split frequencies: 0.013114

      270500 -- (-499.290) [-498.794] (-496.928) (-495.294) * (-498.048) [-498.191] (-495.395) (-500.243) -- 0:00:48
      271000 -- [-496.609] (-496.971) (-495.886) (-502.956) * (-495.034) [-495.955] (-498.580) (-495.904) -- 0:00:48
      271500 -- [-495.969] (-497.247) (-499.793) (-498.509) * (-497.483) [-496.930] (-496.397) (-496.495) -- 0:00:48
      272000 -- [-497.667] (-497.695) (-501.682) (-496.107) * (-498.381) (-496.965) [-496.826] (-496.182) -- 0:00:48
      272500 -- (-496.633) [-495.604] (-500.011) (-495.515) * [-496.987] (-497.532) (-499.770) (-494.976) -- 0:00:48
      273000 -- (-498.662) (-501.826) [-498.495] (-494.663) * (-495.296) (-497.129) [-495.120] (-497.774) -- 0:00:50
      273500 -- (-498.058) [-500.872] (-497.731) (-494.386) * (-495.348) (-497.717) (-496.682) [-497.806] -- 0:00:50
      274000 -- (-500.754) (-496.691) (-495.959) [-495.014] * (-499.572) (-495.834) [-494.532] (-495.238) -- 0:00:50
      274500 -- (-500.931) [-497.004] (-495.192) (-494.871) * (-496.481) (-499.935) (-496.196) [-496.686] -- 0:00:50
      275000 -- (-498.596) (-499.197) [-499.466] (-495.470) * (-497.820) (-498.492) [-497.062] (-495.528) -- 0:00:50

      Average standard deviation of split frequencies: 0.013162

      275500 -- (-500.765) (-496.460) [-497.479] (-495.524) * (-497.364) (-496.097) (-498.906) [-496.790] -- 0:00:49
      276000 -- (-497.313) [-496.640] (-498.144) (-496.708) * (-498.057) [-497.631] (-494.259) (-498.934) -- 0:00:49
      276500 -- (-495.595) [-497.824] (-495.694) (-495.374) * (-498.071) [-496.853] (-495.958) (-499.706) -- 0:00:49
      277000 -- [-495.978] (-496.800) (-495.850) (-501.802) * [-498.690] (-496.906) (-496.392) (-499.329) -- 0:00:49
      277500 -- (-495.817) (-496.287) [-497.071] (-498.399) * [-495.820] (-494.467) (-495.566) (-500.033) -- 0:00:49
      278000 -- [-496.456] (-499.997) (-496.709) (-494.922) * (-497.699) [-497.118] (-496.901) (-496.614) -- 0:00:49
      278500 -- (-496.572) (-501.404) [-496.033] (-497.695) * (-495.008) (-494.984) [-494.596] (-495.491) -- 0:00:49
      279000 -- [-496.781] (-494.986) (-496.818) (-495.764) * (-495.443) (-495.998) [-495.304] (-495.466) -- 0:00:49
      279500 -- [-497.100] (-495.615) (-495.441) (-495.641) * (-495.788) (-495.425) (-495.526) [-496.003] -- 0:00:48
      280000 -- (-494.663) [-496.173] (-495.750) (-496.534) * [-496.818] (-496.876) (-495.316) (-495.426) -- 0:00:48

      Average standard deviation of split frequencies: 0.014650

      280500 -- (-495.612) (-498.432) [-495.231] (-498.275) * (-497.214) (-497.026) (-495.620) [-495.486] -- 0:00:48
      281000 -- (-495.903) (-497.126) (-499.774) [-497.542] * (-497.663) [-499.738] (-501.025) (-495.179) -- 0:00:48
      281500 -- (-497.167) (-495.718) [-502.635] (-498.899) * (-494.783) [-496.576] (-497.310) (-495.182) -- 0:00:48
      282000 -- [-496.076] (-495.886) (-497.317) (-496.026) * (-496.734) (-504.321) [-495.091] (-499.529) -- 0:00:48
      282500 -- (-495.666) (-496.948) [-497.166] (-496.004) * [-499.252] (-498.143) (-494.732) (-498.327) -- 0:00:48
      283000 -- (-494.842) [-497.854] (-499.390) (-497.244) * (-496.857) (-496.042) [-495.297] (-502.557) -- 0:00:48
      283500 -- [-494.739] (-494.808) (-495.602) (-497.997) * (-498.546) (-496.070) (-496.352) [-495.050] -- 0:00:48
      284000 -- (-495.478) (-494.819) [-495.164] (-498.720) * (-495.989) [-495.083] (-498.150) (-494.431) -- 0:00:47
      284500 -- (-495.123) (-496.169) (-496.805) [-496.753] * [-497.447] (-501.604) (-499.440) (-494.921) -- 0:00:47
      285000 -- (-495.754) (-496.118) (-495.193) [-497.999] * [-496.430] (-495.907) (-499.762) (-495.532) -- 0:00:47

      Average standard deviation of split frequencies: 0.014285

      285500 -- (-495.632) [-497.269] (-500.467) (-497.467) * [-495.358] (-495.702) (-495.468) (-497.624) -- 0:00:47
      286000 -- (-496.537) [-494.648] (-502.480) (-494.622) * [-495.004] (-496.772) (-496.788) (-499.931) -- 0:00:47
      286500 -- [-496.639] (-496.931) (-496.865) (-494.727) * (-497.006) (-495.401) (-497.627) [-495.344] -- 0:00:47
      287000 -- (-506.478) [-496.501] (-494.663) (-496.400) * (-495.630) [-495.833] (-496.126) (-496.229) -- 0:00:49
      287500 -- (-497.080) (-495.566) [-496.058] (-495.894) * (-495.106) [-497.685] (-495.875) (-496.157) -- 0:00:49
      288000 -- [-494.693] (-496.259) (-499.916) (-495.624) * [-495.240] (-497.098) (-496.194) (-498.382) -- 0:00:49
      288500 -- (-498.658) [-494.792] (-496.968) (-494.588) * [-495.064] (-494.998) (-497.600) (-496.589) -- 0:00:49
      289000 -- [-497.129] (-496.501) (-494.480) (-495.966) * [-497.831] (-496.204) (-496.641) (-496.115) -- 0:00:49
      289500 -- (-500.705) (-498.864) [-495.122] (-496.954) * (-495.641) (-496.424) [-498.322] (-497.779) -- 0:00:49
      290000 -- (-498.919) (-498.391) (-494.597) [-494.994] * [-495.740] (-498.940) (-497.865) (-498.239) -- 0:00:48

      Average standard deviation of split frequencies: 0.014146

      290500 -- [-495.231] (-497.546) (-495.329) (-498.703) * (-497.783) (-496.066) [-496.430] (-496.476) -- 0:00:48
      291000 -- (-496.365) (-496.335) (-495.311) [-496.847] * (-494.678) (-495.949) (-496.394) [-499.377] -- 0:00:48
      291500 -- (-498.882) (-500.157) (-495.952) [-495.378] * (-496.106) (-498.024) (-494.855) [-498.050] -- 0:00:48
      292000 -- (-495.532) (-497.386) (-495.255) [-496.346] * (-495.522) (-495.989) [-495.884] (-497.296) -- 0:00:48
      292500 -- [-496.842] (-497.893) (-498.104) (-499.775) * (-495.452) (-494.865) [-495.503] (-496.116) -- 0:00:48
      293000 -- (-497.431) (-502.712) (-497.492) [-495.808] * (-498.703) [-498.845] (-496.444) (-494.923) -- 0:00:48
      293500 -- [-497.510] (-495.216) (-498.295) (-498.337) * (-498.434) [-499.217] (-496.292) (-503.346) -- 0:00:48
      294000 -- (-498.372) (-496.258) (-498.083) [-496.306] * (-496.245) (-496.546) [-496.391] (-500.326) -- 0:00:48
      294500 -- [-495.360] (-495.468) (-500.268) (-496.044) * [-496.630] (-498.476) (-499.729) (-497.846) -- 0:00:47
      295000 -- (-497.761) (-495.424) (-495.768) [-495.568] * (-498.448) [-496.482] (-496.091) (-494.809) -- 0:00:47

      Average standard deviation of split frequencies: 0.013979

      295500 -- (-494.953) (-499.495) (-495.220) [-495.344] * (-504.510) (-498.468) [-495.538] (-498.950) -- 0:00:47
      296000 -- (-495.565) (-497.003) [-494.861] (-498.495) * (-500.491) (-497.065) (-496.117) [-498.627] -- 0:00:47
      296500 -- [-497.279] (-495.533) (-499.005) (-496.938) * (-495.689) (-496.710) [-497.317] (-494.780) -- 0:00:47
      297000 -- (-499.305) (-496.636) [-495.498] (-496.827) * (-500.125) (-497.035) (-498.102) [-494.597] -- 0:00:47
      297500 -- (-495.062) (-495.763) [-496.821] (-498.895) * (-498.246) (-496.135) [-495.527] (-495.054) -- 0:00:47
      298000 -- (-496.562) (-495.904) (-496.516) [-495.746] * (-503.063) (-494.796) [-498.923] (-494.812) -- 0:00:47
      298500 -- (-496.989) (-494.600) (-494.375) [-496.842] * (-497.481) (-495.915) (-494.615) [-497.115] -- 0:00:47
      299000 -- (-495.596) [-494.597] (-495.835) (-495.538) * (-495.821) [-496.771] (-495.390) (-496.229) -- 0:00:46
      299500 -- (-497.189) [-495.481] (-494.434) (-495.844) * [-495.903] (-495.316) (-497.647) (-495.734) -- 0:00:46
      300000 -- [-495.053] (-497.987) (-495.159) (-498.786) * (-494.776) (-496.619) (-498.397) [-497.041] -- 0:00:46

      Average standard deviation of split frequencies: 0.012635

      300500 -- (-494.889) (-495.541) (-495.975) [-496.002] * (-496.789) [-497.257] (-496.314) (-495.193) -- 0:00:46
      301000 -- (-497.400) [-494.303] (-495.588) (-495.692) * [-496.789] (-497.683) (-498.916) (-495.435) -- 0:00:46
      301500 -- (-496.380) (-494.994) (-497.670) [-496.023] * (-497.215) (-495.940) (-496.304) [-497.643] -- 0:00:48
      302000 -- [-498.051] (-496.549) (-497.105) (-495.594) * (-498.945) (-498.263) (-498.500) [-495.922] -- 0:00:48
      302500 -- (-497.868) (-496.428) (-497.675) [-496.688] * (-495.579) [-495.192] (-498.841) (-499.050) -- 0:00:48
      303000 -- [-495.312] (-494.617) (-496.085) (-495.285) * (-494.797) [-495.949] (-497.926) (-496.610) -- 0:00:48
      303500 -- (-498.576) (-498.094) (-500.929) [-495.065] * [-495.205] (-497.734) (-498.580) (-496.320) -- 0:00:48
      304000 -- (-495.661) (-496.452) (-496.271) [-494.934] * [-497.005] (-495.899) (-495.996) (-499.835) -- 0:00:48
      304500 -- [-497.084] (-499.053) (-496.810) (-497.020) * (-496.557) (-495.750) (-497.899) [-495.489] -- 0:00:47
      305000 -- (-496.603) (-495.486) [-494.850] (-495.573) * [-495.519] (-497.283) (-496.220) (-496.084) -- 0:00:47

      Average standard deviation of split frequencies: 0.012752

      305500 -- [-496.518] (-498.811) (-499.228) (-496.493) * (-495.700) (-495.211) [-495.091] (-497.784) -- 0:00:47
      306000 -- (-498.427) [-500.898] (-496.303) (-496.166) * (-496.685) (-495.496) [-494.441] (-494.616) -- 0:00:47
      306500 -- (-495.079) (-498.283) [-494.863] (-502.647) * [-497.735] (-496.261) (-497.699) (-495.144) -- 0:00:47
      307000 -- (-495.524) [-496.062] (-497.343) (-496.001) * [-497.061] (-497.036) (-495.890) (-495.369) -- 0:00:47
      307500 -- (-496.789) [-497.267] (-500.044) (-495.743) * (-498.293) (-496.523) (-495.337) [-495.521] -- 0:00:47
      308000 -- (-497.388) (-495.065) [-495.839] (-496.366) * (-498.185) (-499.858) [-496.655] (-495.463) -- 0:00:47
      308500 -- (-495.716) [-495.624] (-495.501) (-496.104) * [-495.215] (-496.682) (-495.894) (-496.510) -- 0:00:47
      309000 -- [-501.574] (-495.294) (-497.519) (-498.181) * (-498.324) (-495.950) (-496.680) [-496.269] -- 0:00:46
      309500 -- (-496.470) (-497.585) [-496.916] (-496.055) * (-499.293) (-497.032) (-498.075) [-496.755] -- 0:00:46
      310000 -- (-499.533) (-495.648) (-499.247) [-495.838] * [-497.639] (-496.257) (-495.364) (-498.468) -- 0:00:46

      Average standard deviation of split frequencies: 0.012561

      310500 -- (-500.057) (-495.381) [-497.298] (-496.972) * (-497.159) [-495.386] (-495.278) (-497.830) -- 0:00:46
      311000 -- [-496.701] (-495.431) (-495.923) (-496.666) * [-495.428] (-502.256) (-495.848) (-497.977) -- 0:00:46
      311500 -- (-497.022) (-496.140) [-494.754] (-497.715) * (-496.135) (-500.735) (-496.703) [-499.887] -- 0:00:46
      312000 -- (-497.075) [-494.982] (-494.599) (-497.863) * (-494.975) [-494.957] (-497.733) (-497.160) -- 0:00:46
      312500 -- [-495.912] (-494.711) (-495.028) (-499.128) * (-500.855) (-494.516) (-499.811) [-499.099] -- 0:00:46
      313000 -- (-496.346) (-494.793) [-495.105] (-499.695) * (-494.916) (-496.237) [-496.574] (-495.730) -- 0:00:46
      313500 -- (-496.675) [-494.793] (-494.365) (-494.709) * (-495.778) [-495.848] (-495.868) (-496.915) -- 0:00:45
      314000 -- (-497.515) (-496.451) [-498.078] (-497.464) * [-497.328] (-496.031) (-497.943) (-495.960) -- 0:00:45
      314500 -- (-499.095) (-495.785) (-494.264) [-496.556] * (-497.230) [-494.620] (-496.605) (-501.805) -- 0:00:45
      315000 -- (-495.600) (-494.700) (-496.413) [-494.738] * (-500.323) [-495.870] (-497.232) (-496.077) -- 0:00:45

      Average standard deviation of split frequencies: 0.011841

      315500 -- (-497.293) (-494.998) (-497.845) [-496.680] * (-496.699) (-496.932) [-498.004] (-497.301) -- 0:00:47
      316000 -- (-497.174) [-496.587] (-497.240) (-494.291) * [-500.628] (-496.213) (-498.262) (-496.406) -- 0:00:47
      316500 -- (-498.945) (-499.725) [-495.248] (-496.525) * (-496.475) [-495.912] (-498.088) (-497.167) -- 0:00:47
      317000 -- (-495.775) (-499.110) (-498.665) [-494.282] * (-499.514) (-495.531) [-495.569] (-494.860) -- 0:00:47
      317500 -- (-495.012) (-497.660) (-495.639) [-494.873] * (-496.279) (-495.250) [-494.765] (-495.779) -- 0:00:47
      318000 -- (-502.188) (-496.189) (-495.702) [-495.933] * [-498.213] (-494.460) (-496.223) (-496.848) -- 0:00:47
      318500 -- (-496.459) (-495.032) (-499.343) [-497.028] * (-495.426) (-494.627) (-496.892) [-496.247] -- 0:00:47
      319000 -- (-503.250) [-499.026] (-496.013) (-496.042) * (-496.955) [-495.352] (-495.200) (-497.860) -- 0:00:46
      319500 -- (-500.703) [-497.140] (-497.730) (-499.733) * (-497.141) (-495.465) (-496.210) [-494.864] -- 0:00:46
      320000 -- (-501.486) [-496.983] (-500.431) (-494.905) * (-496.324) [-494.344] (-496.064) (-495.398) -- 0:00:46

      Average standard deviation of split frequencies: 0.010015

      320500 -- [-495.500] (-495.208) (-497.648) (-496.810) * [-494.832] (-496.786) (-496.356) (-495.072) -- 0:00:46
      321000 -- (-497.229) (-496.405) [-496.501] (-494.659) * [-495.869] (-497.419) (-497.010) (-496.513) -- 0:00:46
      321500 -- (-498.763) (-495.518) [-495.150] (-495.026) * (-497.570) (-497.210) (-495.808) [-501.000] -- 0:00:46
      322000 -- (-499.734) [-494.719] (-496.665) (-499.317) * (-498.976) [-497.793] (-498.444) (-504.993) -- 0:00:46
      322500 -- [-499.915] (-495.830) (-498.198) (-494.514) * (-498.747) (-498.051) (-496.970) [-497.148] -- 0:00:46
      323000 -- (-494.531) [-497.123] (-496.114) (-496.078) * [-496.814] (-496.775) (-494.656) (-497.294) -- 0:00:46
      323500 -- (-495.674) (-496.038) [-496.073] (-496.674) * (-497.061) [-495.894] (-495.580) (-496.392) -- 0:00:46
      324000 -- (-497.559) [-494.533] (-497.285) (-495.217) * [-498.506] (-499.055) (-494.607) (-494.965) -- 0:00:45
      324500 -- (-501.227) (-496.083) [-496.494] (-498.648) * (-496.531) (-497.731) [-496.369] (-495.161) -- 0:00:45
      325000 -- (-497.350) [-496.049] (-498.243) (-496.959) * [-494.996] (-498.992) (-497.169) (-497.698) -- 0:00:45

      Average standard deviation of split frequencies: 0.009612

      325500 -- (-497.312) [-497.297] (-498.666) (-495.493) * [-495.121] (-502.052) (-497.217) (-496.401) -- 0:00:45
      326000 -- (-495.499) (-495.697) [-500.442] (-497.972) * [-495.281] (-499.463) (-495.736) (-501.778) -- 0:00:45
      326500 -- [-496.490] (-496.249) (-500.881) (-497.179) * (-495.570) (-495.155) (-495.412) [-497.384] -- 0:00:45
      327000 -- (-498.711) (-495.370) (-496.962) [-496.323] * [-495.201] (-495.386) (-496.755) (-500.805) -- 0:00:45
      327500 -- (-497.363) (-497.040) (-496.642) [-497.021] * (-496.055) [-497.286] (-495.567) (-499.008) -- 0:00:45
      328000 -- [-495.726] (-495.900) (-497.157) (-498.197) * (-497.258) (-496.372) (-496.883) [-496.009] -- 0:00:45
      328500 -- (-499.276) (-498.615) (-498.038) [-496.905] * [-494.793] (-495.354) (-495.773) (-495.392) -- 0:00:44
      329000 -- (-497.723) (-498.548) (-495.560) [-498.074] * (-494.859) (-495.106) [-494.998] (-496.405) -- 0:00:44
      329500 -- [-496.878] (-496.981) (-498.081) (-498.064) * (-497.539) [-495.017] (-494.472) (-497.582) -- 0:00:44
      330000 -- (-495.164) (-500.068) (-495.973) [-496.970] * [-498.424] (-494.484) (-496.323) (-495.984) -- 0:00:46

      Average standard deviation of split frequencies: 0.009225

      330500 -- [-496.917] (-496.536) (-497.281) (-496.652) * (-496.496) (-495.758) [-496.782] (-494.153) -- 0:00:46
      331000 -- (-494.978) [-497.560] (-497.404) (-498.558) * (-498.726) (-499.102) [-496.375] (-495.678) -- 0:00:46
      331500 -- (-495.011) (-495.591) [-498.212] (-495.343) * (-495.589) (-495.656) (-499.223) [-496.596] -- 0:00:46
      332000 -- (-497.347) (-496.052) [-496.054] (-497.736) * (-494.409) (-497.831) [-495.906] (-497.924) -- 0:00:46
      332500 -- (-496.005) [-495.153] (-496.686) (-497.976) * (-496.588) (-496.059) (-495.319) [-495.259] -- 0:00:46
      333000 -- (-496.564) [-496.568] (-496.053) (-498.148) * [-497.967] (-494.652) (-498.003) (-496.954) -- 0:00:46
      333500 -- [-496.629] (-497.813) (-498.956) (-499.107) * (-495.665) [-494.454] (-497.726) (-495.109) -- 0:00:45
      334000 -- [-500.084] (-497.951) (-494.699) (-503.244) * (-496.892) [-497.520] (-495.889) (-495.455) -- 0:00:45
      334500 -- (-500.452) (-496.890) (-498.320) [-496.478] * (-498.076) [-498.165] (-497.570) (-496.967) -- 0:00:45
      335000 -- (-497.627) (-499.085) [-497.062] (-495.440) * (-498.853) (-500.021) [-496.469] (-496.539) -- 0:00:45

      Average standard deviation of split frequencies: 0.009821

      335500 -- (-501.783) (-499.392) (-494.884) [-497.734] * (-496.270) (-496.986) (-497.044) [-497.843] -- 0:00:45
      336000 -- (-497.375) (-497.041) [-497.753] (-495.724) * (-496.523) [-496.225] (-496.525) (-496.444) -- 0:00:45
      336500 -- [-496.687] (-495.078) (-495.914) (-495.982) * [-499.474] (-494.631) (-495.266) (-497.997) -- 0:00:45
      337000 -- (-496.332) (-494.909) [-495.513] (-495.036) * (-496.664) [-496.567] (-496.068) (-498.566) -- 0:00:45
      337500 -- (-495.856) (-495.551) [-498.141] (-499.535) * (-496.234) (-495.422) (-498.026) [-495.269] -- 0:00:45
      338000 -- (-497.334) [-497.303] (-495.459) (-497.986) * [-497.604] (-497.002) (-496.235) (-499.741) -- 0:00:45
      338500 -- [-497.610] (-496.805) (-495.994) (-496.918) * (-496.629) [-497.206] (-500.115) (-496.600) -- 0:00:44
      339000 -- (-498.287) (-496.663) [-496.426] (-497.833) * [-499.027] (-502.093) (-496.371) (-495.572) -- 0:00:44
      339500 -- [-496.372] (-497.709) (-497.728) (-497.951) * (-496.125) (-500.334) (-496.147) [-497.975] -- 0:00:44
      340000 -- (-495.053) (-496.057) [-494.552] (-496.102) * (-496.096) [-497.913] (-499.932) (-500.402) -- 0:00:44

      Average standard deviation of split frequencies: 0.009117

      340500 -- (-495.509) (-494.898) [-494.822] (-496.116) * (-496.285) (-496.525) [-496.051] (-500.785) -- 0:00:44
      341000 -- (-498.308) (-496.176) [-498.688] (-497.490) * [-497.615] (-495.152) (-494.706) (-497.298) -- 0:00:44
      341500 -- (-495.125) [-497.891] (-495.882) (-494.674) * [-497.489] (-496.431) (-498.718) (-499.015) -- 0:00:44
      342000 -- (-495.151) [-505.334] (-500.071) (-495.149) * (-499.186) (-495.067) [-501.245] (-495.991) -- 0:00:44
      342500 -- (-496.074) (-495.842) (-496.530) [-495.968] * (-496.507) (-496.017) [-495.209] (-498.040) -- 0:00:44
      343000 -- [-497.440] (-496.272) (-502.343) (-497.730) * (-499.213) [-494.856] (-496.021) (-497.437) -- 0:00:44
      343500 -- (-495.987) [-498.668] (-496.329) (-497.308) * [-495.446] (-498.369) (-496.761) (-498.623) -- 0:00:43
      344000 -- (-495.238) (-502.811) [-496.253] (-495.241) * (-494.672) (-497.891) [-495.293] (-495.844) -- 0:00:45
      344500 -- (-497.760) (-495.544) [-494.666] (-498.800) * [-497.789] (-500.556) (-497.196) (-494.699) -- 0:00:45
      345000 -- (-497.438) [-494.964] (-496.038) (-500.508) * (-497.900) (-495.203) [-496.157] (-497.184) -- 0:00:45

      Average standard deviation of split frequencies: 0.009778

      345500 -- (-497.066) [-496.934] (-495.363) (-498.238) * [-499.667] (-494.680) (-495.224) (-497.259) -- 0:00:45
      346000 -- (-495.438) (-501.063) [-494.557] (-497.068) * (-496.867) (-497.328) [-500.433] (-498.046) -- 0:00:45
      346500 -- (-496.236) [-498.701] (-496.151) (-495.016) * (-495.710) (-500.348) (-498.688) [-498.438] -- 0:00:45
      347000 -- (-496.631) (-494.947) [-496.491] (-496.386) * (-495.037) (-496.052) (-494.271) [-495.629] -- 0:00:45
      347500 -- (-496.195) (-500.706) [-496.021] (-497.420) * (-495.339) (-499.013) (-495.218) [-496.844] -- 0:00:45
      348000 -- [-495.681] (-496.866) (-495.020) (-497.723) * (-495.143) (-497.371) [-494.663] (-499.144) -- 0:00:44
      348500 -- (-497.884) (-496.114) (-496.326) [-497.237] * [-496.415] (-494.911) (-494.800) (-499.497) -- 0:00:44
      349000 -- [-497.335] (-497.183) (-496.869) (-494.573) * (-494.989) (-496.962) (-494.720) [-499.740] -- 0:00:44
      349500 -- (-498.613) [-496.706] (-498.032) (-496.256) * (-494.399) (-498.080) [-494.870] (-497.118) -- 0:00:44
      350000 -- [-501.839] (-496.666) (-496.092) (-496.902) * (-495.575) [-497.836] (-498.390) (-496.439) -- 0:00:44

      Average standard deviation of split frequencies: 0.009173

      350500 -- [-498.355] (-495.869) (-496.187) (-504.994) * (-494.551) (-502.932) [-495.932] (-499.176) -- 0:00:44
      351000 -- (-495.013) (-495.210) [-496.755] (-496.451) * (-495.592) (-501.453) [-496.895] (-497.347) -- 0:00:44
      351500 -- (-495.944) [-496.660] (-497.930) (-496.204) * [-496.635] (-497.617) (-497.386) (-496.375) -- 0:00:44
      352000 -- (-495.243) [-495.625] (-496.940) (-495.554) * (-496.423) (-496.942) (-497.768) [-495.929] -- 0:00:44
      352500 -- (-497.694) [-494.328] (-495.358) (-496.952) * (-495.207) [-494.638] (-494.964) (-500.107) -- 0:00:44
      353000 -- (-495.574) (-498.195) (-494.666) [-500.515] * (-502.018) [-495.733] (-498.169) (-494.943) -- 0:00:43
      353500 -- (-494.995) [-495.259] (-497.192) (-502.445) * (-502.129) [-495.543] (-496.914) (-497.736) -- 0:00:43
      354000 -- (-498.325) (-499.228) [-497.437] (-496.746) * [-495.596] (-496.860) (-497.480) (-494.940) -- 0:00:43
      354500 -- [-497.712] (-501.237) (-495.873) (-498.846) * (-498.337) [-494.470] (-497.411) (-498.529) -- 0:00:43
      355000 -- [-496.032] (-497.775) (-499.032) (-495.887) * [-494.607] (-498.603) (-495.657) (-497.476) -- 0:00:43

      Average standard deviation of split frequencies: 0.008880

      355500 -- (-496.435) (-496.289) (-496.138) [-500.115] * (-499.513) (-496.425) [-496.484] (-495.083) -- 0:00:43
      356000 -- [-502.916] (-499.197) (-498.169) (-502.081) * (-495.679) [-495.066] (-495.415) (-496.498) -- 0:00:43
      356500 -- (-500.498) (-495.806) (-496.012) [-498.984] * (-496.132) [-496.715] (-497.682) (-497.274) -- 0:00:43
      357000 -- (-498.299) (-496.532) (-495.184) [-495.427] * (-497.111) (-495.077) (-496.386) [-497.467] -- 0:00:43
      357500 -- (-496.070) (-498.487) [-497.065] (-500.027) * (-495.848) (-497.488) [-496.946] (-496.274) -- 0:00:43
      358000 -- [-495.920] (-495.769) (-497.264) (-498.707) * (-495.984) [-498.041] (-494.677) (-499.001) -- 0:00:43
      358500 -- (-498.960) [-495.452] (-497.277) (-495.873) * (-496.041) (-495.855) (-494.551) [-497.844] -- 0:00:44
      359000 -- (-499.376) (-496.023) (-497.388) [-496.707] * (-496.944) (-495.437) (-496.822) [-496.098] -- 0:00:44
      359500 -- (-503.600) [-496.239] (-497.413) (-498.227) * (-496.958) (-497.439) (-497.988) [-499.083] -- 0:00:44
      360000 -- (-495.199) (-496.483) [-495.670] (-497.864) * [-495.534] (-497.536) (-498.498) (-495.406) -- 0:00:44

      Average standard deviation of split frequencies: 0.009149

      360500 -- (-496.306) [-496.090] (-497.514) (-497.504) * (-496.078) (-498.082) (-495.735) [-498.056] -- 0:00:44
      361000 -- (-498.257) [-495.456] (-494.843) (-499.130) * (-496.859) (-500.501) (-497.630) [-494.849] -- 0:00:44
      361500 -- (-496.676) [-494.391] (-495.569) (-497.515) * (-494.751) (-496.969) [-498.628] (-495.076) -- 0:00:44
      362000 -- (-497.278) (-496.267) (-496.522) [-496.870] * [-495.747] (-496.632) (-499.151) (-494.708) -- 0:00:44
      362500 -- (-497.187) [-497.870] (-495.324) (-495.519) * (-497.119) [-497.481] (-496.807) (-501.153) -- 0:00:43
      363000 -- [-495.816] (-498.520) (-500.467) (-497.601) * (-503.894) [-496.024] (-494.907) (-497.193) -- 0:00:43
      363500 -- (-498.514) (-495.116) (-497.817) [-497.383] * (-495.261) (-497.727) [-495.465] (-499.905) -- 0:00:43
      364000 -- (-495.165) (-497.324) (-500.241) [-494.704] * (-500.940) (-495.652) (-494.924) [-496.715] -- 0:00:43
      364500 -- [-498.123] (-498.444) (-495.638) (-494.360) * (-501.172) [-495.605] (-496.193) (-496.386) -- 0:00:43
      365000 -- [-495.487] (-498.171) (-496.242) (-496.971) * (-496.304) (-497.770) (-500.076) [-495.595] -- 0:00:43

      Average standard deviation of split frequencies: 0.008561

      365500 -- [-495.823] (-498.693) (-496.304) (-496.859) * (-504.509) [-495.596] (-497.551) (-498.308) -- 0:00:43
      366000 -- [-500.240] (-499.028) (-495.104) (-495.713) * (-495.695) (-496.424) [-496.280] (-498.077) -- 0:00:43
      366500 -- [-496.207] (-498.033) (-495.310) (-497.250) * (-496.919) (-497.329) [-499.645] (-501.176) -- 0:00:43
      367000 -- [-494.613] (-496.765) (-495.927) (-497.061) * (-497.093) (-501.426) (-500.313) [-497.164] -- 0:00:43
      367500 -- (-496.837) (-496.381) (-496.382) [-497.350] * [-497.522] (-497.026) (-498.220) (-498.904) -- 0:00:43
      368000 -- [-495.763] (-498.014) (-496.232) (-496.616) * [-495.476] (-496.175) (-497.802) (-500.158) -- 0:00:42
      368500 -- [-496.008] (-503.195) (-496.718) (-498.187) * (-496.135) (-498.929) [-496.302] (-497.159) -- 0:00:42
      369000 -- (-495.310) (-496.314) (-496.755) [-498.928] * (-495.622) [-496.090] (-495.988) (-498.408) -- 0:00:42
      369500 -- (-499.209) [-494.944] (-498.970) (-495.574) * (-495.300) (-495.249) (-496.815) [-496.975] -- 0:00:42
      370000 -- (-499.654) [-502.920] (-494.914) (-496.862) * (-495.128) (-495.903) [-497.936] (-494.735) -- 0:00:42

      Average standard deviation of split frequencies: 0.008902

      370500 -- (-496.933) [-497.497] (-495.533) (-494.992) * (-497.587) (-496.113) [-494.258] (-495.196) -- 0:00:42
      371000 -- (-499.909) (-498.458) (-495.148) [-495.942] * (-495.095) (-495.634) [-494.240] (-494.635) -- 0:00:42
      371500 -- (-495.929) [-495.050] (-495.620) (-499.315) * (-496.898) (-500.424) [-495.128] (-497.724) -- 0:00:42
      372000 -- (-495.319) (-496.416) [-495.284] (-497.165) * (-494.803) [-500.178] (-496.077) (-496.670) -- 0:00:42
      372500 -- (-497.175) (-496.166) [-494.548] (-495.016) * (-498.958) (-496.383) [-498.639] (-497.196) -- 0:00:43
      373000 -- [-496.214] (-496.337) (-496.231) (-496.232) * (-499.158) [-495.956] (-498.260) (-496.284) -- 0:00:43
      373500 -- (-496.921) [-494.512] (-497.573) (-495.545) * [-495.390] (-495.226) (-495.600) (-495.450) -- 0:00:43
      374000 -- (-496.030) (-499.635) (-494.970) [-498.598] * (-494.815) (-497.282) [-495.232] (-495.097) -- 0:00:43
      374500 -- [-494.687] (-497.083) (-496.194) (-498.917) * (-496.952) [-495.490] (-494.545) (-495.585) -- 0:00:43
      375000 -- (-496.428) (-499.078) [-494.845] (-497.577) * [-497.915] (-496.061) (-497.931) (-496.835) -- 0:00:43

      Average standard deviation of split frequencies: 0.009145

      375500 -- (-496.029) (-495.153) (-497.032) [-494.504] * [-498.044] (-494.572) (-499.288) (-505.746) -- 0:00:43
      376000 -- [-494.911] (-496.365) (-495.930) (-498.083) * (-498.026) (-496.977) [-497.838] (-499.310) -- 0:00:43
      376500 -- [-495.292] (-497.837) (-495.035) (-496.918) * (-495.480) (-497.207) [-496.499] (-494.917) -- 0:00:43
      377000 -- [-496.285] (-496.366) (-497.326) (-498.476) * (-495.626) (-498.591) [-495.251] (-497.200) -- 0:00:42
      377500 -- [-497.030] (-498.122) (-507.166) (-497.803) * (-496.562) (-499.822) [-495.477] (-494.656) -- 0:00:42
      378000 -- [-494.873] (-495.452) (-501.219) (-494.832) * (-499.954) [-495.703] (-500.359) (-497.211) -- 0:00:42
      378500 -- (-495.157) (-495.252) (-499.826) [-496.745] * (-500.151) (-495.519) (-495.796) [-495.622] -- 0:00:42
      379000 -- (-494.658) (-497.412) (-496.457) [-495.761] * (-497.143) (-495.111) (-497.825) [-496.876] -- 0:00:42
      379500 -- (-497.984) (-497.037) (-494.835) [-495.573] * (-500.085) (-499.159) [-497.930] (-500.534) -- 0:00:42
      380000 -- (-496.248) [-496.318] (-496.215) (-495.101) * (-496.596) (-499.537) [-501.770] (-498.234) -- 0:00:42

      Average standard deviation of split frequencies: 0.008377

      380500 -- [-496.101] (-501.146) (-495.794) (-498.597) * (-497.561) (-498.818) [-502.249] (-500.259) -- 0:00:42
      381000 -- (-496.217) (-497.715) (-496.194) [-498.160] * (-495.671) (-497.212) [-497.704] (-494.422) -- 0:00:42
      381500 -- (-497.819) (-497.317) (-499.482) [-495.468] * (-495.954) (-499.466) (-496.378) [-494.622] -- 0:00:42
      382000 -- [-497.376] (-497.647) (-496.233) (-496.143) * [-495.986] (-498.950) (-497.877) (-496.739) -- 0:00:42
      382500 -- (-496.886) (-498.803) (-501.743) [-495.843] * [-496.004] (-497.080) (-497.944) (-495.338) -- 0:00:41
      383000 -- (-494.801) (-497.033) (-496.288) [-496.317] * [-497.355] (-496.171) (-497.910) (-496.342) -- 0:00:41
      383500 -- [-496.211] (-499.592) (-496.153) (-496.786) * (-495.533) [-500.649] (-495.392) (-495.734) -- 0:00:41
      384000 -- [-496.456] (-496.920) (-495.563) (-495.761) * (-495.478) [-497.756] (-494.587) (-497.540) -- 0:00:41
      384500 -- [-496.516] (-498.597) (-497.275) (-498.835) * (-496.126) [-496.512] (-500.820) (-495.384) -- 0:00:41
      385000 -- (-496.486) (-495.485) (-496.667) [-497.341] * (-495.156) [-494.784] (-495.332) (-496.213) -- 0:00:41

      Average standard deviation of split frequencies: 0.007974

      385500 -- [-496.041] (-495.429) (-497.791) (-495.220) * (-498.609) (-497.227) [-496.097] (-498.138) -- 0:00:43
      386000 -- [-496.319] (-498.102) (-500.669) (-495.772) * (-498.157) (-498.118) [-496.004] (-495.842) -- 0:00:42
      386500 -- (-497.759) [-500.063] (-497.164) (-495.247) * (-496.281) [-496.333] (-496.411) (-502.102) -- 0:00:42
      387000 -- [-494.916] (-501.184) (-497.378) (-494.726) * (-495.999) (-496.694) (-494.990) [-500.880] -- 0:00:42
      387500 -- (-496.556) (-499.712) (-497.523) [-494.726] * (-496.238) [-495.133] (-495.645) (-497.312) -- 0:00:42
      388000 -- (-498.152) (-495.581) [-498.273] (-494.723) * (-498.985) [-495.142] (-496.845) (-499.342) -- 0:00:42
      388500 -- (-499.713) (-494.802) (-499.350) [-494.412] * (-501.362) (-495.595) [-496.621] (-495.996) -- 0:00:42
      389000 -- [-494.442] (-495.704) (-496.166) (-495.474) * (-497.749) (-497.977) (-494.873) [-495.237] -- 0:00:42
      389500 -- (-496.164) (-499.070) [-495.166] (-496.780) * (-497.460) (-505.632) (-494.231) [-497.319] -- 0:00:42
      390000 -- [-495.869] (-499.552) (-496.745) (-496.364) * (-497.856) [-502.530] (-496.099) (-494.927) -- 0:00:42

      Average standard deviation of split frequencies: 0.008660

      390500 -- (-495.281) (-498.129) [-495.471] (-499.394) * [-495.947] (-504.543) (-495.394) (-495.462) -- 0:00:42
      391000 -- [-496.411] (-495.888) (-496.983) (-496.377) * [-496.142] (-496.372) (-495.377) (-496.315) -- 0:00:42
      391500 -- (-496.978) (-495.146) (-495.676) [-498.269] * (-499.043) [-495.337] (-496.054) (-499.757) -- 0:00:41
      392000 -- (-500.081) [-494.929] (-494.251) (-497.961) * (-495.125) (-499.024) [-496.064] (-494.897) -- 0:00:41
      392500 -- (-500.312) (-495.977) (-501.576) [-501.160] * (-499.553) (-497.627) (-496.806) [-498.127] -- 0:00:41
      393000 -- (-496.855) (-501.289) (-494.529) [-495.979] * (-497.323) (-497.449) [-497.082] (-495.806) -- 0:00:41
      393500 -- (-496.165) (-497.024) [-498.674] (-495.652) * (-500.606) (-498.876) [-496.357] (-501.368) -- 0:00:41
      394000 -- (-494.454) [-494.110] (-500.450) (-495.076) * (-495.188) [-499.423] (-496.779) (-496.784) -- 0:00:41
      394500 -- (-499.170) (-495.007) [-495.134] (-494.805) * (-502.307) (-497.896) [-495.516] (-495.613) -- 0:00:41
      395000 -- (-497.781) (-495.799) (-496.129) [-495.147] * [-498.548] (-496.223) (-497.025) (-494.886) -- 0:00:41

      Average standard deviation of split frequencies: 0.009033

      395500 -- (-495.842) (-497.570) [-494.640] (-495.426) * (-498.586) (-496.359) (-495.193) [-494.846] -- 0:00:41
      396000 -- (-498.065) (-498.854) (-497.586) [-494.899] * (-496.821) (-495.802) [-496.893] (-501.680) -- 0:00:41
      396500 -- (-494.925) (-495.883) [-497.050] (-495.439) * (-494.653) (-496.663) [-494.870] (-498.103) -- 0:00:41
      397000 -- (-494.658) (-503.671) [-497.690] (-495.867) * (-496.721) (-496.364) [-496.880] (-498.612) -- 0:00:41
      397500 -- (-494.895) (-498.055) [-498.363] (-497.412) * (-495.902) [-496.504] (-496.085) (-500.786) -- 0:00:40
      398000 -- (-494.621) (-496.375) (-500.584) [-496.983] * (-495.877) [-498.058] (-497.656) (-496.877) -- 0:00:40
      398500 -- (-496.836) (-498.045) (-497.353) [-495.914] * [-495.563] (-498.327) (-495.003) (-495.233) -- 0:00:40
      399000 -- (-497.231) (-496.840) (-494.920) [-497.803] * (-495.007) [-500.447] (-494.805) (-497.175) -- 0:00:40
      399500 -- (-499.979) (-497.053) [-495.660] (-495.061) * (-497.525) (-495.678) (-496.644) [-496.493] -- 0:00:42
      400000 -- (-498.366) (-503.778) [-496.355] (-494.129) * (-495.176) [-496.508] (-495.833) (-499.161) -- 0:00:41

      Average standard deviation of split frequencies: 0.009482

      400500 -- [-499.643] (-498.613) (-498.426) (-495.860) * (-499.345) (-496.987) [-494.399] (-497.427) -- 0:00:41
      401000 -- (-501.286) (-496.895) (-498.424) [-497.287] * (-495.916) (-494.767) [-495.790] (-495.554) -- 0:00:41
      401500 -- [-495.206] (-496.162) (-497.836) (-495.478) * (-495.060) [-499.331] (-496.673) (-496.752) -- 0:00:41
      402000 -- [-498.874] (-496.313) (-495.478) (-495.579) * (-497.829) (-496.641) [-494.608] (-499.777) -- 0:00:41
      402500 -- [-494.390] (-497.711) (-497.574) (-496.809) * (-495.391) (-497.298) [-495.177] (-494.814) -- 0:00:41
      403000 -- (-499.184) (-502.063) (-499.834) [-495.454] * (-496.004) (-497.962) [-499.381] (-495.883) -- 0:00:41
      403500 -- (-497.884) [-498.859] (-497.358) (-498.508) * (-496.334) (-496.793) [-498.883] (-495.172) -- 0:00:41
      404000 -- (-497.171) (-496.895) [-496.513] (-501.701) * (-496.193) [-496.134] (-495.945) (-495.486) -- 0:00:41
      404500 -- (-500.043) (-496.841) (-497.054) [-495.087] * [-496.942] (-496.227) (-497.789) (-496.727) -- 0:00:41
      405000 -- (-496.201) (-496.481) [-495.899] (-496.033) * [-497.009] (-497.305) (-502.764) (-495.312) -- 0:00:41

      Average standard deviation of split frequencies: 0.008947

      405500 -- [-502.133] (-496.424) (-494.417) (-501.258) * (-497.119) (-494.911) [-496.257] (-498.589) -- 0:00:41
      406000 -- (-496.308) (-498.837) [-494.730] (-495.292) * (-497.633) (-496.008) (-495.871) [-496.310] -- 0:00:40
      406500 -- (-498.391) (-497.226) [-494.497] (-498.128) * (-498.254) (-495.118) [-495.664] (-497.756) -- 0:00:40
      407000 -- [-494.838] (-501.299) (-494.456) (-495.663) * [-497.288] (-495.563) (-495.157) (-495.392) -- 0:00:40
      407500 -- (-494.672) (-501.056) [-496.478] (-496.853) * (-496.944) (-495.305) (-497.428) [-495.010] -- 0:00:40
      408000 -- (-495.680) [-496.872] (-497.093) (-501.764) * (-496.848) [-495.305] (-496.665) (-495.737) -- 0:00:40
      408500 -- (-495.420) [-496.381] (-497.619) (-496.369) * (-498.107) [-495.402] (-494.987) (-496.081) -- 0:00:40
      409000 -- (-500.256) [-496.240] (-497.118) (-498.388) * (-496.301) (-502.917) [-497.838] (-500.795) -- 0:00:40
      409500 -- [-495.043] (-498.363) (-497.290) (-498.585) * (-495.214) [-500.678] (-502.994) (-496.474) -- 0:00:40
      410000 -- (-496.165) [-495.277] (-496.777) (-496.168) * (-497.017) (-498.286) (-499.139) [-498.281] -- 0:00:40

      Average standard deviation of split frequencies: 0.009398

      410500 -- (-498.460) (-499.390) (-497.285) [-496.530] * (-496.962) [-494.746] (-494.518) (-495.321) -- 0:00:40
      411000 -- [-499.341] (-499.286) (-499.105) (-496.403) * (-502.567) (-495.528) [-495.238] (-494.973) -- 0:00:40
      411500 -- (-495.744) [-497.631] (-496.738) (-498.527) * (-497.364) (-496.940) [-498.493] (-495.267) -- 0:00:40
      412000 -- [-496.291] (-495.572) (-496.306) (-504.672) * (-495.609) (-496.173) (-498.089) [-496.280] -- 0:00:39
      412500 -- (-494.612) [-494.726] (-496.728) (-498.828) * (-498.444) (-500.391) [-499.440] (-496.159) -- 0:00:39
      413000 -- (-498.908) (-497.230) (-498.243) [-496.165] * (-500.778) [-494.901] (-498.496) (-498.201) -- 0:00:39
      413500 -- (-500.723) (-496.061) [-497.824] (-496.910) * [-501.477] (-497.783) (-497.229) (-499.448) -- 0:00:39
      414000 -- (-496.099) (-495.326) (-498.084) [-501.009] * (-500.705) (-494.962) (-499.037) [-495.641] -- 0:00:41
      414500 -- [-494.937] (-497.410) (-495.817) (-496.110) * [-497.936] (-498.987) (-496.025) (-495.209) -- 0:00:40
      415000 -- (-497.182) (-497.814) (-494.633) [-495.106] * [-495.952] (-495.611) (-495.482) (-495.349) -- 0:00:40

      Average standard deviation of split frequencies: 0.008732

      415500 -- (-499.149) (-497.898) [-494.460] (-496.510) * (-495.096) (-495.637) [-496.938] (-497.369) -- 0:00:40
      416000 -- (-495.969) (-497.675) [-497.954] (-497.654) * (-498.247) (-495.930) [-496.085] (-495.524) -- 0:00:40
      416500 -- [-496.831] (-495.731) (-496.808) (-498.619) * [-494.989] (-495.069) (-496.452) (-498.501) -- 0:00:40
      417000 -- (-496.937) (-496.180) [-495.031] (-496.253) * (-495.473) [-494.542] (-498.429) (-496.107) -- 0:00:40
      417500 -- [-498.779] (-495.465) (-495.912) (-496.229) * (-495.542) (-494.606) (-495.225) [-496.637] -- 0:00:40
      418000 -- (-497.948) (-495.681) [-494.956] (-495.190) * (-496.737) (-495.761) (-495.111) [-495.481] -- 0:00:40
      418500 -- (-498.268) [-494.737] (-498.171) (-499.542) * [-494.580] (-494.332) (-496.784) (-498.820) -- 0:00:40
      419000 -- (-502.897) (-497.559) [-495.301] (-498.904) * [-496.932] (-497.348) (-497.934) (-498.382) -- 0:00:40
      419500 -- [-495.852] (-495.906) (-495.021) (-497.769) * [-500.532] (-496.261) (-496.971) (-499.815) -- 0:00:40
      420000 -- [-496.100] (-496.413) (-495.249) (-495.959) * (-496.791) (-496.816) [-494.983] (-497.881) -- 0:00:40

      Average standard deviation of split frequencies: 0.008635

      420500 -- [-494.811] (-499.603) (-495.276) (-495.183) * (-497.802) (-495.121) [-494.875] (-497.687) -- 0:00:39
      421000 -- (-500.690) (-495.403) [-498.373] (-496.524) * [-496.764] (-495.139) (-499.110) (-495.074) -- 0:00:39
      421500 -- [-497.541] (-499.040) (-498.588) (-499.406) * (-496.250) (-496.864) (-496.371) [-496.060] -- 0:00:39
      422000 -- (-496.913) [-494.832] (-495.064) (-499.009) * [-495.323] (-496.560) (-494.942) (-498.433) -- 0:00:39
      422500 -- (-495.672) (-494.846) [-496.280] (-501.840) * (-494.783) (-496.447) [-495.455] (-497.406) -- 0:00:39
      423000 -- (-495.447) (-497.515) [-495.329] (-499.026) * [-497.310] (-498.907) (-498.474) (-496.797) -- 0:00:39
      423500 -- (-497.438) (-499.095) [-496.007] (-495.909) * (-497.558) (-497.019) (-496.361) [-495.790] -- 0:00:39
      424000 -- [-494.494] (-498.805) (-495.079) (-495.750) * (-497.947) (-496.866) [-494.810] (-496.073) -- 0:00:39
      424500 -- [-495.184] (-495.562) (-497.348) (-496.335) * [-498.494] (-495.957) (-494.643) (-496.561) -- 0:00:39
      425000 -- (-496.521) (-497.249) [-495.322] (-497.080) * (-498.842) (-495.646) (-496.454) [-497.021] -- 0:00:39

      Average standard deviation of split frequencies: 0.008202

      425500 -- [-495.723] (-501.406) (-498.069) (-496.485) * (-495.535) (-494.445) [-495.685] (-498.593) -- 0:00:39
      426000 -- (-495.545) [-495.161] (-495.110) (-497.541) * (-496.525) (-496.025) (-497.043) [-498.362] -- 0:00:39
      426500 -- [-495.697] (-495.377) (-497.454) (-498.404) * (-495.512) (-495.226) (-494.796) [-494.850] -- 0:00:38
      427000 -- (-498.448) (-495.215) (-495.349) [-497.377] * (-494.633) (-496.191) [-496.259] (-496.988) -- 0:00:38
      427500 -- [-497.017] (-495.309) (-494.945) (-495.766) * (-496.511) (-495.237) [-499.056] (-496.827) -- 0:00:38
      428000 -- (-500.680) (-495.183) [-495.620] (-498.750) * [-497.351] (-495.621) (-499.595) (-496.375) -- 0:00:40
      428500 -- (-498.947) [-496.483] (-494.958) (-497.118) * (-499.471) (-495.517) (-495.071) [-499.803] -- 0:00:40
      429000 -- (-498.822) (-498.071) [-497.025] (-495.261) * (-501.574) [-496.327] (-496.168) (-495.623) -- 0:00:39
      429500 -- (-498.096) (-498.404) (-499.914) [-496.968] * (-503.857) [-495.367] (-500.093) (-496.571) -- 0:00:39
      430000 -- (-498.270) [-496.472] (-495.715) (-496.768) * (-495.995) (-494.459) (-496.033) [-495.842] -- 0:00:39

      Average standard deviation of split frequencies: 0.009272

      430500 -- (-499.797) [-495.190] (-495.431) (-495.414) * [-496.904] (-498.793) (-496.495) (-495.787) -- 0:00:39
      431000 -- (-501.143) (-499.100) [-498.474] (-497.747) * (-496.983) (-498.767) [-495.860] (-495.773) -- 0:00:39
      431500 -- (-498.048) (-498.078) [-496.211] (-500.367) * (-498.015) [-494.897] (-497.709) (-496.162) -- 0:00:39
      432000 -- (-499.759) (-495.950) (-495.652) [-501.148] * (-496.670) (-495.432) [-498.307] (-498.919) -- 0:00:39
      432500 -- [-496.057] (-495.198) (-494.330) (-497.413) * (-500.982) [-497.848] (-497.226) (-496.732) -- 0:00:39
      433000 -- (-503.177) [-495.766] (-497.194) (-495.465) * (-494.990) (-495.061) [-494.502] (-495.313) -- 0:00:39
      433500 -- (-500.777) (-496.596) [-494.723] (-502.149) * (-497.800) [-495.612] (-494.723) (-495.085) -- 0:00:39
      434000 -- [-497.435] (-495.060) (-494.769) (-501.141) * [-500.805] (-494.711) (-495.135) (-496.971) -- 0:00:39
      434500 -- (-497.324) (-496.539) [-495.635] (-499.392) * (-500.072) (-495.352) [-495.203] (-495.788) -- 0:00:39
      435000 -- (-496.916) (-497.603) [-501.965] (-499.398) * (-499.817) (-494.543) [-495.977] (-497.076) -- 0:00:38

      Average standard deviation of split frequencies: 0.007950

      435500 -- (-496.358) [-496.047] (-495.227) (-502.226) * (-497.191) (-497.220) [-497.071] (-496.323) -- 0:00:38
      436000 -- (-497.859) [-501.555] (-496.462) (-497.347) * (-497.633) [-496.605] (-494.977) (-495.038) -- 0:00:38
      436500 -- (-498.672) (-498.951) (-498.240) [-497.240] * (-497.517) (-496.057) (-496.949) [-497.199] -- 0:00:38
      437000 -- (-496.510) (-497.163) (-495.461) [-495.582] * [-496.350] (-496.828) (-495.926) (-495.430) -- 0:00:38
      437500 -- [-495.651] (-498.528) (-498.402) (-496.668) * (-502.022) (-499.069) [-494.495] (-497.936) -- 0:00:38
      438000 -- (-498.684) [-496.465] (-495.949) (-497.215) * (-496.479) (-498.257) [-497.373] (-495.063) -- 0:00:38
      438500 -- (-496.160) (-495.612) [-494.750] (-501.452) * (-496.941) (-497.711) (-498.849) [-495.629] -- 0:00:38
      439000 -- [-496.165] (-500.243) (-494.583) (-497.954) * (-497.316) [-498.032] (-495.231) (-496.978) -- 0:00:38
      439500 -- (-495.229) (-498.333) [-495.168] (-496.721) * (-495.354) [-495.722] (-495.586) (-497.951) -- 0:00:38
      440000 -- [-496.209] (-497.108) (-495.078) (-496.284) * [-496.204] (-496.022) (-496.881) (-496.226) -- 0:00:38

      Average standard deviation of split frequencies: 0.009360

      440500 -- [-495.863] (-495.506) (-495.739) (-497.234) * (-495.413) (-495.011) (-496.800) [-494.969] -- 0:00:38
      441000 -- [-496.797] (-496.564) (-496.067) (-496.913) * (-496.192) (-496.499) (-495.993) [-495.301] -- 0:00:38
      441500 -- (-499.462) [-494.884] (-496.067) (-494.885) * (-495.052) [-495.996] (-495.563) (-494.431) -- 0:00:37
      442000 -- (-495.324) [-496.712] (-495.120) (-495.798) * (-495.078) (-496.623) [-496.731] (-494.871) -- 0:00:37
      442500 -- (-496.486) (-496.010) (-495.806) [-497.866] * (-496.406) (-496.467) [-498.970] (-495.062) -- 0:00:39
      443000 -- (-496.635) (-498.114) [-494.862] (-495.901) * (-497.339) (-497.801) [-495.836] (-495.886) -- 0:00:38
      443500 -- (-498.553) [-496.506] (-495.384) (-498.612) * [-495.210] (-498.316) (-499.848) (-494.968) -- 0:00:38
      444000 -- (-496.635) [-495.815] (-496.342) (-495.573) * (-497.988) (-496.729) [-497.109] (-494.473) -- 0:00:38
      444500 -- (-496.339) (-497.691) (-496.404) [-495.666] * (-495.376) [-495.654] (-498.999) (-494.699) -- 0:00:38
      445000 -- (-497.695) (-498.003) (-496.337) [-495.209] * (-495.686) (-500.267) [-496.234] (-497.733) -- 0:00:38

      Average standard deviation of split frequencies: 0.009454

      445500 -- (-497.727) [-495.238] (-499.428) (-496.621) * [-495.473] (-497.030) (-494.980) (-497.512) -- 0:00:38
      446000 -- (-495.632) (-500.403) [-495.854] (-495.926) * (-495.972) [-496.244] (-494.898) (-497.104) -- 0:00:38
      446500 -- (-496.008) (-497.228) (-501.311) [-494.792] * [-497.602] (-495.000) (-495.792) (-496.604) -- 0:00:38
      447000 -- [-498.478] (-494.677) (-495.564) (-497.406) * (-495.530) (-496.621) [-495.333] (-496.828) -- 0:00:38
      447500 -- [-494.831] (-495.516) (-494.936) (-495.532) * (-496.418) (-496.391) [-497.364] (-498.063) -- 0:00:38
      448000 -- (-494.894) (-495.565) [-496.235] (-495.899) * (-498.103) (-495.798) [-496.195] (-497.704) -- 0:00:38
      448500 -- (-495.447) [-495.042] (-497.382) (-495.617) * (-499.510) (-495.798) [-495.501] (-495.664) -- 0:00:38
      449000 -- (-499.293) (-496.887) [-496.164] (-495.629) * (-498.412) (-496.290) [-495.397] (-495.441) -- 0:00:38
      449500 -- (-506.412) (-497.683) [-497.484] (-495.357) * (-497.388) (-496.811) (-499.098) [-500.393] -- 0:00:37
      450000 -- [-497.187] (-495.411) (-497.482) (-497.474) * (-496.241) (-495.243) [-497.729] (-497.620) -- 0:00:37

      Average standard deviation of split frequencies: 0.008737

      450500 -- (-495.784) [-496.030] (-494.927) (-495.954) * (-495.986) [-494.898] (-494.832) (-496.425) -- 0:00:37
      451000 -- (-494.238) [-496.557] (-503.853) (-496.638) * (-495.939) (-496.577) (-495.178) [-495.398] -- 0:00:37
      451500 -- (-494.334) (-496.975) [-495.745] (-495.220) * (-496.849) (-500.851) [-495.850] (-496.828) -- 0:00:37
      452000 -- (-495.955) [-494.399] (-495.779) (-497.405) * [-495.412] (-496.140) (-495.815) (-495.950) -- 0:00:37
      452500 -- (-497.247) (-495.379) [-499.545] (-497.086) * (-495.052) (-496.674) [-494.662] (-496.419) -- 0:00:37
      453000 -- (-496.520) [-495.346] (-498.580) (-496.302) * [-496.348] (-496.493) (-495.476) (-495.626) -- 0:00:37
      453500 -- (-496.433) [-497.209] (-498.864) (-498.002) * (-496.810) [-496.491] (-499.261) (-496.825) -- 0:00:37
      454000 -- (-495.880) (-495.520) [-494.987] (-501.739) * (-495.918) (-498.701) [-498.412] (-497.715) -- 0:00:37
      454500 -- [-495.611] (-495.103) (-494.993) (-496.217) * (-496.462) [-495.092] (-496.041) (-495.886) -- 0:00:37
      455000 -- (-501.895) [-496.729] (-497.866) (-494.679) * (-497.229) (-496.954) [-498.636] (-496.431) -- 0:00:37

      Average standard deviation of split frequencies: 0.008757

      455500 -- (-501.361) (-495.074) [-496.036] (-496.514) * [-497.481] (-497.378) (-497.542) (-495.568) -- 0:00:37
      456000 -- (-496.428) [-498.104] (-496.746) (-498.718) * [-495.272] (-494.722) (-502.453) (-498.944) -- 0:00:36
      456500 -- [-496.841] (-497.714) (-495.844) (-497.982) * [-497.890] (-500.247) (-500.620) (-497.532) -- 0:00:36
      457000 -- [-498.417] (-500.780) (-498.747) (-496.064) * (-500.363) (-494.706) (-497.254) [-499.222] -- 0:00:38
      457500 -- (-496.430) (-495.560) [-504.403] (-496.675) * (-494.943) [-496.916] (-496.182) (-494.763) -- 0:00:37
      458000 -- (-497.275) (-496.274) (-502.152) [-495.953] * (-496.941) (-496.837) (-497.069) [-495.764] -- 0:00:37
      458500 -- (-505.945) (-497.077) (-499.829) [-497.692] * (-496.994) (-496.240) (-495.751) [-494.827] -- 0:00:37
      459000 -- (-498.147) (-495.557) (-498.339) [-495.430] * (-499.242) (-498.017) [-498.488] (-495.396) -- 0:00:37
      459500 -- (-496.403) [-497.740] (-497.681) (-495.943) * (-495.120) (-497.678) (-498.659) [-497.064] -- 0:00:37
      460000 -- (-496.423) (-498.394) [-496.127] (-496.146) * (-496.805) [-499.368] (-496.952) (-495.652) -- 0:00:37

      Average standard deviation of split frequencies: 0.009402

      460500 -- (-495.489) [-496.944] (-495.623) (-495.270) * (-499.536) (-494.799) (-496.891) [-500.319] -- 0:00:37
      461000 -- [-497.718] (-497.862) (-496.103) (-496.918) * (-496.223) [-494.658] (-498.553) (-495.859) -- 0:00:37
      461500 -- (-495.394) (-499.740) [-495.515] (-502.062) * (-497.390) (-494.755) (-496.075) [-499.644] -- 0:00:37
      462000 -- (-494.625) (-495.644) [-496.587] (-498.326) * (-498.149) (-495.441) (-496.244) [-497.849] -- 0:00:37
      462500 -- (-494.780) (-496.164) [-495.401] (-494.803) * (-500.870) (-494.815) [-495.818] (-498.538) -- 0:00:37
      463000 -- [-497.512] (-495.423) (-495.519) (-497.611) * [-495.051] (-496.530) (-496.461) (-504.932) -- 0:00:37
      463500 -- (-494.806) [-494.995] (-496.166) (-496.819) * [-496.148] (-495.420) (-498.125) (-496.925) -- 0:00:37
      464000 -- (-495.175) [-495.791] (-496.506) (-494.742) * (-496.063) (-496.277) [-496.269] (-494.604) -- 0:00:36
      464500 -- (-495.130) (-495.511) (-496.521) [-495.320] * [-494.989] (-496.449) (-497.032) (-497.698) -- 0:00:36
      465000 -- (-496.056) [-499.976] (-496.362) (-496.370) * [-495.499] (-496.178) (-499.938) (-497.024) -- 0:00:36

      Average standard deviation of split frequencies: 0.008851

      465500 -- [-496.553] (-498.142) (-496.787) (-494.265) * [-494.504] (-498.104) (-496.726) (-497.859) -- 0:00:36
      466000 -- (-496.386) (-496.696) [-497.259] (-495.190) * [-498.866] (-497.502) (-499.646) (-498.801) -- 0:00:36
      466500 -- (-496.929) [-495.015] (-496.226) (-500.469) * [-496.960] (-496.654) (-494.407) (-495.998) -- 0:00:36
      467000 -- (-496.797) [-500.705] (-495.795) (-499.683) * (-497.038) [-497.218] (-495.019) (-495.285) -- 0:00:36
      467500 -- (-496.622) (-496.568) (-496.960) [-497.853] * (-497.133) (-496.529) [-497.391] (-494.439) -- 0:00:36
      468000 -- (-495.553) [-496.835] (-495.167) (-497.760) * [-496.219] (-497.695) (-496.462) (-495.647) -- 0:00:36
      468500 -- (-498.125) (-497.916) [-499.283] (-497.295) * (-498.009) (-498.221) [-495.816] (-496.334) -- 0:00:36
      469000 -- (-496.563) (-496.644) (-495.869) [-495.317] * (-495.586) (-497.463) [-495.383] (-498.826) -- 0:00:36
      469500 -- (-495.473) (-500.908) (-497.750) [-494.585] * (-497.778) (-495.462) (-495.555) [-497.866] -- 0:00:36
      470000 -- (-497.530) (-495.925) (-498.505) [-494.443] * [-498.511] (-497.416) (-495.825) (-497.121) -- 0:00:36

      Average standard deviation of split frequencies: 0.008013

      470500 -- (-496.762) (-495.007) (-495.812) [-496.805] * (-495.832) [-495.320] (-496.163) (-495.251) -- 0:00:36
      471000 -- (-495.045) [-495.545] (-495.407) (-496.875) * (-498.714) (-496.560) [-496.657] (-496.009) -- 0:00:37
      471500 -- (-496.337) [-495.088] (-496.355) (-495.915) * (-496.091) (-495.854) (-497.252) [-496.072] -- 0:00:36
      472000 -- (-497.591) (-496.106) [-495.455] (-495.957) * [-494.673] (-496.339) (-497.787) (-498.219) -- 0:00:36
      472500 -- [-498.251] (-495.117) (-495.713) (-495.891) * (-495.244) (-502.770) (-495.670) [-495.404] -- 0:00:36
      473000 -- (-496.076) [-495.358] (-494.805) (-496.870) * (-499.357) (-494.649) (-495.612) [-496.426] -- 0:00:36
      473500 -- (-496.781) [-495.412] (-500.775) (-497.627) * (-498.568) (-495.885) (-497.938) [-496.660] -- 0:00:36
      474000 -- [-496.087] (-495.221) (-496.852) (-496.518) * (-499.040) (-495.184) [-494.673] (-495.581) -- 0:00:36
      474500 -- (-496.222) (-495.682) (-495.542) [-497.060] * (-498.700) [-495.008] (-496.793) (-497.643) -- 0:00:36
      475000 -- (-495.585) (-495.069) [-497.109] (-495.161) * (-499.064) (-495.888) (-495.142) [-496.484] -- 0:00:36

      Average standard deviation of split frequencies: 0.007613

      475500 -- (-494.427) (-495.640) (-496.458) [-494.998] * (-499.284) (-502.523) [-495.109] (-496.515) -- 0:00:36
      476000 -- (-494.360) (-498.855) (-494.434) [-496.445] * (-494.854) (-497.840) [-495.472] (-501.575) -- 0:00:36
      476500 -- [-496.188] (-496.508) (-495.938) (-497.913) * (-495.686) (-498.147) [-494.806] (-497.511) -- 0:00:36
      477000 -- (-495.915) [-497.339] (-497.426) (-496.378) * (-495.412) [-496.209] (-495.024) (-497.456) -- 0:00:36
      477500 -- (-494.696) [-496.256] (-500.500) (-494.597) * (-497.486) (-496.152) [-495.494] (-495.651) -- 0:00:36
      478000 -- [-495.370] (-495.443) (-501.536) (-497.093) * (-494.673) (-496.736) (-495.571) [-495.529] -- 0:00:36
      478500 -- (-500.232) [-495.206] (-497.762) (-496.053) * (-495.324) (-498.663) [-496.653] (-496.270) -- 0:00:35
      479000 -- (-497.095) (-496.705) [-494.972] (-495.933) * [-496.746] (-495.162) (-495.853) (-496.700) -- 0:00:35
      479500 -- (-497.071) [-495.448] (-495.416) (-496.999) * (-495.960) [-495.040] (-497.258) (-497.286) -- 0:00:35
      480000 -- (-498.587) (-496.337) (-496.640) [-497.361] * (-495.995) (-495.307) (-497.058) [-501.862] -- 0:00:35

      Average standard deviation of split frequencies: 0.007846

      480500 -- [-497.538] (-496.559) (-502.627) (-496.295) * (-496.397) (-498.446) [-497.115] (-498.022) -- 0:00:35
      481000 -- (-497.042) (-496.714) (-499.399) [-496.434] * (-497.490) (-494.897) [-495.580] (-497.499) -- 0:00:35
      481500 -- (-495.073) (-495.752) [-498.410] (-496.406) * (-495.339) (-495.527) (-495.167) [-496.212] -- 0:00:35
      482000 -- (-498.705) [-496.272] (-499.152) (-497.799) * (-497.195) (-495.291) [-494.901] (-495.920) -- 0:00:35
      482500 -- (-502.261) (-496.433) (-499.771) [-498.769] * (-497.735) (-496.735) (-499.447) [-496.415] -- 0:00:35
      483000 -- (-498.536) [-499.575] (-496.414) (-498.034) * (-495.484) (-497.998) [-497.460] (-495.188) -- 0:00:35
      483500 -- (-497.581) (-497.770) (-495.823) [-495.899] * (-494.251) (-499.347) (-496.098) [-497.422] -- 0:00:35
      484000 -- (-499.623) (-496.725) [-495.910] (-496.266) * (-496.352) (-496.465) (-494.956) [-499.096] -- 0:00:35
      484500 -- (-501.176) (-497.448) (-496.113) [-497.841] * [-496.638] (-497.719) (-495.878) (-498.112) -- 0:00:35
      485000 -- [-499.863] (-497.420) (-495.395) (-495.447) * (-498.596) (-495.320) (-497.890) [-499.138] -- 0:00:35

      Average standard deviation of split frequencies: 0.007335

      485500 -- [-495.911] (-498.813) (-494.671) (-498.198) * (-497.482) (-495.484) [-495.378] (-498.419) -- 0:00:36
      486000 -- (-497.422) [-496.787] (-495.331) (-497.475) * (-499.716) (-496.619) [-495.496] (-495.021) -- 0:00:35
      486500 -- (-499.905) [-494.820] (-494.937) (-495.766) * [-497.157] (-496.329) (-495.886) (-498.174) -- 0:00:35
      487000 -- (-499.518) (-496.220) [-494.996] (-495.524) * (-496.477) (-500.414) (-494.821) [-495.862] -- 0:00:35
      487500 -- (-495.590) (-495.861) (-507.679) [-497.315] * (-497.938) [-495.284] (-496.956) (-500.064) -- 0:00:35
      488000 -- (-497.095) [-497.146] (-496.023) (-498.664) * (-495.919) (-499.286) (-496.387) [-496.955] -- 0:00:35
      488500 -- (-495.792) [-496.539] (-495.754) (-495.484) * (-499.576) (-498.797) [-497.561] (-495.204) -- 0:00:35
      489000 -- [-496.776] (-500.386) (-494.978) (-500.004) * (-497.032) (-499.098) [-498.154] (-497.320) -- 0:00:35
      489500 -- [-496.094] (-498.053) (-495.479) (-497.228) * (-497.603) (-497.222) [-494.918] (-496.337) -- 0:00:35
      490000 -- (-499.359) (-496.291) [-495.171] (-496.988) * (-496.443) [-496.818] (-495.206) (-497.310) -- 0:00:35

      Average standard deviation of split frequencies: 0.008467

      490500 -- (-500.315) (-500.062) (-496.689) [-495.296] * (-495.878) [-496.115] (-503.664) (-495.341) -- 0:00:35
      491000 -- (-495.181) (-496.425) [-498.849] (-496.328) * (-495.054) (-496.578) (-502.881) [-498.863] -- 0:00:35
      491500 -- [-494.993] (-497.167) (-496.277) (-496.949) * (-500.072) (-495.574) [-495.183] (-500.103) -- 0:00:35
      492000 -- (-496.129) [-495.333] (-495.863) (-497.332) * (-497.731) [-496.860] (-495.676) (-497.883) -- 0:00:35
      492500 -- (-496.219) (-495.290) [-495.844] (-496.908) * (-495.320) [-496.438] (-496.883) (-499.434) -- 0:00:35
      493000 -- [-495.907] (-495.146) (-496.782) (-497.317) * [-494.921] (-496.064) (-497.299) (-494.857) -- 0:00:34
      493500 -- (-494.692) (-498.153) (-494.985) [-495.091] * (-495.230) (-496.098) [-497.080] (-496.188) -- 0:00:34
      494000 -- [-497.983] (-499.971) (-495.739) (-497.378) * (-494.840) (-494.679) [-494.680] (-498.742) -- 0:00:34
      494500 -- (-496.170) (-494.663) (-496.250) [-494.877] * (-500.094) [-495.827] (-495.712) (-497.086) -- 0:00:34
      495000 -- (-495.351) (-494.551) (-496.209) [-494.927] * (-498.366) (-500.212) [-496.117] (-496.563) -- 0:00:34

      Average standard deviation of split frequencies: 0.008554

      495500 -- (-494.740) (-494.544) [-496.958] (-498.855) * [-501.159] (-496.415) (-496.704) (-496.556) -- 0:00:34
      496000 -- [-497.753] (-494.921) (-495.668) (-500.195) * (-496.839) (-498.299) [-500.347] (-496.863) -- 0:00:34
      496500 -- [-498.994] (-495.798) (-494.747) (-500.071) * (-496.312) [-495.000] (-496.641) (-496.001) -- 0:00:34
      497000 -- (-500.034) [-494.881] (-496.299) (-496.604) * (-502.277) [-497.983] (-497.630) (-496.811) -- 0:00:34
      497500 -- (-496.609) (-496.770) [-500.382] (-495.184) * (-494.553) (-495.508) (-495.228) [-494.561] -- 0:00:34
      498000 -- (-500.372) (-496.005) [-496.591] (-495.753) * [-495.591] (-495.580) (-494.889) (-498.605) -- 0:00:34
      498500 -- (-496.903) (-496.502) (-497.776) [-496.364] * [-494.421] (-497.311) (-498.547) (-500.533) -- 0:00:34
      499000 -- (-500.172) (-496.967) [-497.602] (-496.835) * (-495.723) (-496.641) (-498.971) [-496.449] -- 0:00:34
      499500 -- (-496.258) (-496.397) (-500.476) [-496.261] * [-495.507] (-501.442) (-495.499) (-495.892) -- 0:00:35
      500000 -- (-496.178) (-496.686) (-496.750) [-496.052] * (-494.954) (-494.534) (-498.486) [-495.848] -- 0:00:35

      Average standard deviation of split frequencies: 0.008062

      500500 -- (-496.267) (-495.276) (-497.194) [-496.115] * [-495.563] (-494.624) (-498.308) (-497.103) -- 0:00:34
      501000 -- (-496.580) [-501.305] (-494.765) (-496.688) * [-494.441] (-496.804) (-494.999) (-497.566) -- 0:00:34
      501500 -- (-496.308) (-500.172) (-494.635) [-496.714] * (-495.560) [-498.632] (-497.709) (-497.588) -- 0:00:34
      502000 -- (-496.465) (-499.670) (-496.420) [-495.770] * (-494.583) (-498.403) [-494.503] (-497.052) -- 0:00:34
      502500 -- [-497.549] (-495.152) (-496.621) (-497.905) * (-496.147) (-500.683) [-494.616] (-496.129) -- 0:00:34
      503000 -- [-497.560] (-501.220) (-496.166) (-497.048) * (-499.791) (-494.494) [-496.013] (-499.918) -- 0:00:34
      503500 -- (-497.960) [-496.969] (-496.333) (-494.601) * [-498.045] (-497.345) (-495.930) (-497.443) -- 0:00:34
      504000 -- (-499.335) (-498.416) [-497.309] (-494.799) * (-496.339) (-497.862) (-496.512) [-495.261] -- 0:00:34
      504500 -- [-494.654] (-494.812) (-495.121) (-498.346) * (-496.642) (-500.210) (-497.715) [-495.522] -- 0:00:34
      505000 -- (-495.119) (-497.605) (-496.284) [-495.378] * [-495.915] (-496.030) (-495.021) (-496.217) -- 0:00:34

      Average standard deviation of split frequencies: 0.008330

      505500 -- (-496.399) (-494.695) (-495.868) [-495.903] * (-496.903) (-499.282) [-498.930] (-496.558) -- 0:00:34
      506000 -- [-495.382] (-497.099) (-497.051) (-496.139) * (-497.501) [-495.514] (-495.334) (-495.644) -- 0:00:34
      506500 -- (-497.923) (-499.293) (-496.262) [-496.809] * (-497.115) (-498.019) [-496.166] (-498.518) -- 0:00:34
      507000 -- (-499.733) (-496.078) [-496.793] (-497.797) * (-496.184) [-497.812] (-497.682) (-498.679) -- 0:00:34
      507500 -- [-497.923] (-500.336) (-497.350) (-496.642) * [-495.863] (-499.506) (-496.476) (-501.790) -- 0:00:33
      508000 -- [-499.208] (-496.969) (-496.672) (-495.985) * (-495.638) (-497.203) (-499.916) [-500.810] -- 0:00:33
      508500 -- (-495.131) (-496.899) [-500.543] (-495.750) * [-495.240] (-495.624) (-497.520) (-496.348) -- 0:00:33
      509000 -- (-494.865) (-496.470) [-496.519] (-503.630) * (-497.620) (-497.108) [-495.916] (-496.864) -- 0:00:33
      509500 -- (-498.481) [-495.262] (-497.847) (-495.903) * [-496.682] (-495.952) (-495.586) (-496.642) -- 0:00:33
      510000 -- (-498.341) [-495.776] (-497.396) (-496.127) * [-495.225] (-496.243) (-495.752) (-497.853) -- 0:00:33

      Average standard deviation of split frequencies: 0.007819

      510500 -- (-496.126) [-500.608] (-495.898) (-497.866) * (-496.140) [-496.295] (-498.486) (-495.509) -- 0:00:33
      511000 -- (-495.241) [-496.189] (-496.336) (-497.362) * (-501.319) (-495.351) (-494.878) [-497.458] -- 0:00:33
      511500 -- (-495.208) (-497.102) [-495.151] (-497.001) * [-498.943] (-496.601) (-495.136) (-495.003) -- 0:00:33
      512000 -- (-494.632) (-495.414) (-499.231) [-496.162] * (-499.424) (-502.451) (-495.761) [-495.499] -- 0:00:33
      512500 -- (-495.608) [-494.793] (-497.497) (-501.191) * (-495.150) (-497.818) [-495.348] (-495.576) -- 0:00:33
      513000 -- (-496.617) [-495.421] (-495.774) (-499.598) * (-496.603) [-495.335] (-494.269) (-497.842) -- 0:00:33
      513500 -- (-495.464) (-496.845) [-495.487] (-497.796) * (-497.005) [-496.087] (-497.081) (-497.539) -- 0:00:33
      514000 -- [-497.466] (-497.571) (-495.673) (-497.211) * (-495.351) (-498.986) (-494.927) [-494.925] -- 0:00:34
      514500 -- [-495.620] (-497.237) (-494.302) (-503.294) * [-496.192] (-497.347) (-499.121) (-498.801) -- 0:00:33
      515000 -- (-494.518) (-495.554) (-496.969) [-497.054] * [-494.733] (-500.306) (-497.176) (-495.347) -- 0:00:33

      Average standard deviation of split frequencies: 0.007953

      515500 -- [-495.764] (-496.891) (-494.929) (-495.566) * (-495.296) (-497.685) [-496.479] (-495.333) -- 0:00:33
      516000 -- (-499.269) (-496.706) (-496.777) [-497.357] * (-497.903) (-497.261) [-494.489] (-494.466) -- 0:00:33
      516500 -- (-494.376) (-496.705) [-495.636] (-500.440) * (-497.026) (-497.874) (-496.164) [-495.038] -- 0:00:33
      517000 -- (-495.095) (-496.454) (-497.617) [-500.566] * (-496.669) (-496.972) (-495.618) [-494.980] -- 0:00:33
      517500 -- (-495.297) [-496.877] (-497.047) (-499.532) * [-494.716] (-495.235) (-497.155) (-495.501) -- 0:00:33
      518000 -- (-497.295) [-496.343] (-497.090) (-498.305) * (-498.266) (-498.596) [-494.711] (-495.281) -- 0:00:33
      518500 -- (-496.165) (-497.946) [-494.852] (-495.472) * (-498.485) (-497.089) (-496.685) [-496.253] -- 0:00:33
      519000 -- (-498.258) [-495.357] (-497.211) (-495.945) * [-496.033] (-499.513) (-495.693) (-495.604) -- 0:00:33
      519500 -- (-498.873) [-495.838] (-494.667) (-495.816) * (-495.249) (-496.592) (-495.368) [-498.911] -- 0:00:33
      520000 -- (-495.985) [-494.847] (-495.170) (-497.160) * (-495.794) (-496.825) (-496.944) [-495.868] -- 0:00:33

      Average standard deviation of split frequencies: 0.008362

      520500 -- (-494.840) (-495.506) (-495.408) [-498.693] * (-497.111) (-495.381) [-497.562] (-496.578) -- 0:00:33
      521000 -- [-496.934] (-494.990) (-495.016) (-496.065) * (-498.714) [-499.386] (-496.113) (-496.338) -- 0:00:33
      521500 -- [-496.051] (-497.055) (-496.222) (-496.006) * (-496.914) (-499.187) [-496.713] (-495.629) -- 0:00:33
      522000 -- (-498.197) (-495.065) (-498.944) [-497.072] * [-497.096] (-502.716) (-499.836) (-497.104) -- 0:00:32
      522500 -- (-498.951) [-495.837] (-498.089) (-500.183) * (-495.147) (-495.993) (-496.514) [-497.045] -- 0:00:32
      523000 -- (-494.805) [-495.321] (-495.088) (-500.017) * [-496.721] (-495.221) (-496.329) (-495.987) -- 0:00:32
      523500 -- [-496.801] (-496.654) (-498.669) (-496.384) * (-501.144) (-495.688) [-496.597] (-498.874) -- 0:00:32
      524000 -- [-499.177] (-500.114) (-499.974) (-494.709) * (-501.411) [-497.105] (-501.220) (-496.293) -- 0:00:32
      524500 -- (-499.663) (-498.114) [-501.207] (-495.644) * (-498.114) (-494.672) (-497.042) [-497.029] -- 0:00:32
      525000 -- [-500.549] (-497.513) (-496.849) (-495.665) * (-499.182) [-497.624] (-495.635) (-496.523) -- 0:00:32

      Average standard deviation of split frequencies: 0.007908

      525500 -- (-495.690) (-495.750) [-498.597] (-496.114) * [-497.171] (-496.727) (-495.684) (-496.016) -- 0:00:32
      526000 -- (-495.661) (-495.067) [-499.770] (-495.754) * [-495.892] (-495.515) (-496.111) (-494.938) -- 0:00:32
      526500 -- (-495.555) (-495.743) (-499.787) [-495.020] * (-499.897) [-497.618] (-504.073) (-498.174) -- 0:00:32
      527000 -- (-497.687) (-496.313) (-498.775) [-500.321] * (-499.150) [-495.037] (-500.317) (-494.893) -- 0:00:32
      527500 -- [-497.442] (-495.381) (-497.920) (-498.312) * (-494.489) (-498.433) [-496.838] (-494.530) -- 0:00:32
      528000 -- (-495.079) (-495.130) [-497.124] (-499.748) * (-495.524) [-496.702] (-496.016) (-495.895) -- 0:00:32
      528500 -- (-496.462) [-498.664] (-496.381) (-495.634) * (-494.231) (-497.180) [-497.045] (-496.809) -- 0:00:33
      529000 -- (-495.542) (-499.054) [-495.693] (-495.634) * (-494.435) [-499.683] (-495.941) (-495.132) -- 0:00:32
      529500 -- (-496.184) (-495.653) (-495.214) [-497.325] * (-495.819) (-500.460) [-498.321] (-494.616) -- 0:00:32
      530000 -- (-495.524) (-499.411) [-494.669] (-497.253) * [-496.977] (-495.807) (-498.534) (-497.126) -- 0:00:32

      Average standard deviation of split frequencies: 0.007681

      530500 -- [-494.817] (-497.507) (-496.270) (-498.930) * (-496.418) (-496.946) (-499.670) [-494.805] -- 0:00:32
      531000 -- [-494.795] (-498.549) (-494.898) (-496.708) * [-495.947] (-495.734) (-495.928) (-495.820) -- 0:00:32
      531500 -- (-499.596) (-501.205) (-496.573) [-496.414] * (-496.156) (-495.803) (-495.511) [-498.304] -- 0:00:32
      532000 -- (-498.145) [-496.779] (-496.024) (-495.999) * (-496.451) [-496.238] (-495.333) (-499.837) -- 0:00:32
      532500 -- (-497.405) (-495.412) [-494.446] (-496.367) * (-494.466) [-498.340] (-495.515) (-495.793) -- 0:00:32
      533000 -- [-495.101] (-494.812) (-496.831) (-495.938) * [-494.305] (-495.455) (-496.447) (-496.591) -- 0:00:32
      533500 -- [-496.545] (-495.408) (-495.126) (-495.133) * (-496.904) (-502.995) [-495.634] (-496.433) -- 0:00:32
      534000 -- (-498.315) [-495.910] (-494.912) (-499.795) * (-497.105) (-498.199) [-495.435] (-496.584) -- 0:00:32
      534500 -- (-497.491) (-498.136) (-498.116) [-497.922] * [-495.354] (-499.069) (-495.025) (-497.131) -- 0:00:32
      535000 -- (-494.673) (-496.082) (-496.413) [-503.707] * (-497.782) (-496.619) (-496.284) [-495.741] -- 0:00:32

      Average standard deviation of split frequencies: 0.007346

      535500 -- [-494.332] (-495.251) (-498.210) (-496.524) * [-495.385] (-494.861) (-495.028) (-495.344) -- 0:00:32
      536000 -- [-494.190] (-496.742) (-500.541) (-495.623) * (-502.023) (-496.312) (-499.502) [-496.787] -- 0:00:32
      536500 -- [-495.394] (-497.326) (-494.719) (-495.155) * (-498.572) [-495.636] (-494.466) (-498.410) -- 0:00:31
      537000 -- (-495.797) (-495.567) [-498.497] (-495.582) * [-496.786] (-499.238) (-497.531) (-500.306) -- 0:00:31
      537500 -- (-497.612) (-496.673) [-495.556] (-496.289) * (-497.197) (-498.076) [-497.225] (-499.324) -- 0:00:31
      538000 -- (-495.396) (-496.998) [-497.629] (-499.309) * (-497.709) [-495.380] (-497.933) (-497.813) -- 0:00:31
      538500 -- (-496.543) (-495.626) [-496.788] (-496.447) * (-496.300) (-498.087) (-501.535) [-499.772] -- 0:00:31
      539000 -- (-497.701) (-496.389) (-494.880) [-495.675] * (-495.982) (-494.517) (-497.885) [-496.701] -- 0:00:31
      539500 -- (-497.135) [-494.159] (-497.485) (-495.781) * (-498.280) (-495.956) [-501.644] (-495.532) -- 0:00:31
      540000 -- (-498.186) (-500.606) [-498.565] (-495.595) * [-498.924] (-499.503) (-495.917) (-495.195) -- 0:00:31

      Average standard deviation of split frequencies: 0.007385

      540500 -- (-497.420) (-499.173) (-496.697) [-497.624] * (-499.309) [-497.922] (-495.284) (-498.546) -- 0:00:31
      541000 -- (-496.724) [-497.016] (-499.391) (-495.683) * (-495.511) [-498.006] (-499.471) (-495.550) -- 0:00:31
      541500 -- (-496.398) (-498.682) (-497.390) [-495.629] * (-494.771) [-495.553] (-496.324) (-496.717) -- 0:00:31
      542000 -- [-495.882] (-502.030) (-494.517) (-496.311) * (-495.494) [-495.919] (-495.491) (-501.185) -- 0:00:31
      542500 -- (-496.166) (-497.622) [-495.188] (-495.865) * (-499.854) [-497.972] (-495.106) (-495.323) -- 0:00:31
      543000 -- (-494.885) [-495.971] (-497.912) (-497.067) * (-497.756) (-495.602) (-496.993) [-495.396] -- 0:00:31
      543500 -- (-495.672) [-496.354] (-495.700) (-495.774) * (-496.197) (-494.609) [-497.568] (-498.031) -- 0:00:31
      544000 -- (-495.794) (-496.293) [-496.123] (-495.322) * (-496.773) [-495.550] (-495.670) (-497.907) -- 0:00:31
      544500 -- (-494.288) (-497.264) [-496.601] (-496.612) * [-497.781] (-498.851) (-497.762) (-494.618) -- 0:00:31
      545000 -- (-495.817) (-500.730) (-495.964) [-497.197] * [-496.244] (-496.699) (-500.733) (-498.048) -- 0:00:31

      Average standard deviation of split frequencies: 0.007516

      545500 -- (-498.715) (-496.600) [-497.031] (-497.158) * (-496.229) [-498.574] (-498.149) (-495.008) -- 0:00:31
      546000 -- [-498.572] (-497.584) (-498.810) (-499.891) * (-498.893) (-495.386) (-499.858) [-496.031] -- 0:00:31
      546500 -- (-496.150) (-496.814) [-494.752] (-496.986) * (-499.901) (-494.942) (-498.932) [-496.298] -- 0:00:31
      547000 -- (-498.560) (-500.540) (-497.073) [-495.546] * (-496.611) [-498.457] (-496.009) (-497.489) -- 0:00:31
      547500 -- (-494.354) (-495.810) (-498.472) [-495.708] * [-499.852] (-494.258) (-496.550) (-496.887) -- 0:00:31
      548000 -- (-497.537) (-494.904) (-495.571) [-496.120] * (-495.311) (-497.473) [-498.564] (-497.566) -- 0:00:31
      548500 -- (-494.247) [-497.758] (-497.172) (-499.621) * [-495.851] (-497.451) (-497.141) (-495.114) -- 0:00:31
      549000 -- (-495.100) [-498.450] (-496.795) (-495.841) * (-496.479) (-495.453) (-496.051) [-497.840] -- 0:00:31
      549500 -- (-495.503) [-495.852] (-495.508) (-495.789) * (-496.414) (-496.231) (-496.541) [-497.279] -- 0:00:31
      550000 -- (-496.322) (-498.311) [-496.588] (-496.514) * (-500.413) [-499.032] (-496.804) (-497.723) -- 0:00:31

      Average standard deviation of split frequencies: 0.007755

      550500 -- [-495.167] (-495.969) (-499.398) (-495.863) * (-499.262) (-497.543) (-498.200) [-497.163] -- 0:00:31
      551000 -- (-494.975) (-497.385) [-499.251] (-498.578) * (-495.900) (-498.228) (-498.084) [-496.207] -- 0:00:30
      551500 -- (-494.381) [-497.085] (-495.197) (-496.286) * (-496.588) [-494.536] (-500.595) (-498.146) -- 0:00:30
      552000 -- [-494.589] (-495.023) (-497.100) (-497.603) * (-495.446) (-495.106) [-500.432] (-496.120) -- 0:00:30
      552500 -- (-497.791) (-496.280) (-495.582) [-495.319] * (-495.038) (-495.768) [-499.379] (-496.439) -- 0:00:30
      553000 -- (-499.422) (-495.864) (-501.321) [-496.424] * (-497.254) (-495.437) [-496.498] (-497.735) -- 0:00:30
      553500 -- (-495.038) (-496.573) [-498.897] (-495.666) * (-495.869) [-495.878] (-494.455) (-501.382) -- 0:00:30
      554000 -- (-494.293) (-496.705) [-497.298] (-500.055) * (-496.679) (-496.690) [-497.951] (-494.627) -- 0:00:30
      554500 -- [-495.694] (-496.141) (-497.841) (-501.307) * (-498.527) (-500.074) [-494.575] (-496.024) -- 0:00:30
      555000 -- [-496.569] (-495.339) (-497.192) (-497.886) * (-498.025) (-500.227) [-496.747] (-495.152) -- 0:00:30

      Average standard deviation of split frequencies: 0.007780

      555500 -- [-499.850] (-495.176) (-495.426) (-502.984) * (-500.007) [-497.961] (-495.529) (-497.171) -- 0:00:30
      556000 -- (-499.850) (-495.481) (-495.262) [-495.497] * (-494.513) (-502.156) (-496.961) [-496.809] -- 0:00:30
      556500 -- (-495.475) [-495.655] (-495.758) (-495.900) * (-497.235) [-496.222] (-496.070) (-496.307) -- 0:00:30
      557000 -- (-495.228) [-498.383] (-494.748) (-496.391) * (-495.942) (-495.311) (-497.149) [-495.901] -- 0:00:30
      557500 -- (-503.143) (-498.471) (-499.261) [-494.489] * (-495.130) (-497.074) [-496.643] (-497.378) -- 0:00:30
      558000 -- (-497.952) [-497.064] (-497.297) (-494.913) * (-497.869) (-497.471) [-502.279] (-497.987) -- 0:00:30
      558500 -- (-497.244) (-494.593) [-497.851] (-496.470) * (-498.483) (-496.095) (-499.239) [-497.815] -- 0:00:30
      559000 -- [-497.461] (-496.452) (-498.737) (-498.262) * (-496.893) [-495.826] (-497.175) (-497.176) -- 0:00:30
      559500 -- (-496.308) (-498.015) [-494.863] (-496.069) * [-494.948] (-494.550) (-498.792) (-495.195) -- 0:00:30
      560000 -- [-496.735] (-495.035) (-496.798) (-498.696) * (-496.549) [-495.691] (-497.969) (-499.143) -- 0:00:30

      Average standard deviation of split frequencies: 0.008507

      560500 -- (-495.768) [-497.871] (-497.518) (-498.529) * [-495.119] (-497.661) (-498.314) (-497.414) -- 0:00:30
      561000 -- (-495.830) (-499.721) [-495.969] (-495.532) * (-494.947) (-494.928) [-497.245] (-496.709) -- 0:00:30
      561500 -- (-496.755) (-495.620) [-495.143] (-494.747) * [-495.424] (-498.816) (-495.687) (-498.306) -- 0:00:30
      562000 -- (-497.906) (-494.671) (-495.267) [-494.523] * (-495.766) (-496.173) (-496.787) [-494.935] -- 0:00:30
      562500 -- (-495.692) (-502.552) (-494.855) [-496.034] * [-498.798] (-499.496) (-495.731) (-496.772) -- 0:00:30
      563000 -- (-500.996) (-497.662) [-498.816] (-498.564) * (-496.726) [-498.531] (-496.806) (-497.026) -- 0:00:30
      563500 -- (-496.584) [-499.878] (-495.637) (-501.226) * (-497.929) (-499.843) (-496.110) [-499.666] -- 0:00:30
      564000 -- (-495.766) [-498.815] (-496.461) (-501.468) * [-497.466] (-497.272) (-494.817) (-496.610) -- 0:00:30
      564500 -- (-498.076) (-506.141) [-497.080] (-497.291) * [-496.792] (-495.730) (-499.136) (-497.916) -- 0:00:30
      565000 -- (-495.727) (-499.090) (-494.667) [-497.718] * (-494.874) (-495.822) (-496.013) [-496.318] -- 0:00:30

      Average standard deviation of split frequencies: 0.007986

      565500 -- (-496.283) (-502.732) (-496.641) [-498.180] * [-495.747] (-494.771) (-500.090) (-497.970) -- 0:00:29
      566000 -- (-495.412) (-496.957) [-496.871] (-496.907) * (-496.904) [-495.128] (-502.573) (-495.639) -- 0:00:29
      566500 -- (-496.341) [-497.482] (-500.808) (-497.185) * (-500.615) [-501.117] (-495.885) (-495.100) -- 0:00:29
      567000 -- (-499.666) [-495.597] (-500.021) (-496.595) * (-500.831) [-495.195] (-495.723) (-496.337) -- 0:00:29
      567500 -- (-498.162) (-495.442) (-495.439) [-497.829] * [-495.493] (-495.657) (-497.910) (-498.759) -- 0:00:29
      568000 -- (-501.429) [-501.249] (-495.399) (-499.162) * (-495.071) (-495.881) [-495.122] (-495.805) -- 0:00:29
      568500 -- (-495.022) [-495.655] (-495.126) (-499.686) * (-495.974) (-496.486) (-495.515) [-495.731] -- 0:00:29
      569000 -- [-495.299] (-496.086) (-494.618) (-494.778) * [-498.556] (-496.674) (-496.489) (-498.735) -- 0:00:29
      569500 -- (-496.534) (-495.718) [-496.172] (-497.005) * (-497.011) (-496.701) [-497.076] (-495.911) -- 0:00:29
      570000 -- (-495.380) (-497.370) [-498.337] (-496.297) * (-496.320) [-498.615] (-497.755) (-496.355) -- 0:00:29

      Average standard deviation of split frequencies: 0.008455

      570500 -- (-497.680) [-498.160] (-498.348) (-495.053) * (-502.455) (-496.764) [-494.274] (-494.336) -- 0:00:29
      571000 -- (-495.436) (-496.791) (-497.989) [-495.566] * (-501.010) (-495.733) [-497.204] (-498.262) -- 0:00:29
      571500 -- (-494.671) (-500.603) (-497.199) [-496.867] * [-496.178] (-496.817) (-497.981) (-495.746) -- 0:00:29
      572000 -- (-498.526) [-494.621] (-496.297) (-496.600) * (-496.974) [-494.918] (-495.745) (-501.149) -- 0:00:29
      572500 -- [-497.972] (-495.810) (-500.835) (-495.861) * (-496.497) (-495.893) (-495.927) [-494.839] -- 0:00:29
      573000 -- [-495.723] (-498.098) (-498.742) (-495.706) * (-497.182) (-494.520) (-497.616) [-494.819] -- 0:00:29
      573500 -- (-497.018) (-498.353) (-497.503) [-496.623] * (-497.084) (-496.545) [-496.321] (-504.522) -- 0:00:29
      574000 -- [-495.723] (-496.169) (-496.740) (-496.445) * (-498.794) [-496.865] (-494.550) (-497.576) -- 0:00:29
      574500 -- (-495.281) (-496.319) (-497.287) [-498.448] * (-497.719) (-496.500) (-497.776) [-496.383] -- 0:00:29
      575000 -- [-494.980] (-498.246) (-500.973) (-496.219) * (-497.793) [-495.533] (-497.228) (-496.512) -- 0:00:29

      Average standard deviation of split frequencies: 0.009003

      575500 -- [-495.230] (-497.658) (-496.135) (-497.209) * (-496.884) [-495.058] (-496.698) (-495.769) -- 0:00:29
      576000 -- (-496.871) [-495.260] (-496.378) (-498.189) * [-495.706] (-496.313) (-502.328) (-498.425) -- 0:00:29
      576500 -- (-498.210) [-495.705] (-502.119) (-494.970) * (-496.389) (-495.921) [-497.689] (-497.067) -- 0:00:29
      577000 -- (-496.200) [-495.815] (-496.951) (-498.538) * (-498.092) [-494.615] (-497.508) (-496.765) -- 0:00:29
      577500 -- (-499.064) (-496.569) (-499.698) [-498.457] * (-497.002) (-497.966) [-498.265] (-496.232) -- 0:00:29
      578000 -- (-501.260) [-497.831] (-495.647) (-495.468) * (-495.953) (-499.865) [-495.978] (-494.693) -- 0:00:29
      578500 -- [-496.288] (-498.376) (-495.326) (-494.224) * (-496.777) (-496.907) [-495.178] (-495.908) -- 0:00:29
      579000 -- (-496.371) [-495.954] (-494.859) (-494.772) * (-497.403) (-495.710) [-497.163] (-496.193) -- 0:00:29
      579500 -- (-495.252) [-495.145] (-495.738) (-496.555) * (-496.704) (-499.415) (-496.254) [-497.331] -- 0:00:29
      580000 -- [-496.755] (-495.549) (-498.386) (-494.842) * (-497.577) (-497.046) (-499.288) [-495.651] -- 0:00:28

      Average standard deviation of split frequencies: 0.008787

      580500 -- (-495.526) [-501.455] (-495.775) (-497.174) * (-496.193) [-499.013] (-501.272) (-496.205) -- 0:00:28
      581000 -- [-495.257] (-499.425) (-496.449) (-494.857) * (-495.229) [-498.170] (-497.399) (-499.045) -- 0:00:28
      581500 -- (-494.618) (-496.000) (-495.654) [-495.956] * (-497.903) (-494.956) [-495.447] (-506.058) -- 0:00:28
      582000 -- (-495.837) [-496.267] (-496.257) (-498.144) * (-496.939) (-495.584) [-496.283] (-496.159) -- 0:00:28
      582500 -- (-498.938) [-496.192] (-498.007) (-497.695) * [-504.520] (-495.782) (-498.536) (-499.532) -- 0:00:28
      583000 -- (-496.572) (-500.172) [-496.882] (-498.598) * (-502.169) (-495.758) (-495.805) [-497.029] -- 0:00:28
      583500 -- [-497.315] (-494.461) (-495.079) (-497.891) * [-500.401] (-498.492) (-496.612) (-499.050) -- 0:00:28
      584000 -- [-495.419] (-498.616) (-496.123) (-496.038) * (-495.349) (-500.477) [-498.138] (-496.803) -- 0:00:28
      584500 -- (-494.925) (-495.483) (-495.564) [-498.085] * [-495.142] (-498.781) (-500.104) (-496.046) -- 0:00:28
      585000 -- (-495.888) (-498.319) (-502.843) [-494.819] * (-497.467) [-497.345] (-500.368) (-498.024) -- 0:00:28

      Average standard deviation of split frequencies: 0.008268

      585500 -- (-495.023) (-498.377) (-496.307) [-497.384] * (-495.275) (-496.681) [-496.693] (-498.653) -- 0:00:28
      586000 -- (-494.784) [-497.987] (-500.895) (-494.825) * (-497.644) (-499.197) (-494.683) [-494.897] -- 0:00:28
      586500 -- (-499.191) [-495.369] (-497.059) (-500.078) * [-495.578] (-495.621) (-497.102) (-496.056) -- 0:00:28
      587000 -- (-502.118) (-497.943) (-494.461) [-498.018] * (-495.664) (-497.086) [-494.881] (-495.434) -- 0:00:28
      587500 -- (-499.652) (-499.954) [-495.256] (-497.479) * [-496.184] (-495.874) (-495.170) (-497.785) -- 0:00:28
      588000 -- (-497.549) [-495.386] (-498.826) (-496.558) * (-500.087) (-495.085) [-495.703] (-498.834) -- 0:00:28
      588500 -- (-495.177) (-496.242) [-494.856] (-494.578) * (-495.673) (-494.515) (-495.912) [-495.839] -- 0:00:28
      589000 -- (-496.686) [-499.637] (-495.942) (-497.640) * (-498.028) [-496.796] (-495.180) (-495.687) -- 0:00:28
      589500 -- (-494.862) (-497.509) (-494.805) [-501.231] * [-497.020] (-496.500) (-498.072) (-500.367) -- 0:00:28
      590000 -- (-496.088) (-495.324) (-495.733) [-496.006] * [-495.819] (-497.756) (-504.878) (-496.458) -- 0:00:28

      Average standard deviation of split frequencies: 0.008180

      590500 -- (-495.662) (-495.800) [-495.284] (-494.362) * (-497.065) [-496.820] (-497.528) (-496.825) -- 0:00:28
      591000 -- (-498.240) (-501.011) [-497.239] (-495.844) * [-495.858] (-495.949) (-495.564) (-495.941) -- 0:00:28
      591500 -- (-496.710) [-496.485] (-500.078) (-494.873) * (-496.556) (-496.046) [-495.581] (-497.526) -- 0:00:28
      592000 -- [-497.129] (-497.694) (-495.350) (-496.912) * (-497.883) (-496.831) (-497.408) [-495.171] -- 0:00:28
      592500 -- (-499.254) [-494.898] (-501.588) (-495.990) * [-495.465] (-500.828) (-496.655) (-499.590) -- 0:00:28
      593000 -- (-496.547) [-502.643] (-501.698) (-496.471) * [-496.640] (-497.526) (-494.634) (-500.860) -- 0:00:28
      593500 -- (-499.797) [-495.516] (-498.203) (-495.578) * (-498.468) [-495.824] (-495.967) (-497.767) -- 0:00:28
      594000 -- [-498.089] (-495.832) (-497.060) (-496.261) * (-496.225) [-495.416] (-496.436) (-495.242) -- 0:00:28
      594500 -- (-500.509) (-494.811) (-503.848) [-496.255] * (-497.581) (-497.324) (-495.702) [-494.571] -- 0:00:27
      595000 -- (-496.599) [-494.929] (-496.831) (-494.319) * [-495.380] (-498.861) (-499.071) (-495.391) -- 0:00:27

      Average standard deviation of split frequencies: 0.008799

      595500 -- (-497.039) (-495.091) (-496.902) [-499.226] * (-495.474) (-501.090) [-498.898] (-495.759) -- 0:00:27
      596000 -- (-498.290) [-496.103] (-498.265) (-496.066) * (-495.313) (-499.101) (-497.974) [-494.639] -- 0:00:27
      596500 -- (-495.301) (-497.671) [-496.492] (-497.390) * (-496.641) (-503.628) [-504.508] (-496.544) -- 0:00:27
      597000 -- [-498.779] (-496.123) (-496.586) (-497.295) * (-496.258) [-497.618] (-500.605) (-496.236) -- 0:00:27
      597500 -- (-496.914) (-496.481) (-496.018) [-496.720] * [-497.199] (-494.514) (-496.733) (-497.567) -- 0:00:27
      598000 -- (-498.831) (-495.911) [-496.431] (-504.393) * [-494.827] (-494.982) (-497.828) (-501.122) -- 0:00:27
      598500 -- (-497.196) (-499.375) [-494.541] (-501.680) * [-495.390] (-495.434) (-496.888) (-499.066) -- 0:00:27
      599000 -- (-499.410) (-494.667) [-495.522] (-496.267) * [-498.261] (-494.610) (-497.104) (-497.706) -- 0:00:27
      599500 -- (-494.964) [-494.853] (-495.427) (-496.991) * [-498.809] (-497.090) (-501.124) (-499.892) -- 0:00:27
      600000 -- (-494.830) (-495.118) [-497.108] (-495.485) * (-498.480) (-497.899) (-499.026) [-495.315] -- 0:00:27

      Average standard deviation of split frequencies: 0.008339

      600500 -- (-497.087) [-497.186] (-499.289) (-496.894) * [-495.980] (-498.733) (-498.609) (-496.099) -- 0:00:27
      601000 -- (-495.075) [-496.959] (-502.450) (-497.210) * (-496.421) (-498.686) (-498.348) [-495.932] -- 0:00:27
      601500 -- (-499.085) (-495.270) (-499.553) [-495.367] * (-498.845) (-498.101) (-501.609) [-496.990] -- 0:00:27
      602000 -- (-496.467) (-496.633) [-498.924] (-496.806) * [-499.587] (-496.873) (-498.480) (-497.065) -- 0:00:27
      602500 -- [-495.507] (-496.974) (-496.417) (-496.898) * (-495.949) (-498.927) (-497.658) [-495.797] -- 0:00:27
      603000 -- (-498.035) (-495.234) (-498.725) [-494.392] * [-496.799] (-494.506) (-498.037) (-497.527) -- 0:00:27
      603500 -- (-499.029) (-495.112) [-497.220] (-495.288) * (-495.844) (-494.735) (-498.559) [-497.703] -- 0:00:27
      604000 -- (-502.507) [-496.109] (-498.950) (-497.127) * [-496.099] (-495.074) (-499.748) (-501.681) -- 0:00:27
      604500 -- (-501.709) (-496.346) (-500.129) [-494.509] * (-496.344) [-494.661] (-495.322) (-497.264) -- 0:00:27
      605000 -- [-498.455] (-499.498) (-499.781) (-496.540) * (-499.234) (-494.790) [-497.675] (-498.336) -- 0:00:27

      Average standard deviation of split frequencies: 0.008071

      605500 -- (-500.154) (-497.602) [-495.604] (-496.283) * (-499.066) (-495.714) (-496.685) [-500.652] -- 0:00:27
      606000 -- (-495.651) (-498.177) (-494.607) [-496.202] * (-496.721) (-495.673) [-495.100] (-494.203) -- 0:00:27
      606500 -- (-496.000) (-497.523) (-496.782) [-498.580] * (-496.741) [-495.679] (-497.128) (-494.634) -- 0:00:27
      607000 -- (-497.496) (-500.350) (-500.874) [-497.791] * (-499.672) (-495.852) (-495.713) [-496.826] -- 0:00:27
      607500 -- (-495.567) [-496.240] (-500.234) (-498.411) * (-497.720) (-497.766) [-497.215] (-497.226) -- 0:00:27
      608000 -- (-496.451) (-496.289) [-496.092] (-497.387) * (-496.144) (-494.685) (-499.119) [-495.337] -- 0:00:27
      608500 -- [-497.301] (-496.394) (-497.004) (-495.225) * (-494.329) (-497.732) (-498.009) [-496.107] -- 0:00:27
      609000 -- (-494.848) (-497.805) (-494.932) [-496.758] * [-496.446] (-499.924) (-494.586) (-496.381) -- 0:00:26
      609500 -- (-496.540) [-497.076] (-495.362) (-495.437) * (-495.402) (-513.391) [-495.131] (-494.852) -- 0:00:26
      610000 -- (-495.582) [-495.257] (-496.444) (-497.246) * (-501.778) (-497.157) [-495.407] (-499.889) -- 0:00:26

      Average standard deviation of split frequencies: 0.008974

      610500 -- [-496.444] (-495.109) (-495.046) (-499.454) * (-506.400) (-495.743) [-494.773] (-497.048) -- 0:00:26
      611000 -- (-498.231) (-496.044) (-499.295) [-498.639] * (-496.273) (-498.264) (-495.159) [-495.769] -- 0:00:26
      611500 -- [-495.653] (-497.043) (-497.615) (-498.440) * [-495.714] (-501.223) (-499.751) (-495.522) -- 0:00:26
      612000 -- (-497.133) (-497.759) (-495.231) [-498.508] * (-495.173) (-495.777) [-498.152] (-497.778) -- 0:00:26
      612500 -- (-495.396) [-498.513] (-497.843) (-497.634) * (-499.212) [-494.994] (-495.995) (-496.373) -- 0:00:26
      613000 -- (-495.195) (-497.998) [-495.610] (-498.083) * (-497.698) (-498.026) [-496.944] (-495.943) -- 0:00:26
      613500 -- (-496.062) (-495.996) (-497.940) [-495.663] * [-497.249] (-498.751) (-495.764) (-495.646) -- 0:00:26
      614000 -- (-495.511) [-495.684] (-497.672) (-499.763) * (-495.908) (-496.307) (-500.176) [-498.832] -- 0:00:26
      614500 -- (-498.109) (-496.250) [-498.253] (-496.019) * [-495.123] (-495.633) (-498.067) (-497.725) -- 0:00:26
      615000 -- (-495.449) [-496.045] (-498.050) (-496.943) * (-496.667) [-496.123] (-497.770) (-496.183) -- 0:00:26

      Average standard deviation of split frequencies: 0.008913

      615500 -- (-495.323) [-494.848] (-496.137) (-497.685) * (-500.650) [-498.589] (-494.959) (-495.411) -- 0:00:26
      616000 -- [-495.273] (-495.677) (-496.641) (-495.410) * (-501.032) (-501.853) (-500.948) [-498.899] -- 0:00:26
      616500 -- [-495.006] (-495.062) (-495.467) (-497.872) * (-498.344) [-501.007] (-498.201) (-496.183) -- 0:00:26
      617000 -- (-496.790) [-495.120] (-500.190) (-496.503) * [-498.218] (-497.653) (-498.930) (-499.909) -- 0:00:26
      617500 -- (-494.945) [-495.162] (-497.595) (-497.964) * (-497.795) (-494.725) [-494.980] (-495.013) -- 0:00:26
      618000 -- (-502.083) [-495.042] (-497.667) (-497.565) * (-495.161) [-495.213] (-495.416) (-496.374) -- 0:00:26
      618500 -- [-497.024] (-495.172) (-494.673) (-499.435) * [-496.831] (-496.285) (-496.259) (-499.022) -- 0:00:26
      619000 -- (-501.468) (-495.063) [-495.291] (-500.964) * (-500.747) (-496.204) [-494.931] (-500.325) -- 0:00:26
      619500 -- (-495.242) (-496.935) [-495.768] (-501.583) * (-496.325) [-495.811] (-495.801) (-501.430) -- 0:00:26
      620000 -- (-496.832) [-496.972] (-496.553) (-495.572) * (-499.367) (-495.209) (-496.785) [-495.825] -- 0:00:26

      Average standard deviation of split frequencies: 0.009209

      620500 -- (-501.536) (-495.717) [-496.415] (-494.657) * (-500.087) (-495.221) [-496.032] (-496.227) -- 0:00:26
      621000 -- (-494.704) (-495.243) (-495.884) [-494.708] * [-496.550] (-498.031) (-498.509) (-497.241) -- 0:00:26
      621500 -- (-497.554) (-495.438) [-495.450] (-496.934) * [-497.217] (-495.338) (-495.176) (-497.046) -- 0:00:26
      622000 -- (-494.763) (-498.264) (-494.759) [-494.935] * (-496.070) [-494.281] (-495.310) (-499.654) -- 0:00:26
      622500 -- (-495.012) (-496.380) (-495.678) [-497.262] * (-494.692) [-498.180] (-497.775) (-498.660) -- 0:00:26
      623000 -- (-494.434) [-495.473] (-497.967) (-497.793) * (-495.337) (-497.933) (-504.412) [-495.046] -- 0:00:26
      623500 -- (-494.546) [-499.056] (-499.037) (-494.355) * (-495.117) (-500.740) [-497.384] (-497.237) -- 0:00:25
      624000 -- (-495.393) (-499.380) [-499.974] (-497.896) * [-495.290] (-496.743) (-496.673) (-496.927) -- 0:00:25
      624500 -- [-495.198] (-495.910) (-497.277) (-497.289) * (-500.560) [-494.462] (-496.393) (-497.791) -- 0:00:25
      625000 -- (-495.463) (-494.951) (-497.594) [-500.224] * (-500.990) (-494.725) [-495.917] (-498.362) -- 0:00:25

      Average standard deviation of split frequencies: 0.008942

      625500 -- (-494.932) (-495.487) [-496.330] (-500.209) * [-495.559] (-494.690) (-496.132) (-496.417) -- 0:00:25
      626000 -- (-496.301) [-498.700] (-495.762) (-497.294) * (-495.870) (-495.266) (-494.506) [-496.023] -- 0:00:25
      626500 -- [-496.155] (-496.123) (-496.243) (-498.865) * (-496.963) (-498.536) (-495.976) [-494.519] -- 0:00:25
      627000 -- (-497.224) (-495.317) [-496.610] (-495.550) * (-497.238) (-498.698) (-497.434) [-495.133] -- 0:00:25
      627500 -- (-499.083) (-495.536) [-497.107] (-496.994) * (-498.496) (-498.613) (-495.652) [-499.705] -- 0:00:25
      628000 -- (-496.259) [-494.899] (-500.389) (-495.540) * [-499.985] (-499.128) (-495.693) (-495.953) -- 0:00:25
      628500 -- (-495.566) [-497.639] (-495.493) (-497.867) * (-498.203) (-498.728) [-498.071] (-495.362) -- 0:00:25
      629000 -- (-501.859) (-495.879) [-495.624] (-498.929) * [-497.968] (-496.774) (-498.624) (-498.248) -- 0:00:25
      629500 -- [-496.253] (-495.849) (-496.658) (-495.282) * (-494.943) (-495.445) (-497.266) [-497.783] -- 0:00:25
      630000 -- [-495.162] (-497.168) (-497.838) (-495.861) * (-495.193) (-494.514) [-494.395] (-497.042) -- 0:00:25

      Average standard deviation of split frequencies: 0.008926

      630500 -- (-495.980) (-494.501) [-494.446] (-495.036) * [-495.318] (-497.150) (-495.491) (-494.745) -- 0:00:25
      631000 -- (-497.291) (-499.462) [-495.609] (-496.208) * (-496.521) (-500.747) [-495.669] (-497.526) -- 0:00:25
      631500 -- (-497.376) (-495.778) [-495.244] (-498.778) * (-497.350) (-498.578) [-495.367] (-498.503) -- 0:00:25
      632000 -- [-497.836] (-496.208) (-495.310) (-495.894) * (-495.891) (-497.402) [-498.200] (-498.287) -- 0:00:25
      632500 -- (-497.027) (-500.283) [-495.121] (-496.130) * [-497.192] (-497.449) (-497.061) (-495.067) -- 0:00:25
      633000 -- (-498.653) (-499.603) (-497.254) [-495.323] * (-496.356) (-497.427) [-496.262] (-495.068) -- 0:00:25
      633500 -- [-496.486] (-495.336) (-499.663) (-495.985) * (-496.408) [-495.262] (-496.615) (-494.896) -- 0:00:25
      634000 -- (-497.277) [-498.436] (-498.330) (-494.921) * (-497.960) [-494.491] (-500.562) (-494.498) -- 0:00:25
      634500 -- (-495.147) [-494.444] (-498.558) (-496.484) * [-495.425] (-494.563) (-494.692) (-494.535) -- 0:00:25
      635000 -- [-496.172] (-498.189) (-502.692) (-499.316) * (-496.589) [-495.175] (-497.591) (-495.354) -- 0:00:25

      Average standard deviation of split frequencies: 0.008720

      635500 -- (-495.664) [-496.496] (-495.203) (-495.038) * (-494.817) (-498.209) (-495.924) [-502.030] -- 0:00:25
      636000 -- [-495.260] (-496.584) (-496.606) (-495.140) * (-497.467) [-497.868] (-497.107) (-496.898) -- 0:00:25
      636500 -- (-497.167) [-497.287] (-495.364) (-495.856) * (-497.473) (-496.244) (-502.229) [-497.350] -- 0:00:25
      637000 -- (-497.034) [-497.850] (-496.895) (-498.105) * (-496.552) [-497.943] (-495.545) (-496.753) -- 0:00:25
      637500 -- (-497.737) (-495.506) [-496.400] (-496.883) * (-497.065) [-496.254] (-495.529) (-500.756) -- 0:00:25
      638000 -- (-500.987) [-496.538] (-496.123) (-497.355) * (-501.278) (-497.827) (-499.458) [-495.699] -- 0:00:24
      638500 -- (-497.391) (-498.741) [-499.196] (-499.176) * (-494.944) [-496.809] (-495.034) (-501.018) -- 0:00:24
      639000 -- (-497.090) (-499.341) [-494.900] (-495.456) * (-495.834) (-495.839) (-495.434) [-495.511] -- 0:00:24
      639500 -- [-495.974] (-497.041) (-495.960) (-497.557) * (-497.399) (-495.770) [-495.502] (-495.426) -- 0:00:24
      640000 -- (-496.405) (-498.675) [-497.511] (-498.946) * (-495.965) (-497.428) [-497.326] (-495.881) -- 0:00:24

      Average standard deviation of split frequencies: 0.008743

      640500 -- (-495.297) (-497.010) (-501.264) [-497.275] * (-496.745) [-496.858] (-497.467) (-494.302) -- 0:00:24
      641000 -- (-497.358) [-494.866] (-496.747) (-498.855) * (-498.460) (-495.980) [-496.027] (-496.283) -- 0:00:24
      641500 -- (-495.829) [-495.136] (-496.566) (-495.385) * (-494.780) [-496.970] (-499.739) (-497.197) -- 0:00:24
      642000 -- [-497.271] (-497.127) (-496.852) (-495.104) * [-496.512] (-499.970) (-497.384) (-497.475) -- 0:00:24
      642500 -- (-497.260) (-495.806) (-497.065) [-498.950] * [-498.649] (-498.149) (-497.974) (-498.611) -- 0:00:24
      643000 -- [-494.912] (-497.210) (-497.858) (-500.186) * (-497.968) [-496.939] (-499.823) (-501.316) -- 0:00:24
      643500 -- (-496.144) [-496.164] (-498.633) (-499.978) * [-495.921] (-495.237) (-500.059) (-496.461) -- 0:00:24
      644000 -- (-495.060) [-496.453] (-497.162) (-499.107) * [-495.259] (-495.362) (-495.290) (-496.722) -- 0:00:24
      644500 -- (-498.359) [-496.703] (-496.416) (-497.885) * (-496.170) (-495.210) [-498.209] (-495.988) -- 0:00:24
      645000 -- (-495.807) [-495.451] (-495.286) (-497.013) * (-499.487) (-495.480) [-495.897] (-498.301) -- 0:00:24

      Average standard deviation of split frequencies: 0.009100

      645500 -- [-497.651] (-497.516) (-494.702) (-498.655) * (-501.414) [-494.942] (-496.923) (-494.389) -- 0:00:24
      646000 -- (-498.913) (-500.391) [-495.142] (-495.339) * [-495.422] (-496.060) (-495.302) (-495.354) -- 0:00:24
      646500 -- (-497.345) [-501.337] (-499.717) (-495.532) * [-497.794] (-495.817) (-496.871) (-494.988) -- 0:00:24
      647000 -- (-499.105) (-496.714) [-496.659] (-495.421) * [-496.602] (-499.212) (-494.775) (-497.404) -- 0:00:24
      647500 -- (-496.238) (-495.371) (-498.896) [-496.146] * (-495.424) (-497.524) [-494.336] (-498.531) -- 0:00:24
      648000 -- (-496.163) (-496.202) [-495.851] (-504.937) * [-496.844] (-497.014) (-497.501) (-498.914) -- 0:00:24
      648500 -- [-495.275] (-498.722) (-495.234) (-500.854) * (-497.570) [-495.560] (-495.916) (-496.606) -- 0:00:24
      649000 -- (-494.729) [-496.863] (-495.208) (-498.600) * (-498.248) [-494.463] (-497.932) (-495.253) -- 0:00:24
      649500 -- (-496.135) (-495.267) (-500.191) [-497.502] * [-495.904] (-496.509) (-500.056) (-496.101) -- 0:00:24
      650000 -- (-500.434) (-495.731) (-497.240) [-497.507] * [-495.813] (-496.173) (-499.526) (-495.076) -- 0:00:24

      Average standard deviation of split frequencies: 0.009035

      650500 -- (-496.053) (-495.672) (-498.070) [-497.015] * (-495.540) [-494.440] (-501.978) (-494.469) -- 0:00:24
      651000 -- (-495.534) (-500.863) [-498.097] (-495.464) * [-496.436] (-495.996) (-495.041) (-495.663) -- 0:00:24
      651500 -- (-497.851) (-502.409) [-496.846] (-495.014) * (-494.988) [-495.140] (-494.600) (-495.185) -- 0:00:24
      652000 -- (-497.620) [-496.822] (-496.440) (-497.257) * [-495.263] (-494.922) (-497.890) (-496.369) -- 0:00:24
      652500 -- (-497.036) (-496.332) (-495.269) [-494.817] * (-497.221) [-495.543] (-496.624) (-495.768) -- 0:00:23
      653000 -- (-496.292) [-500.561] (-498.458) (-497.453) * [-496.782] (-494.285) (-497.716) (-494.571) -- 0:00:23
      653500 -- (-496.571) [-498.267] (-498.964) (-498.645) * [-496.994] (-494.720) (-496.333) (-496.187) -- 0:00:23
      654000 -- (-496.956) (-497.285) (-499.324) [-495.011] * (-496.147) [-495.750] (-494.879) (-498.417) -- 0:00:23
      654500 -- (-497.131) [-496.771] (-495.954) (-495.201) * (-494.887) [-496.382] (-497.252) (-495.886) -- 0:00:23
      655000 -- (-495.066) (-497.261) (-497.961) [-498.638] * (-496.897) [-497.358] (-498.294) (-495.818) -- 0:00:23

      Average standard deviation of split frequencies: 0.009342

      655500 -- (-496.663) (-495.303) [-496.548] (-495.454) * (-496.359) [-501.546] (-497.746) (-495.074) -- 0:00:23
      656000 -- (-501.346) [-495.246] (-496.110) (-497.053) * (-498.334) (-497.564) (-496.111) [-495.640] -- 0:00:23
      656500 -- (-496.232) [-494.621] (-494.728) (-497.954) * (-498.320) (-497.645) (-497.650) [-498.792] -- 0:00:23
      657000 -- (-497.317) (-494.530) (-499.293) [-496.326] * (-499.596) (-495.806) (-497.157) [-496.894] -- 0:00:23
      657500 -- [-498.382] (-496.887) (-499.806) (-496.355) * [-497.626] (-497.039) (-501.188) (-494.171) -- 0:00:23
      658000 -- (-495.902) [-494.927] (-495.775) (-495.050) * (-495.351) [-499.015] (-495.206) (-494.999) -- 0:00:23
      658500 -- [-498.128] (-495.892) (-496.405) (-495.613) * (-496.245) (-496.075) (-495.353) [-495.333] -- 0:00:23
      659000 -- (-499.209) (-494.258) [-495.445] (-498.314) * (-496.754) [-500.663] (-497.960) (-495.314) -- 0:00:23
      659500 -- [-495.414] (-494.719) (-495.420) (-495.840) * (-498.122) [-497.065] (-496.166) (-498.974) -- 0:00:23
      660000 -- (-494.550) (-494.353) [-495.192] (-494.796) * (-495.446) [-495.489] (-498.571) (-496.881) -- 0:00:23

      Average standard deviation of split frequencies: 0.009360

      660500 -- [-494.508] (-494.602) (-496.454) (-496.588) * [-494.553] (-494.962) (-505.163) (-498.215) -- 0:00:23
      661000 -- (-496.183) (-496.890) (-496.700) [-496.411] * (-495.154) (-496.462) (-501.054) [-499.161] -- 0:00:23
      661500 -- (-498.250) (-496.119) [-495.256] (-494.696) * (-494.597) [-496.002] (-498.881) (-501.398) -- 0:00:23
      662000 -- (-496.837) (-497.951) (-496.568) [-496.082] * (-497.009) (-494.980) (-497.835) [-497.190] -- 0:00:23
      662500 -- [-497.212] (-497.954) (-504.840) (-496.012) * (-495.199) [-496.089] (-495.430) (-498.691) -- 0:00:23
      663000 -- [-498.976] (-496.417) (-496.013) (-504.917) * (-500.280) (-495.845) [-498.600] (-500.932) -- 0:00:23
      663500 -- (-496.409) (-497.979) [-497.750] (-501.093) * [-496.241] (-496.085) (-495.221) (-497.378) -- 0:00:23
      664000 -- (-499.498) (-494.323) [-496.088] (-496.249) * (-495.064) (-496.104) [-494.960] (-495.948) -- 0:00:23
      664500 -- (-497.851) (-495.366) (-495.915) [-495.594] * [-495.909] (-497.963) (-495.402) (-496.827) -- 0:00:23
      665000 -- (-497.740) (-497.807) [-495.357] (-496.603) * (-495.521) (-496.261) (-495.684) [-494.726] -- 0:00:23

      Average standard deviation of split frequencies: 0.009701

      665500 -- (-496.923) (-499.535) [-496.094] (-495.582) * (-496.894) (-499.346) (-494.524) [-495.796] -- 0:00:23
      666000 -- (-498.284) (-498.448) (-497.197) [-498.897] * (-502.450) (-495.609) (-496.046) [-494.569] -- 0:00:23
      666500 -- (-499.112) (-496.940) [-495.291] (-497.934) * (-498.396) [-494.594] (-496.562) (-501.093) -- 0:00:23
      667000 -- (-498.700) (-496.242) [-496.713] (-495.709) * (-496.808) (-497.095) (-496.162) [-494.722] -- 0:00:22
      667500 -- [-500.524] (-498.451) (-496.931) (-506.199) * (-501.051) (-499.206) [-495.964] (-497.026) -- 0:00:22
      668000 -- (-498.710) (-495.943) (-496.731) [-496.471] * [-499.647] (-497.518) (-498.269) (-497.091) -- 0:00:22
      668500 -- [-496.203] (-495.377) (-495.178) (-499.331) * (-498.863) (-494.794) (-495.552) [-498.105] -- 0:00:22
      669000 -- (-496.461) (-497.028) (-495.794) [-495.938] * (-495.938) (-497.788) [-498.378] (-496.146) -- 0:00:22
      669500 -- (-501.426) (-500.150) [-495.307] (-498.154) * (-494.899) (-496.176) (-499.009) [-494.965] -- 0:00:22
      670000 -- (-497.214) [-498.943] (-495.903) (-495.700) * (-496.126) [-494.345] (-499.891) (-496.160) -- 0:00:22

      Average standard deviation of split frequencies: 0.010700

      670500 -- (-498.320) [-497.070] (-494.605) (-496.342) * (-496.726) (-495.574) [-498.201] (-495.751) -- 0:00:22
      671000 -- [-497.545] (-495.900) (-494.583) (-499.462) * (-496.420) [-494.986] (-495.731) (-498.160) -- 0:00:22
      671500 -- (-495.977) (-496.210) [-497.763] (-496.748) * (-499.259) [-499.441] (-498.958) (-495.327) -- 0:00:22
      672000 -- (-498.164) [-496.203] (-494.681) (-495.626) * [-496.332] (-498.164) (-498.061) (-495.143) -- 0:00:22
      672500 -- [-495.781] (-494.455) (-496.283) (-495.792) * (-500.601) (-497.534) (-497.730) [-496.653] -- 0:00:22
      673000 -- (-496.157) (-494.734) (-496.816) [-495.493] * (-495.538) (-496.442) [-496.912] (-496.871) -- 0:00:22
      673500 -- (-496.166) (-496.109) (-494.640) [-496.659] * (-497.373) (-495.592) [-496.151] (-497.782) -- 0:00:22
      674000 -- (-496.476) (-496.156) [-494.653] (-495.910) * (-498.028) [-499.547] (-497.624) (-495.624) -- 0:00:22
      674500 -- [-495.590] (-495.251) (-495.186) (-498.130) * (-496.207) [-496.711] (-496.458) (-499.236) -- 0:00:22
      675000 -- [-496.187] (-495.938) (-496.561) (-499.639) * (-497.902) (-499.108) [-496.651] (-497.313) -- 0:00:22

      Average standard deviation of split frequencies: 0.010091

      675500 -- [-497.725] (-495.041) (-496.560) (-504.027) * [-495.921] (-498.943) (-496.441) (-495.461) -- 0:00:22
      676000 -- (-497.970) [-496.493] (-495.614) (-496.276) * [-494.545] (-495.994) (-496.106) (-495.518) -- 0:00:22
      676500 -- (-495.222) (-497.231) [-498.073] (-496.970) * (-497.066) (-500.304) (-497.167) [-496.624] -- 0:00:22
      677000 -- (-497.461) (-494.773) (-496.267) [-496.227] * [-497.909] (-497.447) (-502.189) (-497.817) -- 0:00:22
      677500 -- [-496.973] (-497.517) (-495.468) (-495.491) * [-496.415] (-495.912) (-503.138) (-496.127) -- 0:00:22
      678000 -- (-496.250) (-496.110) (-498.493) [-495.320] * [-498.083] (-498.541) (-497.775) (-496.104) -- 0:00:22
      678500 -- (-499.398) (-495.720) (-495.403) [-495.140] * [-495.313] (-496.585) (-497.073) (-501.189) -- 0:00:22
      679000 -- (-499.249) [-494.514] (-496.096) (-497.678) * (-495.236) (-498.764) (-499.420) [-497.529] -- 0:00:22
      679500 -- (-497.160) [-496.649] (-496.139) (-495.120) * (-494.897) (-495.108) (-495.995) [-497.059] -- 0:00:22
      680000 -- (-497.727) [-496.496] (-496.073) (-495.000) * [-498.922] (-496.505) (-495.049) (-496.375) -- 0:00:22

      Average standard deviation of split frequencies: 0.009207

      680500 -- (-494.743) [-494.957] (-496.836) (-496.662) * [-496.623] (-495.018) (-498.122) (-496.438) -- 0:00:22
      681000 -- (-496.358) (-498.152) [-497.939] (-495.219) * (-494.322) [-494.417] (-498.362) (-497.343) -- 0:00:22
      681500 -- (-497.752) (-496.168) [-495.836] (-497.176) * (-499.115) [-499.948] (-498.093) (-498.004) -- 0:00:21
      682000 -- (-496.400) (-496.121) (-498.185) [-495.266] * (-496.024) (-495.715) (-497.858) [-495.759] -- 0:00:21
      682500 -- [-501.751] (-495.494) (-501.429) (-496.675) * (-497.890) (-496.650) [-496.919] (-496.051) -- 0:00:21
      683000 -- (-496.982) (-497.657) (-494.442) [-497.649] * (-497.695) (-495.041) (-496.380) [-495.482] -- 0:00:21
      683500 -- (-497.095) (-496.380) (-496.998) [-495.360] * (-495.969) (-498.895) (-496.320) [-495.494] -- 0:00:21
      684000 -- [-495.353] (-495.654) (-499.363) (-495.911) * (-495.669) [-496.684] (-496.174) (-497.105) -- 0:00:21
      684500 -- (-496.201) (-496.616) [-497.177] (-495.115) * [-494.623] (-498.994) (-498.493) (-495.422) -- 0:00:21
      685000 -- (-495.211) (-494.586) (-495.655) [-494.858] * (-499.473) (-496.332) [-498.113] (-496.437) -- 0:00:21

      Average standard deviation of split frequencies: 0.009418

      685500 -- (-495.528) (-496.233) (-495.935) [-497.988] * (-500.005) (-497.141) (-495.791) [-496.399] -- 0:00:21
      686000 -- [-497.086] (-495.117) (-496.291) (-497.607) * (-498.407) (-498.741) [-495.221] (-495.181) -- 0:00:21
      686500 -- (-496.153) (-495.468) [-496.172] (-498.215) * (-495.533) (-497.860) (-494.952) [-494.793] -- 0:00:21
      687000 -- (-497.786) (-496.697) (-498.061) [-498.590] * (-496.089) (-496.844) (-500.307) [-496.722] -- 0:00:21
      687500 -- [-497.242] (-495.810) (-497.690) (-498.914) * (-501.646) (-496.475) [-495.859] (-496.143) -- 0:00:21
      688000 -- (-497.395) (-494.592) [-497.482] (-495.371) * [-496.703] (-496.467) (-497.928) (-497.361) -- 0:00:21
      688500 -- (-497.625) (-496.049) [-497.840] (-500.027) * (-496.262) [-497.867] (-501.001) (-499.723) -- 0:00:21
      689000 -- (-496.780) (-496.975) (-496.654) [-497.651] * [-497.422] (-497.290) (-495.916) (-497.237) -- 0:00:21
      689500 -- (-497.195) [-497.870] (-496.326) (-497.419) * [-495.428] (-494.754) (-496.442) (-495.784) -- 0:00:21
      690000 -- [-497.642] (-495.767) (-495.224) (-496.061) * (-496.072) [-498.998] (-499.995) (-496.911) -- 0:00:21

      Average standard deviation of split frequencies: 0.009154

      690500 -- (-501.414) (-496.148) [-495.547] (-500.344) * [-494.880] (-497.109) (-495.808) (-496.855) -- 0:00:21
      691000 -- (-496.022) (-495.538) (-496.084) [-497.472] * [-497.196] (-498.508) (-498.225) (-497.114) -- 0:00:21
      691500 -- [-496.386] (-495.887) (-494.750) (-495.342) * (-494.552) [-496.169] (-497.668) (-495.895) -- 0:00:21
      692000 -- (-496.503) (-494.777) (-495.891) [-498.185] * (-501.229) [-496.114] (-495.017) (-495.936) -- 0:00:21
      692500 -- (-496.878) [-495.459] (-497.428) (-495.771) * [-498.422] (-495.229) (-496.003) (-496.792) -- 0:00:21
      693000 -- (-498.283) (-500.609) (-495.919) [-499.009] * (-495.905) (-495.400) (-495.249) [-497.292] -- 0:00:21
      693500 -- (-496.750) (-498.689) (-497.838) [-495.813] * (-497.543) [-496.194] (-497.948) (-498.907) -- 0:00:21
      694000 -- (-495.227) [-498.058] (-495.906) (-497.510) * [-497.167] (-497.601) (-499.430) (-500.393) -- 0:00:21
      694500 -- [-495.459] (-496.911) (-497.044) (-498.982) * (-498.184) [-495.767] (-498.236) (-497.901) -- 0:00:21
      695000 -- (-494.778) (-496.302) (-497.790) [-496.041] * (-494.870) [-496.889] (-499.254) (-497.237) -- 0:00:21

      Average standard deviation of split frequencies: 0.009363

      695500 -- (-496.872) (-495.948) (-498.925) [-495.016] * (-495.681) (-495.088) (-497.954) [-496.931] -- 0:00:21
      696000 -- (-498.242) [-497.690] (-502.210) (-495.000) * (-500.175) [-495.424] (-497.514) (-497.178) -- 0:00:20
      696500 -- (-502.226) [-500.747] (-496.876) (-494.506) * (-495.132) (-511.445) [-495.193] (-498.056) -- 0:00:20
      697000 -- (-501.079) (-501.197) [-496.913] (-494.968) * (-496.470) (-501.849) (-494.151) [-495.331] -- 0:00:20
      697500 -- (-495.447) (-499.788) [-498.964] (-494.257) * (-498.023) [-496.459] (-494.330) (-498.459) -- 0:00:20
      698000 -- (-495.977) [-500.364] (-499.876) (-495.095) * [-495.324] (-499.402) (-496.736) (-496.122) -- 0:00:20
      698500 -- (-496.371) (-495.848) [-494.986] (-495.823) * [-494.627] (-498.589) (-500.437) (-495.722) -- 0:00:20
      699000 -- (-498.403) (-495.145) [-495.256] (-497.956) * (-495.281) (-497.572) (-498.120) [-495.574] -- 0:00:20
      699500 -- (-497.202) [-497.064] (-500.076) (-499.945) * (-497.865) (-498.504) [-496.234] (-499.545) -- 0:00:20
      700000 -- (-496.262) (-496.025) [-497.556] (-498.304) * (-496.120) [-495.796] (-496.578) (-495.170) -- 0:00:20

      Average standard deviation of split frequencies: 0.009894

      700500 -- (-497.037) (-495.867) (-498.710) [-495.953] * (-495.142) (-496.577) (-498.569) [-495.439] -- 0:00:20
      701000 -- [-496.631] (-498.157) (-494.697) (-494.605) * (-496.273) (-499.744) (-499.091) [-496.853] -- 0:00:20
      701500 -- (-495.808) (-499.161) [-497.553] (-494.929) * [-496.830] (-497.392) (-499.167) (-495.763) -- 0:00:20
      702000 -- [-494.866] (-497.292) (-495.242) (-499.500) * (-495.270) (-496.134) (-496.792) [-496.139] -- 0:00:20
      702500 -- (-494.591) (-495.544) [-496.721] (-498.528) * [-497.414] (-496.905) (-499.235) (-494.622) -- 0:00:20
      703000 -- (-502.620) (-494.179) (-503.283) [-499.330] * (-496.689) (-496.797) [-495.589] (-495.530) -- 0:00:20
      703500 -- (-495.113) (-496.345) [-501.799] (-498.466) * (-499.256) [-498.008] (-497.328) (-497.210) -- 0:00:20
      704000 -- [-502.776] (-496.397) (-497.972) (-496.867) * (-497.305) (-495.678) [-497.739] (-494.945) -- 0:00:20
      704500 -- [-496.603] (-495.658) (-498.250) (-495.362) * (-497.680) [-495.909] (-497.374) (-498.897) -- 0:00:20
      705000 -- (-497.277) [-496.809] (-496.047) (-497.768) * (-498.070) (-496.391) (-501.708) [-497.260] -- 0:00:20

      Average standard deviation of split frequencies: 0.009544

      705500 -- (-498.404) (-495.929) [-498.818] (-495.687) * (-499.191) (-502.557) [-495.362] (-499.492) -- 0:00:20
      706000 -- (-497.682) (-500.861) (-498.279) [-495.539] * [-496.728] (-498.293) (-499.352) (-495.539) -- 0:00:20
      706500 -- (-496.648) [-496.503] (-497.007) (-494.235) * [-496.672] (-495.065) (-497.260) (-496.543) -- 0:00:20
      707000 -- (-496.789) [-495.609] (-496.201) (-495.715) * [-496.681] (-495.459) (-496.829) (-497.885) -- 0:00:20
      707500 -- (-495.532) (-495.410) [-495.781] (-500.567) * (-497.209) (-496.909) (-497.649) [-495.888] -- 0:00:20
      708000 -- (-495.693) (-498.071) (-495.771) [-497.075] * (-494.808) (-496.213) [-498.325] (-498.502) -- 0:00:20
      708500 -- (-494.516) (-498.390) (-497.296) [-495.857] * (-497.235) (-498.060) (-496.712) [-495.677] -- 0:00:20
      709000 -- (-498.723) [-495.690] (-498.052) (-496.314) * (-496.076) (-496.198) (-499.535) [-501.110] -- 0:00:20
      709500 -- (-499.324) (-498.026) [-494.569] (-500.327) * (-495.590) (-494.359) (-501.730) [-496.502] -- 0:00:20
      710000 -- [-497.811] (-500.070) (-495.562) (-498.768) * [-497.117] (-495.721) (-495.948) (-495.462) -- 0:00:20

      Average standard deviation of split frequencies: 0.009677

      710500 -- [-495.752] (-495.740) (-496.643) (-498.472) * (-496.780) (-495.408) (-495.100) [-495.009] -- 0:00:19
      711000 -- (-496.375) (-495.646) (-500.460) [-499.781] * (-495.899) (-498.723) [-494.683] (-496.694) -- 0:00:19
      711500 -- (-495.671) (-498.868) [-495.407] (-499.041) * [-496.293] (-495.658) (-496.653) (-496.361) -- 0:00:19
      712000 -- (-495.447) [-494.906] (-495.650) (-497.714) * (-496.188) (-496.775) [-500.187] (-495.914) -- 0:00:19
      712500 -- (-495.788) (-496.587) (-494.788) [-496.588] * [-496.779] (-497.446) (-494.939) (-495.931) -- 0:00:19
      713000 -- (-496.367) (-494.460) [-495.743] (-494.837) * [-495.512] (-498.938) (-495.666) (-497.330) -- 0:00:19
      713500 -- (-494.477) (-495.132) (-496.947) [-496.322] * (-498.778) [-495.142] (-498.389) (-496.980) -- 0:00:19
      714000 -- [-494.694] (-498.139) (-496.489) (-496.820) * (-498.891) (-496.907) [-495.105] (-496.424) -- 0:00:19
      714500 -- (-498.775) (-495.030) (-495.290) [-495.369] * (-498.264) [-494.670] (-495.104) (-495.316) -- 0:00:19
      715000 -- [-497.106] (-495.682) (-496.666) (-496.807) * (-497.690) [-495.915] (-494.734) (-497.743) -- 0:00:19

      Average standard deviation of split frequencies: 0.009760

      715500 -- (-496.783) (-500.645) [-497.613] (-495.672) * (-497.885) (-495.494) [-498.246] (-498.127) -- 0:00:19
      716000 -- [-495.182] (-496.720) (-497.189) (-497.610) * (-495.747) (-495.011) (-494.510) [-498.688] -- 0:00:19
      716500 -- [-495.693] (-496.420) (-495.674) (-497.179) * (-494.853) [-498.860] (-496.450) (-495.734) -- 0:00:19
      717000 -- (-497.377) [-496.591] (-497.024) (-496.024) * (-497.032) [-494.950] (-498.917) (-504.322) -- 0:00:19
      717500 -- (-497.161) (-498.446) [-497.304] (-496.037) * [-495.818] (-495.533) (-496.689) (-499.778) -- 0:00:19
      718000 -- (-495.376) (-496.864) [-495.622] (-494.649) * [-498.078] (-497.870) (-498.883) (-496.666) -- 0:00:19
      718500 -- (-494.274) (-496.941) [-494.622] (-497.884) * [-495.332] (-497.148) (-495.745) (-496.727) -- 0:00:19
      719000 -- (-497.240) (-495.686) [-496.225] (-495.442) * (-500.457) (-497.096) [-497.372] (-498.539) -- 0:00:19
      719500 -- (-496.032) (-496.320) [-496.437] (-494.427) * [-494.769] (-496.292) (-497.549) (-497.719) -- 0:00:19
      720000 -- (-496.554) (-503.337) (-497.009) [-495.953] * (-494.753) (-497.716) (-499.876) [-500.752] -- 0:00:19

      Average standard deviation of split frequencies: 0.009735

      720500 -- (-495.700) (-497.381) [-498.342] (-498.596) * [-495.672] (-496.726) (-498.880) (-496.733) -- 0:00:19
      721000 -- (-496.075) (-494.765) (-498.602) [-495.777] * [-496.515] (-495.041) (-496.795) (-495.559) -- 0:00:19
      721500 -- [-495.037] (-494.424) (-499.102) (-496.006) * [-495.528] (-495.957) (-496.535) (-497.153) -- 0:00:19
      722000 -- (-495.718) (-495.620) (-500.212) [-496.774] * (-494.925) [-495.979] (-495.992) (-498.186) -- 0:00:19
      722500 -- [-496.607] (-498.762) (-499.188) (-494.796) * (-495.001) (-496.888) (-500.387) [-497.516] -- 0:00:19
      723000 -- [-501.491] (-498.010) (-496.395) (-497.788) * (-495.782) (-496.738) (-496.047) [-497.075] -- 0:00:19
      723500 -- (-497.979) [-499.077] (-497.430) (-499.728) * (-496.384) (-497.384) (-497.039) [-496.308] -- 0:00:19
      724000 -- (-498.182) (-497.839) [-497.533] (-496.828) * (-500.932) [-499.787] (-498.378) (-495.930) -- 0:00:19
      724500 -- (-496.354) (-495.586) [-495.333] (-496.285) * (-497.295) [-496.315] (-500.918) (-501.071) -- 0:00:19
      725000 -- (-497.070) (-497.747) [-496.722] (-502.665) * (-496.085) [-496.617] (-497.669) (-498.599) -- 0:00:18

      Average standard deviation of split frequencies: 0.009969

      725500 -- (-496.224) (-496.109) (-497.186) [-496.054] * [-494.910] (-502.064) (-495.882) (-498.600) -- 0:00:18
      726000 -- (-498.469) (-494.764) [-497.541] (-499.851) * (-495.066) [-498.322] (-498.099) (-495.471) -- 0:00:18
      726500 -- [-495.913] (-496.033) (-497.886) (-499.626) * [-494.131] (-497.214) (-495.121) (-495.171) -- 0:00:18
      727000 -- (-501.987) (-497.367) (-495.604) [-497.397] * (-498.559) (-496.361) [-494.789] (-495.935) -- 0:00:18
      727500 -- (-498.886) [-496.076] (-498.093) (-496.151) * (-496.097) (-496.700) (-498.129) [-495.077] -- 0:00:18
      728000 -- (-499.071) [-499.710] (-496.320) (-494.614) * [-497.088] (-495.980) (-498.310) (-499.117) -- 0:00:18
      728500 -- [-496.190] (-496.176) (-498.016) (-494.152) * (-497.664) (-496.264) [-497.535] (-499.029) -- 0:00:18
      729000 -- (-496.878) (-495.403) [-495.566] (-494.825) * (-494.654) (-495.677) [-501.200] (-494.154) -- 0:00:18
      729500 -- (-494.989) (-495.282) [-494.950] (-495.869) * [-502.038] (-496.475) (-497.438) (-494.985) -- 0:00:18
      730000 -- (-498.624) (-494.818) [-495.023] (-495.961) * [-497.572] (-496.676) (-500.267) (-495.505) -- 0:00:18

      Average standard deviation of split frequencies: 0.010133

      730500 -- (-495.308) [-495.006] (-497.010) (-496.735) * (-496.868) [-495.792] (-498.757) (-495.407) -- 0:00:18
      731000 -- (-498.550) (-495.821) (-496.309) [-495.457] * (-497.822) [-495.546] (-498.087) (-494.550) -- 0:00:18
      731500 -- (-501.231) [-494.647] (-494.608) (-498.899) * (-498.709) [-495.068] (-495.204) (-494.501) -- 0:00:18
      732000 -- (-500.833) [-495.499] (-499.697) (-498.508) * [-498.025] (-501.710) (-498.923) (-495.484) -- 0:00:18
      732500 -- (-499.691) (-496.683) (-498.747) [-496.228] * (-494.810) (-496.885) (-496.108) [-497.495] -- 0:00:18
      733000 -- (-497.861) [-497.472] (-498.604) (-497.875) * (-496.034) (-499.936) (-496.248) [-496.739] -- 0:00:18
      733500 -- [-494.871] (-500.064) (-495.922) (-499.312) * (-499.084) (-495.776) [-500.618] (-498.759) -- 0:00:18
      734000 -- [-495.852] (-500.634) (-496.896) (-495.218) * [-495.698] (-497.198) (-501.365) (-496.914) -- 0:00:18
      734500 -- (-498.060) (-500.307) (-497.560) [-501.547] * (-494.649) (-497.335) [-496.171] (-501.230) -- 0:00:18
      735000 -- (-496.648) (-502.631) [-495.128] (-496.770) * (-495.269) [-495.188] (-498.594) (-498.058) -- 0:00:18

      Average standard deviation of split frequencies: 0.009728

      735500 -- (-494.751) (-496.746) (-495.476) [-497.192] * (-496.091) [-498.596] (-503.666) (-497.980) -- 0:00:18
      736000 -- (-502.330) [-494.701] (-498.005) (-494.776) * [-496.357] (-495.823) (-497.271) (-496.594) -- 0:00:18
      736500 -- (-495.439) (-495.817) [-499.770] (-498.419) * (-497.600) (-495.604) [-496.776] (-496.825) -- 0:00:18
      737000 -- (-496.793) [-495.851] (-500.404) (-495.597) * [-497.519] (-498.975) (-496.836) (-496.519) -- 0:00:18
      737500 -- [-496.324] (-495.773) (-499.491) (-495.473) * (-495.381) [-497.883] (-497.091) (-494.419) -- 0:00:18
      738000 -- (-494.862) [-500.616] (-495.659) (-496.167) * [-498.106] (-497.716) (-504.563) (-494.952) -- 0:00:18
      738500 -- (-498.473) (-501.507) [-495.219] (-497.361) * (-495.947) (-496.624) (-502.383) [-495.536] -- 0:00:18
      739000 -- (-498.196) (-496.930) [-495.670] (-497.539) * (-498.015) [-495.618] (-500.070) (-501.031) -- 0:00:18
      739500 -- (-496.329) [-496.584] (-496.207) (-497.205) * (-496.721) [-494.391] (-497.825) (-497.807) -- 0:00:17
      740000 -- (-495.474) (-497.611) [-495.383] (-495.510) * (-498.366) (-498.456) [-495.313] (-499.476) -- 0:00:17

      Average standard deviation of split frequencies: 0.009268

      740500 -- (-495.474) (-497.689) [-497.433] (-500.195) * (-499.133) [-495.198] (-495.228) (-497.248) -- 0:00:17
      741000 -- (-496.054) (-496.550) [-495.749] (-495.638) * (-497.299) (-495.576) (-495.517) [-496.374] -- 0:00:17
      741500 -- (-499.059) (-494.523) [-495.888] (-497.659) * (-498.390) (-497.781) [-497.658] (-497.251) -- 0:00:17
      742000 -- (-498.272) (-495.683) [-495.344] (-498.301) * [-495.677] (-502.503) (-497.770) (-498.328) -- 0:00:17
      742500 -- (-496.003) [-495.679] (-496.234) (-496.564) * (-496.033) (-496.761) (-495.017) [-498.322] -- 0:00:17
      743000 -- (-494.412) (-497.467) (-496.402) [-502.145] * [-496.657] (-496.341) (-495.474) (-495.528) -- 0:00:17
      743500 -- (-502.669) [-498.628] (-496.184) (-498.907) * (-495.719) [-497.209] (-496.882) (-496.226) -- 0:00:17
      744000 -- [-499.352] (-495.803) (-496.566) (-498.396) * (-495.065) [-497.090] (-498.230) (-498.297) -- 0:00:17
      744500 -- (-497.172) (-498.655) [-494.710] (-496.575) * (-495.637) (-496.411) [-495.194] (-499.086) -- 0:00:17
      745000 -- (-496.095) (-502.265) [-495.202] (-496.686) * [-496.763] (-498.070) (-495.730) (-498.066) -- 0:00:17

      Average standard deviation of split frequencies: 0.009360

      745500 -- (-497.929) (-499.769) (-495.739) [-498.795] * (-499.797) (-494.797) [-494.798] (-496.554) -- 0:00:17
      746000 -- (-499.370) (-496.558) [-495.213] (-498.306) * [-497.663] (-501.491) (-497.775) (-497.761) -- 0:00:17
      746500 -- (-496.644) (-497.124) [-496.817] (-495.831) * (-497.221) (-496.683) [-495.767] (-495.850) -- 0:00:17
      747000 -- (-496.602) (-498.260) (-495.767) [-496.048] * [-497.150] (-494.702) (-495.295) (-498.910) -- 0:00:17
      747500 -- [-496.603] (-498.477) (-494.620) (-494.921) * [-498.416] (-495.610) (-495.728) (-496.042) -- 0:00:17
      748000 -- [-495.148] (-495.564) (-494.635) (-499.995) * (-496.117) (-498.038) (-495.261) [-494.992] -- 0:00:17
      748500 -- [-495.561] (-497.682) (-497.025) (-497.910) * [-497.200] (-497.097) (-495.771) (-496.253) -- 0:00:17
      749000 -- (-495.479) (-498.278) (-497.309) [-496.739] * [-497.927] (-497.462) (-496.231) (-497.222) -- 0:00:17
      749500 -- [-498.501] (-499.540) (-495.849) (-495.563) * [-494.753] (-499.299) (-497.691) (-496.646) -- 0:00:17
      750000 -- (-499.637) (-499.937) [-497.223] (-497.581) * (-500.710) [-497.901] (-496.438) (-496.349) -- 0:00:17

      Average standard deviation of split frequencies: 0.008988

      750500 -- (-496.665) [-497.837] (-496.615) (-496.522) * (-495.316) (-496.111) (-496.734) [-496.333] -- 0:00:17
      751000 -- (-497.677) (-495.017) [-495.294] (-494.813) * (-495.893) (-497.849) [-500.403] (-498.671) -- 0:00:17
      751500 -- (-499.851) [-495.909] (-495.491) (-496.792) * [-499.261] (-500.392) (-496.900) (-499.997) -- 0:00:17
      752000 -- [-499.389] (-494.568) (-495.921) (-494.827) * (-495.278) [-496.995] (-496.099) (-496.584) -- 0:00:17
      752500 -- (-495.547) (-496.904) (-495.398) [-496.021] * (-495.935) [-497.187] (-495.768) (-497.102) -- 0:00:17
      753000 -- (-498.647) (-494.646) [-495.114] (-499.165) * (-495.129) (-500.001) (-496.276) [-496.430] -- 0:00:17
      753500 -- [-499.116] (-497.963) (-496.455) (-497.011) * (-498.211) (-501.195) [-494.971] (-497.525) -- 0:00:17
      754000 -- (-501.923) [-497.381] (-496.465) (-501.633) * [-496.137] (-496.534) (-495.968) (-497.629) -- 0:00:16
      754500 -- (-498.724) (-498.012) [-496.047] (-498.118) * (-496.007) (-499.655) [-495.519] (-495.302) -- 0:00:16
      755000 -- [-497.795] (-495.943) (-502.275) (-498.461) * (-495.857) (-498.556) (-495.533) [-495.277] -- 0:00:16

      Average standard deviation of split frequencies: 0.008535

      755500 -- (-499.284) (-497.945) [-495.661] (-495.096) * [-495.207] (-496.985) (-495.208) (-498.430) -- 0:00:16
      756000 -- (-500.246) (-496.532) (-495.168) [-498.289] * (-494.756) (-495.371) [-498.333] (-495.914) -- 0:00:16
      756500 -- (-499.659) (-498.874) (-496.732) [-494.604] * [-499.167] (-500.182) (-496.435) (-498.255) -- 0:00:16
      757000 -- (-495.168) (-500.301) [-497.359] (-495.194) * (-495.924) [-498.968] (-497.166) (-496.855) -- 0:00:16
      757500 -- [-501.389] (-495.305) (-498.023) (-496.015) * (-495.893) (-498.153) [-497.033] (-496.860) -- 0:00:16
      758000 -- (-494.838) (-498.456) [-495.436] (-494.959) * [-496.107] (-504.038) (-498.463) (-497.324) -- 0:00:16
      758500 -- [-496.946] (-498.845) (-495.915) (-495.883) * (-495.619) (-496.309) [-495.343] (-496.234) -- 0:00:16
      759000 -- (-495.682) (-495.906) (-498.073) [-496.587] * (-495.697) (-496.305) (-495.355) [-494.949] -- 0:00:16
      759500 -- (-496.925) (-496.070) (-496.136) [-495.631] * (-497.238) (-495.950) [-495.520] (-495.361) -- 0:00:16
      760000 -- (-498.076) (-496.233) [-496.829] (-494.448) * [-495.930] (-499.115) (-497.355) (-494.413) -- 0:00:16

      Average standard deviation of split frequencies: 0.008289

      760500 -- (-499.107) (-497.012) [-495.664] (-496.980) * (-496.625) [-498.195] (-496.641) (-496.012) -- 0:00:16
      761000 -- (-496.080) [-496.071] (-495.971) (-494.691) * (-502.042) [-496.990] (-496.204) (-498.496) -- 0:00:16
      761500 -- (-496.624) [-496.539] (-497.112) (-496.005) * [-502.372] (-500.684) (-500.033) (-499.025) -- 0:00:16
      762000 -- (-496.239) (-496.082) [-495.848] (-501.420) * (-499.916) (-495.356) (-497.889) [-499.214] -- 0:00:16
      762500 -- (-495.503) [-494.945] (-496.019) (-500.497) * (-494.551) (-501.014) [-495.362] (-499.743) -- 0:00:16
      763000 -- (-497.053) (-497.618) (-502.671) [-495.329] * (-497.350) (-495.987) [-494.619] (-498.689) -- 0:00:16
      763500 -- (-495.511) [-495.169] (-499.609) (-500.973) * (-495.478) (-495.701) [-497.072] (-498.755) -- 0:00:16
      764000 -- (-497.853) (-497.762) [-497.287] (-502.902) * [-495.523] (-495.696) (-496.668) (-503.356) -- 0:00:16
      764500 -- [-497.590] (-495.798) (-498.364) (-498.221) * (-497.444) (-497.131) (-496.178) [-498.112] -- 0:00:16
      765000 -- (-495.405) (-499.445) [-495.077] (-496.463) * (-500.406) (-497.426) [-495.321] (-497.522) -- 0:00:16

      Average standard deviation of split frequencies: 0.008039

      765500 -- (-494.603) (-495.080) (-494.675) [-496.611] * (-496.156) [-494.997] (-497.388) (-496.757) -- 0:00:16
      766000 -- (-500.235) (-495.895) (-496.156) [-501.220] * (-497.675) [-495.544] (-499.790) (-497.950) -- 0:00:16
      766500 -- (-502.211) (-497.841) [-495.276] (-498.916) * [-496.499] (-496.521) (-495.570) (-502.596) -- 0:00:16
      767000 -- (-497.131) [-495.992] (-496.223) (-500.999) * (-495.010) [-494.768] (-495.666) (-499.300) -- 0:00:16
      767500 -- (-495.438) [-497.211] (-497.415) (-498.477) * [-495.169] (-495.934) (-495.010) (-501.362) -- 0:00:16
      768000 -- (-497.659) (-496.035) [-497.119] (-495.654) * [-494.761] (-496.835) (-501.107) (-497.181) -- 0:00:16
      768500 -- [-498.346] (-497.867) (-496.012) (-495.481) * (-497.336) (-497.008) (-497.310) [-495.623] -- 0:00:15
      769000 -- (-496.136) (-496.504) (-497.053) [-496.446] * [-500.083] (-495.714) (-495.558) (-497.288) -- 0:00:15
      769500 -- (-498.098) [-495.394] (-495.450) (-502.384) * (-495.065) (-495.133) [-495.090] (-495.864) -- 0:00:15
      770000 -- [-498.224] (-495.449) (-495.343) (-501.576) * (-495.127) (-495.059) (-499.770) [-497.830] -- 0:00:15

      Average standard deviation of split frequencies: 0.008181

      770500 -- [-497.795] (-494.739) (-496.247) (-498.505) * (-495.170) [-497.329] (-497.556) (-495.459) -- 0:00:15
      771000 -- (-498.674) (-494.659) [-497.346] (-498.769) * (-500.727) [-497.661] (-4