--- EXPERIMENT NOTES
--- EXPERIMENT PROPERTIES
#Thu Jan 23 14:43:09 GMT 2020
codeml.models=0 1 2 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=MUSCLE
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/11res/rplR/input.fasta
input.names=
mrbayes.params=
codeml.params=
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -495.83 -499.27
2 -495.85 -499.02
--------------------------------------
TOTAL -495.84 -499.16
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.894794 0.090541 0.366590 1.486165 0.867773 1501.00 1501.00 1.000
r(A<->C){all} 0.172540 0.019885 0.000008 0.451878 0.136883 196.25 249.93 1.006
r(A<->G){all} 0.164748 0.018710 0.000031 0.433407 0.129447 164.97 188.57 1.000
r(A<->T){all} 0.166116 0.020165 0.000082 0.446244 0.129437 141.84 184.71 1.000
r(C<->G){all} 0.164659 0.020992 0.000002 0.468278 0.122273 198.94 227.56 1.007
r(C<->T){all} 0.167516 0.020705 0.000072 0.447906 0.129617 180.73 203.31 1.000
r(G<->T){all} 0.164422 0.017665 0.000030 0.418061 0.133910 274.30 354.31 1.000
pi(A){all} 0.183652 0.000410 0.145234 0.222549 0.183123 1334.06 1354.12 1.001
pi(C){all} 0.276282 0.000541 0.232389 0.323024 0.276021 1137.29 1150.81 1.000
pi(G){all} 0.348832 0.000599 0.299571 0.396177 0.348527 1142.41 1162.18 1.000
pi(T){all} 0.191233 0.000434 0.150742 0.232149 0.191058 864.14 1084.96 1.000
alpha{1,2} 0.420395 0.236149 0.000135 1.444660 0.244740 1055.58 1150.89 1.000
alpha{3} 0.456416 0.249838 0.000168 1.505327 0.281660 1102.65 1118.90 1.000
pinvar{all} 0.995548 0.000027 0.985239 1.000000 0.997274 1303.10 1402.05 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
--- CODEML SUMMARY
Model 1: NearlyNeutral -476.708168
Model 2: PositiveSelection -476.708133
Model 0: one-ratio -476.708129
Model 7: beta -476.708168
Model 8: beta&w>1 -476.708129
Model 0 vs 1 7.80000000304426E-5
Model 2 vs 1 7.000000005064066E-5
Model 8 vs 7 7.80000000304426E-5
>C1
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C2
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C3
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C4
VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
YTYGGRIAALADSVRENGLNFo
>C5
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C6
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=123
C1 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C2 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C3 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C4 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C5 VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
C6 VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
*************************************************
C1 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C2 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C3 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C4 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C5 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
C6 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
**************************************************
C1 GYTYGGRIAALADSVRENGLNFo
C2 GYTYGGRIAALADSVRENGLNFo
C3 GYTYGGRIAALADSVRENGLNFo
C4 GYTYGGRIAALADSVRENGLNFo
C5 GYTYGGRIAALADSVRENGLNF-
C6 GYTYGGRIAALADSVRENGLNF-
**********************
PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log S [0]
-genepred_score S [0] nsd
-run_name S [0]
-mem_mode S [0] mem
-extend D [1] 1
-extend_mode S [0] very_fast_triplet
-max_n_pair D [0] 10
-seq_name_for_quadruplet S [0] all
-compact S [0] default
-clean S [0] no
-do_self FL [0] 0
-do_normalise D [0] 1000
-template_file S [0]
-setenv S [0] 0
-template_mode S [0]
-flip D [0] 0
-remove_template_file D [0] 0
-profile_template_file S [0]
-in S [0]
-seq S [0]
-aln S [0]
-method_limits S [0]
-method S [0]
-lib S [0]
-profile S [0]
-profile1 S [0]
-profile2 S [0]
-pdb S [0]
-relax_lib D [0] 1
-filter_lib D [0] 0
-shrink_lib D [0] 0
-out_lib W_F [0] no
-out_lib_mode S [0] primary
-lib_only D [0] 0
-outseqweight W_F [0] no
-dpa FL [0] 0
-seq_source S [0] ANY
-cosmetic_penalty D [0] 0
-gapopen D [0] 0
-gapext D [0] 0
-fgapopen D [0] 0
-fgapext D [0] 0
-nomatch D [0] 0
-newtree W_F [0] default
-tree W_F [0] NO
-usetree R_F [0]
-tree_mode S [0] nj
-distance_matrix_mode S [0] ktup
-distance_matrix_sim_mode S [0] idmat_sim1
-quicktree FL [0] 0
-outfile W_F [0] default
-maximise FL [1] 1
-output S [1] score_ascii html score_ascii
-len D [0] 0
-infile R_F [1] input.prot.fasta.muscle_rs_0_0.fasta.aln
-matrix S [0] default
-tg_mode D [0] 1
-profile_mode S [0] cw_profile_profile
-profile_comparison S [0] profile
-dp_mode S [0] linked_pair_wise
-ktuple D [0] 1
-ndiag D [0] 0
-diag_threshold D [0] 0
-diag_mode D [0] 0
-sim_matrix S [0] vasiliky
-transform S [0]
-extend_seq FL [0] 0
-outorder S [0] input
-inorder S [0] aligned
-seqnos S [0] off
-case S [0] keep
-cpu D [0] 0
-maxnseq D [0] 1000
-maxlen D [0] -1
-sample_dp D [0] 0
-weight S [0] default
-seq_weight S [0] no
-align FL [1] 1
-mocca FL [0] 0
-domain FL [0] 0
-start D [0] 0
-len D [0] 0
-scale D [0] 0
-mocca_interactive FL [0] 0
-method_evaluate_mode S [0] default
-evaluate_mode S [1] t_coffee_fast
-get_type FL [0] 0
-clean_aln D [0] 0
-clean_threshold D [1] 1
-clean_iteration D [1] 1
-clean_evaluate_mode S [0] t_coffee_fast
-extend_matrix FL [0] 0
-prot_min_sim D [40] 40
-prot_max_sim D [90] 90
-prot_min_cov D [40] 40
-pdb_type S [0] d
-pdb_min_sim D [35] 35
-pdb_max_sim D [100] 100
-pdb_min_cov D [50] 50
-pdb_blast_server W_F [0] EBI
-blast W_F [0]
-blast_server W_F [0] EBI
-pdb_db W_F [0] pdb
-protein_db W_F [0] uniprot
-method_log W_F [0] no
-struc_to_use S [0]
-cache W_F [0] use
-align_pdb_param_file W_F [0] no
-align_pdb_hasch_mode W_F [0] hasch_ca_trace_bubble
-external_aligner S [0] NO
-msa_mode S [0] tree
-master S [0] no
-blast_nseq D [0] 0
-lalign_n_top D [0] 10
-iterate D [1] 0
-trim D [0] 0
-split D [0] 0
-trimfile S [0] default
-split D [0] 0
-split_nseq_thres D [0] 0
-split_score_thres D [0] 0
-check_pdb_status D [0] 0
-clean_seq_name D [0] 0
-seq_to_keep S [0]
-dpa_master_aln S [0]
-dpa_maxnseq D [0] 0
-dpa_min_score1 D [0]
-dpa_min_score2 D [0]
-dpa_keep_tmpfile FL [0] 0
-dpa_debug D [0] 0
-multi_core S [0] templates_jobs_relax_msa_evaluate
-n_core D [0] 0
-max_n_proc D [0] 0
-lib_list S [0]
-prune_lib_mode S [0] 5
-tip S [0] none
-rna_lib S [0]
-no_warning D [0] 0
-run_local_script D [0] 0
-plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 122 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 122 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3708]
Library Relaxation: Multi_proc [96]
Relaxation Summary: [3708]--->[3708]
UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1
OUTPUT RESULTS
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
#### File Type= MSA Format= html Name= input.prot.fasta.muscle_rs_0_0.fasta.html
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
# Command Line: t_coffee -infile input.prot.fasta.muscle_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.460 Mb, Max= 30.652 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/
FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment
C1 VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C2 VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C3 VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C4 VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C5 VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
C6 VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDVT
**************************************************
C1 GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C2 GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C3 GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C4 GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C5 GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
C6 GTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRGG
**************************************************
C1 YTYGGRIAALADSVRENGLNF
C2 YTYGGRIAALADSVRENGLNF
C3 YTYGGRIAALADSVRENGLNF
C4 YTYGGRIAALADSVRENGLNF
C5 YTYGGRIAALADSVRENGLNF
C6 YTYGGRIAALADSVRENGLNF
*********************
FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.muscle_rs_0_0.fasta.aln I:93 S:99 BS:94
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES
BOT 0 1 100.00 C1 C2 100.00
TOP 1 0 100.00 C2 C1 100.00
BOT 0 2 100.00 C1 C3 100.00
TOP 2 0 100.00 C3 C1 100.00
BOT 0 3 100.00 C1 C4 100.00
TOP 3 0 100.00 C4 C1 100.00
BOT 0 4 100.00 C1 C5 100.00
TOP 4 0 100.00 C5 C1 100.00
BOT 0 5 100.00 C1 C6 100.00
TOP 5 0 100.00 C6 C1 100.00
BOT 1 2 100.00 C2 C3 100.00
TOP 2 1 100.00 C3 C2 100.00
BOT 1 3 100.00 C2 C4 100.00
TOP 3 1 100.00 C4 C2 100.00
BOT 1 4 100.00 C2 C5 100.00
TOP 4 1 100.00 C5 C2 100.00
BOT 1 5 100.00 C2 C6 100.00
TOP 5 1 100.00 C6 C2 100.00
BOT 2 3 100.00 C3 C4 100.00
TOP 3 2 100.00 C4 C3 100.00
BOT 2 4 100.00 C3 C5 100.00
TOP 4 2 100.00 C5 C3 100.00
BOT 2 5 100.00 C3 C6 100.00
TOP 5 2 100.00 C6 C3 100.00
BOT 3 4 100.00 C4 C5 100.00
TOP 4 3 100.00 C5 C4 100.00
BOT 3 5 100.00 C4 C6 100.00
TOP 5 3 100.00 C6 C4 100.00
BOT 4 5 100.00 C5 C6 100.00
TOP 5 4 100.00 C6 C5 100.00
AVG 0 C1 * 100.00
AVG 1 C2 * 100.00
AVG 2 C3 * 100.00
AVG 3 C4 * 100.00
AVG 4 C5 * 100.00
AVG 5 C6 * 100.00
TOT TOT * 100.00
CLUSTAL W (1.83) multiple sequence alignment
C1 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C2 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C3 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C4 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C5 GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
C6 GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
***********************************************
C1 CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C2 CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C3 CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C4 CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C5 CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
C6 CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
**************************************************
C1 TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C2 TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C3 TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C4 TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C5 TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
C6 TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
**************************************************
C1 ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C2 ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C3 ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C4 ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C5 ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
C6 ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
**************************************************
C1 TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C2 TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C3 TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C4 TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C5 TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
C6 TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
**************************************************
C1 CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C2 CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C3 CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C4 CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C5 CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
C6 CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
**************************************************
C1 GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C2 GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C3 GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C4 GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C5 GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
C6 GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
**************************************************
C1 GAACGGATTGAATTTC---
C2 GAACGGATTGAATTTC---
C3 GAACGGATTGAATTTC---
C4 GAACGGATTGAATTTC---
C5 GAACGGATTGAATTTC---
C6 GAACGGATTGAATTTC---
****************
>C1
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C2
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C3
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C4
---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C5
GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C6
GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA
CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG
TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC
ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG
TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG
CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC
GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA
GAACGGATTGAATTTC---
>C1
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C2
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C3
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C4
oVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C5
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
>C6
VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
GYTYGGRIAALADSVRENGLNF
MrBayes v3.2.2 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 6 taxa and 369 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Taxon 5 -> C5
Taxon 6 -> C6
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1579790505
Setting output file names to "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called first_pos
Defining charset called second_pos
Defining charset called third_pos
Defining partition called by_codon
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1882261152
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 0755050800
Seed = 143950338
Swapseed = 1579790505
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Active parameters:
Partition(s)
Parameters 1 2 3
------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:Exponential(10.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.06 % Dirichlet(Revmat{all})
1.06 % Slider(Revmat{all})
1.06 % Dirichlet(Pi{all})
1.06 % Slider(Pi{all})
2.13 % Multiplier(Alpha{1,2})
2.13 % Multiplier(Alpha{3})
2.13 % Slider(Pinvar{all})
10.64 % ExtSPR(Tau{all},V{all})
10.64 % ExtTBR(Tau{all},V{all})
10.64 % NNI(Tau{all},V{all})
10.64 % ParsSPR(Tau{all},V{all})
31.91 % Multiplier(V{all})
10.64 % Nodeslider(V{all})
4.26 % TLMultiplier(V{all})
Division 1 has 6 unique site patterns
Division 2 has 6 unique site patterns
Division 3 has 6 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -817.898725 -- -24.965149
Chain 2 -- -817.408960 -- -24.965149
Chain 3 -- -817.408960 -- -24.965149
Chain 4 -- -817.408960 -- -24.965149
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -817.660696 -- -24.965149
Chain 2 -- -817.898678 -- -24.965149
Chain 3 -- -817.408960 -- -24.965149
Chain 4 -- -817.408960 -- -24.965149
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-817.899] (-817.409) (-817.409) (-817.409) * [-817.661] (-817.899) (-817.409) (-817.409)
500 -- (-502.614) [-503.692] (-504.198) (-504.371) * (-515.039) (-506.196) (-513.910) [-505.808] -- 0:00:00
1000 -- (-505.531) [-507.763] (-505.515) (-504.750) * [-511.335] (-504.250) (-503.403) (-514.318) -- 0:00:00
1500 -- (-512.436) (-508.493) (-505.715) [-504.185] * (-502.553) (-504.332) (-511.753) [-501.551] -- 0:00:00
2000 -- (-502.712) (-504.359) [-504.980] (-502.463) * (-514.776) [-505.787] (-508.178) (-508.026) -- 0:00:00
2500 -- (-507.617) [-514.817] (-506.470) (-508.815) * (-500.526) (-506.992) [-510.250] (-506.057) -- 0:00:00
3000 -- (-503.490) [-502.689] (-503.050) (-508.159) * (-505.243) (-509.457) [-500.996] (-506.372) -- 0:00:00
3500 -- (-513.297) [-500.025] (-513.157) (-511.593) * (-510.008) (-506.547) (-504.845) [-509.367] -- 0:00:00
4000 -- (-502.460) (-505.485) (-508.205) [-497.498] * (-505.207) [-508.536] (-510.089) (-502.590) -- 0:00:00
4500 -- (-501.910) (-504.319) [-510.587] (-515.433) * (-505.003) (-512.271) [-508.232] (-501.883) -- 0:00:00
5000 -- [-499.048] (-507.803) (-504.423) (-499.322) * (-503.524) (-500.505) [-507.074] (-509.939) -- 0:00:00
Average standard deviation of split frequencies: 0.061488
5500 -- (-501.809) (-505.416) (-511.680) [-506.415] * (-519.434) (-496.817) [-503.244] (-510.138) -- 0:00:00
6000 -- (-507.583) (-505.181) (-503.276) [-501.367] * [-507.354] (-496.881) (-508.752) (-510.363) -- 0:00:00
6500 -- (-504.301) (-503.608) [-501.356] (-501.292) * (-510.297) (-498.549) (-507.913) [-501.144] -- 0:00:00
7000 -- (-504.028) (-504.240) (-511.292) [-502.165] * (-501.092) (-497.930) [-506.400] (-513.631) -- 0:00:00
7500 -- (-504.944) (-507.572) (-509.362) [-504.476] * [-505.220] (-499.513) (-504.999) (-508.779) -- 0:00:00
8000 -- (-501.819) (-511.073) [-506.116] (-504.436) * (-509.395) [-496.309] (-507.703) (-512.819) -- 0:00:00
8500 -- (-502.858) (-500.869) (-512.688) [-502.323] * (-511.906) [-496.603] (-502.040) (-510.973) -- 0:00:00
9000 -- (-507.885) (-501.933) (-508.284) [-501.411] * (-513.704) (-496.693) [-507.807] (-503.102) -- 0:00:00
9500 -- [-506.839] (-505.961) (-508.069) (-512.928) * (-505.758) (-498.813) (-502.702) [-507.575] -- 0:00:00
10000 -- (-507.379) (-511.022) [-508.184] (-502.631) * [-504.235] (-496.763) (-504.127) (-510.990) -- 0:00:00
Average standard deviation of split frequencies: 0.062392
10500 -- (-502.603) (-509.515) [-503.383] (-506.378) * [-505.230] (-499.324) (-505.043) (-508.517) -- 0:00:00
11000 -- [-498.295] (-506.575) (-510.188) (-508.361) * (-505.093) (-500.313) [-502.663] (-510.873) -- 0:00:00
11500 -- (-501.325) (-507.813) [-503.838] (-522.142) * (-511.615) [-495.823] (-498.587) (-502.642) -- 0:00:00
12000 -- (-508.001) (-510.845) (-507.848) [-495.864] * (-505.671) [-497.021] (-508.496) (-502.700) -- 0:00:00
12500 -- (-508.904) (-502.323) [-503.800] (-494.396) * (-505.052) [-497.970] (-502.535) (-506.020) -- 0:00:00
13000 -- (-506.712) (-510.931) (-509.310) [-495.228] * (-500.485) (-497.062) (-502.087) [-502.387] -- 0:01:15
13500 -- [-511.521] (-515.905) (-509.592) (-499.495) * (-502.086) (-494.612) [-507.623] (-503.958) -- 0:01:13
14000 -- [-507.916] (-507.682) (-518.437) (-498.528) * (-503.110) (-498.604) [-507.137] (-508.793) -- 0:01:10
14500 -- [-502.842] (-511.938) (-496.303) (-496.586) * (-500.585) [-502.345] (-506.585) (-508.469) -- 0:01:07
15000 -- (-514.389) (-518.605) [-496.397] (-496.344) * (-504.024) (-497.340) (-504.923) [-504.136] -- 0:01:05
Average standard deviation of split frequencies: 0.058926
15500 -- [-506.485] (-499.313) (-499.339) (-500.543) * [-505.240] (-497.601) (-501.428) (-519.957) -- 0:01:03
16000 -- [-500.414] (-500.450) (-496.601) (-499.222) * [-507.973] (-496.430) (-502.492) (-515.870) -- 0:01:01
16500 -- (-506.290) (-506.630) [-495.725] (-496.506) * (-504.220) (-501.901) [-507.292] (-501.045) -- 0:00:59
17000 -- (-509.823) (-510.757) [-498.105] (-497.033) * [-506.631] (-501.224) (-501.480) (-504.728) -- 0:00:57
17500 -- (-511.952) (-512.171) [-499.714] (-499.479) * [-498.567] (-499.910) (-504.352) (-495.148) -- 0:00:56
18000 -- (-501.208) (-513.093) (-497.322) [-496.189] * (-504.766) [-494.403] (-508.712) (-499.889) -- 0:00:54
18500 -- (-501.784) (-513.130) (-496.969) [-496.557] * (-508.281) (-497.778) (-512.879) [-496.278] -- 0:00:53
19000 -- [-508.067] (-503.223) (-497.657) (-495.723) * [-503.321] (-502.348) (-512.937) (-499.032) -- 0:00:51
19500 -- (-507.250) (-507.224) (-496.363) [-497.538] * (-506.530) [-497.120] (-506.300) (-501.026) -- 0:00:50
20000 -- [-502.691] (-508.764) (-494.911) (-495.935) * [-503.128] (-497.843) (-505.701) (-495.549) -- 0:00:49
Average standard deviation of split frequencies: 0.044479
20500 -- (-505.766) (-516.062) (-497.212) [-501.222] * (-504.098) [-496.287] (-505.366) (-496.809) -- 0:00:47
21000 -- [-502.109] (-500.940) (-497.675) (-497.754) * (-509.414) [-496.504] (-507.798) (-498.681) -- 0:00:46
21500 -- (-506.775) [-494.842] (-497.673) (-500.349) * (-514.193) [-496.938] (-506.272) (-496.282) -- 0:00:45
22000 -- (-510.171) (-496.486) [-494.649] (-498.928) * [-503.765] (-497.250) (-505.533) (-495.459) -- 0:00:44
22500 -- (-503.324) (-497.444) [-494.958] (-497.970) * [-502.836] (-496.550) (-509.542) (-495.998) -- 0:00:43
23000 -- [-507.050] (-495.914) (-496.148) (-499.130) * (-508.276) (-495.117) [-509.053] (-497.942) -- 0:00:42
23500 -- (-507.025) (-496.006) (-494.173) [-497.168] * (-513.202) [-494.638] (-519.704) (-498.925) -- 0:00:41
24000 -- (-505.199) (-498.664) [-495.560] (-498.960) * (-507.466) (-494.666) [-504.557] (-495.211) -- 0:00:40
24500 -- (-510.270) [-496.960] (-495.737) (-494.265) * [-505.780] (-495.236) (-510.684) (-496.138) -- 0:00:39
25000 -- (-504.501) [-494.971] (-496.293) (-495.484) * [-510.769] (-495.483) (-508.059) (-495.410) -- 0:00:39
Average standard deviation of split frequencies: 0.033109
25500 -- (-523.411) [-496.534] (-496.067) (-495.877) * (-508.764) [-502.519] (-505.048) (-499.348) -- 0:00:38
26000 -- (-503.311) (-498.663) [-495.100] (-495.227) * (-502.043) [-496.803] (-499.739) (-499.103) -- 0:00:37
26500 -- (-495.623) [-499.834] (-497.051) (-497.224) * (-512.167) (-496.617) (-496.726) [-497.121] -- 0:00:36
27000 -- (-498.268) (-497.143) [-496.000] (-494.629) * [-502.418] (-499.726) (-494.897) (-497.598) -- 0:00:36
27500 -- (-496.017) [-494.466] (-494.751) (-494.443) * (-505.162) (-494.606) (-494.422) [-495.883] -- 0:01:10
28000 -- (-498.525) [-496.968] (-497.939) (-495.060) * (-504.128) (-495.951) (-494.768) [-499.146] -- 0:01:09
28500 -- [-496.227] (-497.800) (-498.998) (-495.814) * (-508.902) (-498.140) (-495.915) [-497.768] -- 0:01:08
29000 -- (-495.274) (-495.506) (-498.995) [-497.236] * [-508.207] (-495.862) (-497.034) (-496.758) -- 0:01:06
29500 -- (-495.457) [-494.519] (-496.990) (-497.181) * [-503.777] (-496.633) (-499.940) (-495.674) -- 0:01:05
30000 -- [-495.227] (-499.623) (-498.849) (-497.617) * (-507.454) (-495.975) (-500.739) [-495.650] -- 0:01:04
Average standard deviation of split frequencies: 0.035868
30500 -- (-495.001) (-499.754) (-497.998) [-496.571] * (-506.859) (-496.293) (-495.835) [-497.092] -- 0:01:03
31000 -- (-496.406) (-498.449) [-497.496] (-496.748) * (-504.566) [-495.014] (-496.798) (-495.407) -- 0:01:02
31500 -- (-496.452) [-495.956] (-494.601) (-498.595) * (-502.486) (-496.132) [-494.787] (-497.788) -- 0:01:01
32000 -- (-496.987) (-496.399) (-502.772) [-495.093] * (-512.117) (-496.813) [-495.053] (-497.474) -- 0:01:00
32500 -- (-498.175) (-497.051) (-497.807) [-495.267] * (-509.884) (-497.181) [-498.275] (-496.803) -- 0:00:59
33000 -- (-498.485) (-496.052) [-495.366] (-499.647) * [-508.564] (-499.181) (-497.249) (-498.625) -- 0:00:58
33500 -- [-499.713] (-496.317) (-496.879) (-499.506) * (-504.043) (-496.886) [-496.337] (-498.860) -- 0:00:57
34000 -- (-498.519) (-495.415) (-496.615) [-499.584] * (-501.851) (-500.307) [-494.393] (-496.386) -- 0:00:56
34500 -- (-498.752) (-495.645) (-494.875) [-496.287] * [-507.886] (-496.588) (-494.373) (-495.590) -- 0:00:55
35000 -- (-498.601) [-494.335] (-497.264) (-499.127) * [-497.537] (-495.776) (-496.513) (-496.610) -- 0:00:55
Average standard deviation of split frequencies: 0.039284
35500 -- (-496.021) [-495.189] (-496.649) (-494.531) * (-494.967) [-498.043] (-495.403) (-497.283) -- 0:00:54
36000 -- [-494.920] (-496.185) (-498.379) (-496.563) * (-498.105) [-496.876] (-499.811) (-497.332) -- 0:00:53
36500 -- (-496.250) [-497.584] (-497.395) (-498.073) * (-498.385) (-496.129) [-497.129] (-496.269) -- 0:00:52
37000 -- (-495.930) (-498.076) (-494.605) [-500.321] * (-499.554) [-497.284] (-498.022) (-494.467) -- 0:00:52
37500 -- (-495.735) (-498.056) (-497.474) [-498.867] * [-495.177] (-498.693) (-497.052) (-494.446) -- 0:00:51
38000 -- (-496.196) [-496.968] (-498.688) (-496.611) * (-496.415) (-494.667) (-495.400) [-497.222] -- 0:00:50
38500 -- (-500.675) (-498.133) [-494.772] (-499.612) * [-496.020] (-496.058) (-497.101) (-496.192) -- 0:00:49
39000 -- (-499.161) (-498.877) [-496.576] (-497.661) * (-501.833) [-498.250] (-494.518) (-496.249) -- 0:00:49
39500 -- (-498.357) (-495.478) [-495.620] (-495.815) * [-502.895] (-496.969) (-497.938) (-495.971) -- 0:00:48
40000 -- (-497.559) (-495.009) [-494.850] (-497.572) * (-500.503) (-495.337) (-495.145) [-498.166] -- 0:00:48
Average standard deviation of split frequencies: 0.042097
40500 -- (-497.240) [-498.824] (-497.449) (-496.045) * [-500.510] (-495.547) (-494.618) (-497.888) -- 0:00:47
41000 -- (-496.047) (-497.019) [-499.077] (-496.411) * (-498.072) (-496.248) (-496.834) [-496.170] -- 0:00:46
41500 -- [-494.870] (-496.058) (-497.696) (-497.346) * (-498.182) (-495.445) (-495.103) [-495.414] -- 0:00:46
42000 -- (-496.080) (-498.800) (-498.702) [-497.294] * (-501.396) (-498.574) [-496.647] (-497.338) -- 0:01:08
42500 -- (-495.736) (-498.457) (-497.405) [-495.624] * (-499.852) [-495.359] (-497.654) (-496.829) -- 0:01:07
43000 -- (-498.498) (-498.105) (-496.752) [-495.159] * (-497.404) (-494.627) [-496.236] (-495.396) -- 0:01:06
43500 -- (-497.482) (-496.803) [-495.720] (-498.003) * (-496.392) [-498.217] (-497.992) (-496.259) -- 0:01:05
44000 -- (-498.693) (-495.962) [-495.054] (-496.783) * (-499.964) [-498.598] (-498.632) (-498.101) -- 0:01:05
44500 -- (-495.814) (-497.056) [-495.976] (-497.131) * (-497.440) (-496.709) (-496.757) [-496.302] -- 0:01:04
45000 -- [-496.331] (-496.938) (-498.175) (-497.052) * (-494.936) (-496.348) [-497.998] (-496.621) -- 0:01:03
Average standard deviation of split frequencies: 0.042016
45500 -- (-495.302) (-495.958) (-498.500) [-496.534] * (-497.020) [-498.690] (-497.809) (-495.139) -- 0:01:02
46000 -- (-498.474) (-495.703) (-498.685) [-497.945] * (-496.209) (-495.061) (-503.100) [-495.675] -- 0:01:02
46500 -- (-495.703) [-494.940] (-496.515) (-497.012) * [-498.368] (-497.418) (-495.158) (-495.935) -- 0:01:01
47000 -- (-498.294) (-496.259) (-501.017) [-496.638] * (-498.567) [-497.239] (-495.129) (-494.760) -- 0:01:00
47500 -- (-495.620) [-497.445] (-496.231) (-495.166) * (-496.060) (-496.291) (-497.092) [-495.797] -- 0:01:00
48000 -- (-498.196) (-496.951) (-498.482) [-494.758] * (-499.652) [-496.551] (-497.497) (-496.960) -- 0:00:59
48500 -- (-500.040) (-498.744) [-497.726] (-496.263) * (-499.734) (-495.425) [-497.682] (-499.584) -- 0:00:58
49000 -- (-497.960) (-497.223) (-496.462) [-495.294] * (-497.129) [-494.621] (-494.548) (-495.323) -- 0:00:58
49500 -- (-498.469) [-497.497] (-496.861) (-496.092) * (-494.390) (-494.601) [-495.070] (-496.569) -- 0:00:57
50000 -- (-495.131) [-497.243] (-497.373) (-497.552) * (-497.577) (-497.544) [-495.582] (-495.113) -- 0:00:57
Average standard deviation of split frequencies: 0.039874
50500 -- [-495.779] (-496.804) (-496.395) (-497.503) * (-502.389) [-496.082] (-496.744) (-495.239) -- 0:00:56
51000 -- (-496.420) (-494.711) (-498.689) [-496.100] * (-499.761) [-496.180] (-497.186) (-495.714) -- 0:00:55
51500 -- (-496.997) [-496.024] (-499.050) (-495.932) * (-497.397) (-498.371) [-494.855] (-496.107) -- 0:00:55
52000 -- (-496.311) [-496.231] (-496.122) (-494.764) * (-496.806) (-499.888) [-495.386] (-495.432) -- 0:00:54
52500 -- (-495.757) (-497.937) (-494.576) [-495.971] * [-494.852] (-495.245) (-498.297) (-494.482) -- 0:00:54
53000 -- (-495.065) (-502.960) (-498.095) [-495.640] * (-496.657) [-495.813] (-497.157) (-496.461) -- 0:00:53
53500 -- (-496.243) (-497.838) [-494.490] (-495.521) * [-494.247] (-495.252) (-496.222) (-499.710) -- 0:00:53
54000 -- (-500.003) (-498.841) (-495.039) [-497.886] * (-495.425) (-496.617) (-495.998) [-496.580] -- 0:00:52
54500 -- (-497.751) [-497.297] (-497.488) (-496.621) * (-498.332) [-496.386] (-497.752) (-497.938) -- 0:00:52
55000 -- (-495.547) [-495.636] (-502.355) (-500.484) * (-498.056) [-494.760] (-495.326) (-497.198) -- 0:00:51
Average standard deviation of split frequencies: 0.038482
55500 -- (-498.641) (-498.510) [-498.406] (-499.268) * (-496.555) (-494.877) [-497.629] (-496.260) -- 0:00:51
56000 -- (-496.481) [-495.349] (-497.437) (-496.243) * [-497.951] (-496.934) (-496.777) (-495.889) -- 0:00:50
56500 -- (-497.597) [-497.678] (-500.102) (-497.069) * [-498.372] (-497.771) (-496.758) (-496.067) -- 0:01:06
57000 -- (-496.065) [-494.280] (-496.581) (-500.033) * (-497.560) (-496.245) (-496.191) [-494.587] -- 0:01:06
57500 -- (-499.712) (-494.681) [-498.095] (-498.040) * [-495.106] (-494.709) (-497.400) (-495.230) -- 0:01:05
58000 -- (-497.333) (-496.625) [-498.233] (-497.132) * (-495.344) [-494.809] (-503.198) (-496.153) -- 0:01:04
58500 -- (-499.953) (-497.682) (-498.031) [-494.906] * (-495.100) (-497.561) (-495.730) [-499.787] -- 0:01:04
59000 -- (-498.859) (-495.938) (-494.338) [-494.799] * (-499.985) (-495.457) (-496.990) [-498.991] -- 0:01:03
59500 -- (-497.935) (-498.744) [-495.817] (-494.617) * (-496.892) (-497.610) [-496.283] (-495.792) -- 0:01:03
60000 -- (-496.193) (-499.666) (-497.952) [-497.513] * (-499.912) (-498.107) (-497.057) [-498.083] -- 0:01:02
Average standard deviation of split frequencies: 0.039261
60500 -- (-496.292) (-495.539) [-495.944] (-498.219) * [-495.459] (-499.255) (-494.330) (-497.713) -- 0:01:02
61000 -- [-497.095] (-496.604) (-495.487) (-494.683) * (-499.339) [-495.774] (-496.660) (-497.302) -- 0:01:01
61500 -- (-494.853) [-496.179] (-498.346) (-496.271) * (-498.803) [-496.096] (-496.846) (-494.981) -- 0:01:01
62000 -- (-497.999) [-496.386] (-495.782) (-499.808) * (-496.750) (-496.695) (-497.906) [-495.610] -- 0:01:00
62500 -- (-496.531) (-496.386) [-495.768] (-495.384) * (-497.250) (-499.681) (-499.304) [-495.500] -- 0:01:00
63000 -- (-495.246) [-495.480] (-497.739) (-495.329) * (-496.749) [-495.434] (-497.455) (-496.602) -- 0:00:59
63500 -- (-496.676) (-495.480) [-498.774] (-494.604) * (-499.975) [-496.167] (-499.951) (-497.774) -- 0:00:58
64000 -- [-496.724] (-497.450) (-498.627) (-496.598) * (-496.913) (-496.098) [-497.017] (-497.536) -- 0:00:58
64500 -- [-497.350] (-496.367) (-495.802) (-498.513) * (-497.429) (-495.347) (-494.505) [-495.236] -- 0:00:58
65000 -- [-495.170] (-497.488) (-495.015) (-495.168) * (-496.725) [-500.102] (-495.272) (-495.980) -- 0:00:57
Average standard deviation of split frequencies: 0.038927
65500 -- [-496.317] (-495.565) (-494.926) (-495.991) * (-496.392) (-496.938) (-496.978) [-494.927] -- 0:00:57
66000 -- (-495.167) (-497.339) (-495.301) [-499.480] * (-496.763) (-497.653) [-494.995] (-495.162) -- 0:00:56
66500 -- (-497.732) (-495.870) (-496.941) [-495.140] * (-497.299) (-494.522) [-497.199] (-498.554) -- 0:00:56
67000 -- (-497.362) (-496.410) (-496.440) [-494.723] * (-499.952) (-502.325) (-499.732) [-495.402] -- 0:00:55
67500 -- (-497.592) [-494.908] (-495.934) (-498.757) * [-501.378] (-498.959) (-497.727) (-496.131) -- 0:00:55
68000 -- (-497.624) (-496.841) (-494.947) [-495.130] * (-497.052) (-497.518) [-495.578] (-495.734) -- 0:00:54
68500 -- (-497.411) [-496.666] (-494.831) (-496.789) * (-498.090) (-495.804) [-496.967] (-494.514) -- 0:00:54
69000 -- (-496.658) (-496.223) [-496.791] (-498.153) * [-494.615] (-502.113) (-496.971) (-495.576) -- 0:00:53
69500 -- (-499.681) [-495.120] (-496.063) (-495.346) * (-494.640) (-495.465) [-495.644] (-497.813) -- 0:00:53
70000 -- (-497.199) [-496.388] (-501.327) (-496.534) * (-498.545) (-497.648) (-494.716) [-500.424] -- 0:00:53
Average standard deviation of split frequencies: 0.035461
70500 -- (-497.441) (-495.774) [-500.342] (-494.962) * (-495.811) (-494.594) (-496.277) [-495.376] -- 0:00:52
71000 -- (-496.948) [-495.418] (-496.428) (-500.044) * (-495.922) (-494.941) [-495.275] (-495.558) -- 0:00:52
71500 -- (-496.878) (-495.948) (-495.303) [-496.023] * (-494.964) (-494.865) [-494.645] (-497.174) -- 0:01:04
72000 -- [-496.066] (-498.293) (-494.970) (-495.027) * (-496.298) [-499.051] (-496.251) (-496.168) -- 0:01:04
72500 -- (-496.957) [-496.636] (-495.966) (-494.918) * (-496.321) (-498.563) [-494.633] (-497.059) -- 0:01:03
73000 -- (-498.088) [-497.672] (-496.396) (-496.955) * (-495.898) (-496.762) [-495.152] (-494.772) -- 0:01:03
73500 -- (-495.424) [-497.155] (-495.183) (-496.850) * (-496.119) (-499.230) [-495.549] (-494.449) -- 0:01:03
74000 -- (-495.351) [-495.127] (-501.182) (-495.872) * (-496.482) (-496.606) [-496.667] (-496.413) -- 0:01:02
74500 -- [-494.593] (-496.047) (-500.770) (-498.407) * [-496.435] (-497.096) (-495.938) (-494.814) -- 0:01:02
75000 -- (-496.125) [-496.697] (-501.756) (-495.217) * (-495.510) [-495.228] (-496.386) (-497.569) -- 0:01:01
Average standard deviation of split frequencies: 0.035976
75500 -- (-497.755) [-495.556] (-498.140) (-498.976) * (-496.076) [-496.913] (-497.691) (-496.437) -- 0:01:01
76000 -- (-501.623) (-496.443) (-494.843) [-496.967] * (-503.254) (-494.829) [-497.918] (-496.591) -- 0:01:00
76500 -- (-497.659) [-495.795] (-495.353) (-495.853) * (-499.350) [-494.508] (-499.859) (-497.417) -- 0:01:00
77000 -- (-498.547) (-498.176) (-497.790) [-495.473] * (-496.276) (-495.010) [-495.231] (-496.849) -- 0:00:59
77500 -- (-501.222) (-498.692) (-495.049) [-496.458] * (-496.281) (-495.762) [-494.720] (-497.840) -- 0:00:59
78000 -- (-495.629) (-497.162) [-496.005] (-500.598) * (-495.686) (-494.772) (-498.297) [-500.468] -- 0:00:59
78500 -- (-497.519) (-496.189) [-495.613] (-496.286) * (-496.871) (-496.161) [-498.133] (-495.257) -- 0:00:58
79000 -- (-495.557) (-500.144) [-496.232] (-498.499) * (-496.416) (-498.178) (-501.732) [-495.176] -- 0:00:58
79500 -- [-495.470] (-497.031) (-494.510) (-494.686) * (-495.415) [-498.760] (-501.714) (-495.132) -- 0:00:57
80000 -- (-495.567) (-498.992) [-495.058] (-497.205) * (-497.627) (-497.817) [-495.818] (-495.736) -- 0:00:57
Average standard deviation of split frequencies: 0.036909
80500 -- (-497.143) (-497.607) [-494.856] (-495.122) * [-498.272] (-498.030) (-494.534) (-497.094) -- 0:00:57
81000 -- [-496.823] (-495.965) (-498.581) (-495.614) * (-498.454) [-498.681] (-497.208) (-498.256) -- 0:00:56
81500 -- (-495.336) (-498.389) (-499.345) [-495.510] * [-495.064] (-497.847) (-495.738) (-501.918) -- 0:00:56
82000 -- (-495.542) [-495.304] (-495.754) (-499.086) * (-495.395) (-500.611) (-497.285) [-496.929] -- 0:00:55
82500 -- [-498.521] (-497.954) (-496.407) (-495.349) * (-494.965) (-499.004) [-495.524] (-495.537) -- 0:00:55
83000 -- [-495.947] (-496.272) (-495.418) (-497.018) * (-495.635) [-494.194] (-494.572) (-495.448) -- 0:00:55
83500 -- [-495.526] (-497.971) (-496.774) (-496.723) * [-494.994] (-495.760) (-502.148) (-497.666) -- 0:00:54
84000 -- [-495.347] (-499.339) (-498.236) (-494.903) * [-496.294] (-496.228) (-497.881) (-500.548) -- 0:00:54
84500 -- [-495.253] (-499.512) (-496.551) (-495.815) * [-498.309] (-497.244) (-495.229) (-497.428) -- 0:00:54
85000 -- [-495.213] (-499.647) (-497.189) (-496.517) * (-494.695) (-499.836) [-496.120] (-497.051) -- 0:00:53
Average standard deviation of split frequencies: 0.035629
85500 -- (-501.269) (-499.065) [-496.228] (-499.872) * (-500.514) (-503.824) (-495.979) [-494.446] -- 0:00:53
86000 -- (-496.297) (-498.033) [-495.757] (-500.911) * (-495.835) (-498.182) (-495.952) [-494.775] -- 0:01:03
86500 -- [-496.084] (-495.355) (-495.690) (-496.688) * (-496.187) (-496.447) (-497.323) [-495.360] -- 0:01:03
87000 -- (-499.104) (-499.325) (-497.869) [-497.330] * [-494.934] (-496.854) (-494.909) (-496.504) -- 0:01:02
87500 -- (-496.560) [-499.497] (-497.712) (-497.984) * (-494.826) (-497.417) (-494.845) [-499.246] -- 0:01:02
88000 -- [-495.963] (-496.593) (-497.217) (-495.335) * [-497.752] (-495.730) (-495.458) (-504.595) -- 0:01:02
88500 -- (-494.693) (-496.565) [-495.358] (-505.851) * (-499.954) [-498.118] (-495.030) (-495.961) -- 0:01:01
89000 -- [-494.619] (-495.044) (-496.823) (-499.268) * (-499.326) (-495.330) (-495.768) [-498.280] -- 0:01:01
89500 -- [-496.011] (-494.494) (-494.817) (-498.719) * [-496.896] (-496.814) (-495.165) (-496.858) -- 0:01:01
90000 -- (-502.816) (-497.063) (-495.525) [-495.616] * (-495.408) (-494.512) [-498.156] (-498.024) -- 0:01:00
Average standard deviation of split frequencies: 0.033385
90500 -- (-497.476) [-494.690] (-495.748) (-499.317) * [-496.476] (-497.669) (-496.343) (-498.618) -- 0:01:00
91000 -- (-495.498) (-497.716) (-499.065) [-495.773] * (-499.388) (-499.446) (-496.122) [-499.116] -- 0:00:59
91500 -- (-495.113) (-495.147) (-499.138) [-494.696] * (-497.771) (-495.091) (-495.635) [-496.774] -- 0:00:59
92000 -- (-500.238) [-495.255] (-496.849) (-497.527) * (-495.668) (-494.912) [-495.506] (-496.089) -- 0:00:59
92500 -- (-496.778) [-494.679] (-497.601) (-497.355) * (-496.195) [-494.811] (-499.324) (-499.511) -- 0:00:58
93000 -- [-498.697] (-494.537) (-495.655) (-495.443) * [-496.538] (-494.960) (-498.872) (-495.783) -- 0:00:58
93500 -- (-499.237) (-495.349) (-495.947) [-495.769] * (-503.968) (-494.588) (-496.896) [-496.242] -- 0:00:58
94000 -- (-496.388) (-497.365) [-496.725] (-495.967) * (-498.257) (-494.453) (-498.533) [-498.754] -- 0:00:57
94500 -- (-498.066) [-496.455] (-495.531) (-495.418) * (-499.716) [-495.541] (-496.995) (-496.899) -- 0:00:57
95000 -- (-502.250) (-495.000) (-498.028) [-495.305] * (-495.482) [-496.894] (-496.326) (-495.958) -- 0:00:57
Average standard deviation of split frequencies: 0.030008
95500 -- (-496.193) (-496.966) (-495.693) [-496.448] * [-495.827] (-498.266) (-497.902) (-495.247) -- 0:00:56
96000 -- (-494.802) (-498.323) (-495.449) [-495.785] * (-496.441) (-495.207) [-494.920] (-494.593) -- 0:00:56
96500 -- (-498.080) (-496.741) [-496.203] (-496.094) * (-497.185) (-495.613) (-499.673) [-494.686] -- 0:00:56
97000 -- (-499.302) [-496.037] (-494.646) (-496.224) * (-496.174) (-500.547) [-495.445] (-496.841) -- 0:00:55
97500 -- (-496.702) [-494.570] (-495.522) (-496.255) * [-499.424] (-497.753) (-497.449) (-495.162) -- 0:00:55
98000 -- (-497.619) (-497.476) [-495.659] (-501.184) * (-496.060) [-498.129] (-495.550) (-495.238) -- 0:00:55
98500 -- (-497.502) (-497.476) [-495.727] (-495.731) * (-496.356) [-498.422] (-494.726) (-496.234) -- 0:00:54
99000 -- (-497.746) (-498.763) [-499.840] (-496.865) * [-494.868] (-497.882) (-498.881) (-496.931) -- 0:00:54
99500 -- (-497.468) (-495.415) (-498.303) [-495.362] * [-495.632] (-495.577) (-498.675) (-496.887) -- 0:00:54
100000 -- (-498.373) (-496.876) [-496.575] (-494.666) * [-497.115] (-501.607) (-495.135) (-494.911) -- 0:00:54
Average standard deviation of split frequencies: 0.027358
100500 -- [-496.748] (-498.521) (-498.241) (-495.877) * [-495.358] (-501.423) (-495.689) (-497.797) -- 0:01:02
101000 -- (-495.336) (-501.838) (-496.059) [-498.804] * [-496.797] (-495.038) (-495.674) (-500.527) -- 0:01:02
101500 -- (-501.224) (-497.045) [-494.590] (-497.677) * (-495.436) (-499.677) (-496.405) [-494.913] -- 0:01:01
102000 -- (-497.861) [-495.399] (-494.759) (-497.881) * (-499.143) (-494.455) [-496.972] (-496.953) -- 0:01:01
102500 -- [-494.894] (-495.744) (-498.562) (-496.615) * (-498.272) (-496.932) [-495.876] (-495.764) -- 0:01:01
103000 -- (-497.079) (-496.892) [-496.484] (-496.447) * [-495.939] (-497.025) (-494.956) (-496.455) -- 0:01:00
103500 -- (-498.213) (-499.250) [-494.596] (-495.865) * (-496.835) [-498.350] (-497.112) (-494.927) -- 0:01:00
104000 -- (-496.497) [-496.297] (-497.806) (-498.984) * [-496.820] (-494.698) (-494.353) (-495.720) -- 0:01:00
104500 -- (-496.684) [-497.185] (-497.546) (-497.653) * (-496.096) (-496.095) [-495.299] (-498.727) -- 0:00:59
105000 -- (-494.858) (-494.664) [-498.797] (-495.368) * [-495.183] (-497.424) (-501.124) (-495.647) -- 0:00:59
Average standard deviation of split frequencies: 0.025747
105500 -- (-495.115) (-494.381) (-499.130) [-495.208] * (-495.878) (-498.057) (-496.925) [-494.773] -- 0:00:59
106000 -- [-496.869] (-497.634) (-496.102) (-495.078) * [-496.335] (-499.245) (-497.328) (-495.096) -- 0:00:59
106500 -- (-495.543) (-495.968) [-496.313] (-497.226) * (-499.464) (-496.312) [-495.169] (-495.066) -- 0:00:58
107000 -- [-496.336] (-497.229) (-495.172) (-496.740) * [-495.604] (-497.738) (-497.564) (-495.346) -- 0:00:58
107500 -- [-494.993] (-496.876) (-495.929) (-496.169) * (-499.064) [-500.493] (-498.330) (-497.307) -- 0:00:58
108000 -- (-498.196) (-497.547) (-497.662) [-495.334] * [-494.608] (-494.808) (-498.337) (-501.313) -- 0:00:57
108500 -- (-495.210) (-496.838) (-497.551) [-495.370] * (-498.155) (-496.915) [-497.264] (-495.468) -- 0:00:57
109000 -- (-496.582) (-497.155) (-494.844) [-496.032] * (-495.894) (-499.795) (-495.839) [-495.542] -- 0:00:57
109500 -- (-497.190) (-497.134) [-495.853] (-497.044) * [-496.644] (-496.875) (-497.436) (-495.475) -- 0:00:56
110000 -- (-497.089) (-497.819) [-496.093] (-498.663) * (-496.140) [-496.343] (-498.673) (-497.263) -- 0:00:56
Average standard deviation of split frequencies: 0.023804
110500 -- [-496.215] (-496.411) (-498.286) (-497.053) * (-498.438) [-497.143] (-495.928) (-496.386) -- 0:00:56
111000 -- [-496.082] (-496.612) (-495.322) (-499.223) * [-495.753] (-497.180) (-497.526) (-496.393) -- 0:00:56
111500 -- (-497.894) (-497.102) [-498.566] (-497.461) * (-494.200) [-497.998] (-497.836) (-497.111) -- 0:00:55
112000 -- (-498.616) [-500.027] (-495.832) (-497.593) * (-497.418) (-498.637) (-495.733) [-497.123] -- 0:00:55
112500 -- (-499.170) (-496.658) (-496.804) [-501.644] * (-497.423) [-496.429] (-499.079) (-498.097) -- 0:00:55
113000 -- (-496.774) (-498.628) (-497.008) [-497.418] * [-496.571] (-496.525) (-495.402) (-494.336) -- 0:00:54
113500 -- (-495.954) [-496.900] (-495.685) (-495.080) * [-497.095] (-497.998) (-496.528) (-495.478) -- 0:00:54
114000 -- [-495.507] (-497.672) (-500.995) (-495.152) * (-498.782) (-495.296) (-496.371) [-495.887] -- 0:00:54
114500 -- (-498.805) (-498.366) (-496.945) [-495.762] * (-500.576) (-497.157) [-494.848] (-495.887) -- 0:00:54
115000 -- [-496.357] (-500.943) (-496.394) (-497.017) * (-496.008) (-494.776) [-496.194] (-494.946) -- 0:01:01
Average standard deviation of split frequencies: 0.023480
115500 -- (-498.836) (-494.563) (-495.798) [-498.497] * (-496.876) (-494.787) (-498.531) [-496.697] -- 0:01:01
116000 -- [-501.819] (-496.271) (-495.178) (-495.651) * (-496.882) (-495.173) (-496.610) [-496.767] -- 0:01:00
116500 -- (-499.185) [-496.421] (-494.809) (-499.897) * (-494.787) (-496.958) [-496.110] (-496.337) -- 0:01:00
117000 -- (-494.583) (-495.072) (-495.018) [-495.954] * [-495.359] (-504.353) (-496.274) (-495.031) -- 0:01:00
117500 -- (-495.224) (-499.923) (-497.046) [-495.190] * (-503.197) (-496.759) (-495.587) [-494.684] -- 0:01:00
118000 -- (-496.244) (-494.775) [-494.209] (-496.153) * [-496.404] (-495.629) (-498.664) (-497.070) -- 0:00:59
118500 -- (-494.945) [-494.477] (-495.295) (-496.465) * (-496.981) (-498.049) [-496.420] (-494.459) -- 0:00:59
119000 -- [-496.142] (-495.674) (-495.067) (-496.859) * [-497.653] (-496.744) (-496.897) (-495.453) -- 0:00:59
119500 -- [-501.498] (-496.064) (-497.904) (-498.403) * [-500.362] (-499.691) (-495.324) (-494.752) -- 0:00:58
120000 -- (-495.793) (-495.755) (-497.621) [-498.516] * (-495.932) (-498.865) (-497.381) [-494.623] -- 0:00:58
Average standard deviation of split frequencies: 0.024589
120500 -- (-495.263) (-495.825) [-497.517] (-496.998) * (-495.152) (-497.293) [-495.675] (-497.078) -- 0:00:58
121000 -- (-495.184) (-496.013) [-498.132] (-499.641) * (-495.552) (-495.942) [-496.626] (-494.901) -- 0:00:58
121500 -- (-496.277) (-497.722) [-498.617] (-495.219) * (-495.145) [-495.429] (-498.782) (-495.288) -- 0:00:57
122000 -- (-497.104) (-494.974) [-498.621] (-494.654) * (-497.913) (-502.135) (-496.789) [-495.498] -- 0:00:57
122500 -- (-497.751) [-497.574] (-496.162) (-496.155) * (-496.249) [-496.470] (-495.123) (-495.107) -- 0:00:57
123000 -- (-502.618) [-496.096] (-499.177) (-499.365) * (-495.739) [-496.788] (-497.211) (-496.631) -- 0:00:57
123500 -- [-496.874] (-497.117) (-500.726) (-496.689) * (-496.547) (-498.023) [-499.760] (-503.552) -- 0:00:56
124000 -- (-495.198) (-497.823) [-499.521] (-495.706) * [-495.001] (-498.287) (-500.527) (-501.430) -- 0:00:56
124500 -- (-497.905) (-496.434) (-496.362) [-496.753] * (-494.844) (-495.257) [-495.794] (-499.632) -- 0:00:56
125000 -- [-495.319] (-497.650) (-498.290) (-496.178) * (-496.652) (-499.530) [-495.708] (-497.250) -- 0:00:56
Average standard deviation of split frequencies: 0.026189
125500 -- (-496.126) (-495.242) (-495.449) [-496.992] * (-497.196) (-497.531) [-495.002] (-499.917) -- 0:00:55
126000 -- (-497.596) (-498.679) (-496.286) [-496.194] * (-495.576) (-496.944) [-495.601] (-500.375) -- 0:00:55
126500 -- (-497.655) [-496.351] (-497.311) (-497.850) * [-494.601] (-497.905) (-495.847) (-494.870) -- 0:00:55
127000 -- (-495.041) (-495.371) [-496.424] (-497.078) * (-496.463) (-495.245) [-496.451] (-495.175) -- 0:00:54
127500 -- [-496.424] (-497.734) (-497.342) (-498.046) * (-495.474) (-499.277) (-499.960) [-495.393] -- 0:00:54
128000 -- (-495.669) (-498.687) (-502.659) [-496.511] * (-498.424) (-494.656) (-498.180) [-496.728] -- 0:00:54
128500 -- (-495.038) [-500.127] (-496.504) (-497.764) * (-499.830) (-497.840) (-495.844) [-496.811] -- 0:00:54
129000 -- (-498.830) (-497.195) (-496.523) [-495.648] * (-496.804) (-501.566) [-496.420] (-497.274) -- 0:00:54
129500 -- [-499.023] (-498.283) (-495.561) (-497.052) * (-498.738) (-494.908) [-498.500] (-500.837) -- 0:01:00
130000 -- (-497.965) [-494.873] (-495.374) (-494.487) * (-494.449) (-495.406) [-497.956] (-497.065) -- 0:01:00
Average standard deviation of split frequencies: 0.026857
130500 -- [-496.718] (-499.238) (-497.784) (-499.208) * (-496.593) (-495.405) (-500.188) [-496.497] -- 0:00:59
131000 -- (-495.938) (-499.021) [-495.236] (-495.437) * (-496.100) [-495.650] (-499.766) (-498.877) -- 0:00:59
131500 -- (-498.545) (-504.825) [-497.954] (-497.585) * (-497.328) (-500.303) (-496.085) [-497.711] -- 0:00:59
132000 -- (-496.142) (-495.931) [-495.633] (-500.603) * (-498.017) (-496.416) [-495.288] (-497.188) -- 0:00:59
132500 -- (-495.196) [-496.011] (-495.252) (-499.545) * [-496.439] (-496.452) (-494.467) (-496.335) -- 0:00:58
133000 -- [-497.189] (-495.723) (-495.459) (-498.295) * [-497.786] (-500.062) (-495.607) (-497.860) -- 0:00:58
133500 -- (-495.414) (-495.240) [-494.707] (-497.043) * (-498.643) (-496.211) (-496.181) [-495.856] -- 0:00:58
134000 -- (-498.628) (-495.806) (-496.298) [-495.489] * (-497.396) (-499.648) [-496.081] (-496.321) -- 0:00:58
134500 -- (-499.882) (-500.570) (-496.116) [-495.170] * (-496.551) [-495.085] (-496.311) (-496.190) -- 0:00:57
135000 -- (-501.956) (-496.636) (-501.716) [-494.957] * (-495.634) (-496.418) [-496.532] (-500.327) -- 0:00:57
Average standard deviation of split frequencies: 0.024071
135500 -- [-501.847] (-497.838) (-498.738) (-497.583) * [-497.314] (-495.863) (-497.431) (-494.696) -- 0:00:57
136000 -- (-494.538) (-498.236) (-498.193) [-496.745] * (-495.925) (-498.142) [-496.184] (-495.141) -- 0:00:57
136500 -- [-496.436] (-499.001) (-497.760) (-498.630) * [-495.960] (-496.774) (-496.639) (-494.771) -- 0:00:56
137000 -- (-495.619) [-495.694] (-499.278) (-496.659) * (-498.620) (-498.063) (-495.471) [-497.080] -- 0:00:56
137500 -- (-498.532) (-496.026) (-496.116) [-494.877] * (-496.468) (-497.625) [-499.558] (-502.398) -- 0:00:56
138000 -- (-498.502) (-496.087) [-496.825] (-496.659) * (-496.275) (-496.704) (-496.999) [-498.600] -- 0:00:56
138500 -- (-497.904) (-495.674) (-496.190) [-497.692] * (-497.750) [-497.930] (-497.952) (-498.916) -- 0:00:55
139000 -- (-495.742) (-496.166) (-496.927) [-496.096] * (-495.996) (-499.070) (-506.877) [-497.437] -- 0:00:55
139500 -- (-496.336) [-494.599] (-499.587) (-497.283) * [-496.551] (-498.150) (-497.178) (-498.353) -- 0:00:55
140000 -- (-496.815) (-497.188) (-496.624) [-498.585] * [-496.143] (-496.783) (-496.483) (-497.162) -- 0:00:55
Average standard deviation of split frequencies: 0.023459
140500 -- [-495.596] (-501.210) (-496.780) (-501.790) * (-495.719) (-495.974) (-497.044) [-496.305] -- 0:00:55
141000 -- (-495.623) (-498.778) (-494.823) [-498.394] * (-495.734) (-495.609) [-496.590] (-496.571) -- 0:00:54
141500 -- (-495.437) (-500.863) (-497.043) [-497.176] * (-496.356) (-498.101) [-495.779] (-496.368) -- 0:00:54
142000 -- (-496.781) (-495.018) (-496.454) [-497.501] * (-496.386) (-499.442) [-495.492] (-495.588) -- 0:00:54
142500 -- [-499.891] (-496.112) (-496.520) (-496.839) * (-495.213) (-498.241) (-498.084) [-498.382] -- 0:00:54
143000 -- [-495.307] (-497.533) (-497.329) (-497.381) * (-495.020) [-498.248] (-495.278) (-502.524) -- 0:00:53
143500 -- (-495.369) (-500.415) [-496.917] (-495.666) * (-495.675) [-495.421] (-499.254) (-497.045) -- 0:00:59
144000 -- (-494.659) (-497.957) (-498.297) [-496.055] * (-498.050) [-495.452] (-495.640) (-496.775) -- 0:00:59
144500 -- (-495.387) (-499.272) (-497.830) [-494.777] * (-497.873) (-494.771) [-496.377] (-495.375) -- 0:00:59
145000 -- (-499.201) (-499.979) [-497.867] (-497.384) * (-497.221) (-497.268) (-498.765) [-495.667] -- 0:00:58
Average standard deviation of split frequencies: 0.022063
145500 -- (-500.228) [-496.653] (-496.662) (-500.620) * [-495.505] (-496.523) (-497.875) (-497.603) -- 0:00:58
146000 -- (-501.029) (-498.088) [-497.628] (-500.912) * (-496.965) (-498.008) [-497.764] (-496.995) -- 0:00:58
146500 -- [-497.594] (-499.238) (-500.323) (-503.615) * (-496.373) (-497.549) (-500.509) [-495.755] -- 0:00:58
147000 -- (-495.951) (-497.809) [-495.255] (-497.451) * (-498.196) (-497.583) [-500.115] (-494.769) -- 0:00:58
147500 -- (-497.294) [-497.056] (-498.638) (-497.276) * (-495.607) [-498.607] (-495.154) (-496.832) -- 0:00:57
148000 -- [-495.247] (-498.639) (-496.621) (-495.386) * (-498.046) [-499.182] (-497.473) (-501.445) -- 0:00:57
148500 -- (-495.702) [-494.534] (-499.868) (-495.116) * (-500.356) (-496.491) (-494.967) [-501.968] -- 0:00:57
149000 -- (-498.527) (-497.718) [-497.132] (-499.615) * (-495.969) (-496.943) [-497.289] (-495.074) -- 0:00:57
149500 -- (-495.913) [-496.676] (-499.981) (-500.189) * [-495.975] (-495.317) (-495.178) (-501.353) -- 0:00:56
150000 -- (-497.025) (-496.349) (-494.798) [-498.265] * (-495.916) (-496.894) (-496.889) [-501.215] -- 0:00:56
Average standard deviation of split frequencies: 0.020429
150500 -- (-496.328) (-495.235) (-495.031) [-496.423] * [-497.495] (-496.169) (-497.049) (-496.665) -- 0:00:56
151000 -- (-498.212) (-497.665) (-495.745) [-497.397] * [-500.684] (-500.465) (-496.063) (-502.938) -- 0:00:56
151500 -- (-498.828) (-496.227) (-495.957) [-499.590] * (-496.593) (-498.673) (-496.748) [-497.878] -- 0:00:56
152000 -- (-498.354) (-497.303) [-495.992] (-497.156) * (-498.221) [-495.763] (-495.457) (-497.874) -- 0:00:55
152500 -- [-495.847] (-496.804) (-498.743) (-497.098) * [-497.319] (-495.059) (-496.426) (-498.859) -- 0:00:55
153000 -- (-495.146) (-502.171) (-498.281) [-498.239] * [-497.230] (-501.082) (-496.970) (-495.702) -- 0:00:55
153500 -- (-497.821) (-496.950) [-497.638] (-499.575) * [-498.569] (-499.310) (-496.212) (-497.587) -- 0:00:55
154000 -- (-496.216) (-497.225) [-498.794] (-497.244) * (-496.877) (-496.069) (-497.365) [-495.580] -- 0:00:54
154500 -- (-499.362) (-498.370) (-502.196) [-496.031] * (-496.492) (-496.905) [-495.035] (-495.708) -- 0:00:54
155000 -- (-496.615) (-496.305) (-496.490) [-495.641] * (-498.475) [-496.954] (-496.382) (-495.730) -- 0:00:54
Average standard deviation of split frequencies: 0.019197
155500 -- (-499.023) (-498.646) (-497.618) [-496.843] * (-497.258) (-497.197) (-496.143) [-495.887] -- 0:00:54
156000 -- (-497.652) (-497.827) (-494.924) [-495.859] * (-494.871) (-496.953) (-498.307) [-498.292] -- 0:00:54
156500 -- [-495.742] (-496.491) (-498.636) (-494.320) * (-497.008) (-497.599) (-497.330) [-495.680] -- 0:00:53
157000 -- [-495.283] (-499.379) (-496.192) (-497.181) * [-496.354] (-498.158) (-497.903) (-500.779) -- 0:00:53
157500 -- (-499.339) [-495.841] (-496.277) (-496.485) * [-494.954] (-495.852) (-496.703) (-495.947) -- 0:00:53
158000 -- (-494.584) (-495.356) (-499.227) [-499.429] * (-497.323) (-495.120) (-494.711) [-495.549] -- 0:00:58
158500 -- (-499.585) (-497.302) (-496.341) [-496.902] * (-499.097) [-494.855] (-496.000) (-495.240) -- 0:00:58
159000 -- (-495.033) (-496.194) (-497.400) [-498.338] * [-494.865] (-495.715) (-494.972) (-500.972) -- 0:00:58
159500 -- (-496.748) (-496.752) [-497.783] (-499.943) * (-497.384) (-494.928) (-499.214) [-498.200] -- 0:00:57
160000 -- (-495.919) (-495.632) (-498.728) [-498.894] * (-497.179) (-496.333) [-498.280] (-499.734) -- 0:00:57
Average standard deviation of split frequencies: 0.021401
160500 -- (-495.897) (-496.423) [-495.532] (-497.955) * (-495.394) (-495.833) (-496.062) [-502.570] -- 0:00:57
161000 -- [-494.525] (-496.705) (-494.740) (-497.126) * [-497.290] (-500.894) (-498.752) (-494.405) -- 0:00:57
161500 -- (-498.404) (-494.944) (-494.902) [-496.739] * (-496.369) (-499.431) (-495.910) [-497.070] -- 0:00:57
162000 -- (-500.480) (-496.371) (-499.258) [-496.735] * [-497.085] (-496.461) (-495.563) (-495.227) -- 0:00:56
162500 -- [-498.842] (-498.730) (-498.096) (-496.717) * (-498.351) [-496.658] (-495.378) (-495.115) -- 0:00:56
163000 -- [-495.766] (-497.216) (-499.406) (-496.779) * [-494.556] (-496.124) (-495.068) (-495.955) -- 0:00:56
163500 -- (-500.442) (-496.432) (-498.723) [-500.331] * (-496.492) (-497.235) (-496.372) [-497.051] -- 0:00:56
164000 -- (-501.006) (-497.819) (-495.856) [-497.605] * [-497.394] (-497.408) (-495.472) (-496.640) -- 0:00:56
164500 -- [-500.711] (-497.546) (-497.732) (-494.481) * (-495.561) (-495.801) (-497.242) [-494.445] -- 0:00:55
165000 -- (-496.069) [-497.269] (-497.767) (-496.979) * (-499.155) [-496.906] (-494.806) (-495.678) -- 0:00:55
Average standard deviation of split frequencies: 0.019090
165500 -- (-496.050) [-498.772] (-503.407) (-496.347) * [-497.671] (-495.129) (-495.846) (-495.883) -- 0:00:55
166000 -- (-496.368) (-496.771) [-495.965] (-497.353) * (-498.166) (-494.280) (-499.484) [-496.148] -- 0:00:55
166500 -- (-497.147) (-496.136) [-495.009] (-494.544) * (-500.443) (-495.180) (-497.335) [-495.991] -- 0:00:55
167000 -- (-495.112) (-496.801) [-496.970] (-497.346) * (-505.698) (-496.140) [-496.621] (-497.512) -- 0:00:54
167500 -- [-498.805] (-494.613) (-499.657) (-495.993) * (-494.569) [-499.925] (-496.065) (-497.649) -- 0:00:54
168000 -- (-494.263) (-500.204) (-494.786) [-495.063] * [-494.871] (-495.891) (-497.953) (-496.046) -- 0:00:54
168500 -- (-494.251) (-497.927) (-497.379) [-498.252] * [-494.728] (-496.596) (-495.983) (-496.626) -- 0:00:54
169000 -- (-497.203) (-495.504) [-495.350] (-496.926) * [-497.581] (-497.910) (-496.606) (-497.727) -- 0:00:54
169500 -- (-502.727) [-498.531] (-496.552) (-496.543) * [-496.389] (-497.563) (-495.411) (-496.341) -- 0:00:53
170000 -- [-494.942] (-497.879) (-496.634) (-495.476) * (-495.938) (-495.938) [-498.565] (-494.172) -- 0:00:53
Average standard deviation of split frequencies: 0.018875
170500 -- (-496.679) (-496.141) (-495.305) [-495.480] * (-496.749) (-495.823) (-497.174) [-494.431] -- 0:00:53
171000 -- [-496.376] (-495.761) (-496.568) (-495.981) * (-496.863) [-495.414] (-495.776) (-500.667) -- 0:00:53
171500 -- (-496.379) (-496.413) (-496.240) [-495.246] * (-497.665) [-498.144] (-496.327) (-495.273) -- 0:00:53
172000 -- [-497.343] (-496.069) (-495.639) (-495.653) * [-496.146] (-500.724) (-497.156) (-498.742) -- 0:00:52
172500 -- (-499.322) (-495.478) [-495.182] (-495.046) * (-499.290) (-496.798) [-498.053] (-501.037) -- 0:00:57
173000 -- (-501.485) [-499.042] (-496.710) (-496.505) * (-496.500) [-495.465] (-496.638) (-495.722) -- 0:00:57
173500 -- (-497.220) (-498.896) [-494.372] (-496.449) * [-496.684] (-500.040) (-497.090) (-495.724) -- 0:00:57
174000 -- (-497.297) [-497.452] (-496.051) (-495.867) * (-499.292) [-495.606] (-498.742) (-496.015) -- 0:00:56
174500 -- (-497.341) (-495.615) (-495.902) [-494.543] * (-496.246) (-497.084) (-497.474) [-497.998] -- 0:00:56
175000 -- (-498.105) [-495.058] (-496.041) (-502.557) * (-498.737) (-497.602) [-499.615] (-496.404) -- 0:00:56
Average standard deviation of split frequencies: 0.016963
175500 -- (-496.979) (-495.325) [-495.638] (-494.777) * (-497.272) (-499.195) (-503.210) [-496.134] -- 0:00:56
176000 -- [-496.004] (-495.612) (-496.374) (-505.256) * [-494.997] (-495.969) (-499.834) (-498.752) -- 0:00:56
176500 -- [-495.035] (-496.273) (-495.104) (-496.395) * (-494.566) (-495.748) [-501.733] (-497.557) -- 0:00:55
177000 -- [-496.450] (-495.655) (-495.000) (-495.202) * [-496.686] (-496.459) (-502.508) (-496.750) -- 0:00:55
177500 -- [-496.628] (-496.048) (-495.254) (-500.027) * (-495.234) [-495.478] (-495.384) (-500.224) -- 0:00:55
178000 -- (-495.911) [-494.817] (-497.304) (-497.082) * (-497.378) (-496.514) [-496.218] (-497.777) -- 0:00:55
178500 -- (-496.004) [-496.180] (-498.573) (-498.238) * (-501.628) (-495.436) [-496.282] (-499.737) -- 0:00:55
179000 -- (-496.657) [-503.287] (-495.118) (-495.768) * (-504.089) [-494.673] (-494.330) (-496.145) -- 0:00:55
179500 -- [-496.122] (-498.732) (-495.009) (-497.097) * (-499.959) (-495.984) [-495.759] (-495.665) -- 0:00:54
180000 -- (-495.262) [-494.691] (-495.929) (-501.337) * (-495.011) [-495.172] (-497.865) (-495.257) -- 0:00:54
Average standard deviation of split frequencies: 0.018265
180500 -- (-494.816) (-496.644) (-495.910) [-498.520] * (-496.231) [-494.418] (-497.667) (-495.821) -- 0:00:54
181000 -- (-497.624) (-500.768) (-497.183) [-496.345] * (-498.116) [-496.610] (-496.560) (-496.368) -- 0:00:54
181500 -- (-500.378) (-501.809) [-496.242] (-496.050) * (-499.648) (-496.973) [-499.116] (-496.074) -- 0:00:54
182000 -- (-498.001) (-496.364) [-495.885] (-496.250) * (-498.430) (-497.794) [-495.573] (-495.465) -- 0:00:53
182500 -- (-496.129) [-495.395] (-496.375) (-495.918) * [-497.382] (-496.817) (-497.441) (-497.638) -- 0:00:53
183000 -- (-499.072) (-497.983) (-499.331) [-496.034] * [-497.248] (-504.655) (-494.543) (-496.980) -- 0:00:53
183500 -- (-499.867) (-495.706) (-494.966) [-496.273] * [-496.734] (-495.311) (-494.658) (-496.678) -- 0:00:53
184000 -- (-494.347) (-495.752) [-494.958] (-496.901) * [-495.563] (-495.123) (-495.485) (-498.728) -- 0:00:53
184500 -- [-498.611] (-495.399) (-499.397) (-495.686) * (-495.443) [-495.435] (-495.516) (-495.465) -- 0:00:53
185000 -- (-495.861) [-496.077] (-497.125) (-497.097) * [-495.266] (-495.875) (-496.810) (-494.784) -- 0:00:52
Average standard deviation of split frequencies: 0.017890
185500 -- (-497.926) [-495.803] (-496.438) (-498.146) * [-495.920] (-495.552) (-495.106) (-497.381) -- 0:00:52
186000 -- (-497.958) (-494.400) (-498.150) [-495.728] * (-495.706) (-496.242) [-498.129] (-495.571) -- 0:00:52
186500 -- [-501.269] (-496.175) (-499.061) (-496.338) * (-498.595) [-495.227] (-498.184) (-495.196) -- 0:00:56
187000 -- (-496.525) (-495.530) [-496.820] (-496.617) * (-498.059) [-494.534] (-496.439) (-494.970) -- 0:00:56
187500 -- [-497.034] (-499.724) (-496.748) (-494.982) * (-494.659) [-496.529] (-498.500) (-498.545) -- 0:00:56
188000 -- (-496.724) (-496.919) (-496.856) [-495.127] * (-494.493) [-496.968] (-499.508) (-498.121) -- 0:00:56
188500 -- (-495.595) (-494.875) (-495.577) [-494.923] * [-496.937] (-499.982) (-499.801) (-497.508) -- 0:00:55
189000 -- (-497.292) (-495.139) (-496.456) [-494.934] * (-497.042) (-496.644) [-497.357] (-496.306) -- 0:00:55
189500 -- (-496.408) (-494.444) (-496.681) [-495.305] * (-496.038) [-496.595] (-499.472) (-497.709) -- 0:00:55
190000 -- (-497.612) (-497.126) (-501.808) [-494.749] * (-497.206) [-497.827] (-496.950) (-497.482) -- 0:00:55
Average standard deviation of split frequencies: 0.017161
190500 -- (-497.909) (-495.996) [-497.614] (-497.047) * (-495.178) (-496.963) (-495.280) [-498.683] -- 0:00:55
191000 -- [-496.212] (-494.869) (-497.325) (-497.895) * (-495.689) (-497.011) (-500.800) [-497.003] -- 0:00:55
191500 -- (-496.143) (-494.988) (-498.043) [-498.629] * (-498.205) (-499.377) (-498.411) [-496.944] -- 0:00:54
192000 -- (-500.175) (-497.069) (-496.339) [-497.473] * (-495.609) (-496.317) [-496.612] (-495.254) -- 0:00:54
192500 -- (-496.790) (-500.141) [-497.772] (-497.743) * (-498.633) [-494.836] (-496.542) (-495.414) -- 0:00:54
193000 -- [-497.620] (-497.730) (-499.679) (-494.631) * (-498.445) [-495.787] (-497.313) (-495.870) -- 0:00:54
193500 -- (-495.893) (-497.818) (-499.826) [-494.874] * (-496.674) (-495.522) (-497.664) [-496.034] -- 0:00:54
194000 -- (-496.141) (-500.777) (-495.098) [-496.416] * (-495.685) (-497.495) (-499.162) [-495.686] -- 0:00:54
194500 -- (-500.333) (-503.316) (-497.988) [-495.379] * (-498.399) (-496.350) (-500.984) [-496.496] -- 0:00:53
195000 -- [-499.458] (-508.205) (-495.426) (-496.105) * [-498.352] (-497.366) (-497.562) (-495.735) -- 0:00:53
Average standard deviation of split frequencies: 0.017437
195500 -- (-501.603) (-495.623) (-495.689) [-497.086] * [-496.439] (-497.749) (-496.832) (-494.604) -- 0:00:53
196000 -- (-495.156) [-499.067] (-495.759) (-495.311) * (-499.490) (-497.683) (-496.532) [-495.763] -- 0:00:53
196500 -- (-494.828) (-497.894) (-496.959) [-495.856] * (-499.584) (-499.672) [-499.081] (-495.563) -- 0:00:53
197000 -- (-496.507) [-495.364] (-496.365) (-495.685) * (-495.258) (-502.548) [-496.541] (-495.549) -- 0:00:52
197500 -- (-495.148) (-498.741) [-498.187] (-498.604) * (-497.274) (-496.887) [-495.803] (-496.156) -- 0:00:52
198000 -- (-497.302) [-498.467] (-498.231) (-496.109) * (-500.332) [-496.859] (-495.590) (-496.148) -- 0:00:52
198500 -- [-494.443] (-497.840) (-496.053) (-495.829) * (-494.837) (-497.905) [-496.357] (-499.220) -- 0:00:52
199000 -- [-495.441] (-496.788) (-496.877) (-495.264) * (-496.674) (-495.908) [-497.556] (-498.733) -- 0:00:52
199500 -- [-495.417] (-496.883) (-498.092) (-499.309) * (-496.973) [-496.994] (-496.660) (-496.376) -- 0:00:52
200000 -- (-496.895) [-496.492] (-498.270) (-496.865) * [-496.019] (-496.550) (-499.105) (-495.227) -- 0:00:51
Average standard deviation of split frequencies: 0.016444
200500 -- (-494.853) (-498.581) (-496.647) [-498.418] * (-496.101) [-495.394] (-496.909) (-497.069) -- 0:00:51
201000 -- (-495.140) (-495.764) [-497.463] (-495.560) * (-496.766) [-495.280] (-496.360) (-496.703) -- 0:00:55
201500 -- (-499.634) (-497.557) [-496.465] (-495.629) * (-497.702) (-497.379) [-498.568] (-494.730) -- 0:00:55
202000 -- (-497.925) (-500.053) (-496.598) [-496.256] * [-496.607] (-498.720) (-497.728) (-499.327) -- 0:00:55
202500 -- (-498.057) (-495.508) [-496.513] (-496.788) * [-496.715] (-497.280) (-498.214) (-497.002) -- 0:00:55
203000 -- (-495.856) (-497.952) [-495.639] (-496.810) * (-496.115) (-496.186) (-495.276) [-495.406] -- 0:00:54
203500 -- (-496.188) [-495.996] (-496.062) (-498.134) * [-494.950] (-496.100) (-494.851) (-495.366) -- 0:00:54
204000 -- (-496.335) [-497.723] (-496.019) (-496.050) * [-496.578] (-503.286) (-494.443) (-497.820) -- 0:00:54
204500 -- [-495.728] (-494.877) (-494.660) (-499.445) * [-495.387] (-497.220) (-497.104) (-501.932) -- 0:00:54
205000 -- (-495.772) (-494.856) [-496.009] (-497.568) * (-498.979) (-497.682) (-499.976) [-496.955] -- 0:00:54
Average standard deviation of split frequencies: 0.016422
205500 -- (-495.150) [-498.704] (-497.853) (-497.585) * (-497.380) (-495.149) [-495.661] (-497.871) -- 0:00:54
206000 -- (-496.387) (-500.129) (-496.274) [-499.629] * (-500.271) (-496.276) (-496.355) [-494.469] -- 0:00:53
206500 -- (-497.511) (-498.088) (-496.002) [-496.453] * (-498.743) (-494.677) (-495.484) [-496.360] -- 0:00:53
207000 -- (-497.169) (-496.407) (-498.665) [-498.740] * (-500.171) (-494.800) (-495.211) [-496.471] -- 0:00:53
207500 -- (-496.961) (-496.097) [-498.169] (-494.977) * (-495.161) (-498.965) (-497.361) [-495.051] -- 0:00:53
208000 -- (-496.148) (-496.436) (-495.936) [-495.500] * [-494.943] (-499.329) (-494.768) (-500.548) -- 0:00:53
208500 -- [-494.946] (-498.005) (-495.540) (-496.272) * [-496.309] (-497.447) (-494.768) (-499.742) -- 0:00:53
209000 -- (-495.264) (-497.015) (-495.447) [-495.333] * (-497.768) (-494.579) (-496.728) [-496.376] -- 0:00:52
209500 -- (-498.235) (-495.853) [-498.362] (-495.670) * (-498.387) (-497.930) (-498.223) [-495.263] -- 0:00:52
210000 -- (-496.503) [-494.911] (-495.985) (-496.841) * (-495.852) [-497.242] (-496.994) (-496.028) -- 0:00:52
Average standard deviation of split frequencies: 0.014742
210500 -- (-495.411) (-498.894) (-495.423) [-497.516] * (-495.472) (-495.105) (-496.713) [-497.457] -- 0:00:52
211000 -- [-498.829] (-505.573) (-495.550) (-496.947) * (-498.519) (-494.522) (-496.964) [-495.024] -- 0:00:52
211500 -- (-495.965) [-497.954] (-495.816) (-494.957) * [-499.572] (-496.038) (-494.858) (-496.498) -- 0:00:52
212000 -- (-494.758) (-494.886) [-495.098] (-497.443) * (-496.361) [-497.807] (-495.113) (-497.173) -- 0:00:52
212500 -- (-496.393) (-495.305) (-496.343) [-494.929] * (-500.739) (-497.698) [-501.279] (-495.314) -- 0:00:51
213000 -- (-495.440) (-498.499) (-499.085) [-496.460] * (-500.266) (-504.195) (-497.881) [-496.753] -- 0:00:51
213500 -- (-495.909) [-496.102] (-496.836) (-499.135) * (-495.798) [-496.401] (-500.409) (-496.988) -- 0:00:51
214000 -- (-494.905) [-495.786] (-495.931) (-504.689) * [-494.906] (-500.076) (-500.629) (-498.949) -- 0:00:51
214500 -- (-494.938) [-496.694] (-498.487) (-498.508) * [-494.895] (-495.263) (-498.341) (-496.340) -- 0:00:51
215000 -- (-494.887) [-496.556] (-497.042) (-500.133) * [-496.855] (-495.619) (-494.673) (-495.950) -- 0:00:51
Average standard deviation of split frequencies: 0.014635
215500 -- (-498.058) [-497.567] (-498.389) (-498.457) * (-499.387) (-500.373) (-497.690) [-500.148] -- 0:00:54
216000 -- [-497.170] (-496.566) (-494.671) (-496.266) * (-497.591) (-494.590) (-499.349) [-495.132] -- 0:00:54
216500 -- [-497.197] (-496.138) (-500.869) (-497.376) * [-495.703] (-495.231) (-497.685) (-495.224) -- 0:00:54
217000 -- (-498.010) (-496.528) (-494.818) [-499.125] * [-494.884] (-499.158) (-499.380) (-494.980) -- 0:00:54
217500 -- (-497.177) (-498.405) [-496.405] (-497.293) * (-497.655) (-495.524) (-499.621) [-495.842] -- 0:00:53
218000 -- (-497.077) (-494.746) [-497.580] (-496.215) * [-496.418] (-496.050) (-496.047) (-495.522) -- 0:00:53
218500 -- (-496.143) (-495.153) (-501.385) [-497.927] * (-495.884) (-497.571) [-496.820] (-495.315) -- 0:00:53
219000 -- [-495.595] (-497.062) (-500.675) (-497.440) * (-497.115) (-502.973) (-499.801) [-498.272] -- 0:00:53
219500 -- (-495.247) (-497.469) (-496.369) [-495.126] * (-497.079) (-497.079) [-496.215] (-498.876) -- 0:00:53
220000 -- (-497.266) (-498.071) [-494.783] (-498.171) * (-496.213) [-495.497] (-495.204) (-500.260) -- 0:00:53
Average standard deviation of split frequencies: 0.015622
220500 -- (-502.026) (-498.462) [-498.570] (-498.969) * (-496.052) (-496.688) (-496.102) [-497.585] -- 0:00:53
221000 -- (-496.595) [-497.367] (-496.946) (-503.266) * (-499.087) (-495.993) [-497.100] (-496.046) -- 0:00:52
221500 -- (-496.741) (-497.497) [-495.626] (-499.039) * (-494.852) [-496.932] (-497.757) (-495.666) -- 0:00:52
222000 -- (-494.750) (-498.697) [-495.537] (-496.459) * (-497.039) (-494.674) (-498.254) [-495.008] -- 0:00:52
222500 -- (-496.539) [-495.731] (-497.384) (-497.660) * (-497.247) (-498.306) (-494.630) [-497.358] -- 0:00:52
223000 -- (-496.356) (-495.448) (-496.197) [-497.263] * (-496.602) (-495.804) [-496.192] (-496.276) -- 0:00:52
223500 -- (-495.124) (-500.722) [-494.625] (-496.653) * [-496.398] (-495.944) (-504.010) (-497.224) -- 0:00:52
224000 -- (-497.850) (-497.740) [-499.925] (-494.734) * (-497.311) [-496.673] (-500.654) (-498.104) -- 0:00:51
224500 -- (-495.822) [-494.643] (-496.735) (-499.924) * (-502.719) [-497.477] (-496.753) (-495.011) -- 0:00:51
225000 -- (-496.045) (-495.825) (-497.940) [-497.542] * (-495.695) [-498.316] (-495.861) (-497.566) -- 0:00:51
Average standard deviation of split frequencies: 0.015644
225500 -- [-495.936] (-496.107) (-499.705) (-494.180) * (-495.838) (-495.357) [-494.688] (-498.167) -- 0:00:51
226000 -- (-498.192) (-496.960) [-496.053] (-496.766) * (-497.375) [-499.384] (-496.680) (-501.160) -- 0:00:51
226500 -- (-497.708) [-497.131] (-495.468) (-496.294) * [-495.763] (-497.920) (-498.105) (-496.272) -- 0:00:51
227000 -- (-497.071) (-501.808) (-496.824) [-495.001] * (-494.925) [-495.925] (-496.104) (-495.847) -- 0:00:51
227500 -- (-496.087) [-496.035] (-495.308) (-495.641) * [-497.912] (-498.741) (-496.927) (-495.004) -- 0:00:50
228000 -- (-495.966) (-495.096) (-498.246) [-496.760] * (-495.724) (-495.225) (-496.906) [-496.770] -- 0:00:50
228500 -- (-496.817) (-496.147) [-494.351] (-498.042) * (-498.944) (-494.336) (-500.010) [-497.334] -- 0:00:50
229000 -- (-494.655) [-496.083] (-494.835) (-495.571) * (-495.800) (-494.945) (-496.541) [-501.735] -- 0:00:50
229500 -- (-498.377) (-498.666) (-498.534) [-497.198] * (-495.406) (-496.589) (-495.868) [-497.160] -- 0:00:53
230000 -- [-501.032] (-500.497) (-497.493) (-498.765) * (-497.329) [-496.680] (-497.470) (-499.115) -- 0:00:53
Average standard deviation of split frequencies: 0.015388
230500 -- (-497.015) (-499.975) (-495.585) [-496.254] * [-495.824] (-495.864) (-496.926) (-495.677) -- 0:00:53
231000 -- (-496.442) (-496.364) [-496.295] (-495.398) * (-497.416) [-495.228] (-497.553) (-499.806) -- 0:00:53
231500 -- (-496.735) (-497.858) (-495.795) [-496.163] * (-496.963) (-504.316) [-495.654] (-497.080) -- 0:00:53
232000 -- (-497.561) (-498.691) [-496.806] (-495.216) * (-496.312) (-499.687) [-497.174] (-495.884) -- 0:00:52
232500 -- (-496.216) (-496.784) (-495.700) [-497.031] * (-496.228) (-501.710) [-495.877] (-495.097) -- 0:00:52
233000 -- (-501.362) [-496.249] (-497.644) (-496.666) * (-495.393) (-497.306) [-497.360] (-496.006) -- 0:00:52
233500 -- (-498.217) [-501.750] (-496.157) (-500.357) * [-497.107] (-495.500) (-499.100) (-494.770) -- 0:00:52
234000 -- (-495.583) (-501.777) [-500.229] (-498.563) * (-496.337) [-495.984] (-497.868) (-498.129) -- 0:00:52
234500 -- (-494.521) (-495.738) [-496.426] (-498.108) * (-503.355) (-495.184) [-494.748] (-497.212) -- 0:00:52
235000 -- (-497.255) [-495.323] (-495.391) (-497.810) * (-497.477) (-498.935) (-498.643) [-499.105] -- 0:00:52
Average standard deviation of split frequencies: 0.014731
235500 -- (-496.845) [-494.726] (-496.658) (-499.382) * [-496.134] (-497.642) (-498.569) (-496.640) -- 0:00:51
236000 -- (-495.646) (-495.739) [-494.801] (-500.624) * (-498.112) (-497.068) [-495.486] (-495.731) -- 0:00:51
236500 -- (-497.743) (-498.095) (-496.489) [-494.789] * (-497.583) (-496.522) (-496.383) [-496.343] -- 0:00:51
237000 -- (-499.894) (-495.774) (-497.242) [-497.051] * (-495.518) (-495.353) [-496.039] (-498.851) -- 0:00:51
237500 -- [-495.689] (-496.191) (-495.502) (-496.358) * (-494.533) (-499.089) (-495.029) [-496.831] -- 0:00:51
238000 -- (-496.805) (-497.428) [-495.234] (-496.021) * (-497.445) [-497.549] (-497.974) (-494.900) -- 0:00:51
238500 -- (-497.651) (-495.217) [-496.794] (-497.370) * [-494.722] (-494.501) (-497.399) (-497.372) -- 0:00:51
239000 -- (-495.708) (-496.235) [-495.549] (-497.717) * (-497.087) [-494.424] (-495.925) (-503.379) -- 0:00:50
239500 -- (-494.795) (-496.917) [-495.417] (-495.324) * (-495.274) (-496.803) [-496.424] (-497.984) -- 0:00:50
240000 -- (-495.791) (-501.239) (-494.793) [-494.881] * (-495.653) (-497.314) [-496.155] (-496.946) -- 0:00:50
Average standard deviation of split frequencies: 0.015058
240500 -- (-494.352) [-499.790] (-499.802) (-494.870) * (-494.961) (-495.380) [-496.073] (-495.871) -- 0:00:50
241000 -- (-496.054) [-495.516] (-497.846) (-496.823) * (-496.629) (-494.842) (-496.392) [-497.862] -- 0:00:50
241500 -- (-496.536) (-497.302) [-496.359] (-497.975) * [-498.275] (-501.961) (-495.396) (-498.313) -- 0:00:50
242000 -- (-498.616) (-499.779) (-495.029) [-496.101] * [-495.854] (-497.481) (-497.627) (-500.014) -- 0:00:50
242500 -- (-496.485) (-498.185) (-504.856) [-494.417] * [-495.770] (-494.159) (-502.419) (-498.020) -- 0:00:49
243000 -- (-499.418) [-497.766] (-497.332) (-495.484) * [-498.218] (-497.934) (-494.813) (-495.162) -- 0:00:49
243500 -- [-495.202] (-495.820) (-495.477) (-499.507) * (-495.146) (-496.133) [-494.219] (-499.409) -- 0:00:49
244000 -- [-495.986] (-495.464) (-502.517) (-500.485) * [-496.389] (-496.590) (-496.816) (-498.516) -- 0:00:52
244500 -- (-496.683) (-498.111) [-504.885] (-500.808) * [-496.211] (-495.120) (-497.101) (-498.577) -- 0:00:52
245000 -- (-495.681) (-496.929) [-502.367] (-499.236) * (-496.730) [-495.859] (-497.251) (-497.429) -- 0:00:52
Average standard deviation of split frequencies: 0.014541
245500 -- (-497.786) [-495.833] (-498.500) (-498.200) * (-494.664) [-495.440] (-501.744) (-496.288) -- 0:00:52
246000 -- (-497.912) (-495.283) [-496.576] (-496.048) * (-494.680) (-497.589) [-497.549] (-494.885) -- 0:00:52
246500 -- (-498.309) [-494.213] (-500.180) (-502.357) * (-495.022) [-495.306] (-494.830) (-499.301) -- 0:00:51
247000 -- (-497.921) (-494.479) (-497.486) [-499.386] * (-496.912) [-495.854] (-494.809) (-495.884) -- 0:00:51
247500 -- [-498.617] (-495.412) (-499.234) (-497.083) * (-497.366) (-496.402) (-495.303) [-495.442] -- 0:00:51
248000 -- (-496.944) (-498.759) [-495.184] (-495.724) * (-495.072) (-502.343) (-499.825) [-495.271] -- 0:00:51
248500 -- (-497.290) (-498.486) [-497.048] (-495.592) * (-496.066) [-497.465] (-496.355) (-496.276) -- 0:00:51
249000 -- (-497.026) [-496.110] (-496.321) (-497.832) * (-494.867) (-495.986) (-495.790) [-499.497] -- 0:00:51
249500 -- [-497.335] (-495.888) (-501.388) (-496.597) * (-495.858) [-495.301] (-497.568) (-498.984) -- 0:00:51
250000 -- (-498.877) (-496.758) (-495.829) [-495.351] * [-496.270] (-494.677) (-502.933) (-499.899) -- 0:00:51
Average standard deviation of split frequencies: 0.014457
250500 -- (-498.322) (-495.008) (-495.954) [-495.256] * (-496.955) [-497.027] (-496.771) (-499.508) -- 0:00:50
251000 -- [-498.487] (-494.736) (-495.746) (-496.167) * (-496.323) (-497.341) (-497.175) [-494.500] -- 0:00:50
251500 -- (-495.271) (-495.915) (-500.377) [-496.508] * (-498.506) (-495.420) [-497.136] (-501.990) -- 0:00:50
252000 -- (-499.714) (-497.659) (-495.749) [-495.314] * [-497.402] (-494.312) (-495.716) (-495.601) -- 0:00:50
252500 -- (-500.683) (-499.654) (-495.187) [-496.609] * (-498.713) (-497.129) [-498.340] (-495.259) -- 0:00:50
253000 -- (-504.015) [-495.835] (-496.959) (-496.838) * [-497.031] (-494.541) (-496.523) (-497.576) -- 0:00:50
253500 -- (-498.658) [-498.367] (-498.630) (-497.689) * (-495.414) (-498.129) (-495.053) [-496.631] -- 0:00:50
254000 -- (-495.246) (-498.159) (-496.961) [-496.384] * (-495.084) (-496.250) [-494.907] (-497.263) -- 0:00:49
254500 -- (-495.478) [-502.839] (-497.446) (-495.164) * (-495.208) [-496.577] (-497.035) (-500.013) -- 0:00:49
255000 -- [-494.330] (-501.338) (-496.948) (-497.715) * (-497.947) (-496.927) (-494.814) [-500.161] -- 0:00:49
Average standard deviation of split frequencies: 0.014840
255500 -- (-500.781) (-496.063) [-495.767] (-499.268) * (-497.132) (-496.215) (-496.488) [-496.097] -- 0:00:49
256000 -- (-500.548) (-495.566) (-498.105) [-494.889] * [-495.481] (-496.040) (-497.186) (-496.027) -- 0:00:49
256500 -- (-500.047) [-496.172] (-498.447) (-497.842) * [-496.747] (-500.147) (-495.077) (-498.650) -- 0:00:49
257000 -- (-498.235) (-496.434) [-495.737] (-500.880) * [-497.057] (-497.506) (-495.253) (-497.816) -- 0:00:49
257500 -- (-498.530) (-497.709) [-496.299] (-498.000) * [-499.054] (-495.616) (-496.854) (-499.444) -- 0:00:49
258000 -- (-496.392) (-495.740) [-498.163] (-495.057) * (-497.526) (-496.692) (-497.101) [-499.185] -- 0:00:48
258500 -- [-497.659] (-495.398) (-495.351) (-495.640) * (-497.444) (-497.327) (-495.629) [-497.332] -- 0:00:51
259000 -- (-495.540) (-495.813) (-495.753) [-495.273] * (-498.998) (-499.096) [-497.742] (-498.525) -- 0:00:51
259500 -- (-496.355) (-495.637) [-494.930] (-495.676) * [-498.378] (-497.518) (-496.266) (-499.460) -- 0:00:51
260000 -- (-500.030) (-497.970) [-496.280] (-496.145) * [-496.363] (-495.734) (-495.654) (-498.415) -- 0:00:51
Average standard deviation of split frequencies: 0.013297
260500 -- (-497.601) (-494.875) [-496.061] (-496.424) * (-497.696) (-495.901) (-495.127) [-497.284] -- 0:00:51
261000 -- (-496.175) (-495.615) (-496.759) [-502.857] * (-497.889) [-495.786] (-498.735) (-497.327) -- 0:00:50
261500 -- (-496.156) (-496.911) [-494.790] (-495.309) * [-495.796] (-495.339) (-500.930) (-495.544) -- 0:00:50
262000 -- (-496.400) (-496.698) (-499.011) [-496.683] * [-497.193] (-497.172) (-497.700) (-495.729) -- 0:00:50
262500 -- (-495.579) [-496.935] (-498.975) (-496.974) * (-495.794) (-499.364) (-495.376) [-495.095] -- 0:00:50
263000 -- (-495.984) [-496.019] (-503.266) (-495.558) * (-496.090) (-498.539) (-496.889) [-494.817] -- 0:00:50
263500 -- (-498.449) (-495.416) (-497.166) [-495.456] * (-494.867) (-498.114) (-497.802) [-497.118] -- 0:00:50
264000 -- [-497.289] (-494.873) (-497.332) (-496.298) * (-495.020) [-495.594] (-497.866) (-495.785) -- 0:00:50
264500 -- (-494.867) (-497.188) [-496.177] (-497.902) * (-495.766) (-501.852) [-497.420] (-500.967) -- 0:00:50
265000 -- (-494.562) (-495.198) [-495.381] (-499.032) * (-499.135) (-498.507) (-497.496) [-498.068] -- 0:00:49
Average standard deviation of split frequencies: 0.012197
265500 -- (-497.174) (-494.924) (-499.072) [-497.670] * (-495.375) (-498.028) (-494.868) [-495.517] -- 0:00:49
266000 -- (-495.185) (-496.215) (-494.969) [-495.100] * (-495.829) (-500.768) (-494.511) [-495.894] -- 0:00:49
266500 -- [-497.684] (-495.227) (-496.194) (-495.883) * (-496.577) (-497.677) (-494.957) [-495.351] -- 0:00:49
267000 -- (-495.050) [-498.023] (-499.044) (-496.502) * (-498.264) (-496.281) [-494.759] (-497.187) -- 0:00:49
267500 -- (-498.117) (-502.315) [-496.112] (-498.665) * (-496.535) (-495.188) [-496.275] (-496.851) -- 0:00:49
268000 -- (-497.707) (-497.072) (-497.274) [-495.532] * (-495.932) (-496.436) [-494.312] (-496.935) -- 0:00:49
268500 -- (-495.503) [-498.095] (-500.243) (-496.864) * (-495.488) [-499.354] (-498.751) (-497.546) -- 0:00:49
269000 -- (-498.000) [-495.536] (-496.106) (-498.883) * (-495.118) (-502.353) (-495.307) [-498.545] -- 0:00:48
269500 -- (-495.740) (-497.121) [-495.385] (-498.166) * (-501.860) (-499.480) [-496.832] (-501.262) -- 0:00:48
270000 -- (-496.762) [-495.626] (-496.066) (-496.160) * (-498.862) (-501.743) [-495.724] (-498.426) -- 0:00:48
Average standard deviation of split frequencies: 0.013114
270500 -- (-499.290) [-498.794] (-496.928) (-495.294) * (-498.048) [-498.191] (-495.395) (-500.243) -- 0:00:48
271000 -- [-496.609] (-496.971) (-495.886) (-502.956) * (-495.034) [-495.955] (-498.580) (-495.904) -- 0:00:48
271500 -- [-495.969] (-497.247) (-499.793) (-498.509) * (-497.483) [-496.930] (-496.397) (-496.495) -- 0:00:48
272000 -- [-497.667] (-497.695) (-501.682) (-496.107) * (-498.381) (-496.965) [-496.826] (-496.182) -- 0:00:48
272500 -- (-496.633) [-495.604] (-500.011) (-495.515) * [-496.987] (-497.532) (-499.770) (-494.976) -- 0:00:48
273000 -- (-498.662) (-501.826) [-498.495] (-494.663) * (-495.296) (-497.129) [-495.120] (-497.774) -- 0:00:50
273500 -- (-498.058) [-500.872] (-497.731) (-494.386) * (-495.348) (-497.717) (-496.682) [-497.806] -- 0:00:50
274000 -- (-500.754) (-496.691) (-495.959) [-495.014] * (-499.572) (-495.834) [-494.532] (-495.238) -- 0:00:50
274500 -- (-500.931) [-497.004] (-495.192) (-494.871) * (-496.481) (-499.935) (-496.196) [-496.686] -- 0:00:50
275000 -- (-498.596) (-499.197) [-499.466] (-495.470) * (-497.820) (-498.492) [-497.062] (-495.528) -- 0:00:50
Average standard deviation of split frequencies: 0.013162
275500 -- (-500.765) (-496.460) [-497.479] (-495.524) * (-497.364) (-496.097) (-498.906) [-496.790] -- 0:00:49
276000 -- (-497.313) [-496.640] (-498.144) (-496.708) * (-498.057) [-497.631] (-494.259) (-498.934) -- 0:00:49
276500 -- (-495.595) [-497.824] (-495.694) (-495.374) * (-498.071) [-496.853] (-495.958) (-499.706) -- 0:00:49
277000 -- [-495.978] (-496.800) (-495.850) (-501.802) * [-498.690] (-496.906) (-496.392) (-499.329) -- 0:00:49
277500 -- (-495.817) (-496.287) [-497.071] (-498.399) * [-495.820] (-494.467) (-495.566) (-500.033) -- 0:00:49
278000 -- [-496.456] (-499.997) (-496.709) (-494.922) * (-497.699) [-497.118] (-496.901) (-496.614) -- 0:00:49
278500 -- (-496.572) (-501.404) [-496.033] (-497.695) * (-495.008) (-494.984) [-494.596] (-495.491) -- 0:00:49
279000 -- [-496.781] (-494.986) (-496.818) (-495.764) * (-495.443) (-495.998) [-495.304] (-495.466) -- 0:00:49
279500 -- [-497.100] (-495.615) (-495.441) (-495.641) * (-495.788) (-495.425) (-495.526) [-496.003] -- 0:00:48
280000 -- (-494.663) [-496.173] (-495.750) (-496.534) * [-496.818] (-496.876) (-495.316) (-495.426) -- 0:00:48
Average standard deviation of split frequencies: 0.014650
280500 -- (-495.612) (-498.432) [-495.231] (-498.275) * (-497.214) (-497.026) (-495.620) [-495.486] -- 0:00:48
281000 -- (-495.903) (-497.126) (-499.774) [-497.542] * (-497.663) [-499.738] (-501.025) (-495.179) -- 0:00:48
281500 -- (-497.167) (-495.718) [-502.635] (-498.899) * (-494.783) [-496.576] (-497.310) (-495.182) -- 0:00:48
282000 -- [-496.076] (-495.886) (-497.317) (-496.026) * (-496.734) (-504.321) [-495.091] (-499.529) -- 0:00:48
282500 -- (-495.666) (-496.948) [-497.166] (-496.004) * [-499.252] (-498.143) (-494.732) (-498.327) -- 0:00:48
283000 -- (-494.842) [-497.854] (-499.390) (-497.244) * (-496.857) (-496.042) [-495.297] (-502.557) -- 0:00:48
283500 -- [-494.739] (-494.808) (-495.602) (-497.997) * (-498.546) (-496.070) (-496.352) [-495.050] -- 0:00:48
284000 -- (-495.478) (-494.819) [-495.164] (-498.720) * (-495.989) [-495.083] (-498.150) (-494.431) -- 0:00:47
284500 -- (-495.123) (-496.169) (-496.805) [-496.753] * [-497.447] (-501.604) (-499.440) (-494.921) -- 0:00:47
285000 -- (-495.754) (-496.118) (-495.193) [-497.999] * [-496.430] (-495.907) (-499.762) (-495.532) -- 0:00:47
Average standard deviation of split frequencies: 0.014285
285500 -- (-495.632) [-497.269] (-500.467) (-497.467) * [-495.358] (-495.702) (-495.468) (-497.624) -- 0:00:47
286000 -- (-496.537) [-494.648] (-502.480) (-494.622) * [-495.004] (-496.772) (-496.788) (-499.931) -- 0:00:47
286500 -- [-496.639] (-496.931) (-496.865) (-494.727) * (-497.006) (-495.401) (-497.627) [-495.344] -- 0:00:47
287000 -- (-506.478) [-496.501] (-494.663) (-496.400) * (-495.630) [-495.833] (-496.126) (-496.229) -- 0:00:49
287500 -- (-497.080) (-495.566) [-496.058] (-495.894) * (-495.106) [-497.685] (-495.875) (-496.157) -- 0:00:49
288000 -- [-494.693] (-496.259) (-499.916) (-495.624) * [-495.240] (-497.098) (-496.194) (-498.382) -- 0:00:49
288500 -- (-498.658) [-494.792] (-496.968) (-494.588) * [-495.064] (-494.998) (-497.600) (-496.589) -- 0:00:49
289000 -- [-497.129] (-496.501) (-494.480) (-495.966) * [-497.831] (-496.204) (-496.641) (-496.115) -- 0:00:49
289500 -- (-500.705) (-498.864) [-495.122] (-496.954) * (-495.641) (-496.424) [-498.322] (-497.779) -- 0:00:49
290000 -- (-498.919) (-498.391) (-494.597) [-494.994] * [-495.740] (-498.940) (-497.865) (-498.239) -- 0:00:48
Average standard deviation of split frequencies: 0.014146
290500 -- [-495.231] (-497.546) (-495.329) (-498.703) * (-497.783) (-496.066) [-496.430] (-496.476) -- 0:00:48
291000 -- (-496.365) (-496.335) (-495.311) [-496.847] * (-494.678) (-495.949) (-496.394) [-499.377] -- 0:00:48
291500 -- (-498.882) (-500.157) (-495.952) [-495.378] * (-496.106) (-498.024) (-494.855) [-498.050] -- 0:00:48
292000 -- (-495.532) (-497.386) (-495.255) [-496.346] * (-495.522) (-495.989) [-495.884] (-497.296) -- 0:00:48
292500 -- [-496.842] (-497.893) (-498.104) (-499.775) * (-495.452) (-494.865) [-495.503] (-496.116) -- 0:00:48
293000 -- (-497.431) (-502.712) (-497.492) [-495.808] * (-498.703) [-498.845] (-496.444) (-494.923) -- 0:00:48
293500 -- [-497.510] (-495.216) (-498.295) (-498.337) * (-498.434) [-499.217] (-496.292) (-503.346) -- 0:00:48
294000 -- (-498.372) (-496.258) (-498.083) [-496.306] * (-496.245) (-496.546) [-496.391] (-500.326) -- 0:00:48
294500 -- [-495.360] (-495.468) (-500.268) (-496.044) * [-496.630] (-498.476) (-499.729) (-497.846) -- 0:00:47
295000 -- (-497.761) (-495.424) (-495.768) [-495.568] * (-498.448) [-496.482] (-496.091) (-494.809) -- 0:00:47
Average standard deviation of split frequencies: 0.013979
295500 -- (-494.953) (-499.495) (-495.220) [-495.344] * (-504.510) (-498.468) [-495.538] (-498.950) -- 0:00:47
296000 -- (-495.565) (-497.003) [-494.861] (-498.495) * (-500.491) (-497.065) (-496.117) [-498.627] -- 0:00:47
296500 -- [-497.279] (-495.533) (-499.005) (-496.938) * (-495.689) (-496.710) [-497.317] (-494.780) -- 0:00:47
297000 -- (-499.305) (-496.636) [-495.498] (-496.827) * (-500.125) (-497.035) (-498.102) [-494.597] -- 0:00:47
297500 -- (-495.062) (-495.763) [-496.821] (-498.895) * (-498.246) (-496.135) [-495.527] (-495.054) -- 0:00:47
298000 -- (-496.562) (-495.904) (-496.516) [-495.746] * (-503.063) (-494.796) [-498.923] (-494.812) -- 0:00:47
298500 -- (-496.989) (-494.600) (-494.375) [-496.842] * (-497.481) (-495.915) (-494.615) [-497.115] -- 0:00:47
299000 -- (-495.596) [-494.597] (-495.835) (-495.538) * (-495.821) [-496.771] (-495.390) (-496.229) -- 0:00:46
299500 -- (-497.189) [-495.481] (-494.434) (-495.844) * [-495.903] (-495.316) (-497.647) (-495.734) -- 0:00:46
300000 -- [-495.053] (-497.987) (-495.159) (-498.786) * (-494.776) (-496.619) (-498.397) [-497.041] -- 0:00:46
Average standard deviation of split frequencies: 0.012635
300500 -- (-494.889) (-495.541) (-495.975) [-496.002] * (-496.789) [-497.257] (-496.314) (-495.193) -- 0:00:46
301000 -- (-497.400) [-494.303] (-495.588) (-495.692) * [-496.789] (-497.683) (-498.916) (-495.435) -- 0:00:46
301500 -- (-496.380) (-494.994) (-497.670) [-496.023] * (-497.215) (-495.940) (-496.304) [-497.643] -- 0:00:48
302000 -- [-498.051] (-496.549) (-497.105) (-495.594) * (-498.945) (-498.263) (-498.500) [-495.922] -- 0:00:48
302500 -- (-497.868) (-496.428) (-497.675) [-496.688] * (-495.579) [-495.192] (-498.841) (-499.050) -- 0:00:48
303000 -- [-495.312] (-494.617) (-496.085) (-495.285) * (-494.797) [-495.949] (-497.926) (-496.610) -- 0:00:48
303500 -- (-498.576) (-498.094) (-500.929) [-495.065] * [-495.205] (-497.734) (-498.580) (-496.320) -- 0:00:48
304000 -- (-495.661) (-496.452) (-496.271) [-494.934] * [-497.005] (-495.899) (-495.996) (-499.835) -- 0:00:48
304500 -- [-497.084] (-499.053) (-496.810) (-497.020) * (-496.557) (-495.750) (-497.899) [-495.489] -- 0:00:47
305000 -- (-496.603) (-495.486) [-494.850] (-495.573) * [-495.519] (-497.283) (-496.220) (-496.084) -- 0:00:47
Average standard deviation of split frequencies: 0.012752
305500 -- [-496.518] (-498.811) (-499.228) (-496.493) * (-495.700) (-495.211) [-495.091] (-497.784) -- 0:00:47
306000 -- (-498.427) [-500.898] (-496.303) (-496.166) * (-496.685) (-495.496) [-494.441] (-494.616) -- 0:00:47
306500 -- (-495.079) (-498.283) [-494.863] (-502.647) * [-497.735] (-496.261) (-497.699) (-495.144) -- 0:00:47
307000 -- (-495.524) [-496.062] (-497.343) (-496.001) * [-497.061] (-497.036) (-495.890) (-495.369) -- 0:00:47
307500 -- (-496.789) [-497.267] (-500.044) (-495.743) * (-498.293) (-496.523) (-495.337) [-495.521] -- 0:00:47
308000 -- (-497.388) (-495.065) [-495.839] (-496.366) * (-498.185) (-499.858) [-496.655] (-495.463) -- 0:00:47
308500 -- (-495.716) [-495.624] (-495.501) (-496.104) * [-495.215] (-496.682) (-495.894) (-496.510) -- 0:00:47
309000 -- [-501.574] (-495.294) (-497.519) (-498.181) * (-498.324) (-495.950) (-496.680) [-496.269] -- 0:00:46
309500 -- (-496.470) (-497.585) [-496.916] (-496.055) * (-499.293) (-497.032) (-498.075) [-496.755] -- 0:00:46
310000 -- (-499.533) (-495.648) (-499.247) [-495.838] * [-497.639] (-496.257) (-495.364) (-498.468) -- 0:00:46
Average standard deviation of split frequencies: 0.012561
310500 -- (-500.057) (-495.381) [-497.298] (-496.972) * (-497.159) [-495.386] (-495.278) (-497.830) -- 0:00:46
311000 -- [-496.701] (-495.431) (-495.923) (-496.666) * [-495.428] (-502.256) (-495.848) (-497.977) -- 0:00:46
311500 -- (-497.022) (-496.140) [-494.754] (-497.715) * (-496.135) (-500.735) (-496.703) [-499.887] -- 0:00:46
312000 -- (-497.075) [-494.982] (-494.599) (-497.863) * (-494.975) [-494.957] (-497.733) (-497.160) -- 0:00:46
312500 -- [-495.912] (-494.711) (-495.028) (-499.128) * (-500.855) (-494.516) (-499.811) [-499.099] -- 0:00:46
313000 -- (-496.346) (-494.793) [-495.105] (-499.695) * (-494.916) (-496.237) [-496.574] (-495.730) -- 0:00:46
313500 -- (-496.675) [-494.793] (-494.365) (-494.709) * (-495.778) [-495.848] (-495.868) (-496.915) -- 0:00:45
314000 -- (-497.515) (-496.451) [-498.078] (-497.464) * [-497.328] (-496.031) (-497.943) (-495.960) -- 0:00:45
314500 -- (-499.095) (-495.785) (-494.264) [-496.556] * (-497.230) [-494.620] (-496.605) (-501.805) -- 0:00:45
315000 -- (-495.600) (-494.700) (-496.413) [-494.738] * (-500.323) [-495.870] (-497.232) (-496.077) -- 0:00:45
Average standard deviation of split frequencies: 0.011841
315500 -- (-497.293) (-494.998) (-497.845) [-496.680] * (-496.699) (-496.932) [-498.004] (-497.301) -- 0:00:47
316000 -- (-497.174) [-496.587] (-497.240) (-494.291) * [-500.628] (-496.213) (-498.262) (-496.406) -- 0:00:47
316500 -- (-498.945) (-499.725) [-495.248] (-496.525) * (-496.475) [-495.912] (-498.088) (-497.167) -- 0:00:47
317000 -- (-495.775) (-499.110) (-498.665) [-494.282] * (-499.514) (-495.531) [-495.569] (-494.860) -- 0:00:47
317500 -- (-495.012) (-497.660) (-495.639) [-494.873] * (-496.279) (-495.250) [-494.765] (-495.779) -- 0:00:47
318000 -- (-502.188) (-496.189) (-495.702) [-495.933] * [-498.213] (-494.460) (-496.223) (-496.848) -- 0:00:47
318500 -- (-496.459) (-495.032) (-499.343) [-497.028] * (-495.426) (-494.627) (-496.892) [-496.247] -- 0:00:47
319000 -- (-503.250) [-499.026] (-496.013) (-496.042) * (-496.955) [-495.352] (-495.200) (-497.860) -- 0:00:46
319500 -- (-500.703) [-497.140] (-497.730) (-499.733) * (-497.141) (-495.465) (-496.210) [-494.864] -- 0:00:46
320000 -- (-501.486) [-496.983] (-500.431) (-494.905) * (-496.324) [-494.344] (-496.064) (-495.398) -- 0:00:46
Average standard deviation of split frequencies: 0.010015
320500 -- [-495.500] (-495.208) (-497.648) (-496.810) * [-494.832] (-496.786) (-496.356) (-495.072) -- 0:00:46
321000 -- (-497.229) (-496.405) [-496.501] (-494.659) * [-495.869] (-497.419) (-497.010) (-496.513) -- 0:00:46
321500 -- (-498.763) (-495.518) [-495.150] (-495.026) * (-497.570) (-497.210) (-495.808) [-501.000] -- 0:00:46
322000 -- (-499.734) [-494.719] (-496.665) (-499.317) * (-498.976) [-497.793] (-498.444) (-504.993) -- 0:00:46
322500 -- [-499.915] (-495.830) (-498.198) (-494.514) * (-498.747) (-498.051) (-496.970) [-497.148] -- 0:00:46
323000 -- (-494.531) [-497.123] (-496.114) (-496.078) * [-496.814] (-496.775) (-494.656) (-497.294) -- 0:00:46
323500 -- (-495.674) (-496.038) [-496.073] (-496.674) * (-497.061) [-495.894] (-495.580) (-496.392) -- 0:00:46
324000 -- (-497.559) [-494.533] (-497.285) (-495.217) * [-498.506] (-499.055) (-494.607) (-494.965) -- 0:00:45
324500 -- (-501.227) (-496.083) [-496.494] (-498.648) * (-496.531) (-497.731) [-496.369] (-495.161) -- 0:00:45
325000 -- (-497.350) [-496.049] (-498.243) (-496.959) * [-494.996] (-498.992) (-497.169) (-497.698) -- 0:00:45
Average standard deviation of split frequencies: 0.009612
325500 -- (-497.312) [-497.297] (-498.666) (-495.493) * [-495.121] (-502.052) (-497.217) (-496.401) -- 0:00:45
326000 -- (-495.499) (-495.697) [-500.442] (-497.972) * [-495.281] (-499.463) (-495.736) (-501.778) -- 0:00:45
326500 -- [-496.490] (-496.249) (-500.881) (-497.179) * (-495.570) (-495.155) (-495.412) [-497.384] -- 0:00:45
327000 -- (-498.711) (-495.370) (-496.962) [-496.323] * [-495.201] (-495.386) (-496.755) (-500.805) -- 0:00:45
327500 -- (-497.363) (-497.040) (-496.642) [-497.021] * (-496.055) [-497.286] (-495.567) (-499.008) -- 0:00:45
328000 -- [-495.726] (-495.900) (-497.157) (-498.197) * (-497.258) (-496.372) (-496.883) [-496.009] -- 0:00:45
328500 -- (-499.276) (-498.615) (-498.038) [-496.905] * [-494.793] (-495.354) (-495.773) (-495.392) -- 0:00:44
329000 -- (-497.723) (-498.548) (-495.560) [-498.074] * (-494.859) (-495.106) [-494.998] (-496.405) -- 0:00:44
329500 -- [-496.878] (-496.981) (-498.081) (-498.064) * (-497.539) [-495.017] (-494.472) (-497.582) -- 0:00:44
330000 -- (-495.164) (-500.068) (-495.973) [-496.970] * [-498.424] (-494.484) (-496.323) (-495.984) -- 0:00:46
Average standard deviation of split frequencies: 0.009225
330500 -- [-496.917] (-496.536) (-497.281) (-496.652) * (-496.496) (-495.758) [-496.782] (-494.153) -- 0:00:46
331000 -- (-494.978) [-497.560] (-497.404) (-498.558) * (-498.726) (-499.102) [-496.375] (-495.678) -- 0:00:46
331500 -- (-495.011) (-495.591) [-498.212] (-495.343) * (-495.589) (-495.656) (-499.223) [-496.596] -- 0:00:46
332000 -- (-497.347) (-496.052) [-496.054] (-497.736) * (-494.409) (-497.831) [-495.906] (-497.924) -- 0:00:46
332500 -- (-496.005) [-495.153] (-496.686) (-497.976) * (-496.588) (-496.059) (-495.319) [-495.259] -- 0:00:46
333000 -- (-496.564) [-496.568] (-496.053) (-498.148) * [-497.967] (-494.652) (-498.003) (-496.954) -- 0:00:46
333500 -- [-496.629] (-497.813) (-498.956) (-499.107) * (-495.665) [-494.454] (-497.726) (-495.109) -- 0:00:45
334000 -- [-500.084] (-497.951) (-494.699) (-503.244) * (-496.892) [-497.520] (-495.889) (-495.455) -- 0:00:45
334500 -- (-500.452) (-496.890) (-498.320) [-496.478] * (-498.076) [-498.165] (-497.570) (-496.967) -- 0:00:45
335000 -- (-497.627) (-499.085) [-497.062] (-495.440) * (-498.853) (-500.021) [-496.469] (-496.539) -- 0:00:45
Average standard deviation of split frequencies: 0.009821
335500 -- (-501.783) (-499.392) (-494.884) [-497.734] * (-496.270) (-496.986) (-497.044) [-497.843] -- 0:00:45
336000 -- (-497.375) (-497.041) [-497.753] (-495.724) * (-496.523) [-496.225] (-496.525) (-496.444) -- 0:00:45
336500 -- [-496.687] (-495.078) (-495.914) (-495.982) * [-499.474] (-494.631) (-495.266) (-497.997) -- 0:00:45
337000 -- (-496.332) (-494.909) [-495.513] (-495.036) * (-496.664) [-496.567] (-496.068) (-498.566) -- 0:00:45
337500 -- (-495.856) (-495.551) [-498.141] (-499.535) * (-496.234) (-495.422) (-498.026) [-495.269] -- 0:00:45
338000 -- (-497.334) [-497.303] (-495.459) (-497.986) * [-497.604] (-497.002) (-496.235) (-499.741) -- 0:00:45
338500 -- [-497.610] (-496.805) (-495.994) (-496.918) * (-496.629) [-497.206] (-500.115) (-496.600) -- 0:00:44
339000 -- (-498.287) (-496.663) [-496.426] (-497.833) * [-499.027] (-502.093) (-496.371) (-495.572) -- 0:00:44
339500 -- [-496.372] (-497.709) (-497.728) (-497.951) * (-496.125) (-500.334) (-496.147) [-497.975] -- 0:00:44
340000 -- (-495.053) (-496.057) [-494.552] (-496.102) * (-496.096) [-497.913] (-499.932) (-500.402) -- 0:00:44
Average standard deviation of split frequencies: 0.009117
340500 -- (-495.509) (-494.898) [-494.822] (-496.116) * (-496.285) (-496.525) [-496.051] (-500.785) -- 0:00:44
341000 -- (-498.308) (-496.176) [-498.688] (-497.490) * [-497.615] (-495.152) (-494.706) (-497.298) -- 0:00:44
341500 -- (-495.125) [-497.891] (-495.882) (-494.674) * [-497.489] (-496.431) (-498.718) (-499.015) -- 0:00:44
342000 -- (-495.151) [-505.334] (-500.071) (-495.149) * (-499.186) (-495.067) [-501.245] (-495.991) -- 0:00:44
342500 -- (-496.074) (-495.842) (-496.530) [-495.968] * (-496.507) (-496.017) [-495.209] (-498.040) -- 0:00:44
343000 -- [-497.440] (-496.272) (-502.343) (-497.730) * (-499.213) [-494.856] (-496.021) (-497.437) -- 0:00:44
343500 -- (-495.987) [-498.668] (-496.329) (-497.308) * [-495.446] (-498.369) (-496.761) (-498.623) -- 0:00:43
344000 -- (-495.238) (-502.811) [-496.253] (-495.241) * (-494.672) (-497.891) [-495.293] (-495.844) -- 0:00:45
344500 -- (-497.760) (-495.544) [-494.666] (-498.800) * [-497.789] (-500.556) (-497.196) (-494.699) -- 0:00:45
345000 -- (-497.438) [-494.964] (-496.038) (-500.508) * (-497.900) (-495.203) [-496.157] (-497.184) -- 0:00:45
Average standard deviation of split frequencies: 0.009778
345500 -- (-497.066) [-496.934] (-495.363) (-498.238) * [-499.667] (-494.680) (-495.224) (-497.259) -- 0:00:45
346000 -- (-495.438) (-501.063) [-494.557] (-497.068) * (-496.867) (-497.328) [-500.433] (-498.046) -- 0:00:45
346500 -- (-496.236) [-498.701] (-496.151) (-495.016) * (-495.710) (-500.348) (-498.688) [-498.438] -- 0:00:45
347000 -- (-496.631) (-494.947) [-496.491] (-496.386) * (-495.037) (-496.052) (-494.271) [-495.629] -- 0:00:45
347500 -- (-496.195) (-500.706) [-496.021] (-497.420) * (-495.339) (-499.013) (-495.218) [-496.844] -- 0:00:45
348000 -- [-495.681] (-496.866) (-495.020) (-497.723) * (-495.143) (-497.371) [-494.663] (-499.144) -- 0:00:44
348500 -- (-497.884) (-496.114) (-496.326) [-497.237] * [-496.415] (-494.911) (-494.800) (-499.497) -- 0:00:44
349000 -- [-497.335] (-497.183) (-496.869) (-494.573) * (-494.989) (-496.962) (-494.720) [-499.740] -- 0:00:44
349500 -- (-498.613) [-496.706] (-498.032) (-496.256) * (-494.399) (-498.080) [-494.870] (-497.118) -- 0:00:44
350000 -- [-501.839] (-496.666) (-496.092) (-496.902) * (-495.575) [-497.836] (-498.390) (-496.439) -- 0:00:44
Average standard deviation of split frequencies: 0.009173
350500 -- [-498.355] (-495.869) (-496.187) (-504.994) * (-494.551) (-502.932) [-495.932] (-499.176) -- 0:00:44
351000 -- (-495.013) (-495.210) [-496.755] (-496.451) * (-495.592) (-501.453) [-496.895] (-497.347) -- 0:00:44
351500 -- (-495.944) [-496.660] (-497.930) (-496.204) * [-496.635] (-497.617) (-497.386) (-496.375) -- 0:00:44
352000 -- (-495.243) [-495.625] (-496.940) (-495.554) * (-496.423) (-496.942) (-497.768) [-495.929] -- 0:00:44
352500 -- (-497.694) [-494.328] (-495.358) (-496.952) * (-495.207) [-494.638] (-494.964) (-500.107) -- 0:00:44
353000 -- (-495.574) (-498.195) (-494.666) [-500.515] * (-502.018) [-495.733] (-498.169) (-494.943) -- 0:00:43
353500 -- (-494.995) [-495.259] (-497.192) (-502.445) * (-502.129) [-495.543] (-496.914) (-497.736) -- 0:00:43
354000 -- (-498.325) (-499.228) [-497.437] (-496.746) * [-495.596] (-496.860) (-497.480) (-494.940) -- 0:00:43
354500 -- [-497.712] (-501.237) (-495.873) (-498.846) * (-498.337) [-494.470] (-497.411) (-498.529) -- 0:00:43
355000 -- [-496.032] (-497.775) (-499.032) (-495.887) * [-494.607] (-498.603) (-495.657) (-497.476) -- 0:00:43
Average standard deviation of split frequencies: 0.008880
355500 -- (-496.435) (-496.289) (-496.138) [-500.115] * (-499.513) (-496.425) [-496.484] (-495.083) -- 0:00:43
356000 -- [-502.916] (-499.197) (-498.169) (-502.081) * (-495.679) [-495.066] (-495.415) (-496.498) -- 0:00:43
356500 -- (-500.498) (-495.806) (-496.012) [-498.984] * (-496.132) [-496.715] (-497.682) (-497.274) -- 0:00:43
357000 -- (-498.299) (-496.532) (-495.184) [-495.427] * (-497.111) (-495.077) (-496.386) [-497.467] -- 0:00:43
357500 -- (-496.070) (-498.487) [-497.065] (-500.027) * (-495.848) (-497.488) [-496.946] (-496.274) -- 0:00:43
358000 -- [-495.920] (-495.769) (-497.264) (-498.707) * (-495.984) [-498.041] (-494.677) (-499.001) -- 0:00:43
358500 -- (-498.960) [-495.452] (-497.277) (-495.873) * (-496.041) (-495.855) (-494.551) [-497.844] -- 0:00:44
359000 -- (-499.376) (-496.023) (-497.388) [-496.707] * (-496.944) (-495.437) (-496.822) [-496.098] -- 0:00:44
359500 -- (-503.600) [-496.239] (-497.413) (-498.227) * (-496.958) (-497.439) (-497.988) [-499.083] -- 0:00:44
360000 -- (-495.199) (-496.483) [-495.670] (-497.864) * [-495.534] (-497.536) (-498.498) (-495.406) -- 0:00:44
Average standard deviation of split frequencies: 0.009149
360500 -- (-496.306) [-496.090] (-497.514) (-497.504) * (-496.078) (-498.082) (-495.735) [-498.056] -- 0:00:44
361000 -- (-498.257) [-495.456] (-494.843) (-499.130) * (-496.859) (-500.501) (-497.630) [-494.849] -- 0:00:44
361500 -- (-496.676) [-494.391] (-495.569) (-497.515) * (-494.751) (-496.969) [-498.628] (-495.076) -- 0:00:44
362000 -- (-497.278) (-496.267) (-496.522) [-496.870] * [-495.747] (-496.632) (-499.151) (-494.708) -- 0:00:44
362500 -- (-497.187) [-497.870] (-495.324) (-495.519) * (-497.119) [-497.481] (-496.807) (-501.153) -- 0:00:43
363000 -- [-495.816] (-498.520) (-500.467) (-497.601) * (-503.894) [-496.024] (-494.907) (-497.193) -- 0:00:43
363500 -- (-498.514) (-495.116) (-497.817) [-497.383] * (-495.261) (-497.727) [-495.465] (-499.905) -- 0:00:43
364000 -- (-495.165) (-497.324) (-500.241) [-494.704] * (-500.940) (-495.652) (-494.924) [-496.715] -- 0:00:43
364500 -- [-498.123] (-498.444) (-495.638) (-494.360) * (-501.172) [-495.605] (-496.193) (-496.386) -- 0:00:43
365000 -- [-495.487] (-498.171) (-496.242) (-496.971) * (-496.304) (-497.770) (-500.076) [-495.595] -- 0:00:43
Average standard deviation of split frequencies: 0.008561
365500 -- [-495.823] (-498.693) (-496.304) (-496.859) * (-504.509) [-495.596] (-497.551) (-498.308) -- 0:00:43
366000 -- [-500.240] (-499.028) (-495.104) (-495.713) * (-495.695) (-496.424) [-496.280] (-498.077) -- 0:00:43
366500 -- [-496.207] (-498.033) (-495.310) (-497.250) * (-496.919) (-497.329) [-499.645] (-501.176) -- 0:00:43
367000 -- [-494.613] (-496.765) (-495.927) (-497.061) * (-497.093) (-501.426) (-500.313) [-497.164] -- 0:00:43
367500 -- (-496.837) (-496.381) (-496.382) [-497.350] * [-497.522] (-497.026) (-498.220) (-498.904) -- 0:00:43
368000 -- [-495.763] (-498.014) (-496.232) (-496.616) * [-495.476] (-496.175) (-497.802) (-500.158) -- 0:00:42
368500 -- [-496.008] (-503.195) (-496.718) (-498.187) * (-496.135) (-498.929) [-496.302] (-497.159) -- 0:00:42
369000 -- (-495.310) (-496.314) (-496.755) [-498.928] * (-495.622) [-496.090] (-495.988) (-498.408) -- 0:00:42
369500 -- (-499.209) [-494.944] (-498.970) (-495.574) * (-495.300) (-495.249) (-496.815) [-496.975] -- 0:00:42
370000 -- (-499.654) [-502.920] (-494.914) (-496.862) * (-495.128) (-495.903) [-497.936] (-494.735) -- 0:00:42
Average standard deviation of split frequencies: 0.008902
370500 -- (-496.933) [-497.497] (-495.533) (-494.992) * (-497.587) (-496.113) [-494.258] (-495.196) -- 0:00:42
371000 -- (-499.909) (-498.458) (-495.148) [-495.942] * (-495.095) (-495.634) [-494.240] (-494.635) -- 0:00:42
371500 -- (-495.929) [-495.050] (-495.620) (-499.315) * (-496.898) (-500.424) [-495.128] (-497.724) -- 0:00:42
372000 -- (-495.319) (-496.416) [-495.284] (-497.165) * (-494.803) [-500.178] (-496.077) (-496.670) -- 0:00:42
372500 -- (-497.175) (-496.166) [-494.548] (-495.016) * (-498.958) (-496.383) [-498.639] (-497.196) -- 0:00:43
373000 -- [-496.214] (-496.337) (-496.231) (-496.232) * (-499.158) [-495.956] (-498.260) (-496.284) -- 0:00:43
373500 -- (-496.921) [-494.512] (-497.573) (-495.545) * [-495.390] (-495.226) (-495.600) (-495.450) -- 0:00:43
374000 -- (-496.030) (-499.635) (-494.970) [-498.598] * (-494.815) (-497.282) [-495.232] (-495.097) -- 0:00:43
374500 -- [-494.687] (-497.083) (-496.194) (-498.917) * (-496.952) [-495.490] (-494.545) (-495.585) -- 0:00:43
375000 -- (-496.428) (-499.078) [-494.845] (-497.577) * [-497.915] (-496.061) (-497.931) (-496.835) -- 0:00:43
Average standard deviation of split frequencies: 0.009145
375500 -- (-496.029) (-495.153) (-497.032) [-494.504] * [-498.044] (-494.572) (-499.288) (-505.746) -- 0:00:43
376000 -- [-494.911] (-496.365) (-495.930) (-498.083) * (-498.026) (-496.977) [-497.838] (-499.310) -- 0:00:43
376500 -- [-495.292] (-497.837) (-495.035) (-496.918) * (-495.480) (-497.207) [-496.499] (-494.917) -- 0:00:43
377000 -- [-496.285] (-496.366) (-497.326) (-498.476) * (-495.626) (-498.591) [-495.251] (-497.200) -- 0:00:42
377500 -- [-497.030] (-498.122) (-507.166) (-497.803) * (-496.562) (-499.822) [-495.477] (-494.656) -- 0:00:42
378000 -- [-494.873] (-495.452) (-501.219) (-494.832) * (-499.954) [-495.703] (-500.359) (-497.211) -- 0:00:42
378500 -- (-495.157) (-495.252) (-499.826) [-496.745] * (-500.151) (-495.519) (-495.796) [-495.622] -- 0:00:42
379000 -- (-494.658) (-497.412) (-496.457) [-495.761] * (-497.143) (-495.111) (-497.825) [-496.876] -- 0:00:42
379500 -- (-497.984) (-497.037) (-494.835) [-495.573] * (-500.085) (-499.159) [-497.930] (-500.534) -- 0:00:42
380000 -- (-496.248) [-496.318] (-496.215) (-495.101) * (-496.596) (-499.537) [-501.770] (-498.234) -- 0:00:42
Average standard deviation of split frequencies: 0.008377
380500 -- [-496.101] (-501.146) (-495.794) (-498.597) * (-497.561) (-498.818) [-502.249] (-500.259) -- 0:00:42
381000 -- (-496.217) (-497.715) (-496.194) [-498.160] * (-495.671) (-497.212) [-497.704] (-494.422) -- 0:00:42
381500 -- (-497.819) (-497.317) (-499.482) [-495.468] * (-495.954) (-499.466) (-496.378) [-494.622] -- 0:00:42
382000 -- [-497.376] (-497.647) (-496.233) (-496.143) * [-495.986] (-498.950) (-497.877) (-496.739) -- 0:00:42
382500 -- (-496.886) (-498.803) (-501.743) [-495.843] * [-496.004] (-497.080) (-497.944) (-495.338) -- 0:00:41
383000 -- (-494.801) (-497.033) (-496.288) [-496.317] * [-497.355] (-496.171) (-497.910) (-496.342) -- 0:00:41
383500 -- [-496.211] (-499.592) (-496.153) (-496.786) * (-495.533) [-500.649] (-495.392) (-495.734) -- 0:00:41
384000 -- [-496.456] (-496.920) (-495.563) (-495.761) * (-495.478) [-497.756] (-494.587) (-497.540) -- 0:00:41
384500 -- [-496.516] (-498.597) (-497.275) (-498.835) * (-496.126) [-496.512] (-500.820) (-495.384) -- 0:00:41
385000 -- (-496.486) (-495.485) (-496.667) [-497.341] * (-495.156) [-494.784] (-495.332) (-496.213) -- 0:00:41
Average standard deviation of split frequencies: 0.007974
385500 -- [-496.041] (-495.429) (-497.791) (-495.220) * (-498.609) (-497.227) [-496.097] (-498.138) -- 0:00:43
386000 -- [-496.319] (-498.102) (-500.669) (-495.772) * (-498.157) (-498.118) [-496.004] (-495.842) -- 0:00:42
386500 -- (-497.759) [-500.063] (-497.164) (-495.247) * (-496.281) [-496.333] (-496.411) (-502.102) -- 0:00:42
387000 -- [-494.916] (-501.184) (-497.378) (-494.726) * (-495.999) (-496.694) (-494.990) [-500.880] -- 0:00:42
387500 -- (-496.556) (-499.712) (-497.523) [-494.726] * (-496.238) [-495.133] (-495.645) (-497.312) -- 0:00:42
388000 -- (-498.152) (-495.581) [-498.273] (-494.723) * (-498.985) [-495.142] (-496.845) (-499.342) -- 0:00:42
388500 -- (-499.713) (-494.802) (-499.350) [-494.412] * (-501.362) (-495.595) [-496.621] (-495.996) -- 0:00:42
389000 -- [-494.442] (-495.704) (-496.166) (-495.474) * (-497.749) (-497.977) (-494.873) [-495.237] -- 0:00:42
389500 -- (-496.164) (-499.070) [-495.166] (-496.780) * (-497.460) (-505.632) (-494.231) [-497.319] -- 0:00:42
390000 -- [-495.869] (-499.552) (-496.745) (-496.364) * (-497.856) [-502.530] (-496.099) (-494.927) -- 0:00:42
Average standard deviation of split frequencies: 0.008660
390500 -- (-495.281) (-498.129) [-495.471] (-499.394) * [-495.947] (-504.543) (-495.394) (-495.462) -- 0:00:42
391000 -- [-496.411] (-495.888) (-496.983) (-496.377) * [-496.142] (-496.372) (-495.377) (-496.315) -- 0:00:42
391500 -- (-496.978) (-495.146) (-495.676) [-498.269] * (-499.043) [-495.337] (-496.054) (-499.757) -- 0:00:41
392000 -- (-500.081) [-494.929] (-494.251) (-497.961) * (-495.125) (-499.024) [-496.064] (-494.897) -- 0:00:41
392500 -- (-500.312) (-495.977) (-501.576) [-501.160] * (-499.553) (-497.627) (-496.806) [-498.127] -- 0:00:41
393000 -- (-496.855) (-501.289) (-494.529) [-495.979] * (-497.323) (-497.449) [-497.082] (-495.806) -- 0:00:41
393500 -- (-496.165) (-497.024) [-498.674] (-495.652) * (-500.606) (-498.876) [-496.357] (-501.368) -- 0:00:41
394000 -- (-494.454) [-494.110] (-500.450) (-495.076) * (-495.188) [-499.423] (-496.779) (-496.784) -- 0:00:41
394500 -- (-499.170) (-495.007) [-495.134] (-494.805) * (-502.307) (-497.896) [-495.516] (-495.613) -- 0:00:41
395000 -- (-497.781) (-495.799) (-496.129) [-495.147] * [-498.548] (-496.223) (-497.025) (-494.886) -- 0:00:41
Average standard deviation of split frequencies: 0.009033
395500 -- (-495.842) (-497.570) [-494.640] (-495.426) * (-498.586) (-496.359) (-495.193) [-494.846] -- 0:00:41
396000 -- (-498.065) (-498.854) (-497.586) [-494.899] * (-496.821) (-495.802) [-496.893] (-501.680) -- 0:00:41
396500 -- (-494.925) (-495.883) [-497.050] (-495.439) * (-494.653) (-496.663) [-494.870] (-498.103) -- 0:00:41
397000 -- (-494.658) (-503.671) [-497.690] (-495.867) * (-496.721) (-496.364) [-496.880] (-498.612) -- 0:00:41
397500 -- (-494.895) (-498.055) [-498.363] (-497.412) * (-495.902) [-496.504] (-496.085) (-500.786) -- 0:00:40
398000 -- (-494.621) (-496.375) (-500.584) [-496.983] * (-495.877) [-498.058] (-497.656) (-496.877) -- 0:00:40
398500 -- (-496.836) (-498.045) (-497.353) [-495.914] * [-495.563] (-498.327) (-495.003) (-495.233) -- 0:00:40
399000 -- (-497.231) (-496.840) (-494.920) [-497.803] * (-495.007) [-500.447] (-494.805) (-497.175) -- 0:00:40
399500 -- (-499.979) (-497.053) [-495.660] (-495.061) * (-497.525) (-495.678) (-496.644) [-496.493] -- 0:00:42
400000 -- (-498.366) (-503.778) [-496.355] (-494.129) * (-495.176) [-496.508] (-495.833) (-499.161) -- 0:00:41
Average standard deviation of split frequencies: 0.009482
400500 -- [-499.643] (-498.613) (-498.426) (-495.860) * (-499.345) (-496.987) [-494.399] (-497.427) -- 0:00:41
401000 -- (-501.286) (-496.895) (-498.424) [-497.287] * (-495.916) (-494.767) [-495.790] (-495.554) -- 0:00:41
401500 -- [-495.206] (-496.162) (-497.836) (-495.478) * (-495.060) [-499.331] (-496.673) (-496.752) -- 0:00:41
402000 -- [-498.874] (-496.313) (-495.478) (-495.579) * (-497.829) (-496.641) [-494.608] (-499.777) -- 0:00:41
402500 -- [-494.390] (-497.711) (-497.574) (-496.809) * (-495.391) (-497.298) [-495.177] (-494.814) -- 0:00:41
403000 -- (-499.184) (-502.063) (-499.834) [-495.454] * (-496.004) (-497.962) [-499.381] (-495.883) -- 0:00:41
403500 -- (-497.884) [-498.859] (-497.358) (-498.508) * (-496.334) (-496.793) [-498.883] (-495.172) -- 0:00:41
404000 -- (-497.171) (-496.895) [-496.513] (-501.701) * (-496.193) [-496.134] (-495.945) (-495.486) -- 0:00:41
404500 -- (-500.043) (-496.841) (-497.054) [-495.087] * [-496.942] (-496.227) (-497.789) (-496.727) -- 0:00:41
405000 -- (-496.201) (-496.481) [-495.899] (-496.033) * [-497.009] (-497.305) (-502.764) (-495.312) -- 0:00:41
Average standard deviation of split frequencies: 0.008947
405500 -- [-502.133] (-496.424) (-494.417) (-501.258) * (-497.119) (-494.911) [-496.257] (-498.589) -- 0:00:41
406000 -- (-496.308) (-498.837) [-494.730] (-495.292) * (-497.633) (-496.008) (-495.871) [-496.310] -- 0:00:40
406500 -- (-498.391) (-497.226) [-494.497] (-498.128) * (-498.254) (-495.118) [-495.664] (-497.756) -- 0:00:40
407000 -- [-494.838] (-501.299) (-494.456) (-495.663) * [-497.288] (-495.563) (-495.157) (-495.392) -- 0:00:40
407500 -- (-494.672) (-501.056) [-496.478] (-496.853) * (-496.944) (-495.305) (-497.428) [-495.010] -- 0:00:40
408000 -- (-495.680) [-496.872] (-497.093) (-501.764) * (-496.848) [-495.305] (-496.665) (-495.737) -- 0:00:40
408500 -- (-495.420) [-496.381] (-497.619) (-496.369) * (-498.107) [-495.402] (-494.987) (-496.081) -- 0:00:40
409000 -- (-500.256) [-496.240] (-497.118) (-498.388) * (-496.301) (-502.917) [-497.838] (-500.795) -- 0:00:40
409500 -- [-495.043] (-498.363) (-497.290) (-498.585) * (-495.214) [-500.678] (-502.994) (-496.474) -- 0:00:40
410000 -- (-496.165) [-495.277] (-496.777) (-496.168) * (-497.017) (-498.286) (-499.139) [-498.281] -- 0:00:40
Average standard deviation of split frequencies: 0.009398
410500 -- (-498.460) (-499.390) (-497.285) [-496.530] * (-496.962) [-494.746] (-494.518) (-495.321) -- 0:00:40
411000 -- [-499.341] (-499.286) (-499.105) (-496.403) * (-502.567) (-495.528) [-495.238] (-494.973) -- 0:00:40
411500 -- (-495.744) [-497.631] (-496.738) (-498.527) * (-497.364) (-496.940) [-498.493] (-495.267) -- 0:00:40
412000 -- [-496.291] (-495.572) (-496.306) (-504.672) * (-495.609) (-496.173) (-498.089) [-496.280] -- 0:00:39
412500 -- (-494.612) [-494.726] (-496.728) (-498.828) * (-498.444) (-500.391) [-499.440] (-496.159) -- 0:00:39
413000 -- (-498.908) (-497.230) (-498.243) [-496.165] * (-500.778) [-494.901] (-498.496) (-498.201) -- 0:00:39
413500 -- (-500.723) (-496.061) [-497.824] (-496.910) * [-501.477] (-497.783) (-497.229) (-499.448) -- 0:00:39
414000 -- (-496.099) (-495.326) (-498.084) [-501.009] * (-500.705) (-494.962) (-499.037) [-495.641] -- 0:00:41
414500 -- [-494.937] (-497.410) (-495.817) (-496.110) * [-497.936] (-498.987) (-496.025) (-495.209) -- 0:00:40
415000 -- (-497.182) (-497.814) (-494.633) [-495.106] * [-495.952] (-495.611) (-495.482) (-495.349) -- 0:00:40
Average standard deviation of split frequencies: 0.008732
415500 -- (-499.149) (-497.898) [-494.460] (-496.510) * (-495.096) (-495.637) [-496.938] (-497.369) -- 0:00:40
416000 -- (-495.969) (-497.675) [-497.954] (-497.654) * (-498.247) (-495.930) [-496.085] (-495.524) -- 0:00:40
416500 -- [-496.831] (-495.731) (-496.808) (-498.619) * [-494.989] (-495.069) (-496.452) (-498.501) -- 0:00:40
417000 -- (-496.937) (-496.180) [-495.031] (-496.253) * (-495.473) [-494.542] (-498.429) (-496.107) -- 0:00:40
417500 -- [-498.779] (-495.465) (-495.912) (-496.229) * (-495.542) (-494.606) (-495.225) [-496.637] -- 0:00:40
418000 -- (-497.948) (-495.681) [-494.956] (-495.190) * (-496.737) (-495.761) (-495.111) [-495.481] -- 0:00:40
418500 -- (-498.268) [-494.737] (-498.171) (-499.542) * [-494.580] (-494.332) (-496.784) (-498.820) -- 0:00:40
419000 -- (-502.897) (-497.559) [-495.301] (-498.904) * [-496.932] (-497.348) (-497.934) (-498.382) -- 0:00:40
419500 -- [-495.852] (-495.906) (-495.021) (-497.769) * [-500.532] (-496.261) (-496.971) (-499.815) -- 0:00:40
420000 -- [-496.100] (-496.413) (-495.249) (-495.959) * (-496.791) (-496.816) [-494.983] (-497.881) -- 0:00:40
Average standard deviation of split frequencies: 0.008635
420500 -- [-494.811] (-499.603) (-495.276) (-495.183) * (-497.802) (-495.121) [-494.875] (-497.687) -- 0:00:39
421000 -- (-500.690) (-495.403) [-498.373] (-496.524) * [-496.764] (-495.139) (-499.110) (-495.074) -- 0:00:39
421500 -- [-497.541] (-499.040) (-498.588) (-499.406) * (-496.250) (-496.864) (-496.371) [-496.060] -- 0:00:39
422000 -- (-496.913) [-494.832] (-495.064) (-499.009) * [-495.323] (-496.560) (-494.942) (-498.433) -- 0:00:39
422500 -- (-495.672) (-494.846) [-496.280] (-501.840) * (-494.783) (-496.447) [-495.455] (-497.406) -- 0:00:39
423000 -- (-495.447) (-497.515) [-495.329] (-499.026) * [-497.310] (-498.907) (-498.474) (-496.797) -- 0:00:39
423500 -- (-497.438) (-499.095) [-496.007] (-495.909) * (-497.558) (-497.019) (-496.361) [-495.790] -- 0:00:39
424000 -- [-494.494] (-498.805) (-495.079) (-495.750) * (-497.947) (-496.866) [-494.810] (-496.073) -- 0:00:39
424500 -- [-495.184] (-495.562) (-497.348) (-496.335) * [-498.494] (-495.957) (-494.643) (-496.561) -- 0:00:39
425000 -- (-496.521) (-497.249) [-495.322] (-497.080) * (-498.842) (-495.646) (-496.454) [-497.021] -- 0:00:39
Average standard deviation of split frequencies: 0.008202
425500 -- [-495.723] (-501.406) (-498.069) (-496.485) * (-495.535) (-494.445) [-495.685] (-498.593) -- 0:00:39
426000 -- (-495.545) [-495.161] (-495.110) (-497.541) * (-496.525) (-496.025) (-497.043) [-498.362] -- 0:00:39
426500 -- [-495.697] (-495.377) (-497.454) (-498.404) * (-495.512) (-495.226) (-494.796) [-494.850] -- 0:00:38
427000 -- (-498.448) (-495.215) (-495.349) [-497.377] * (-494.633) (-496.191) [-496.259] (-496.988) -- 0:00:38
427500 -- [-497.017] (-495.309) (-494.945) (-495.766) * (-496.511) (-495.237) [-499.056] (-496.827) -- 0:00:38
428000 -- (-500.680) (-495.183) [-495.620] (-498.750) * [-497.351] (-495.621) (-499.595) (-496.375) -- 0:00:40
428500 -- (-498.947) [-496.483] (-494.958) (-497.118) * (-499.471) (-495.517) (-495.071) [-499.803] -- 0:00:40
429000 -- (-498.822) (-498.071) [-497.025] (-495.261) * (-501.574) [-496.327] (-496.168) (-495.623) -- 0:00:39
429500 -- (-498.096) (-498.404) (-499.914) [-496.968] * (-503.857) [-495.367] (-500.093) (-496.571) -- 0:00:39
430000 -- (-498.270) [-496.472] (-495.715) (-496.768) * (-495.995) (-494.459) (-496.033) [-495.842] -- 0:00:39
Average standard deviation of split frequencies: 0.009272
430500 -- (-499.797) [-495.190] (-495.431) (-495.414) * [-496.904] (-498.793) (-496.495) (-495.787) -- 0:00:39
431000 -- (-501.143) (-499.100) [-498.474] (-497.747) * (-496.983) (-498.767) [-495.860] (-495.773) -- 0:00:39
431500 -- (-498.048) (-498.078) [-496.211] (-500.367) * (-498.015) [-494.897] (-497.709) (-496.162) -- 0:00:39
432000 -- (-499.759) (-495.950) (-495.652) [-501.148] * (-496.670) (-495.432) [-498.307] (-498.919) -- 0:00:39
432500 -- [-496.057] (-495.198) (-494.330) (-497.413) * (-500.982) [-497.848] (-497.226) (-496.732) -- 0:00:39
433000 -- (-503.177) [-495.766] (-497.194) (-495.465) * (-494.990) (-495.061) [-494.502] (-495.313) -- 0:00:39
433500 -- (-500.777) (-496.596) [-494.723] (-502.149) * (-497.800) [-495.612] (-494.723) (-495.085) -- 0:00:39
434000 -- [-497.435] (-495.060) (-494.769) (-501.141) * [-500.805] (-494.711) (-495.135) (-496.971) -- 0:00:39
434500 -- (-497.324) (-496.539) [-495.635] (-499.392) * (-500.072) (-495.352) [-495.203] (-495.788) -- 0:00:39
435000 -- (-496.916) (-497.603) [-501.965] (-499.398) * (-499.817) (-494.543) [-495.977] (-497.076) -- 0:00:38
Average standard deviation of split frequencies: 0.007950
435500 -- (-496.358) [-496.047] (-495.227) (-502.226) * (-497.191) (-497.220) [-497.071] (-496.323) -- 0:00:38
436000 -- (-497.859) [-501.555] (-496.462) (-497.347) * (-497.633) [-496.605] (-494.977) (-495.038) -- 0:00:38
436500 -- (-498.672) (-498.951) (-498.240) [-497.240] * (-497.517) (-496.057) (-496.949) [-497.199] -- 0:00:38
437000 -- (-496.510) (-497.163) (-495.461) [-495.582] * [-496.350] (-496.828) (-495.926) (-495.430) -- 0:00:38
437500 -- [-495.651] (-498.528) (-498.402) (-496.668) * (-502.022) (-499.069) [-494.495] (-497.936) -- 0:00:38
438000 -- (-498.684) [-496.465] (-495.949) (-497.215) * (-496.479) (-498.257) [-497.373] (-495.063) -- 0:00:38
438500 -- (-496.160) (-495.612) [-494.750] (-501.452) * (-496.941) (-497.711) (-498.849) [-495.629] -- 0:00:38
439000 -- [-496.165] (-500.243) (-494.583) (-497.954) * (-497.316) [-498.032] (-495.231) (-496.978) -- 0:00:38
439500 -- (-495.229) (-498.333) [-495.168] (-496.721) * (-495.354) [-495.722] (-495.586) (-497.951) -- 0:00:38
440000 -- [-496.209] (-497.108) (-495.078) (-496.284) * [-496.204] (-496.022) (-496.881) (-496.226) -- 0:00:38
Average standard deviation of split frequencies: 0.009360
440500 -- [-495.863] (-495.506) (-495.739) (-497.234) * (-495.413) (-495.011) (-496.800) [-494.969] -- 0:00:38
441000 -- [-496.797] (-496.564) (-496.067) (-496.913) * (-496.192) (-496.499) (-495.993) [-495.301] -- 0:00:38
441500 -- (-499.462) [-494.884] (-496.067) (-494.885) * (-495.052) [-495.996] (-495.563) (-494.431) -- 0:00:37
442000 -- (-495.324) [-496.712] (-495.120) (-495.798) * (-495.078) (-496.623) [-496.731] (-494.871) -- 0:00:37
442500 -- (-496.486) (-496.010) (-495.806) [-497.866] * (-496.406) (-496.467) [-498.970] (-495.062) -- 0:00:39
443000 -- (-496.635) (-498.114) [-494.862] (-495.901) * (-497.339) (-497.801) [-495.836] (-495.886) -- 0:00:38
443500 -- (-498.553) [-496.506] (-495.384) (-498.612) * [-495.210] (-498.316) (-499.848) (-494.968) -- 0:00:38
444000 -- (-496.635) [-495.815] (-496.342) (-495.573) * (-497.988) (-496.729) [-497.109] (-494.473) -- 0:00:38
444500 -- (-496.339) (-497.691) (-496.404) [-495.666] * (-495.376) [-495.654] (-498.999) (-494.699) -- 0:00:38
445000 -- (-497.695) (-498.003) (-496.337) [-495.209] * (-495.686) (-500.267) [-496.234] (-497.733) -- 0:00:38
Average standard deviation of split frequencies: 0.009454
445500 -- (-497.727) [-495.238] (-499.428) (-496.621) * [-495.473] (-497.030) (-494.980) (-497.512) -- 0:00:38
446000 -- (-495.632) (-500.403) [-495.854] (-495.926) * (-495.972) [-496.244] (-494.898) (-497.104) -- 0:00:38
446500 -- (-496.008) (-497.228) (-501.311) [-494.792] * [-497.602] (-495.000) (-495.792) (-496.604) -- 0:00:38
447000 -- [-498.478] (-494.677) (-495.564) (-497.406) * (-495.530) (-496.621) [-495.333] (-496.828) -- 0:00:38
447500 -- [-494.831] (-495.516) (-494.936) (-495.532) * (-496.418) (-496.391) [-497.364] (-498.063) -- 0:00:38
448000 -- (-494.894) (-495.565) [-496.235] (-495.899) * (-498.103) (-495.798) [-496.195] (-497.704) -- 0:00:38
448500 -- (-495.447) [-495.042] (-497.382) (-495.617) * (-499.510) (-495.798) [-495.501] (-495.664) -- 0:00:38
449000 -- (-499.293) (-496.887) [-496.164] (-495.629) * (-498.412) (-496.290) [-495.397] (-495.441) -- 0:00:38
449500 -- (-506.412) (-497.683) [-497.484] (-495.357) * (-497.388) (-496.811) (-499.098) [-500.393] -- 0:00:37
450000 -- [-497.187] (-495.411) (-497.482) (-497.474) * (-496.241) (-495.243) [-497.729] (-497.620) -- 0:00:37
Average standard deviation of split frequencies: 0.008737
450500 -- (-495.784) [-496.030] (-494.927) (-495.954) * (-495.986) [-494.898] (-494.832) (-496.425) -- 0:00:37
451000 -- (-494.238) [-496.557] (-503.853) (-496.638) * (-495.939) (-496.577) (-495.178) [-495.398] -- 0:00:37
451500 -- (-494.334) (-496.975) [-495.745] (-495.220) * (-496.849) (-500.851) [-495.850] (-496.828) -- 0:00:37
452000 -- (-495.955) [-494.399] (-495.779) (-497.405) * [-495.412] (-496.140) (-495.815) (-495.950) -- 0:00:37
452500 -- (-497.247) (-495.379) [-499.545] (-497.086) * (-495.052) (-496.674) [-494.662] (-496.419) -- 0:00:37
453000 -- (-496.520) [-495.346] (-498.580) (-496.302) * [-496.348] (-496.493) (-495.476) (-495.626) -- 0:00:37
453500 -- (-496.433) [-497.209] (-498.864) (-498.002) * (-496.810) [-496.491] (-499.261) (-496.825) -- 0:00:37
454000 -- (-495.880) (-495.520) [-494.987] (-501.739) * (-495.918) (-498.701) [-498.412] (-497.715) -- 0:00:37
454500 -- [-495.611] (-495.103) (-494.993) (-496.217) * (-496.462) [-495.092] (-496.041) (-495.886) -- 0:00:37
455000 -- (-501.895) [-496.729] (-497.866) (-494.679) * (-497.229) (-496.954) [-498.636] (-496.431) -- 0:00:37
Average standard deviation of split frequencies: 0.008757
455500 -- (-501.361) (-495.074) [-496.036] (-496.514) * [-497.481] (-497.378) (-497.542) (-495.568) -- 0:00:37
456000 -- (-496.428) [-498.104] (-496.746) (-498.718) * [-495.272] (-494.722) (-502.453) (-498.944) -- 0:00:36
456500 -- [-496.841] (-497.714) (-495.844) (-497.982) * [-497.890] (-500.247) (-500.620) (-497.532) -- 0:00:36
457000 -- [-498.417] (-500.780) (-498.747) (-496.064) * (-500.363) (-494.706) (-497.254) [-499.222] -- 0:00:38
457500 -- (-496.430) (-495.560) [-504.403] (-496.675) * (-494.943) [-496.916] (-496.182) (-494.763) -- 0:00:37
458000 -- (-497.275) (-496.274) (-502.152) [-495.953] * (-496.941) (-496.837) (-497.069) [-495.764] -- 0:00:37
458500 -- (-505.945) (-497.077) (-499.829) [-497.692] * (-496.994) (-496.240) (-495.751) [-494.827] -- 0:00:37
459000 -- (-498.147) (-495.557) (-498.339) [-495.430] * (-499.242) (-498.017) [-498.488] (-495.396) -- 0:00:37
459500 -- (-496.403) [-497.740] (-497.681) (-495.943) * (-495.120) (-497.678) (-498.659) [-497.064] -- 0:00:37
460000 -- (-496.423) (-498.394) [-496.127] (-496.146) * (-496.805) [-499.368] (-496.952) (-495.652) -- 0:00:37
Average standard deviation of split frequencies: 0.009402
460500 -- (-495.489) [-496.944] (-495.623) (-495.270) * (-499.536) (-494.799) (-496.891) [-500.319] -- 0:00:37
461000 -- [-497.718] (-497.862) (-496.103) (-496.918) * (-496.223) [-494.658] (-498.553) (-495.859) -- 0:00:37
461500 -- (-495.394) (-499.740) [-495.515] (-502.062) * (-497.390) (-494.755) (-496.075) [-499.644] -- 0:00:37
462000 -- (-494.625) (-495.644) [-496.587] (-498.326) * (-498.149) (-495.441) (-496.244) [-497.849] -- 0:00:37
462500 -- (-494.780) (-496.164) [-495.401] (-494.803) * (-500.870) (-494.815) [-495.818] (-498.538) -- 0:00:37
463000 -- [-497.512] (-495.423) (-495.519) (-497.611) * [-495.051] (-496.530) (-496.461) (-504.932) -- 0:00:37
463500 -- (-494.806) [-494.995] (-496.166) (-496.819) * [-496.148] (-495.420) (-498.125) (-496.925) -- 0:00:37
464000 -- (-495.175) [-495.791] (-496.506) (-494.742) * (-496.063) (-496.277) [-496.269] (-494.604) -- 0:00:36
464500 -- (-495.130) (-495.511) (-496.521) [-495.320] * [-494.989] (-496.449) (-497.032) (-497.698) -- 0:00:36
465000 -- (-496.056) [-499.976] (-496.362) (-496.370) * [-495.499] (-496.178) (-499.938) (-497.024) -- 0:00:36
Average standard deviation of split frequencies: 0.008851
465500 -- [-496.553] (-498.142) (-496.787) (-494.265) * [-494.504] (-498.104) (-496.726) (-497.859) -- 0:00:36
466000 -- (-496.386) (-496.696) [-497.259] (-495.190) * [-498.866] (-497.502) (-499.646) (-498.801) -- 0:00:36
466500 -- (-496.929) [-495.015] (-496.226) (-500.469) * [-496.960] (-496.654) (-494.407) (-495.998) -- 0:00:36
467000 -- (-496.797) [-500.705] (-495.795) (-499.683) * (-497.038) [-497.218] (-495.019) (-495.285) -- 0:00:36
467500 -- (-496.622) (-496.568) (-496.960) [-497.853] * (-497.133) (-496.529) [-497.391] (-494.439) -- 0:00:36
468000 -- (-495.553) [-496.835] (-495.167) (-497.760) * [-496.219] (-497.695) (-496.462) (-495.647) -- 0:00:36
468500 -- (-498.125) (-497.916) [-499.283] (-497.295) * (-498.009) (-498.221) [-495.816] (-496.334) -- 0:00:36
469000 -- (-496.563) (-496.644) (-495.869) [-495.317] * (-495.586) (-497.463) [-495.383] (-498.826) -- 0:00:36
469500 -- (-495.473) (-500.908) (-497.750) [-494.585] * (-497.778) (-495.462) (-495.555) [-497.866] -- 0:00:36
470000 -- (-497.530) (-495.925) (-498.505) [-494.443] * [-498.511] (-497.416) (-495.825) (-497.121) -- 0:00:36
Average standard deviation of split frequencies: 0.008013
470500 -- (-496.762) (-495.007) (-495.812) [-496.805] * (-495.832) [-495.320] (-496.163) (-495.251) -- 0:00:36
471000 -- (-495.045) [-495.545] (-495.407) (-496.875) * (-498.714) (-496.560) [-496.657] (-496.009) -- 0:00:37
471500 -- (-496.337) [-495.088] (-496.355) (-495.915) * (-496.091) (-495.854) (-497.252) [-496.072] -- 0:00:36
472000 -- (-497.591) (-496.106) [-495.455] (-495.957) * [-494.673] (-496.339) (-497.787) (-498.219) -- 0:00:36
472500 -- [-498.251] (-495.117) (-495.713) (-495.891) * (-495.244) (-502.770) (-495.670) [-495.404] -- 0:00:36
473000 -- (-496.076) [-495.358] (-494.805) (-496.870) * (-499.357) (-494.649) (-495.612) [-496.426] -- 0:00:36
473500 -- (-496.781) [-495.412] (-500.775) (-497.627) * (-498.568) (-495.885) (-497.938) [-496.660] -- 0:00:36
474000 -- [-496.087] (-495.221) (-496.852) (-496.518) * (-499.040) (-495.184) [-494.673] (-495.581) -- 0:00:36
474500 -- (-496.222) (-495.682) (-495.542) [-497.060] * (-498.700) [-495.008] (-496.793) (-497.643) -- 0:00:36
475000 -- (-495.585) (-495.069) [-497.109] (-495.161) * (-499.064) (-495.888) (-495.142) [-496.484] -- 0:00:36
Average standard deviation of split frequencies: 0.007613
475500 -- (-494.427) (-495.640) (-496.458) [-494.998] * (-499.284) (-502.523) [-495.109] (-496.515) -- 0:00:36
476000 -- (-494.360) (-498.855) (-494.434) [-496.445] * (-494.854) (-497.840) [-495.472] (-501.575) -- 0:00:36
476500 -- [-496.188] (-496.508) (-495.938) (-497.913) * (-495.686) (-498.147) [-494.806] (-497.511) -- 0:00:36
477000 -- (-495.915) [-497.339] (-497.426) (-496.378) * (-495.412) [-496.209] (-495.024) (-497.456) -- 0:00:36
477500 -- (-494.696) [-496.256] (-500.500) (-494.597) * (-497.486) (-496.152) [-495.494] (-495.651) -- 0:00:36
478000 -- [-495.370] (-495.443) (-501.536) (-497.093) * (-494.673) (-496.736) (-495.571) [-495.529] -- 0:00:36
478500 -- (-500.232) [-495.206] (-497.762) (-496.053) * (-495.324) (-498.663) [-496.653] (-496.270) -- 0:00:35
479000 -- (-497.095) (-496.705) [-494.972] (-495.933) * [-496.746] (-495.162) (-495.853) (-496.700) -- 0:00:35
479500 -- (-497.071) [-495.448] (-495.416) (-496.999) * (-495.960) [-495.040] (-497.258) (-497.286) -- 0:00:35
480000 -- (-498.587) (-496.337) (-496.640) [-497.361] * (-495.995) (-495.307) (-497.058) [-501.862] -- 0:00:35
Average standard deviation of split frequencies: 0.007846
480500 -- [-497.538] (-496.559) (-502.627) (-496.295) * (-496.397) (-498.446) [-497.115] (-498.022) -- 0:00:35
481000 -- (-497.042) (-496.714) (-499.399) [-496.434] * (-497.490) (-494.897) [-495.580] (-497.499) -- 0:00:35
481500 -- (-495.073) (-495.752) [-498.410] (-496.406) * (-495.339) (-495.527) (-495.167) [-496.212] -- 0:00:35
482000 -- (-498.705) [-496.272] (-499.152) (-497.799) * (-497.195) (-495.291) [-494.901] (-495.920) -- 0:00:35
482500 -- (-502.261) (-496.433) (-499.771) [-498.769] * (-497.735) (-496.735) (-499.447) [-496.415] -- 0:00:35
483000 -- (-498.536) [-499.575] (-496.414) (-498.034) * (-495.484) (-497.998) [-497.460] (-495.188) -- 0:00:35
483500 -- (-497.581) (-497.770) (-495.823) [-495.899] * (-494.251) (-499.347) (-496.098) [-497.422] -- 0:00:35
484000 -- (-499.623) (-496.725) [-495.910] (-496.266) * (-496.352) (-496.465) (-494.956) [-499.096] -- 0:00:35
484500 -- (-501.176) (-497.448) (-496.113) [-497.841] * [-496.638] (-497.719) (-495.878) (-498.112) -- 0:00:35
485000 -- [-499.863] (-497.420) (-495.395) (-495.447) * (-498.596) (-495.320) (-497.890) [-499.138] -- 0:00:35
Average standard deviation of split frequencies: 0.007335
485500 -- [-495.911] (-498.813) (-494.671) (-498.198) * (-497.482) (-495.484) [-495.378] (-498.419) -- 0:00:36
486000 -- (-497.422) [-496.787] (-495.331) (-497.475) * (-499.716) (-496.619) [-495.496] (-495.021) -- 0:00:35
486500 -- (-499.905) [-494.820] (-494.937) (-495.766) * [-497.157] (-496.329) (-495.886) (-498.174) -- 0:00:35
487000 -- (-499.518) (-496.220) [-494.996] (-495.524) * (-496.477) (-500.414) (-494.821) [-495.862] -- 0:00:35
487500 -- (-495.590) (-495.861) (-507.679) [-497.315] * (-497.938) [-495.284] (-496.956) (-500.064) -- 0:00:35
488000 -- (-497.095) [-497.146] (-496.023) (-498.664) * (-495.919) (-499.286) (-496.387) [-496.955] -- 0:00:35
488500 -- (-495.792) [-496.539] (-495.754) (-495.484) * (-499.576) (-498.797) [-497.561] (-495.204) -- 0:00:35
489000 -- [-496.776] (-500.386) (-494.978) (-500.004) * (-497.032) (-499.098) [-498.154] (-497.320) -- 0:00:35
489500 -- [-496.094] (-498.053) (-495.479) (-497.228) * (-497.603) (-497.222) [-494.918] (-496.337) -- 0:00:35
490000 -- (-499.359) (-496.291) [-495.171] (-496.988) * (-496.443) [-496.818] (-495.206) (-497.310) -- 0:00:35
Average standard deviation of split frequencies: 0.008467
490500 -- (-500.315) (-500.062) (-496.689) [-495.296] * (-495.878) [-496.115] (-503.664) (-495.341) -- 0:00:35
491000 -- (-495.181) (-496.425) [-498.849] (-496.328) * (-495.054) (-496.578) (-502.881) [-498.863] -- 0:00:35
491500 -- [-494.993] (-497.167) (-496.277) (-496.949) * (-500.072) (-495.574) [-495.183] (-500.103) -- 0:00:35
492000 -- (-496.129) [-495.333] (-495.863) (-497.332) * (-497.731) [-496.860] (-495.676) (-497.883) -- 0:00:35
492500 -- (-496.219) (-495.290) [-495.844] (-496.908) * (-495.320) [-496.438] (-496.883) (-499.434) -- 0:00:35
493000 -- [-495.907] (-495.146) (-496.782) (-497.317) * [-494.921] (-496.064) (-497.299) (-494.857) -- 0:00:34
493500 -- (-494.692) (-498.153) (-494.985) [-495.091] * (-495.230) (-496.098) [-497.080] (-496.188) -- 0:00:34
494000 -- [-497.983] (-499.971) (-495.739) (-497.378) * (-494.840) (-494.679) [-494.680] (-498.742) -- 0:00:34
494500 -- (-496.170) (-494.663) (-496.250) [-494.877] * (-500.094) [-495.827] (-495.712) (-497.086) -- 0:00:34
495000 -- (-495.351) (-494.551) (-496.209) [-494.927] * (-498.366) (-500.212) [-496.117] (-496.563) -- 0:00:34
Average standard deviation of split frequencies: 0.008554
495500 -- (-494.740) (-494.544) [-496.958] (-498.855) * [-501.159] (-496.415) (-496.704) (-496.556) -- 0:00:34
496000 -- [-497.753] (-494.921) (-495.668) (-500.195) * (-496.839) (-498.299) [-500.347] (-496.863) -- 0:00:34
496500 -- [-498.994] (-495.798) (-494.747) (-500.071) * (-496.312) [-495.000] (-496.641) (-496.001) -- 0:00:34
497000 -- (-500.034) [-494.881] (-496.299) (-496.604) * (-502.277) [-497.983] (-497.630) (-496.811) -- 0:00:34
497500 -- (-496.609) (-496.770) [-500.382] (-495.184) * (-494.553) (-495.508) (-495.228) [-494.561] -- 0:00:34
498000 -- (-500.372) (-496.005) [-496.591] (-495.753) * [-495.591] (-495.580) (-494.889) (-498.605) -- 0:00:34
498500 -- (-496.903) (-496.502) (-497.776) [-496.364] * [-494.421] (-497.311) (-498.547) (-500.533) -- 0:00:34
499000 -- (-500.172) (-496.967) [-497.602] (-496.835) * (-495.723) (-496.641) (-498.971) [-496.449] -- 0:00:34
499500 -- (-496.258) (-496.397) (-500.476) [-496.261] * [-495.507] (-501.442) (-495.499) (-495.892) -- 0:00:35
500000 -- (-496.178) (-496.686) (-496.750) [-496.052] * (-494.954) (-494.534) (-498.486) [-495.848] -- 0:00:35
Average standard deviation of split frequencies: 0.008062
500500 -- (-496.267) (-495.276) (-497.194) [-496.115] * [-495.563] (-494.624) (-498.308) (-497.103) -- 0:00:34
501000 -- (-496.580) [-501.305] (-494.765) (-496.688) * [-494.441] (-496.804) (-494.999) (-497.566) -- 0:00:34
501500 -- (-496.308) (-500.172) (-494.635) [-496.714] * (-495.560) [-498.632] (-497.709) (-497.588) -- 0:00:34
502000 -- (-496.465) (-499.670) (-496.420) [-495.770] * (-494.583) (-498.403) [-494.503] (-497.052) -- 0:00:34
502500 -- [-497.549] (-495.152) (-496.621) (-497.905) * (-496.147) (-500.683) [-494.616] (-496.129) -- 0:00:34
503000 -- [-497.560] (-501.220) (-496.166) (-497.048) * (-499.791) (-494.494) [-496.013] (-499.918) -- 0:00:34
503500 -- (-497.960) [-496.969] (-496.333) (-494.601) * [-498.045] (-497.345) (-495.930) (-497.443) -- 0:00:34
504000 -- (-499.335) (-498.416) [-497.309] (-494.799) * (-496.339) (-497.862) (-496.512) [-495.261] -- 0:00:34
504500 -- [-494.654] (-494.812) (-495.121) (-498.346) * (-496.642) (-500.210) (-497.715) [-495.522] -- 0:00:34
505000 -- (-495.119) (-497.605) (-496.284) [-495.378] * [-495.915] (-496.030) (-495.021) (-496.217) -- 0:00:34
Average standard deviation of split frequencies: 0.008330
505500 -- (-496.399) (-494.695) (-495.868) [-495.903] * (-496.903) (-499.282) [-498.930] (-496.558) -- 0:00:34
506000 -- [-495.382] (-497.099) (-497.051) (-496.139) * (-497.501) [-495.514] (-495.334) (-495.644) -- 0:00:34
506500 -- (-497.923) (-499.293) (-496.262) [-496.809] * (-497.115) (-498.019) [-496.166] (-498.518) -- 0:00:34
507000 -- (-499.733) (-496.078) [-496.793] (-497.797) * (-496.184) [-497.812] (-497.682) (-498.679) -- 0:00:34
507500 -- [-497.923] (-500.336) (-497.350) (-496.642) * [-495.863] (-499.506) (-496.476) (-501.790) -- 0:00:33
508000 -- [-499.208] (-496.969) (-496.672) (-495.985) * (-495.638) (-497.203) (-499.916) [-500.810] -- 0:00:33
508500 -- (-495.131) (-496.899) [-500.543] (-495.750) * [-495.240] (-495.624) (-497.520) (-496.348) -- 0:00:33
509000 -- (-494.865) (-496.470) [-496.519] (-503.630) * (-497.620) (-497.108) [-495.916] (-496.864) -- 0:00:33
509500 -- (-498.481) [-495.262] (-497.847) (-495.903) * [-496.682] (-495.952) (-495.586) (-496.642) -- 0:00:33
510000 -- (-498.341) [-495.776] (-497.396) (-496.127) * [-495.225] (-496.243) (-495.752) (-497.853) -- 0:00:33
Average standard deviation of split frequencies: 0.007819
510500 -- (-496.126) [-500.608] (-495.898) (-497.866) * (-496.140) [-496.295] (-498.486) (-495.509) -- 0:00:33
511000 -- (-495.241) [-496.189] (-496.336) (-497.362) * (-501.319) (-495.351) (-494.878) [-497.458] -- 0:00:33
511500 -- (-495.208) (-497.102) [-495.151] (-497.001) * [-498.943] (-496.601) (-495.136) (-495.003) -- 0:00:33
512000 -- (-494.632) (-495.414) (-499.231) [-496.162] * (-499.424) (-502.451) (-495.761) [-495.499] -- 0:00:33
512500 -- (-495.608) [-494.793] (-497.497) (-501.191) * (-495.150) (-497.818) [-495.348] (-495.576) -- 0:00:33
513000 -- (-496.617) [-495.421] (-495.774) (-499.598) * (-496.603) [-495.335] (-494.269) (-497.842) -- 0:00:33
513500 -- (-495.464) (-496.845) [-495.487] (-497.796) * (-497.005) [-496.087] (-497.081) (-497.539) -- 0:00:33
514000 -- [-497.466] (-497.571) (-495.673) (-497.211) * (-495.351) (-498.986) (-494.927) [-494.925] -- 0:00:34
514500 -- [-495.620] (-497.237) (-494.302) (-503.294) * [-496.192] (-497.347) (-499.121) (-498.801) -- 0:00:33
515000 -- (-494.518) (-495.554) (-496.969) [-497.054] * [-494.733] (-500.306) (-497.176) (-495.347) -- 0:00:33
Average standard deviation of split frequencies: 0.007953
515500 -- [-495.764] (-496.891) (-494.929) (-495.566) * (-495.296) (-497.685) [-496.479] (-495.333) -- 0:00:33
516000 -- (-499.269) (-496.706) (-496.777) [-497.357] * (-497.903) (-497.261) [-494.489] (-494.466) -- 0:00:33
516500 -- (-494.376) (-496.705) [-495.636] (-500.440) * (-497.026) (-497.874) (-496.164) [-495.038] -- 0:00:33
517000 -- (-495.095) (-496.454) (-497.617) [-500.566] * (-496.669) (-496.972) (-495.618) [-494.980] -- 0:00:33
517500 -- (-495.297) [-496.877] (-497.047) (-499.532) * [-494.716] (-495.235) (-497.155) (-495.501) -- 0:00:33
518000 -- (-497.295) [-496.343] (-497.090) (-498.305) * (-498.266) (-498.596) [-494.711] (-495.281) -- 0:00:33
518500 -- (-496.165) (-497.946) [-494.852] (-495.472) * (-498.485) (-497.089) (-496.685) [-496.253] -- 0:00:33
519000 -- (-498.258) [-495.357] (-497.211) (-495.945) * [-496.033] (-499.513) (-495.693) (-495.604) -- 0:00:33
519500 -- (-498.873) [-495.838] (-494.667) (-495.816) * (-495.249) (-496.592) (-495.368) [-498.911] -- 0:00:33
520000 -- (-495.985) [-494.847] (-495.170) (-497.160) * (-495.794) (-496.825) (-496.944) [-495.868] -- 0:00:33
Average standard deviation of split frequencies: 0.008362
520500 -- (-494.840) (-495.506) (-495.408) [-498.693] * (-497.111) (-495.381) [-497.562] (-496.578) -- 0:00:33
521000 -- [-496.934] (-494.990) (-495.016) (-496.065) * (-498.714) [-499.386] (-496.113) (-496.338) -- 0:00:33
521500 -- [-496.051] (-497.055) (-496.222) (-496.006) * (-496.914) (-499.187) [-496.713] (-495.629) -- 0:00:33
522000 -- (-498.197) (-495.065) (-498.944) [-497.072] * [-497.096] (-502.716) (-499.836) (-497.104) -- 0:00:32
522500 -- (-498.951) [-495.837] (-498.089) (-500.183) * (-495.147) (-495.993) (-496.514) [-497.045] -- 0:00:32
523000 -- (-494.805) [-495.321] (-495.088) (-500.017) * [-496.721] (-495.221) (-496.329) (-495.987) -- 0:00:32
523500 -- [-496.801] (-496.654) (-498.669) (-496.384) * (-501.144) (-495.688) [-496.597] (-498.874) -- 0:00:32
524000 -- [-499.177] (-500.114) (-499.974) (-494.709) * (-501.411) [-497.105] (-501.220) (-496.293) -- 0:00:32
524500 -- (-499.663) (-498.114) [-501.207] (-495.644) * (-498.114) (-494.672) (-497.042) [-497.029] -- 0:00:32
525000 -- [-500.549] (-497.513) (-496.849) (-495.665) * (-499.182) [-497.624] (-495.635) (-496.523) -- 0:00:32
Average standard deviation of split frequencies: 0.007908
525500 -- (-495.690) (-495.750) [-498.597] (-496.114) * [-497.171] (-496.727) (-495.684) (-496.016) -- 0:00:32
526000 -- (-495.661) (-495.067) [-499.770] (-495.754) * [-495.892] (-495.515) (-496.111) (-494.938) -- 0:00:32
526500 -- (-495.555) (-495.743) (-499.787) [-495.020] * (-499.897) [-497.618] (-504.073) (-498.174) -- 0:00:32
527000 -- (-497.687) (-496.313) (-498.775) [-500.321] * (-499.150) [-495.037] (-500.317) (-494.893) -- 0:00:32
527500 -- [-497.442] (-495.381) (-497.920) (-498.312) * (-494.489) (-498.433) [-496.838] (-494.530) -- 0:00:32
528000 -- (-495.079) (-495.130) [-497.124] (-499.748) * (-495.524) [-496.702] (-496.016) (-495.895) -- 0:00:32
528500 -- (-496.462) [-498.664] (-496.381) (-495.634) * (-494.231) (-497.180) [-497.045] (-496.809) -- 0:00:33
529000 -- (-495.542) (-499.054) [-495.693] (-495.634) * (-494.435) [-499.683] (-495.941) (-495.132) -- 0:00:32
529500 -- (-496.184) (-495.653) (-495.214) [-497.325] * (-495.819) (-500.460) [-498.321] (-494.616) -- 0:00:32
530000 -- (-495.524) (-499.411) [-494.669] (-497.253) * [-496.977] (-495.807) (-498.534) (-497.126) -- 0:00:32
Average standard deviation of split frequencies: 0.007681
530500 -- [-494.817] (-497.507) (-496.270) (-498.930) * (-496.418) (-496.946) (-499.670) [-494.805] -- 0:00:32
531000 -- [-494.795] (-498.549) (-494.898) (-496.708) * [-495.947] (-495.734) (-495.928) (-495.820) -- 0:00:32
531500 -- (-499.596) (-501.205) (-496.573) [-496.414] * (-496.156) (-495.803) (-495.511) [-498.304] -- 0:00:32
532000 -- (-498.145) [-496.779] (-496.024) (-495.999) * (-496.451) [-496.238] (-495.333) (-499.837) -- 0:00:32
532500 -- (-497.405) (-495.412) [-494.446] (-496.367) * (-494.466) [-498.340] (-495.515) (-495.793) -- 0:00:32
533000 -- [-495.101] (-494.812) (-496.831) (-495.938) * [-494.305] (-495.455) (-496.447) (-496.591) -- 0:00:32
533500 -- [-496.545] (-495.408) (-495.126) (-495.133) * (-496.904) (-502.995) [-495.634] (-496.433) -- 0:00:32
534000 -- (-498.315) [-495.910] (-494.912) (-499.795) * (-497.105) (-498.199) [-495.435] (-496.584) -- 0:00:32
534500 -- (-497.491) (-498.136) (-498.116) [-497.922] * [-495.354] (-499.069) (-495.025) (-497.131) -- 0:00:32
535000 -- (-494.673) (-496.082) (-496.413) [-503.707] * (-497.782) (-496.619) (-496.284) [-495.741] -- 0:00:32
Average standard deviation of split frequencies: 0.007346
535500 -- [-494.332] (-495.251) (-498.210) (-496.524) * [-495.385] (-494.861) (-495.028) (-495.344) -- 0:00:32
536000 -- [-494.190] (-496.742) (-500.541) (-495.623) * (-502.023) (-496.312) (-499.502) [-496.787] -- 0:00:32
536500 -- [-495.394] (-497.326) (-494.719) (-495.155) * (-498.572) [-495.636] (-494.466) (-498.410) -- 0:00:31
537000 -- (-495.797) (-495.567) [-498.497] (-495.582) * [-496.786] (-499.238) (-497.531) (-500.306) -- 0:00:31
537500 -- (-497.612) (-496.673) [-495.556] (-496.289) * (-497.197) (-498.076) [-497.225] (-499.324) -- 0:00:31
538000 -- (-495.396) (-496.998) [-497.629] (-499.309) * (-497.709) [-495.380] (-497.933) (-497.813) -- 0:00:31
538500 -- (-496.543) (-495.626) [-496.788] (-496.447) * (-496.300) (-498.087) (-501.535) [-499.772] -- 0:00:31
539000 -- (-497.701) (-496.389) (-494.880) [-495.675] * (-495.982) (-494.517) (-497.885) [-496.701] -- 0:00:31
539500 -- (-497.135) [-494.159] (-497.485) (-495.781) * (-498.280) (-495.956) [-501.644] (-495.532) -- 0:00:31
540000 -- (-498.186) (-500.606) [-498.565] (-495.595) * [-498.924] (-499.503) (-495.917) (-495.195) -- 0:00:31
Average standard deviation of split frequencies: 0.007385
540500 -- (-497.420) (-499.173) (-496.697) [-497.624] * (-499.309) [-497.922] (-495.284) (-498.546) -- 0:00:31
541000 -- (-496.724) [-497.016] (-499.391) (-495.683) * (-495.511) [-498.006] (-499.471) (-495.550) -- 0:00:31
541500 -- (-496.398) (-498.682) (-497.390) [-495.629] * (-494.771) [-495.553] (-496.324) (-496.717) -- 0:00:31
542000 -- [-495.882] (-502.030) (-494.517) (-496.311) * (-495.494) [-495.919] (-495.491) (-501.185) -- 0:00:31
542500 -- (-496.166) (-497.622) [-495.188] (-495.865) * (-499.854) [-497.972] (-495.106) (-495.323) -- 0:00:31
543000 -- (-494.885) [-495.971] (-497.912) (-497.067) * (-497.756) (-495.602) (-496.993) [-495.396] -- 0:00:31
543500 -- (-495.672) [-496.354] (-495.700) (-495.774) * (-496.197) (-494.609) [-497.568] (-498.031) -- 0:00:31
544000 -- (-495.794) (-496.293) [-496.123] (-495.322) * (-496.773) [-495.550] (-495.670) (-497.907) -- 0:00:31
544500 -- (-494.288) (-497.264) [-496.601] (-496.612) * [-497.781] (-498.851) (-497.762) (-494.618) -- 0:00:31
545000 -- (-495.817) (-500.730) (-495.964) [-497.197] * [-496.244] (-496.699) (-500.733) (-498.048) -- 0:00:31
Average standard deviation of split frequencies: 0.007516
545500 -- (-498.715) (-496.600) [-497.031] (-497.158) * (-496.229) [-498.574] (-498.149) (-495.008) -- 0:00:31
546000 -- [-498.572] (-497.584) (-498.810) (-499.891) * (-498.893) (-495.386) (-499.858) [-496.031] -- 0:00:31
546500 -- (-496.150) (-496.814) [-494.752] (-496.986) * (-499.901) (-494.942) (-498.932) [-496.298] -- 0:00:31
547000 -- (-498.560) (-500.540) (-497.073) [-495.546] * (-496.611) [-498.457] (-496.009) (-497.489) -- 0:00:31
547500 -- (-494.354) (-495.810) (-498.472) [-495.708] * [-499.852] (-494.258) (-496.550) (-496.887) -- 0:00:31
548000 -- (-497.537) (-494.904) (-495.571) [-496.120] * (-495.311) (-497.473) [-498.564] (-497.566) -- 0:00:31
548500 -- (-494.247) [-497.758] (-497.172) (-499.621) * [-495.851] (-497.451) (-497.141) (-495.114) -- 0:00:31
549000 -- (-495.100) [-498.450] (-496.795) (-495.841) * (-496.479) (-495.453) (-496.051) [-497.840] -- 0:00:31
549500 -- (-495.503) [-495.852] (-495.508) (-495.789) * (-496.414) (-496.231) (-496.541) [-497.279] -- 0:00:31
550000 -- (-496.322) (-498.311) [-496.588] (-496.514) * (-500.413) [-499.032] (-496.804) (-497.723) -- 0:00:31
Average standard deviation of split frequencies: 0.007755
550500 -- [-495.167] (-495.969) (-499.398) (-495.863) * (-499.262) (-497.543) (-498.200) [-497.163] -- 0:00:31
551000 -- (-494.975) (-497.385) [-499.251] (-498.578) * (-495.900) (-498.228) (-498.084) [-496.207] -- 0:00:30
551500 -- (-494.381) [-497.085] (-495.197) (-496.286) * (-496.588) [-494.536] (-500.595) (-498.146) -- 0:00:30
552000 -- [-494.589] (-495.023) (-497.100) (-497.603) * (-495.446) (-495.106) [-500.432] (-496.120) -- 0:00:30
552500 -- (-497.791) (-496.280) (-495.582) [-495.319] * (-495.038) (-495.768) [-499.379] (-496.439) -- 0:00:30
553000 -- (-499.422) (-495.864) (-501.321) [-496.424] * (-497.254) (-495.437) [-496.498] (-497.735) -- 0:00:30
553500 -- (-495.038) (-496.573) [-498.897] (-495.666) * (-495.869) [-495.878] (-494.455) (-501.382) -- 0:00:30
554000 -- (-494.293) (-496.705) [-497.298] (-500.055) * (-496.679) (-496.690) [-497.951] (-494.627) -- 0:00:30
554500 -- [-495.694] (-496.141) (-497.841) (-501.307) * (-498.527) (-500.074) [-494.575] (-496.024) -- 0:00:30
555000 -- [-496.569] (-495.339) (-497.192) (-497.886) * (-498.025) (-500.227) [-496.747] (-495.152) -- 0:00:30
Average standard deviation of split frequencies: 0.007780
555500 -- [-499.850] (-495.176) (-495.426) (-502.984) * (-500.007) [-497.961] (-495.529) (-497.171) -- 0:00:30
556000 -- (-499.850) (-495.481) (-495.262) [-495.497] * (-494.513) (-502.156) (-496.961) [-496.809] -- 0:00:30
556500 -- (-495.475) [-495.655] (-495.758) (-495.900) * (-497.235) [-496.222] (-496.070) (-496.307) -- 0:00:30
557000 -- (-495.228) [-498.383] (-494.748) (-496.391) * (-495.942) (-495.311) (-497.149) [-495.901] -- 0:00:30
557500 -- (-503.143) (-498.471) (-499.261) [-494.489] * (-495.130) (-497.074) [-496.643] (-497.378) -- 0:00:30
558000 -- (-497.952) [-497.064] (-497.297) (-494.913) * (-497.869) (-497.471) [-502.279] (-497.987) -- 0:00:30
558500 -- (-497.244) (-494.593) [-497.851] (-496.470) * (-498.483) (-496.095) (-499.239) [-497.815] -- 0:00:30
559000 -- [-497.461] (-496.452) (-498.737) (-498.262) * (-496.893) [-495.826] (-497.175) (-497.176) -- 0:00:30
559500 -- (-496.308) (-498.015) [-494.863] (-496.069) * [-494.948] (-494.550) (-498.792) (-495.195) -- 0:00:30
560000 -- [-496.735] (-495.035) (-496.798) (-498.696) * (-496.549) [-495.691] (-497.969) (-499.143) -- 0:00:30
Average standard deviation of split frequencies: 0.008507
560500 -- (-495.768) [-497.871] (-497.518) (-498.529) * [-495.119] (-497.661) (-498.314) (-497.414) -- 0:00:30
561000 -- (-495.830) (-499.721) [-495.969] (-495.532) * (-494.947) (-494.928) [-497.245] (-496.709) -- 0:00:30
561500 -- (-496.755) (-495.620) [-495.143] (-494.747) * [-495.424] (-498.816) (-495.687) (-498.306) -- 0:00:30
562000 -- (-497.906) (-494.671) (-495.267) [-494.523] * (-495.766) (-496.173) (-496.787) [-494.935] -- 0:00:30
562500 -- (-495.692) (-502.552) (-494.855) [-496.034] * [-498.798] (-499.496) (-495.731) (-496.772) -- 0:00:30
563000 -- (-500.996) (-497.662) [-498.816] (-498.564) * (-496.726) [-498.531] (-496.806) (-497.026) -- 0:00:30
563500 -- (-496.584) [-499.878] (-495.637) (-501.226) * (-497.929) (-499.843) (-496.110) [-499.666] -- 0:00:30
564000 -- (-495.766) [-498.815] (-496.461) (-501.468) * [-497.466] (-497.272) (-494.817) (-496.610) -- 0:00:30
564500 -- (-498.076) (-506.141) [-497.080] (-497.291) * [-496.792] (-495.730) (-499.136) (-497.916) -- 0:00:30
565000 -- (-495.727) (-499.090) (-494.667) [-497.718] * (-494.874) (-495.822) (-496.013) [-496.318] -- 0:00:30
Average standard deviation of split frequencies: 0.007986
565500 -- (-496.283) (-502.732) (-496.641) [-498.180] * [-495.747] (-494.771) (-500.090) (-497.970) -- 0:00:29
566000 -- (-495.412) (-496.957) [-496.871] (-496.907) * (-496.904) [-495.128] (-502.573) (-495.639) -- 0:00:29
566500 -- (-496.341) [-497.482] (-500.808) (-497.185) * (-500.615) [-501.117] (-495.885) (-495.100) -- 0:00:29
567000 -- (-499.666) [-495.597] (-500.021) (-496.595) * (-500.831) [-495.195] (-495.723) (-496.337) -- 0:00:29
567500 -- (-498.162) (-495.442) (-495.439) [-497.829] * [-495.493] (-495.657) (-497.910) (-498.759) -- 0:00:29
568000 -- (-501.429) [-501.249] (-495.399) (-499.162) * (-495.071) (-495.881) [-495.122] (-495.805) -- 0:00:29
568500 -- (-495.022) [-495.655] (-495.126) (-499.686) * (-495.974) (-496.486) (-495.515) [-495.731] -- 0:00:29
569000 -- [-495.299] (-496.086) (-494.618) (-494.778) * [-498.556] (-496.674) (-496.489) (-498.735) -- 0:00:29
569500 -- (-496.534) (-495.718) [-496.172] (-497.005) * (-497.011) (-496.701) [-497.076] (-495.911) -- 0:00:29
570000 -- (-495.380) (-497.370) [-498.337] (-496.297) * (-496.320) [-498.615] (-497.755) (-496.355) -- 0:00:29
Average standard deviation of split frequencies: 0.008455
570500 -- (-497.680) [-498.160] (-498.348) (-495.053) * (-502.455) (-496.764) [-494.274] (-494.336) -- 0:00:29
571000 -- (-495.436) (-496.791) (-497.989) [-495.566] * (-501.010) (-495.733) [-497.204] (-498.262) -- 0:00:29
571500 -- (-494.671) (-500.603) (-497.199) [-496.867] * [-496.178] (-496.817) (-497.981) (-495.746) -- 0:00:29
572000 -- (-498.526) [-494.621] (-496.297) (-496.600) * (-496.974) [-494.918] (-495.745) (-501.149) -- 0:00:29
572500 -- [-497.972] (-495.810) (-500.835) (-495.861) * (-496.497) (-495.893) (-495.927) [-494.839] -- 0:00:29
573000 -- [-495.723] (-498.098) (-498.742) (-495.706) * (-497.182) (-494.520) (-497.616) [-494.819] -- 0:00:29
573500 -- (-497.018) (-498.353) (-497.503) [-496.623] * (-497.084) (-496.545) [-496.321] (-504.522) -- 0:00:29
574000 -- [-495.723] (-496.169) (-496.740) (-496.445) * (-498.794) [-496.865] (-494.550) (-497.576) -- 0:00:29
574500 -- (-495.281) (-496.319) (-497.287) [-498.448] * (-497.719) (-496.500) (-497.776) [-496.383] -- 0:00:29
575000 -- [-494.980] (-498.246) (-500.973) (-496.219) * (-497.793) [-495.533] (-497.228) (-496.512) -- 0:00:29
Average standard deviation of split frequencies: 0.009003
575500 -- [-495.230] (-497.658) (-496.135) (-497.209) * (-496.884) [-495.058] (-496.698) (-495.769) -- 0:00:29
576000 -- (-496.871) [-495.260] (-496.378) (-498.189) * [-495.706] (-496.313) (-502.328) (-498.425) -- 0:00:29
576500 -- (-498.210) [-495.705] (-502.119) (-494.970) * (-496.389) (-495.921) [-497.689] (-497.067) -- 0:00:29
577000 -- (-496.200) [-495.815] (-496.951) (-498.538) * (-498.092) [-494.615] (-497.508) (-496.765) -- 0:00:29
577500 -- (-499.064) (-496.569) (-499.698) [-498.457] * (-497.002) (-497.966) [-498.265] (-496.232) -- 0:00:29
578000 -- (-501.260) [-497.831] (-495.647) (-495.468) * (-495.953) (-499.865) [-495.978] (-494.693) -- 0:00:29
578500 -- [-496.288] (-498.376) (-495.326) (-494.224) * (-496.777) (-496.907) [-495.178] (-495.908) -- 0:00:29
579000 -- (-496.371) [-495.954] (-494.859) (-494.772) * (-497.403) (-495.710) [-497.163] (-496.193) -- 0:00:29
579500 -- (-495.252) [-495.145] (-495.738) (-496.555) * (-496.704) (-499.415) (-496.254) [-497.331] -- 0:00:29
580000 -- [-496.755] (-495.549) (-498.386) (-494.842) * (-497.577) (-497.046) (-499.288) [-495.651] -- 0:00:28
Average standard deviation of split frequencies: 0.008787
580500 -- (-495.526) [-501.455] (-495.775) (-497.174) * (-496.193) [-499.013] (-501.272) (-496.205) -- 0:00:28
581000 -- [-495.257] (-499.425) (-496.449) (-494.857) * (-495.229) [-498.170] (-497.399) (-499.045) -- 0:00:28
581500 -- (-494.618) (-496.000) (-495.654) [-495.956] * (-497.903) (-494.956) [-495.447] (-506.058) -- 0:00:28
582000 -- (-495.837) [-496.267] (-496.257) (-498.144) * (-496.939) (-495.584) [-496.283] (-496.159) -- 0:00:28
582500 -- (-498.938) [-496.192] (-498.007) (-497.695) * [-504.520] (-495.782) (-498.536) (-499.532) -- 0:00:28
583000 -- (-496.572) (-500.172) [-496.882] (-498.598) * (-502.169) (-495.758) (-495.805) [-497.029] -- 0:00:28
583500 -- [-497.315] (-494.461) (-495.079) (-497.891) * [-500.401] (-498.492) (-496.612) (-499.050) -- 0:00:28
584000 -- [-495.419] (-498.616) (-496.123) (-496.038) * (-495.349) (-500.477) [-498.138] (-496.803) -- 0:00:28
584500 -- (-494.925) (-495.483) (-495.564) [-498.085] * [-495.142] (-498.781) (-500.104) (-496.046) -- 0:00:28
585000 -- (-495.888) (-498.319) (-502.843) [-494.819] * (-497.467) [-497.345] (-500.368) (-498.024) -- 0:00:28
Average standard deviation of split frequencies: 0.008268
585500 -- (-495.023) (-498.377) (-496.307) [-497.384] * (-495.275) (-496.681) [-496.693] (-498.653) -- 0:00:28
586000 -- (-494.784) [-497.987] (-500.895) (-494.825) * (-497.644) (-499.197) (-494.683) [-494.897] -- 0:00:28
586500 -- (-499.191) [-495.369] (-497.059) (-500.078) * [-495.578] (-495.621) (-497.102) (-496.056) -- 0:00:28
587000 -- (-502.118) (-497.943) (-494.461) [-498.018] * (-495.664) (-497.086) [-494.881] (-495.434) -- 0:00:28
587500 -- (-499.652) (-499.954) [-495.256] (-497.479) * [-496.184] (-495.874) (-495.170) (-497.785) -- 0:00:28
588000 -- (-497.549) [-495.386] (-498.826) (-496.558) * (-500.087) (-495.085) [-495.703] (-498.834) -- 0:00:28
588500 -- (-495.177) (-496.242) [-494.856] (-494.578) * (-495.673) (-494.515) (-495.912) [-495.839] -- 0:00:28
589000 -- (-496.686) [-499.637] (-495.942) (-497.640) * (-498.028) [-496.796] (-495.180) (-495.687) -- 0:00:28
589500 -- (-494.862) (-497.509) (-494.805) [-501.231] * [-497.020] (-496.500) (-498.072) (-500.367) -- 0:00:28
590000 -- (-496.088) (-495.324) (-495.733) [-496.006] * [-495.819] (-497.756) (-504.878) (-496.458) -- 0:00:28
Average standard deviation of split frequencies: 0.008180
590500 -- (-495.662) (-495.800) [-495.284] (-494.362) * (-497.065) [-496.820] (-497.528) (-496.825) -- 0:00:28
591000 -- (-498.240) (-501.011) [-497.239] (-495.844) * [-495.858] (-495.949) (-495.564) (-495.941) -- 0:00:28
591500 -- (-496.710) [-496.485] (-500.078) (-494.873) * (-496.556) (-496.046) [-495.581] (-497.526) -- 0:00:28
592000 -- [-497.129] (-497.694) (-495.350) (-496.912) * (-497.883) (-496.831) (-497.408) [-495.171] -- 0:00:28
592500 -- (-499.254) [-494.898] (-501.588) (-495.990) * [-495.465] (-500.828) (-496.655) (-499.590) -- 0:00:28
593000 -- (-496.547) [-502.643] (-501.698) (-496.471) * [-496.640] (-497.526) (-494.634) (-500.860) -- 0:00:28
593500 -- (-499.797) [-495.516] (-498.203) (-495.578) * (-498.468) [-495.824] (-495.967) (-497.767) -- 0:00:28
594000 -- [-498.089] (-495.832) (-497.060) (-496.261) * (-496.225) [-495.416] (-496.436) (-495.242) -- 0:00:28
594500 -- (-500.509) (-494.811) (-503.848) [-496.255] * (-497.581) (-497.324) (-495.702) [-494.571] -- 0:00:27
595000 -- (-496.599) [-494.929] (-496.831) (-494.319) * [-495.380] (-498.861) (-499.071) (-495.391) -- 0:00:27
Average standard deviation of split frequencies: 0.008799
595500 -- (-497.039) (-495.091) (-496.902) [-499.226] * (-495.474) (-501.090) [-498.898] (-495.759) -- 0:00:27
596000 -- (-498.290) [-496.103] (-498.265) (-496.066) * (-495.313) (-499.101) (-497.974) [-494.639] -- 0:00:27
596500 -- (-495.301) (-497.671) [-496.492] (-497.390) * (-496.641) (-503.628) [-504.508] (-496.544) -- 0:00:27
597000 -- [-498.779] (-496.123) (-496.586) (-497.295) * (-496.258) [-497.618] (-500.605) (-496.236) -- 0:00:27
597500 -- (-496.914) (-496.481) (-496.018) [-496.720] * [-497.199] (-494.514) (-496.733) (-497.567) -- 0:00:27
598000 -- (-498.831) (-495.911) [-496.431] (-504.393) * [-494.827] (-494.982) (-497.828) (-501.122) -- 0:00:27
598500 -- (-497.196) (-499.375) [-494.541] (-501.680) * [-495.390] (-495.434) (-496.888) (-499.066) -- 0:00:27
599000 -- (-499.410) (-494.667) [-495.522] (-496.267) * [-498.261] (-494.610) (-497.104) (-497.706) -- 0:00:27
599500 -- (-494.964) [-494.853] (-495.427) (-496.991) * [-498.809] (-497.090) (-501.124) (-499.892) -- 0:00:27
600000 -- (-494.830) (-495.118) [-497.108] (-495.485) * (-498.480) (-497.899) (-499.026) [-495.315] -- 0:00:27
Average standard deviation of split frequencies: 0.008339
600500 -- (-497.087) [-497.186] (-499.289) (-496.894) * [-495.980] (-498.733) (-498.609) (-496.099) -- 0:00:27
601000 -- (-495.075) [-496.959] (-502.450) (-497.210) * (-496.421) (-498.686) (-498.348) [-495.932] -- 0:00:27
601500 -- (-499.085) (-495.270) (-499.553) [-495.367] * (-498.845) (-498.101) (-501.609) [-496.990] -- 0:00:27
602000 -- (-496.467) (-496.633) [-498.924] (-496.806) * [-499.587] (-496.873) (-498.480) (-497.065) -- 0:00:27
602500 -- [-495.507] (-496.974) (-496.417) (-496.898) * (-495.949) (-498.927) (-497.658) [-495.797] -- 0:00:27
603000 -- (-498.035) (-495.234) (-498.725) [-494.392] * [-496.799] (-494.506) (-498.037) (-497.527) -- 0:00:27
603500 -- (-499.029) (-495.112) [-497.220] (-495.288) * (-495.844) (-494.735) (-498.559) [-497.703] -- 0:00:27
604000 -- (-502.507) [-496.109] (-498.950) (-497.127) * [-496.099] (-495.074) (-499.748) (-501.681) -- 0:00:27
604500 -- (-501.709) (-496.346) (-500.129) [-494.509] * (-496.344) [-494.661] (-495.322) (-497.264) -- 0:00:27
605000 -- [-498.455] (-499.498) (-499.781) (-496.540) * (-499.234) (-494.790) [-497.675] (-498.336) -- 0:00:27
Average standard deviation of split frequencies: 0.008071
605500 -- (-500.154) (-497.602) [-495.604] (-496.283) * (-499.066) (-495.714) (-496.685) [-500.652] -- 0:00:27
606000 -- (-495.651) (-498.177) (-494.607) [-496.202] * (-496.721) (-495.673) [-495.100] (-494.203) -- 0:00:27
606500 -- (-496.000) (-497.523) (-496.782) [-498.580] * (-496.741) [-495.679] (-497.128) (-494.634) -- 0:00:27
607000 -- (-497.496) (-500.350) (-500.874) [-497.791] * (-499.672) (-495.852) (-495.713) [-496.826] -- 0:00:27
607500 -- (-495.567) [-496.240] (-500.234) (-498.411) * (-497.720) (-497.766) [-497.215] (-497.226) -- 0:00:27
608000 -- (-496.451) (-496.289) [-496.092] (-497.387) * (-496.144) (-494.685) (-499.119) [-495.337] -- 0:00:27
608500 -- [-497.301] (-496.394) (-497.004) (-495.225) * (-494.329) (-497.732) (-498.009) [-496.107] -- 0:00:27
609000 -- (-494.848) (-497.805) (-494.932) [-496.758] * [-496.446] (-499.924) (-494.586) (-496.381) -- 0:00:26
609500 -- (-496.540) [-497.076] (-495.362) (-495.437) * (-495.402) (-513.391) [-495.131] (-494.852) -- 0:00:26
610000 -- (-495.582) [-495.257] (-496.444) (-497.246) * (-501.778) (-497.157) [-495.407] (-499.889) -- 0:00:26
Average standard deviation of split frequencies: 0.008974
610500 -- [-496.444] (-495.109) (-495.046) (-499.454) * (-506.400) (-495.743) [-494.773] (-497.048) -- 0:00:26
611000 -- (-498.231) (-496.044) (-499.295) [-498.639] * (-496.273) (-498.264) (-495.159) [-495.769] -- 0:00:26
611500 -- [-495.653] (-497.043) (-497.615) (-498.440) * [-495.714] (-501.223) (-499.751) (-495.522) -- 0:00:26
612000 -- (-497.133) (-497.759) (-495.231) [-498.508] * (-495.173) (-495.777) [-498.152] (-497.778) -- 0:00:26
612500 -- (-495.396) [-498.513] (-497.843) (-497.634) * (-499.212) [-494.994] (-495.995) (-496.373) -- 0:00:26
613000 -- (-495.195) (-497.998) [-495.610] (-498.083) * (-497.698) (-498.026) [-496.944] (-495.943) -- 0:00:26
613500 -- (-496.062) (-495.996) (-497.940) [-495.663] * [-497.249] (-498.751) (-495.764) (-495.646) -- 0:00:26
614000 -- (-495.511) [-495.684] (-497.672) (-499.763) * (-495.908) (-496.307) (-500.176) [-498.832] -- 0:00:26
614500 -- (-498.109) (-496.250) [-498.253] (-496.019) * [-495.123] (-495.633) (-498.067) (-497.725) -- 0:00:26
615000 -- (-495.449) [-496.045] (-498.050) (-496.943) * (-496.667) [-496.123] (-497.770) (-496.183) -- 0:00:26
Average standard deviation of split frequencies: 0.008913
615500 -- (-495.323) [-494.848] (-496.137) (-497.685) * (-500.650) [-498.589] (-494.959) (-495.411) -- 0:00:26
616000 -- [-495.273] (-495.677) (-496.641) (-495.410) * (-501.032) (-501.853) (-500.948) [-498.899] -- 0:00:26
616500 -- [-495.006] (-495.062) (-495.467) (-497.872) * (-498.344) [-501.007] (-498.201) (-496.183) -- 0:00:26
617000 -- (-496.790) [-495.120] (-500.190) (-496.503) * [-498.218] (-497.653) (-498.930) (-499.909) -- 0:00:26
617500 -- (-494.945) [-495.162] (-497.595) (-497.964) * (-497.795) (-494.725) [-494.980] (-495.013) -- 0:00:26
618000 -- (-502.083) [-495.042] (-497.667) (-497.565) * (-495.161) [-495.213] (-495.416) (-496.374) -- 0:00:26
618500 -- [-497.024] (-495.172) (-494.673) (-499.435) * [-496.831] (-496.285) (-496.259) (-499.022) -- 0:00:26
619000 -- (-501.468) (-495.063) [-495.291] (-500.964) * (-500.747) (-496.204) [-494.931] (-500.325) -- 0:00:26
619500 -- (-495.242) (-496.935) [-495.768] (-501.583) * (-496.325) [-495.811] (-495.801) (-501.430) -- 0:00:26
620000 -- (-496.832) [-496.972] (-496.553) (-495.572) * (-499.367) (-495.209) (-496.785) [-495.825] -- 0:00:26
Average standard deviation of split frequencies: 0.009209
620500 -- (-501.536) (-495.717) [-496.415] (-494.657) * (-500.087) (-495.221) [-496.032] (-496.227) -- 0:00:26
621000 -- (-494.704) (-495.243) (-495.884) [-494.708] * [-496.550] (-498.031) (-498.509) (-497.241) -- 0:00:26
621500 -- (-497.554) (-495.438) [-495.450] (-496.934) * [-497.217] (-495.338) (-495.176) (-497.046) -- 0:00:26
622000 -- (-494.763) (-498.264) (-494.759) [-494.935] * (-496.070) [-494.281] (-495.310) (-499.654) -- 0:00:26
622500 -- (-495.012) (-496.380) (-495.678) [-497.262] * (-494.692) [-498.180] (-497.775) (-498.660) -- 0:00:26
623000 -- (-494.434) [-495.473] (-497.967) (-497.793) * (-495.337) (-497.933) (-504.412) [-495.046] -- 0:00:26
623500 -- (-494.546) [-499.056] (-499.037) (-494.355) * (-495.117) (-500.740) [-497.384] (-497.237) -- 0:00:25
624000 -- (-495.393) (-499.380) [-499.974] (-497.896) * [-495.290] (-496.743) (-496.673) (-496.927) -- 0:00:25
624500 -- [-495.198] (-495.910) (-497.277) (-497.289) * (-500.560) [-494.462] (-496.393) (-497.791) -- 0:00:25
625000 -- (-495.463) (-494.951) (-497.594) [-500.224] * (-500.990) (-494.725) [-495.917] (-498.362) -- 0:00:25
Average standard deviation of split frequencies: 0.008942
625500 -- (-494.932) (-495.487) [-496.330] (-500.209) * [-495.559] (-494.690) (-496.132) (-496.417) -- 0:00:25
626000 -- (-496.301) [-498.700] (-495.762) (-497.294) * (-495.870) (-495.266) (-494.506) [-496.023] -- 0:00:25
626500 -- [-496.155] (-496.123) (-496.243) (-498.865) * (-496.963) (-498.536) (-495.976) [-494.519] -- 0:00:25
627000 -- (-497.224) (-495.317) [-496.610] (-495.550) * (-497.238) (-498.698) (-497.434) [-495.133] -- 0:00:25
627500 -- (-499.083) (-495.536) [-497.107] (-496.994) * (-498.496) (-498.613) (-495.652) [-499.705] -- 0:00:25
628000 -- (-496.259) [-494.899] (-500.389) (-495.540) * [-499.985] (-499.128) (-495.693) (-495.953) -- 0:00:25
628500 -- (-495.566) [-497.639] (-495.493) (-497.867) * (-498.203) (-498.728) [-498.071] (-495.362) -- 0:00:25
629000 -- (-501.859) (-495.879) [-495.624] (-498.929) * [-497.968] (-496.774) (-498.624) (-498.248) -- 0:00:25
629500 -- [-496.253] (-495.849) (-496.658) (-495.282) * (-494.943) (-495.445) (-497.266) [-497.783] -- 0:00:25
630000 -- [-495.162] (-497.168) (-497.838) (-495.861) * (-495.193) (-494.514) [-494.395] (-497.042) -- 0:00:25
Average standard deviation of split frequencies: 0.008926
630500 -- (-495.980) (-494.501) [-494.446] (-495.036) * [-495.318] (-497.150) (-495.491) (-494.745) -- 0:00:25
631000 -- (-497.291) (-499.462) [-495.609] (-496.208) * (-496.521) (-500.747) [-495.669] (-497.526) -- 0:00:25
631500 -- (-497.376) (-495.778) [-495.244] (-498.778) * (-497.350) (-498.578) [-495.367] (-498.503) -- 0:00:25
632000 -- [-497.836] (-496.208) (-495.310) (-495.894) * (-495.891) (-497.402) [-498.200] (-498.287) -- 0:00:25
632500 -- (-497.027) (-500.283) [-495.121] (-496.130) * [-497.192] (-497.449) (-497.061) (-495.067) -- 0:00:25
633000 -- (-498.653) (-499.603) (-497.254) [-495.323] * (-496.356) (-497.427) [-496.262] (-495.068) -- 0:00:25
633500 -- [-496.486] (-495.336) (-499.663) (-495.985) * (-496.408) [-495.262] (-496.615) (-494.896) -- 0:00:25
634000 -- (-497.277) [-498.436] (-498.330) (-494.921) * (-497.960) [-494.491] (-500.562) (-494.498) -- 0:00:25
634500 -- (-495.147) [-494.444] (-498.558) (-496.484) * [-495.425] (-494.563) (-494.692) (-494.535) -- 0:00:25
635000 -- [-496.172] (-498.189) (-502.692) (-499.316) * (-496.589) [-495.175] (-497.591) (-495.354) -- 0:00:25
Average standard deviation of split frequencies: 0.008720
635500 -- (-495.664) [-496.496] (-495.203) (-495.038) * (-494.817) (-498.209) (-495.924) [-502.030] -- 0:00:25
636000 -- [-495.260] (-496.584) (-496.606) (-495.140) * (-497.467) [-497.868] (-497.107) (-496.898) -- 0:00:25
636500 -- (-497.167) [-497.287] (-495.364) (-495.856) * (-497.473) (-496.244) (-502.229) [-497.350] -- 0:00:25
637000 -- (-497.034) [-497.850] (-496.895) (-498.105) * (-496.552) [-497.943] (-495.545) (-496.753) -- 0:00:25
637500 -- (-497.737) (-495.506) [-496.400] (-496.883) * (-497.065) [-496.254] (-495.529) (-500.756) -- 0:00:25
638000 -- (-500.987) [-496.538] (-496.123) (-497.355) * (-501.278) (-497.827) (-499.458) [-495.699] -- 0:00:24
638500 -- (-497.391) (-498.741) [-499.196] (-499.176) * (-494.944) [-496.809] (-495.034) (-501.018) -- 0:00:24
639000 -- (-497.090) (-499.341) [-494.900] (-495.456) * (-495.834) (-495.839) (-495.434) [-495.511] -- 0:00:24
639500 -- [-495.974] (-497.041) (-495.960) (-497.557) * (-497.399) (-495.770) [-495.502] (-495.426) -- 0:00:24
640000 -- (-496.405) (-498.675) [-497.511] (-498.946) * (-495.965) (-497.428) [-497.326] (-495.881) -- 0:00:24
Average standard deviation of split frequencies: 0.008743
640500 -- (-495.297) (-497.010) (-501.264) [-497.275] * (-496.745) [-496.858] (-497.467) (-494.302) -- 0:00:24
641000 -- (-497.358) [-494.866] (-496.747) (-498.855) * (-498.460) (-495.980) [-496.027] (-496.283) -- 0:00:24
641500 -- (-495.829) [-495.136] (-496.566) (-495.385) * (-494.780) [-496.970] (-499.739) (-497.197) -- 0:00:24
642000 -- [-497.271] (-497.127) (-496.852) (-495.104) * [-496.512] (-499.970) (-497.384) (-497.475) -- 0:00:24
642500 -- (-497.260) (-495.806) (-497.065) [-498.950] * [-498.649] (-498.149) (-497.974) (-498.611) -- 0:00:24
643000 -- [-494.912] (-497.210) (-497.858) (-500.186) * (-497.968) [-496.939] (-499.823) (-501.316) -- 0:00:24
643500 -- (-496.144) [-496.164] (-498.633) (-499.978) * [-495.921] (-495.237) (-500.059) (-496.461) -- 0:00:24
644000 -- (-495.060) [-496.453] (-497.162) (-499.107) * [-495.259] (-495.362) (-495.290) (-496.722) -- 0:00:24
644500 -- (-498.359) [-496.703] (-496.416) (-497.885) * (-496.170) (-495.210) [-498.209] (-495.988) -- 0:00:24
645000 -- (-495.807) [-495.451] (-495.286) (-497.013) * (-499.487) (-495.480) [-495.897] (-498.301) -- 0:00:24
Average standard deviation of split frequencies: 0.009100
645500 -- [-497.651] (-497.516) (-494.702) (-498.655) * (-501.414) [-494.942] (-496.923) (-494.389) -- 0:00:24
646000 -- (-498.913) (-500.391) [-495.142] (-495.339) * [-495.422] (-496.060) (-495.302) (-495.354) -- 0:00:24
646500 -- (-497.345) [-501.337] (-499.717) (-495.532) * [-497.794] (-495.817) (-496.871) (-494.988) -- 0:00:24
647000 -- (-499.105) (-496.714) [-496.659] (-495.421) * [-496.602] (-499.212) (-494.775) (-497.404) -- 0:00:24
647500 -- (-496.238) (-495.371) (-498.896) [-496.146] * (-495.424) (-497.524) [-494.336] (-498.531) -- 0:00:24
648000 -- (-496.163) (-496.202) [-495.851] (-504.937) * [-496.844] (-497.014) (-497.501) (-498.914) -- 0:00:24
648500 -- [-495.275] (-498.722) (-495.234) (-500.854) * (-497.570) [-495.560] (-495.916) (-496.606) -- 0:00:24
649000 -- (-494.729) [-496.863] (-495.208) (-498.600) * (-498.248) [-494.463] (-497.932) (-495.253) -- 0:00:24
649500 -- (-496.135) (-495.267) (-500.191) [-497.502] * [-495.904] (-496.509) (-500.056) (-496.101) -- 0:00:24
650000 -- (-500.434) (-495.731) (-497.240) [-497.507] * [-495.813] (-496.173) (-499.526) (-495.076) -- 0:00:24
Average standard deviation of split frequencies: 0.009035
650500 -- (-496.053) (-495.672) (-498.070) [-497.015] * (-495.540) [-494.440] (-501.978) (-494.469) -- 0:00:24
651000 -- (-495.534) (-500.863) [-498.097] (-495.464) * [-496.436] (-495.996) (-495.041) (-495.663) -- 0:00:24
651500 -- (-497.851) (-502.409) [-496.846] (-495.014) * (-494.988) [-495.140] (-494.600) (-495.185) -- 0:00:24
652000 -- (-497.620) [-496.822] (-496.440) (-497.257) * [-495.263] (-494.922) (-497.890) (-496.369) -- 0:00:24
652500 -- (-497.036) (-496.332) (-495.269) [-494.817] * (-497.221) [-495.543] (-496.624) (-495.768) -- 0:00:23
653000 -- (-496.292) [-500.561] (-498.458) (-497.453) * [-496.782] (-494.285) (-497.716) (-494.571) -- 0:00:23
653500 -- (-496.571) [-498.267] (-498.964) (-498.645) * [-496.994] (-494.720) (-496.333) (-496.187) -- 0:00:23
654000 -- (-496.956) (-497.285) (-499.324) [-495.011] * (-496.147) [-495.750] (-494.879) (-498.417) -- 0:00:23
654500 -- (-497.131) [-496.771] (-495.954) (-495.201) * (-494.887) [-496.382] (-497.252) (-495.886) -- 0:00:23
655000 -- (-495.066) (-497.261) (-497.961) [-498.638] * (-496.897) [-497.358] (-498.294) (-495.818) -- 0:00:23
Average standard deviation of split frequencies: 0.009342
655500 -- (-496.663) (-495.303) [-496.548] (-495.454) * (-496.359) [-501.546] (-497.746) (-495.074) -- 0:00:23
656000 -- (-501.346) [-495.246] (-496.110) (-497.053) * (-498.334) (-497.564) (-496.111) [-495.640] -- 0:00:23
656500 -- (-496.232) [-494.621] (-494.728) (-497.954) * (-498.320) (-497.645) (-497.650) [-498.792] -- 0:00:23
657000 -- (-497.317) (-494.530) (-499.293) [-496.326] * (-499.596) (-495.806) (-497.157) [-496.894] -- 0:00:23
657500 -- [-498.382] (-496.887) (-499.806) (-496.355) * [-497.626] (-497.039) (-501.188) (-494.171) -- 0:00:23
658000 -- (-495.902) [-494.927] (-495.775) (-495.050) * (-495.351) [-499.015] (-495.206) (-494.999) -- 0:00:23
658500 -- [-498.128] (-495.892) (-496.405) (-495.613) * (-496.245) (-496.075) (-495.353) [-495.333] -- 0:00:23
659000 -- (-499.209) (-494.258) [-495.445] (-498.314) * (-496.754) [-500.663] (-497.960) (-495.314) -- 0:00:23
659500 -- [-495.414] (-494.719) (-495.420) (-495.840) * (-498.122) [-497.065] (-496.166) (-498.974) -- 0:00:23
660000 -- (-494.550) (-494.353) [-495.192] (-494.796) * (-495.446) [-495.489] (-498.571) (-496.881) -- 0:00:23
Average standard deviation of split frequencies: 0.009360
660500 -- [-494.508] (-494.602) (-496.454) (-496.588) * [-494.553] (-494.962) (-505.163) (-498.215) -- 0:00:23
661000 -- (-496.183) (-496.890) (-496.700) [-496.411] * (-495.154) (-496.462) (-501.054) [-499.161] -- 0:00:23
661500 -- (-498.250) (-496.119) [-495.256] (-494.696) * (-494.597) [-496.002] (-498.881) (-501.398) -- 0:00:23
662000 -- (-496.837) (-497.951) (-496.568) [-496.082] * (-497.009) (-494.980) (-497.835) [-497.190] -- 0:00:23
662500 -- [-497.212] (-497.954) (-504.840) (-496.012) * (-495.199) [-496.089] (-495.430) (-498.691) -- 0:00:23
663000 -- [-498.976] (-496.417) (-496.013) (-504.917) * (-500.280) (-495.845) [-498.600] (-500.932) -- 0:00:23
663500 -- (-496.409) (-497.979) [-497.750] (-501.093) * [-496.241] (-496.085) (-495.221) (-497.378) -- 0:00:23
664000 -- (-499.498) (-494.323) [-496.088] (-496.249) * (-495.064) (-496.104) [-494.960] (-495.948) -- 0:00:23
664500 -- (-497.851) (-495.366) (-495.915) [-495.594] * [-495.909] (-497.963) (-495.402) (-496.827) -- 0:00:23
665000 -- (-497.740) (-497.807) [-495.357] (-496.603) * (-495.521) (-496.261) (-495.684) [-494.726] -- 0:00:23
Average standard deviation of split frequencies: 0.009701
665500 -- (-496.923) (-499.535) [-496.094] (-495.582) * (-496.894) (-499.346) (-494.524) [-495.796] -- 0:00:23
666000 -- (-498.284) (-498.448) (-497.197) [-498.897] * (-502.450) (-495.609) (-496.046) [-494.569] -- 0:00:23
666500 -- (-499.112) (-496.940) [-495.291] (-497.934) * (-498.396) [-494.594] (-496.562) (-501.093) -- 0:00:23
667000 -- (-498.700) (-496.242) [-496.713] (-495.709) * (-496.808) (-497.095) (-496.162) [-494.722] -- 0:00:22
667500 -- [-500.524] (-498.451) (-496.931) (-506.199) * (-501.051) (-499.206) [-495.964] (-497.026) -- 0:00:22
668000 -- (-498.710) (-495.943) (-496.731) [-496.471] * [-499.647] (-497.518) (-498.269) (-497.091) -- 0:00:22
668500 -- [-496.203] (-495.377) (-495.178) (-499.331) * (-498.863) (-494.794) (-495.552) [-498.105] -- 0:00:22
669000 -- (-496.461) (-497.028) (-495.794) [-495.938] * (-495.938) (-497.788) [-498.378] (-496.146) -- 0:00:22
669500 -- (-501.426) (-500.150) [-495.307] (-498.154) * (-494.899) (-496.176) (-499.009) [-494.965] -- 0:00:22
670000 -- (-497.214) [-498.943] (-495.903) (-495.700) * (-496.126) [-494.345] (-499.891) (-496.160) -- 0:00:22
Average standard deviation of split frequencies: 0.010700
670500 -- (-498.320) [-497.070] (-494.605) (-496.342) * (-496.726) (-495.574) [-498.201] (-495.751) -- 0:00:22
671000 -- [-497.545] (-495.900) (-494.583) (-499.462) * (-496.420) [-494.986] (-495.731) (-498.160) -- 0:00:22
671500 -- (-495.977) (-496.210) [-497.763] (-496.748) * (-499.259) [-499.441] (-498.958) (-495.327) -- 0:00:22
672000 -- (-498.164) [-496.203] (-494.681) (-495.626) * [-496.332] (-498.164) (-498.061) (-495.143) -- 0:00:22
672500 -- [-495.781] (-494.455) (-496.283) (-495.792) * (-500.601) (-497.534) (-497.730) [-496.653] -- 0:00:22
673000 -- (-496.157) (-494.734) (-496.816) [-495.493] * (-495.538) (-496.442) [-496.912] (-496.871) -- 0:00:22
673500 -- (-496.166) (-496.109) (-494.640) [-496.659] * (-497.373) (-495.592) [-496.151] (-497.782) -- 0:00:22
674000 -- (-496.476) (-496.156) [-494.653] (-495.910) * (-498.028) [-499.547] (-497.624) (-495.624) -- 0:00:22
674500 -- [-495.590] (-495.251) (-495.186) (-498.130) * (-496.207) [-496.711] (-496.458) (-499.236) -- 0:00:22
675000 -- [-496.187] (-495.938) (-496.561) (-499.639) * (-497.902) (-499.108) [-496.651] (-497.313) -- 0:00:22
Average standard deviation of split frequencies: 0.010091
675500 -- [-497.725] (-495.041) (-496.560) (-504.027) * [-495.921] (-498.943) (-496.441) (-495.461) -- 0:00:22
676000 -- (-497.970) [-496.493] (-495.614) (-496.276) * [-494.545] (-495.994) (-496.106) (-495.518) -- 0:00:22
676500 -- (-495.222) (-497.231) [-498.073] (-496.970) * (-497.066) (-500.304) (-497.167) [-496.624] -- 0:00:22
677000 -- (-497.461) (-494.773) (-496.267) [-496.227] * [-497.909] (-497.447) (-502.189) (-497.817) -- 0:00:22
677500 -- [-496.973] (-497.517) (-495.468) (-495.491) * [-496.415] (-495.912) (-503.138) (-496.127) -- 0:00:22
678000 -- (-496.250) (-496.110) (-498.493) [-495.320] * [-498.083] (-498.541) (-497.775) (-496.104) -- 0:00:22
678500 -- (-499.398) (-495.720) (-495.403) [-495.140] * [-495.313] (-496.585) (-497.073) (-501.189) -- 0:00:22
679000 -- (-499.249) [-494.514] (-496.096) (-497.678) * (-495.236) (-498.764) (-499.420) [-497.529] -- 0:00:22
679500 -- (-497.160) [-496.649] (-496.139) (-495.120) * (-494.897) (-495.108) (-495.995) [-497.059] -- 0:00:22
680000 -- (-497.727) [-496.496] (-496.073) (-495.000) * [-498.922] (-496.505) (-495.049) (-496.375) -- 0:00:22
Average standard deviation of split frequencies: 0.009207
680500 -- (-494.743) [-494.957] (-496.836) (-496.662) * [-496.623] (-495.018) (-498.122) (-496.438) -- 0:00:22
681000 -- (-496.358) (-498.152) [-497.939] (-495.219) * (-494.322) [-494.417] (-498.362) (-497.343) -- 0:00:22
681500 -- (-497.752) (-496.168) [-495.836] (-497.176) * (-499.115) [-499.948] (-498.093) (-498.004) -- 0:00:21
682000 -- (-496.400) (-496.121) (-498.185) [-495.266] * (-496.024) (-495.715) (-497.858) [-495.759] -- 0:00:21
682500 -- [-501.751] (-495.494) (-501.429) (-496.675) * (-497.890) (-496.650) [-496.919] (-496.051) -- 0:00:21
683000 -- (-496.982) (-497.657) (-494.442) [-497.649] * (-497.695) (-495.041) (-496.380) [-495.482] -- 0:00:21
683500 -- (-497.095) (-496.380) (-496.998) [-495.360] * (-495.969) (-498.895) (-496.320) [-495.494] -- 0:00:21
684000 -- [-495.353] (-495.654) (-499.363) (-495.911) * (-495.669) [-496.684] (-496.174) (-497.105) -- 0:00:21
684500 -- (-496.201) (-496.616) [-497.177] (-495.115) * [-494.623] (-498.994) (-498.493) (-495.422) -- 0:00:21
685000 -- (-495.211) (-494.586) (-495.655) [-494.858] * (-499.473) (-496.332) [-498.113] (-496.437) -- 0:00:21
Average standard deviation of split frequencies: 0.009418
685500 -- (-495.528) (-496.233) (-495.935) [-497.988] * (-500.005) (-497.141) (-495.791) [-496.399] -- 0:00:21
686000 -- [-497.086] (-495.117) (-496.291) (-497.607) * (-498.407) (-498.741) [-495.221] (-495.181) -- 0:00:21
686500 -- (-496.153) (-495.468) [-496.172] (-498.215) * (-495.533) (-497.860) (-494.952) [-494.793] -- 0:00:21
687000 -- (-497.786) (-496.697) (-498.061) [-498.590] * (-496.089) (-496.844) (-500.307) [-496.722] -- 0:00:21
687500 -- [-497.242] (-495.810) (-497.690) (-498.914) * (-501.646) (-496.475) [-495.859] (-496.143) -- 0:00:21
688000 -- (-497.395) (-494.592) [-497.482] (-495.371) * [-496.703] (-496.467) (-497.928) (-497.361) -- 0:00:21
688500 -- (-497.625) (-496.049) [-497.840] (-500.027) * (-496.262) [-497.867] (-501.001) (-499.723) -- 0:00:21
689000 -- (-496.780) (-496.975) (-496.654) [-497.651] * [-497.422] (-497.290) (-495.916) (-497.237) -- 0:00:21
689500 -- (-497.195) [-497.870] (-496.326) (-497.419) * [-495.428] (-494.754) (-496.442) (-495.784) -- 0:00:21
690000 -- [-497.642] (-495.767) (-495.224) (-496.061) * (-496.072) [-498.998] (-499.995) (-496.911) -- 0:00:21
Average standard deviation of split frequencies: 0.009154
690500 -- (-501.414) (-496.148) [-495.547] (-500.344) * [-494.880] (-497.109) (-495.808) (-496.855) -- 0:00:21
691000 -- (-496.022) (-495.538) (-496.084) [-497.472] * [-497.196] (-498.508) (-498.225) (-497.114) -- 0:00:21
691500 -- [-496.386] (-495.887) (-494.750) (-495.342) * (-494.552) [-496.169] (-497.668) (-495.895) -- 0:00:21
692000 -- (-496.503) (-494.777) (-495.891) [-498.185] * (-501.229) [-496.114] (-495.017) (-495.936) -- 0:00:21
692500 -- (-496.878) [-495.459] (-497.428) (-495.771) * [-498.422] (-495.229) (-496.003) (-496.792) -- 0:00:21
693000 -- (-498.283) (-500.609) (-495.919) [-499.009] * (-495.905) (-495.400) (-495.249) [-497.292] -- 0:00:21
693500 -- (-496.750) (-498.689) (-497.838) [-495.813] * (-497.543) [-496.194] (-497.948) (-498.907) -- 0:00:21
694000 -- (-495.227) [-498.058] (-495.906) (-497.510) * [-497.167] (-497.601) (-499.430) (-500.393) -- 0:00:21
694500 -- [-495.459] (-496.911) (-497.044) (-498.982) * (-498.184) [-495.767] (-498.236) (-497.901) -- 0:00:21
695000 -- (-494.778) (-496.302) (-497.790) [-496.041] * (-494.870) [-496.889] (-499.254) (-497.237) -- 0:00:21
Average standard deviation of split frequencies: 0.009363
695500 -- (-496.872) (-495.948) (-498.925) [-495.016] * (-495.681) (-495.088) (-497.954) [-496.931] -- 0:00:21
696000 -- (-498.242) [-497.690] (-502.210) (-495.000) * (-500.175) [-495.424] (-497.514) (-497.178) -- 0:00:20
696500 -- (-502.226) [-500.747] (-496.876) (-494.506) * (-495.132) (-511.445) [-495.193] (-498.056) -- 0:00:20
697000 -- (-501.079) (-501.197) [-496.913] (-494.968) * (-496.470) (-501.849) (-494.151) [-495.331] -- 0:00:20
697500 -- (-495.447) (-499.788) [-498.964] (-494.257) * (-498.023) [-496.459] (-494.330) (-498.459) -- 0:00:20
698000 -- (-495.977) [-500.364] (-499.876) (-495.095) * [-495.324] (-499.402) (-496.736) (-496.122) -- 0:00:20
698500 -- (-496.371) (-495.848) [-494.986] (-495.823) * [-494.627] (-498.589) (-500.437) (-495.722) -- 0:00:20
699000 -- (-498.403) (-495.145) [-495.256] (-497.956) * (-495.281) (-497.572) (-498.120) [-495.574] -- 0:00:20
699500 -- (-497.202) [-497.064] (-500.076) (-499.945) * (-497.865) (-498.504) [-496.234] (-499.545) -- 0:00:20
700000 -- (-496.262) (-496.025) [-497.556] (-498.304) * (-496.120) [-495.796] (-496.578) (-495.170) -- 0:00:20
Average standard deviation of split frequencies: 0.009894
700500 -- (-497.037) (-495.867) (-498.710) [-495.953] * (-495.142) (-496.577) (-498.569) [-495.439] -- 0:00:20
701000 -- [-496.631] (-498.157) (-494.697) (-494.605) * (-496.273) (-499.744) (-499.091) [-496.853] -- 0:00:20
701500 -- (-495.808) (-499.161) [-497.553] (-494.929) * [-496.830] (-497.392) (-499.167) (-495.763) -- 0:00:20
702000 -- [-494.866] (-497.292) (-495.242) (-499.500) * (-495.270) (-496.134) (-496.792) [-496.139] -- 0:00:20
702500 -- (-494.591) (-495.544) [-496.721] (-498.528) * [-497.414] (-496.905) (-499.235) (-494.622) -- 0:00:20
703000 -- (-502.620) (-494.179) (-503.283) [-499.330] * (-496.689) (-496.797) [-495.589] (-495.530) -- 0:00:20
703500 -- (-495.113) (-496.345) [-501.799] (-498.466) * (-499.256) [-498.008] (-497.328) (-497.210) -- 0:00:20
704000 -- [-502.776] (-496.397) (-497.972) (-496.867) * (-497.305) (-495.678) [-497.739] (-494.945) -- 0:00:20
704500 -- [-496.603] (-495.658) (-498.250) (-495.362) * (-497.680) [-495.909] (-497.374) (-498.897) -- 0:00:20
705000 -- (-497.277) [-496.809] (-496.047) (-497.768) * (-498.070) (-496.391) (-501.708) [-497.260] -- 0:00:20
Average standard deviation of split frequencies: 0.009544
705500 -- (-498.404) (-495.929) [-498.818] (-495.687) * (-499.191) (-502.557) [-495.362] (-499.492) -- 0:00:20
706000 -- (-497.682) (-500.861) (-498.279) [-495.539] * [-496.728] (-498.293) (-499.352) (-495.539) -- 0:00:20
706500 -- (-496.648) [-496.503] (-497.007) (-494.235) * [-496.672] (-495.065) (-497.260) (-496.543) -- 0:00:20
707000 -- (-496.789) [-495.609] (-496.201) (-495.715) * [-496.681] (-495.459) (-496.829) (-497.885) -- 0:00:20
707500 -- (-495.532) (-495.410) [-495.781] (-500.567) * (-497.209) (-496.909) (-497.649) [-495.888] -- 0:00:20
708000 -- (-495.693) (-498.071) (-495.771) [-497.075] * (-494.808) (-496.213) [-498.325] (-498.502) -- 0:00:20
708500 -- (-494.516) (-498.390) (-497.296) [-495.857] * (-497.235) (-498.060) (-496.712) [-495.677] -- 0:00:20
709000 -- (-498.723) [-495.690] (-498.052) (-496.314) * (-496.076) (-496.198) (-499.535) [-501.110] -- 0:00:20
709500 -- (-499.324) (-498.026) [-494.569] (-500.327) * (-495.590) (-494.359) (-501.730) [-496.502] -- 0:00:20
710000 -- [-497.811] (-500.070) (-495.562) (-498.768) * [-497.117] (-495.721) (-495.948) (-495.462) -- 0:00:20
Average standard deviation of split frequencies: 0.009677
710500 -- [-495.752] (-495.740) (-496.643) (-498.472) * (-496.780) (-495.408) (-495.100) [-495.009] -- 0:00:19
711000 -- (-496.375) (-495.646) (-500.460) [-499.781] * (-495.899) (-498.723) [-494.683] (-496.694) -- 0:00:19
711500 -- (-495.671) (-498.868) [-495.407] (-499.041) * [-496.293] (-495.658) (-496.653) (-496.361) -- 0:00:19
712000 -- (-495.447) [-494.906] (-495.650) (-497.714) * (-496.188) (-496.775) [-500.187] (-495.914) -- 0:00:19
712500 -- (-495.788) (-496.587) (-494.788) [-496.588] * [-496.779] (-497.446) (-494.939) (-495.931) -- 0:00:19
713000 -- (-496.367) (-494.460) [-495.743] (-494.837) * [-495.512] (-498.938) (-495.666) (-497.330) -- 0:00:19
713500 -- (-494.477) (-495.132) (-496.947) [-496.322] * (-498.778) [-495.142] (-498.389) (-496.980) -- 0:00:19
714000 -- [-494.694] (-498.139) (-496.489) (-496.820) * (-498.891) (-496.907) [-495.105] (-496.424) -- 0:00:19
714500 -- (-498.775) (-495.030) (-495.290) [-495.369] * (-498.264) [-494.670] (-495.104) (-495.316) -- 0:00:19
715000 -- [-497.106] (-495.682) (-496.666) (-496.807) * (-497.690) [-495.915] (-494.734) (-497.743) -- 0:00:19
Average standard deviation of split frequencies: 0.009760
715500 -- (-496.783) (-500.645) [-497.613] (-495.672) * (-497.885) (-495.494) [-498.246] (-498.127) -- 0:00:19
716000 -- [-495.182] (-496.720) (-497.189) (-497.610) * (-495.747) (-495.011) (-494.510) [-498.688] -- 0:00:19
716500 -- [-495.693] (-496.420) (-495.674) (-497.179) * (-494.853) [-498.860] (-496.450) (-495.734) -- 0:00:19
717000 -- (-497.377) [-496.591] (-497.024) (-496.024) * (-497.032) [-494.950] (-498.917) (-504.322) -- 0:00:19
717500 -- (-497.161) (-498.446) [-497.304] (-496.037) * [-495.818] (-495.533) (-496.689) (-499.778) -- 0:00:19
718000 -- (-495.376) (-496.864) [-495.622] (-494.649) * [-498.078] (-497.870) (-498.883) (-496.666) -- 0:00:19
718500 -- (-494.274) (-496.941) [-494.622] (-497.884) * [-495.332] (-497.148) (-495.745) (-496.727) -- 0:00:19
719000 -- (-497.240) (-495.686) [-496.225] (-495.442) * (-500.457) (-497.096) [-497.372] (-498.539) -- 0:00:19
719500 -- (-496.032) (-496.320) [-496.437] (-494.427) * [-494.769] (-496.292) (-497.549) (-497.719) -- 0:00:19
720000 -- (-496.554) (-503.337) (-497.009) [-495.953] * (-494.753) (-497.716) (-499.876) [-500.752] -- 0:00:19
Average standard deviation of split frequencies: 0.009735
720500 -- (-495.700) (-497.381) [-498.342] (-498.596) * [-495.672] (-496.726) (-498.880) (-496.733) -- 0:00:19
721000 -- (-496.075) (-494.765) (-498.602) [-495.777] * [-496.515] (-495.041) (-496.795) (-495.559) -- 0:00:19
721500 -- [-495.037] (-494.424) (-499.102) (-496.006) * [-495.528] (-495.957) (-496.535) (-497.153) -- 0:00:19
722000 -- (-495.718) (-495.620) (-500.212) [-496.774] * (-494.925) [-495.979] (-495.992) (-498.186) -- 0:00:19
722500 -- [-496.607] (-498.762) (-499.188) (-494.796) * (-495.001) (-496.888) (-500.387) [-497.516] -- 0:00:19
723000 -- [-501.491] (-498.010) (-496.395) (-497.788) * (-495.782) (-496.738) (-496.047) [-497.075] -- 0:00:19
723500 -- (-497.979) [-499.077] (-497.430) (-499.728) * (-496.384) (-497.384) (-497.039) [-496.308] -- 0:00:19
724000 -- (-498.182) (-497.839) [-497.533] (-496.828) * (-500.932) [-499.787] (-498.378) (-495.930) -- 0:00:19
724500 -- (-496.354) (-495.586) [-495.333] (-496.285) * (-497.295) [-496.315] (-500.918) (-501.071) -- 0:00:19
725000 -- (-497.070) (-497.747) [-496.722] (-502.665) * (-496.085) [-496.617] (-497.669) (-498.599) -- 0:00:18
Average standard deviation of split frequencies: 0.009969
725500 -- (-496.224) (-496.109) (-497.186) [-496.054] * [-494.910] (-502.064) (-495.882) (-498.600) -- 0:00:18
726000 -- (-498.469) (-494.764) [-497.541] (-499.851) * (-495.066) [-498.322] (-498.099) (-495.471) -- 0:00:18
726500 -- [-495.913] (-496.033) (-497.886) (-499.626) * [-494.131] (-497.214) (-495.121) (-495.171) -- 0:00:18
727000 -- (-501.987) (-497.367) (-495.604) [-497.397] * (-498.559) (-496.361) [-494.789] (-495.935) -- 0:00:18
727500 -- (-498.886) [-496.076] (-498.093) (-496.151) * (-496.097) (-496.700) (-498.129) [-495.077] -- 0:00:18
728000 -- (-499.071) [-499.710] (-496.320) (-494.614) * [-497.088] (-495.980) (-498.310) (-499.117) -- 0:00:18
728500 -- [-496.190] (-496.176) (-498.016) (-494.152) * (-497.664) (-496.264) [-497.535] (-499.029) -- 0:00:18
729000 -- (-496.878) (-495.403) [-495.566] (-494.825) * (-494.654) (-495.677) [-501.200] (-494.154) -- 0:00:18
729500 -- (-494.989) (-495.282) [-494.950] (-495.869) * [-502.038] (-496.475) (-497.438) (-494.985) -- 0:00:18
730000 -- (-498.624) (-494.818) [-495.023] (-495.961) * [-497.572] (-496.676) (-500.267) (-495.505) -- 0:00:18
Average standard deviation of split frequencies: 0.010133
730500 -- (-495.308) [-495.006] (-497.010) (-496.735) * (-496.868) [-495.792] (-498.757) (-495.407) -- 0:00:18
731000 -- (-498.550) (-495.821) (-496.309) [-495.457] * (-497.822) [-495.546] (-498.087) (-494.550) -- 0:00:18
731500 -- (-501.231) [-494.647] (-494.608) (-498.899) * (-498.709) [-495.068] (-495.204) (-494.501) -- 0:00:18
732000 -- (-500.833) [-495.499] (-499.697) (-498.508) * [-498.025] (-501.710) (-498.923) (-495.484) -- 0:00:18
732500 -- (-499.691) (-496.683) (-498.747) [-496.228] * (-494.810) (-496.885) (-496.108) [-497.495] -- 0:00:18
733000 -- (-497.861) [-497.472] (-498.604) (-497.875) * (-496.034) (-499.936) (-496.248) [-496.739] -- 0:00:18
733500 -- [-494.871] (-500.064) (-495.922) (-499.312) * (-499.084) (-495.776) [-500.618] (-498.759) -- 0:00:18
734000 -- [-495.852] (-500.634) (-496.896) (-495.218) * [-495.698] (-497.198) (-501.365) (-496.914) -- 0:00:18
734500 -- (-498.060) (-500.307) (-497.560) [-501.547] * (-494.649) (-497.335) [-496.171] (-501.230) -- 0:00:18
735000 -- (-496.648) (-502.631) [-495.128] (-496.770) * (-495.269) [-495.188] (-498.594) (-498.058) -- 0:00:18
Average standard deviation of split frequencies: 0.009728
735500 -- (-494.751) (-496.746) (-495.476) [-497.192] * (-496.091) [-498.596] (-503.666) (-497.980) -- 0:00:18
736000 -- (-502.330) [-494.701] (-498.005) (-494.776) * [-496.357] (-495.823) (-497.271) (-496.594) -- 0:00:18
736500 -- (-495.439) (-495.817) [-499.770] (-498.419) * (-497.600) (-495.604) [-496.776] (-496.825) -- 0:00:18
737000 -- (-496.793) [-495.851] (-500.404) (-495.597) * [-497.519] (-498.975) (-496.836) (-496.519) -- 0:00:18
737500 -- [-496.324] (-495.773) (-499.491) (-495.473) * (-495.381) [-497.883] (-497.091) (-494.419) -- 0:00:18
738000 -- (-494.862) [-500.616] (-495.659) (-496.167) * [-498.106] (-497.716) (-504.563) (-494.952) -- 0:00:18
738500 -- (-498.473) (-501.507) [-495.219] (-497.361) * (-495.947) (-496.624) (-502.383) [-495.536] -- 0:00:18
739000 -- (-498.196) (-496.930) [-495.670] (-497.539) * (-498.015) [-495.618] (-500.070) (-501.031) -- 0:00:18
739500 -- (-496.329) [-496.584] (-496.207) (-497.205) * (-496.721) [-494.391] (-497.825) (-497.807) -- 0:00:17
740000 -- (-495.474) (-497.611) [-495.383] (-495.510) * (-498.366) (-498.456) [-495.313] (-499.476) -- 0:00:17
Average standard deviation of split frequencies: 0.009268
740500 -- (-495.474) (-497.689) [-497.433] (-500.195) * (-499.133) [-495.198] (-495.228) (-497.248) -- 0:00:17
741000 -- (-496.054) (-496.550) [-495.749] (-495.638) * (-497.299) (-495.576) (-495.517) [-496.374] -- 0:00:17
741500 -- (-499.059) (-494.523) [-495.888] (-497.659) * (-498.390) (-497.781) [-497.658] (-497.251) -- 0:00:17
742000 -- (-498.272) (-495.683) [-495.344] (-498.301) * [-495.677] (-502.503) (-497.770) (-498.328) -- 0:00:17
742500 -- (-496.003) [-495.679] (-496.234) (-496.564) * (-496.033) (-496.761) (-495.017) [-498.322] -- 0:00:17
743000 -- (-494.412) (-497.467) (-496.402) [-502.145] * [-496.657] (-496.341) (-495.474) (-495.528) -- 0:00:17
743500 -- (-502.669) [-498.628] (-496.184) (-498.907) * (-495.719) [-497.209] (-496.882) (-496.226) -- 0:00:17
744000 -- [-499.352] (-495.803) (-496.566) (-498.396) * (-495.065) [-497.090] (-498.230) (-498.297) -- 0:00:17
744500 -- (-497.172) (-498.655) [-494.710] (-496.575) * (-495.637) (-496.411) [-495.194] (-499.086) -- 0:00:17
745000 -- (-496.095) (-502.265) [-495.202] (-496.686) * [-496.763] (-498.070) (-495.730) (-498.066) -- 0:00:17
Average standard deviation of split frequencies: 0.009360
745500 -- (-497.929) (-499.769) (-495.739) [-498.795] * (-499.797) (-494.797) [-494.798] (-496.554) -- 0:00:17
746000 -- (-499.370) (-496.558) [-495.213] (-498.306) * [-497.663] (-501.491) (-497.775) (-497.761) -- 0:00:17
746500 -- (-496.644) (-497.124) [-496.817] (-495.831) * (-497.221) (-496.683) [-495.767] (-495.850) -- 0:00:17
747000 -- (-496.602) (-498.260) (-495.767) [-496.048] * [-497.150] (-494.702) (-495.295) (-498.910) -- 0:00:17
747500 -- [-496.603] (-498.477) (-494.620) (-494.921) * [-498.416] (-495.610) (-495.728) (-496.042) -- 0:00:17
748000 -- [-495.148] (-495.564) (-494.635) (-499.995) * (-496.117) (-498.038) (-495.261) [-494.992] -- 0:00:17
748500 -- [-495.561] (-497.682) (-497.025) (-497.910) * [-497.200] (-497.097) (-495.771) (-496.253) -- 0:00:17
749000 -- (-495.479) (-498.278) (-497.309) [-496.739] * [-497.927] (-497.462) (-496.231) (-497.222) -- 0:00:17
749500 -- [-498.501] (-499.540) (-495.849) (-495.563) * [-494.753] (-499.299) (-497.691) (-496.646) -- 0:00:17
750000 -- (-499.637) (-499.937) [-497.223] (-497.581) * (-500.710) [-497.901] (-496.438) (-496.349) -- 0:00:17
Average standard deviation of split frequencies: 0.008988
750500 -- (-496.665) [-497.837] (-496.615) (-496.522) * (-495.316) (-496.111) (-496.734) [-496.333] -- 0:00:17
751000 -- (-497.677) (-495.017) [-495.294] (-494.813) * (-495.893) (-497.849) [-500.403] (-498.671) -- 0:00:17
751500 -- (-499.851) [-495.909] (-495.491) (-496.792) * [-499.261] (-500.392) (-496.900) (-499.997) -- 0:00:17
752000 -- [-499.389] (-494.568) (-495.921) (-494.827) * (-495.278) [-496.995] (-496.099) (-496.584) -- 0:00:17
752500 -- (-495.547) (-496.904) (-495.398) [-496.021] * (-495.935) [-497.187] (-495.768) (-497.102) -- 0:00:17
753000 -- (-498.647) (-494.646) [-495.114] (-499.165) * (-495.129) (-500.001) (-496.276) [-496.430] -- 0:00:17
753500 -- [-499.116] (-497.963) (-496.455) (-497.011) * (-498.211) (-501.195) [-494.971] (-497.525) -- 0:00:17
754000 -- (-501.923) [-497.381] (-496.465) (-501.633) * [-496.137] (-496.534) (-495.968) (-497.629) -- 0:00:16
754500 -- (-498.724) (-498.012) [-496.047] (-498.118) * (-496.007) (-499.655) [-495.519] (-495.302) -- 0:00:16
755000 -- [-497.795] (-495.943) (-502.275) (-498.461) * (-495.857) (-498.556) (-495.533) [-495.277] -- 0:00:16
Average standard deviation of split frequencies: 0.008535
755500 -- (-499.284) (-497.945) [-495.661] (-495.096) * [-495.207] (-496.985) (-495.208) (-498.430) -- 0:00:16
756000 -- (-500.246) (-496.532) (-495.168) [-498.289] * (-494.756) (-495.371) [-498.333] (-495.914) -- 0:00:16
756500 -- (-499.659) (-498.874) (-496.732) [-494.604] * [-499.167] (-500.182) (-496.435) (-498.255) -- 0:00:16
757000 -- (-495.168) (-500.301) [-497.359] (-495.194) * (-495.924) [-498.968] (-497.166) (-496.855) -- 0:00:16
757500 -- [-501.389] (-495.305) (-498.023) (-496.015) * (-495.893) (-498.153) [-497.033] (-496.860) -- 0:00:16
758000 -- (-494.838) (-498.456) [-495.436] (-494.959) * [-496.107] (-504.038) (-498.463) (-497.324) -- 0:00:16
758500 -- [-496.946] (-498.845) (-495.915) (-495.883) * (-495.619) (-496.309) [-495.343] (-496.234) -- 0:00:16
759000 -- (-495.682) (-495.906) (-498.073) [-496.587] * (-495.697) (-496.305) (-495.355) [-494.949] -- 0:00:16
759500 -- (-496.925) (-496.070) (-496.136) [-495.631] * (-497.238) (-495.950) [-495.520] (-495.361) -- 0:00:16
760000 -- (-498.076) (-496.233) [-496.829] (-494.448) * [-495.930] (-499.115) (-497.355) (-494.413) -- 0:00:16
Average standard deviation of split frequencies: 0.008289
760500 -- (-499.107) (-497.012) [-495.664] (-496.980) * (-496.625) [-498.195] (-496.641) (-496.012) -- 0:00:16
761000 -- (-496.080) [-496.071] (-495.971) (-494.691) * (-502.042) [-496.990] (-496.204) (-498.496) -- 0:00:16
761500 -- (-496.624) [-496.539] (-497.112) (-496.005) * [-502.372] (-500.684) (-500.033) (-499.025) -- 0:00:16
762000 -- (-496.239) (-496.082) [-495.848] (-501.420) * (-499.916) (-495.356) (-497.889) [-499.214] -- 0:00:16
762500 -- (-495.503) [-494.945] (-496.019) (-500.497) * (-494.551) (-501.014) [-495.362] (-499.743) -- 0:00:16
763000 -- (-497.053) (-497.618) (-502.671) [-495.329] * (-497.350) (-495.987) [-494.619] (-498.689) -- 0:00:16
763500 -- (-495.511) [-495.169] (-499.609) (-500.973) * (-495.478) (-495.701) [-497.072] (-498.755) -- 0:00:16
764000 -- (-497.853) (-497.762) [-497.287] (-502.902) * [-495.523] (-495.696) (-496.668) (-503.356) -- 0:00:16
764500 -- [-497.590] (-495.798) (-498.364) (-498.221) * (-497.444) (-497.131) (-496.178) [-498.112] -- 0:00:16
765000 -- (-495.405) (-499.445) [-495.077] (-496.463) * (-500.406) (-497.426) [-495.321] (-497.522) -- 0:00:16
Average standard deviation of split frequencies: 0.008039
765500 -- (-494.603) (-495.080) (-494.675) [-496.611] * (-496.156) [-494.997] (-497.388) (-496.757) -- 0:00:16
766000 -- (-500.235) (-495.895) (-496.156) [-501.220] * (-497.675) [-495.544] (-499.790) (-497.950) -- 0:00:16
766500 -- (-502.211) (-497.841) [-495.276] (-498.916) * [-496.499] (-496.521) (-495.570) (-502.596) -- 0:00:16
767000 -- (-497.131) [-495.992] (-496.223) (-500.999) * (-495.010) [-494.768] (-495.666) (-499.300) -- 0:00:16
767500 -- (-495.438) [-497.211] (-497.415) (-498.477) * [-495.169] (-495.934) (-495.010) (-501.362) -- 0:00:16
768000 -- (-497.659) (-496.035) [-497.119] (-495.654) * [-494.761] (-496.835) (-501.107) (-497.181) -- 0:00:16
768500 -- [-498.346] (-497.867) (-496.012) (-495.481) * (-497.336) (-497.008) (-497.310) [-495.623] -- 0:00:15
769000 -- (-496.136) (-496.504) (-497.053) [-496.446] * [-500.083] (-495.714) (-495.558) (-497.288) -- 0:00:15
769500 -- (-498.098) [-495.394] (-495.450) (-502.384) * (-495.065) (-495.133) [-495.090] (-495.864) -- 0:00:15
770000 -- [-498.224] (-495.449) (-495.343) (-501.576) * (-495.127) (-495.059) (-499.770) [-497.830] -- 0:00:15
Average standard deviation of split frequencies: 0.008181
770500 -- [-497.795] (-494.739) (-496.247) (-498.505) * (-495.170) [-497.329] (-497.556) (-495.459) -- 0:00:15
771000 -- (-498.674) (-494.659) [-497.346] (-498.769) * (-500.727) [-497.661] (-495.936) (-496.894) -- 0:00:15
771500 -- (-497.738) (-495.430) (-497.684) [-495.561] * [-497.572] (-497.279) (-496.300) (-497.109) -- 0:00:15
772000 -- (-494.621) (-497.389) [-496.749] (-500.981) * (-496.827) (-498.674) [-497.116] (-497.542) -- 0:00:15
772500 -- (-494.411) [-496.972] (-497.306) (-499.044) * [-498.752] (-496.289) (-494.824) (-498.504) -- 0:00:15
773000 -- (-499.492) (-495.086) (-495.349) [-495.274] * [-495.061] (-497.501) (-494.523) (-496.061) -- 0:00:15
773500 -- (-495.235) (-495.331) [-498.111] (-494.935) * (-497.893) (-499.423) (-496.481) [-497.494] -- 0:00:15
774000 -- [-499.710] (-497.775) (-496.370) (-495.848) * [-496.946] (-496.076) (-497.283) (-503.865) -- 0:00:15
774500 -- (-499.219) [-496.958] (-496.329) (-495.794) * [-498.149] (-496.465) (-496.975) (-502.895) -- 0:00:15
775000 -- (-494.557) [-495.853] (-494.824) (-501.599) * (-500.324) (-495.664) (-496.457) [-496.688] -- 0:00:15
Average standard deviation of split frequencies: 0.008391
775500 -- (-499.144) (-499.397) (-497.328) [-497.624] * (-497.119) (-495.333) (-497.362) [-496.273] -- 0:00:15
776000 -- [-495.618] (-503.897) (-497.427) (-498.587) * [-495.569] (-497.837) (-502.533) (-496.297) -- 0:00:15
776500 -- [-496.189] (-496.759) (-495.174) (-497.346) * [-498.906] (-501.327) (-498.101) (-496.086) -- 0:00:15
777000 -- (-499.071) (-501.913) [-496.331] (-497.956) * [-495.167] (-498.891) (-495.585) (-498.506) -- 0:00:15
777500 -- (-498.735) (-495.180) [-496.352] (-499.775) * [-496.495] (-496.266) (-494.909) (-498.536) -- 0:00:15
778000 -- (-502.899) [-494.846] (-496.652) (-497.094) * (-496.701) [-495.913] (-494.975) (-498.812) -- 0:00:15
778500 -- (-494.782) (-495.818) (-495.496) [-494.668] * (-495.827) [-496.798] (-500.366) (-498.917) -- 0:00:15
779000 -- (-494.763) (-495.386) (-495.419) [-496.147] * [-494.744] (-494.908) (-499.307) (-500.890) -- 0:00:15
779500 -- (-495.989) [-495.309] (-496.690) (-494.631) * (-496.856) [-496.562] (-497.705) (-497.348) -- 0:00:15
780000 -- (-498.220) (-499.632) (-498.306) [-495.087] * (-500.920) (-497.519) [-496.837] (-495.938) -- 0:00:15
Average standard deviation of split frequencies: 0.008303
780500 -- (-495.396) (-495.731) (-498.409) [-497.940] * [-495.683] (-498.904) (-498.207) (-496.060) -- 0:00:15
781000 -- (-496.105) (-499.536) [-495.103] (-498.054) * (-500.103) (-497.482) (-495.773) [-495.174] -- 0:00:15
781500 -- [-495.672] (-496.851) (-496.132) (-499.065) * [-498.522] (-497.465) (-497.540) (-498.104) -- 0:00:15
782000 -- (-496.055) (-496.702) (-494.622) [-495.576] * (-497.073) (-496.975) (-495.549) [-497.429] -- 0:00:15
782500 -- [-495.868] (-497.384) (-496.052) (-498.097) * (-495.314) (-496.156) [-497.358] (-497.848) -- 0:00:15
783000 -- [-495.809] (-497.264) (-497.630) (-499.078) * (-495.336) (-495.686) [-499.986] (-495.938) -- 0:00:14
783500 -- (-496.698) [-495.924] (-497.975) (-495.626) * [-495.157] (-495.733) (-494.944) (-495.905) -- 0:00:14
784000 -- (-495.892) (-495.732) (-499.703) [-495.401] * (-496.483) (-494.813) (-497.124) [-495.108] -- 0:00:14
784500 -- (-495.009) (-495.600) (-499.227) [-495.321] * (-494.711) (-494.723) [-495.325] (-495.677) -- 0:00:14
785000 -- [-496.997] (-497.287) (-498.241) (-494.856) * (-494.635) (-498.274) (-499.645) [-499.359] -- 0:00:14
Average standard deviation of split frequencies: 0.008546
785500 -- (-497.930) (-498.627) [-497.282] (-496.220) * (-496.805) [-497.119] (-497.393) (-496.968) -- 0:00:14
786000 -- (-495.241) (-495.767) [-496.728] (-496.894) * (-500.179) (-495.182) (-496.922) [-494.882] -- 0:00:14
786500 -- [-498.078] (-495.788) (-496.715) (-499.364) * (-496.310) (-499.366) (-496.455) [-495.355] -- 0:00:14
787000 -- (-497.352) (-499.346) (-496.374) [-495.669] * (-494.147) [-495.684] (-497.796) (-496.056) -- 0:00:14
787500 -- (-498.193) (-497.793) [-495.385] (-497.855) * (-498.716) [-495.699] (-496.016) (-499.881) -- 0:00:14
788000 -- [-497.580] (-498.208) (-496.140) (-497.774) * (-496.703) (-495.481) [-497.161] (-496.159) -- 0:00:14
788500 -- (-496.977) [-497.899] (-497.143) (-497.935) * (-495.305) (-495.316) (-497.165) [-496.940] -- 0:00:14
789000 -- [-496.450] (-497.641) (-496.680) (-497.149) * [-495.113] (-498.525) (-497.912) (-495.474) -- 0:00:14
789500 -- (-495.705) (-496.851) (-495.669) [-495.333] * (-498.837) (-498.450) [-496.994] (-499.441) -- 0:00:14
790000 -- [-495.496] (-495.712) (-496.401) (-495.594) * (-494.851) (-496.230) (-496.791) [-496.916] -- 0:00:14
Average standard deviation of split frequencies: 0.008161
790500 -- (-495.164) (-498.147) [-498.118] (-498.944) * (-494.466) (-496.208) (-496.789) [-496.227] -- 0:00:14
791000 -- (-495.650) [-496.405] (-495.859) (-496.423) * (-494.888) (-498.697) (-498.986) [-498.206] -- 0:00:14
791500 -- (-494.835) (-496.094) (-499.306) [-497.090] * (-495.641) [-495.998] (-495.633) (-498.643) -- 0:00:14
792000 -- [-495.738] (-495.687) (-503.430) (-496.527) * (-495.288) (-495.308) (-497.151) [-498.823] -- 0:00:14
792500 -- (-494.253) [-495.072] (-498.180) (-496.121) * (-499.960) (-494.907) [-494.962] (-495.238) -- 0:00:14
793000 -- [-495.435] (-494.967) (-495.609) (-494.755) * (-498.577) (-496.469) [-497.986] (-496.144) -- 0:00:14
793500 -- (-497.293) (-495.953) (-497.631) [-496.160] * [-495.616] (-500.008) (-496.980) (-495.437) -- 0:00:14
794000 -- [-494.960] (-496.736) (-495.793) (-495.340) * (-495.905) [-497.057] (-495.327) (-497.448) -- 0:00:14
794500 -- (-497.285) [-497.182] (-494.633) (-500.253) * (-495.936) [-497.045] (-495.025) (-495.497) -- 0:00:14
795000 -- (-494.864) (-495.606) (-495.540) [-494.992] * (-497.091) (-496.462) (-495.239) [-494.535] -- 0:00:14
Average standard deviation of split frequencies: 0.008254
795500 -- (-496.531) (-495.578) (-496.304) [-497.230] * (-497.357) (-497.614) (-497.480) [-496.285] -- 0:00:14
796000 -- (-497.195) (-496.012) [-496.361] (-496.847) * (-498.606) [-496.177] (-499.201) (-497.205) -- 0:00:14
796500 -- (-494.433) (-496.390) [-495.199] (-499.924) * (-497.284) (-498.285) (-500.734) [-496.727] -- 0:00:14
797000 -- [-495.752] (-500.341) (-496.970) (-501.860) * [-498.216] (-494.972) (-501.289) (-498.142) -- 0:00:14
797500 -- (-500.326) [-495.901] (-500.992) (-499.073) * [-494.996] (-494.507) (-499.297) (-499.003) -- 0:00:13
798000 -- (-496.859) (-496.420) [-495.375] (-500.961) * [-495.709] (-498.059) (-497.908) (-496.402) -- 0:00:13
798500 -- (-496.566) (-496.882) [-496.159] (-497.735) * (-496.392) [-494.822] (-498.153) (-496.638) -- 0:00:13
799000 -- (-498.058) (-495.594) (-497.022) [-495.620] * (-495.511) [-494.199] (-497.100) (-496.148) -- 0:00:13
799500 -- (-499.783) (-496.820) [-496.215] (-497.396) * (-496.086) (-496.994) (-495.434) [-496.007] -- 0:00:13
800000 -- (-497.334) [-495.839] (-496.619) (-495.676) * (-497.549) (-499.145) (-496.022) [-496.520] -- 0:00:13
Average standard deviation of split frequencies: 0.008537
800500 -- (-496.646) (-494.838) [-496.643] (-495.745) * (-495.184) (-495.310) [-498.947] (-499.192) -- 0:00:13
801000 -- [-496.261] (-497.330) (-494.829) (-496.724) * (-495.792) [-494.548] (-497.915) (-497.043) -- 0:00:13
801500 -- (-500.438) (-496.999) [-495.932] (-495.515) * (-499.855) (-502.480) [-495.260] (-496.936) -- 0:00:13
802000 -- (-497.673) [-495.376] (-496.339) (-496.773) * (-499.413) (-498.550) (-494.865) [-496.985] -- 0:00:13
802500 -- (-496.568) (-495.952) (-499.166) [-496.262] * (-497.082) [-494.689] (-495.813) (-499.180) -- 0:00:13
803000 -- (-495.091) [-497.762] (-496.765) (-495.102) * (-499.937) (-494.814) (-495.922) [-500.431] -- 0:00:13
803500 -- (-499.926) (-494.601) [-502.132] (-494.796) * (-500.216) (-494.439) (-495.105) [-496.833] -- 0:00:13
804000 -- (-498.962) (-495.334) (-503.042) [-495.538] * (-494.706) (-495.500) [-498.943] (-496.763) -- 0:00:13
804500 -- (-497.750) (-494.959) (-494.844) [-496.758] * (-497.693) (-495.153) (-494.374) [-498.058] -- 0:00:13
805000 -- (-501.082) [-495.619] (-500.878) (-497.729) * (-494.757) (-499.158) [-498.399] (-495.892) -- 0:00:13
Average standard deviation of split frequencies: 0.008627
805500 -- (-498.615) (-495.133) [-496.703] (-495.759) * (-494.866) (-498.038) [-501.332] (-495.423) -- 0:00:13
806000 -- [-497.686] (-494.247) (-496.947) (-500.166) * (-494.934) (-494.736) [-499.982] (-494.764) -- 0:00:13
806500 -- (-500.357) [-496.611] (-499.547) (-498.600) * (-500.243) (-494.702) [-495.438] (-494.907) -- 0:00:13
807000 -- (-499.592) [-496.174] (-499.281) (-496.639) * (-497.233) (-495.230) [-494.727] (-494.711) -- 0:00:13
807500 -- (-499.513) (-497.929) [-497.386] (-502.914) * (-501.288) [-494.798] (-494.747) (-497.340) -- 0:00:13
808000 -- [-495.443] (-495.726) (-495.885) (-497.058) * [-498.238] (-494.937) (-495.972) (-495.284) -- 0:00:13
808500 -- [-496.494] (-495.206) (-495.491) (-498.344) * (-498.702) [-503.240] (-496.556) (-499.250) -- 0:00:13
809000 -- (-496.672) [-495.538] (-498.010) (-497.465) * (-496.707) [-495.585] (-496.043) (-498.818) -- 0:00:13
809500 -- (-498.946) [-495.732] (-495.119) (-496.983) * (-497.219) [-497.215] (-500.467) (-495.592) -- 0:00:13
810000 -- (-498.058) [-501.452] (-500.885) (-498.806) * (-495.457) (-499.579) (-500.521) [-495.645] -- 0:00:13
Average standard deviation of split frequencies: 0.008868
810500 -- [-496.926] (-499.935) (-495.388) (-494.871) * [-496.411] (-498.017) (-499.864) (-496.335) -- 0:00:13
811000 -- (-496.811) (-498.245) (-494.490) [-495.827] * (-502.603) [-494.866] (-498.464) (-496.458) -- 0:00:13
811500 -- [-495.775] (-497.178) (-495.310) (-495.702) * (-497.988) [-494.548] (-496.461) (-495.781) -- 0:00:13
812000 -- (-495.657) (-496.022) (-503.453) [-495.513] * [-494.794] (-496.023) (-496.699) (-499.692) -- 0:00:12
812500 -- (-495.984) (-495.423) [-495.228] (-496.951) * (-495.190) (-495.851) [-494.878] (-499.562) -- 0:00:12
813000 -- (-497.961) (-494.635) (-495.488) [-497.061] * (-495.190) (-497.075) [-497.271] (-499.012) -- 0:00:12
813500 -- (-497.281) (-495.231) (-497.134) [-498.240] * (-495.929) (-495.297) (-496.804) [-496.497] -- 0:00:12
814000 -- (-497.778) (-495.827) [-494.413] (-498.563) * (-499.145) [-498.106] (-498.787) (-497.034) -- 0:00:12
814500 -- [-495.773] (-497.117) (-495.068) (-495.811) * (-496.000) (-501.207) (-499.326) [-496.067] -- 0:00:12
815000 -- [-497.133] (-499.332) (-498.506) (-496.296) * (-498.531) (-499.357) (-499.696) [-503.817] -- 0:00:12
Average standard deviation of split frequencies: 0.009099
815500 -- (-495.747) [-497.886] (-494.905) (-497.186) * (-500.486) (-495.505) (-497.000) [-497.743] -- 0:00:12
816000 -- (-499.812) (-498.921) [-497.433] (-499.631) * (-498.069) (-495.103) [-494.162] (-497.208) -- 0:00:12
816500 -- [-496.583] (-497.055) (-498.876) (-502.356) * (-496.583) (-500.763) [-494.836] (-499.012) -- 0:00:12
817000 -- [-495.802] (-498.907) (-496.355) (-496.482) * (-495.013) (-496.452) [-494.524] (-496.123) -- 0:00:12
817500 -- (-499.084) (-500.150) (-495.559) [-498.586] * (-497.406) (-496.251) [-500.494] (-495.235) -- 0:00:12
818000 -- [-496.172] (-506.000) (-501.289) (-498.287) * [-496.383] (-495.943) (-499.541) (-495.805) -- 0:00:12
818500 -- (-498.534) (-500.905) (-497.862) [-495.987] * [-495.731] (-495.979) (-496.324) (-500.168) -- 0:00:12
819000 -- [-495.642] (-498.286) (-496.809) (-495.246) * (-498.731) [-498.851] (-498.939) (-495.897) -- 0:00:12
819500 -- (-495.851) (-498.571) (-495.926) [-495.386] * [-496.169] (-494.989) (-496.439) (-497.174) -- 0:00:12
820000 -- [-495.079] (-497.182) (-497.014) (-497.963) * [-495.978] (-494.779) (-497.861) (-495.653) -- 0:00:12
Average standard deviation of split frequencies: 0.009406
820500 -- (-496.642) (-496.337) (-498.366) [-495.965] * (-497.084) [-495.778] (-498.898) (-495.571) -- 0:00:12
821000 -- (-502.683) [-497.714] (-496.581) (-496.544) * [-496.919] (-495.121) (-498.624) (-496.866) -- 0:00:12
821500 -- [-496.273] (-498.585) (-496.335) (-496.124) * [-497.289] (-495.408) (-498.413) (-496.464) -- 0:00:12
822000 -- [-498.046] (-494.943) (-501.872) (-496.867) * (-499.876) [-496.387] (-500.218) (-495.289) -- 0:00:12
822500 -- (-498.722) (-494.801) (-498.238) [-496.418] * (-497.354) (-495.225) [-495.681] (-499.597) -- 0:00:12
823000 -- (-503.962) [-495.115] (-495.431) (-496.408) * (-496.911) [-495.985] (-500.836) (-501.008) -- 0:00:12
823500 -- (-494.843) (-495.089) [-494.508] (-497.353) * (-495.657) [-496.590] (-498.121) (-495.735) -- 0:00:12
824000 -- [-498.463] (-494.890) (-496.342) (-497.403) * (-494.927) [-495.476] (-498.730) (-504.547) -- 0:00:12
824500 -- [-497.398] (-494.960) (-494.829) (-498.428) * (-496.606) (-494.966) (-499.086) [-501.629] -- 0:00:12
825000 -- (-497.499) (-497.988) [-494.811] (-497.722) * [-495.808] (-497.417) (-496.680) (-498.663) -- 0:00:12
Average standard deviation of split frequencies: 0.009310
825500 -- (-498.434) (-495.979) (-497.988) [-500.938] * (-496.337) (-496.832) [-499.373] (-496.587) -- 0:00:12
826000 -- [-498.494] (-495.367) (-496.010) (-498.148) * [-495.791] (-497.495) (-494.983) (-496.907) -- 0:00:12
826500 -- (-497.145) [-496.082] (-498.793) (-495.940) * (-496.197) (-496.416) (-498.727) [-498.187] -- 0:00:11
827000 -- (-496.934) (-494.491) (-494.867) [-497.848] * [-495.994] (-498.294) (-495.048) (-495.134) -- 0:00:11
827500 -- (-496.219) (-496.211) [-496.883] (-499.366) * [-495.780] (-497.075) (-495.368) (-495.383) -- 0:00:11
828000 -- (-496.336) [-499.212] (-495.378) (-499.995) * (-496.599) [-496.818] (-496.914) (-496.875) -- 0:00:11
828500 -- (-497.555) (-495.940) [-497.127] (-500.635) * [-497.099] (-496.550) (-497.239) (-494.925) -- 0:00:11
829000 -- (-496.370) [-495.651] (-496.478) (-497.371) * (-500.077) [-494.907] (-496.847) (-495.482) -- 0:00:11
829500 -- [-497.739] (-494.939) (-497.600) (-495.104) * [-495.545] (-495.508) (-496.959) (-495.562) -- 0:00:11
830000 -- (-495.073) [-496.608] (-496.185) (-494.325) * (-496.389) (-496.743) [-495.444] (-499.330) -- 0:00:11
Average standard deviation of split frequencies: 0.009186
830500 -- (-497.971) [-495.742] (-495.730) (-498.173) * (-495.366) (-496.511) [-494.956] (-498.606) -- 0:00:11
831000 -- (-495.037) (-494.752) (-497.734) [-494.149] * (-496.057) [-497.032] (-500.003) (-495.542) -- 0:00:11
831500 -- (-500.061) [-495.244] (-500.980) (-496.996) * (-496.157) [-496.830] (-498.940) (-495.775) -- 0:00:11
832000 -- (-496.365) [-495.829] (-499.542) (-499.590) * [-497.799] (-494.600) (-495.906) (-497.363) -- 0:00:11
832500 -- (-498.560) [-495.759] (-497.668) (-498.069) * [-494.771] (-495.441) (-495.349) (-497.052) -- 0:00:11
833000 -- (-494.746) [-499.316] (-498.124) (-497.620) * (-498.450) [-495.109] (-498.946) (-498.489) -- 0:00:11
833500 -- (-494.346) (-499.718) (-495.964) [-501.936] * (-494.905) (-496.129) (-499.801) [-496.320] -- 0:00:11
834000 -- [-498.562] (-496.369) (-498.306) (-503.103) * (-497.443) [-496.074] (-498.294) (-495.624) -- 0:00:11
834500 -- (-496.028) [-496.038] (-496.304) (-500.688) * [-496.515] (-495.960) (-496.544) (-494.835) -- 0:00:11
835000 -- [-496.191] (-499.230) (-495.078) (-496.676) * (-495.418) [-496.796] (-496.470) (-495.774) -- 0:00:11
Average standard deviation of split frequencies: 0.009375
835500 -- (-496.832) [-497.113] (-494.886) (-494.461) * [-496.621] (-498.659) (-495.550) (-497.296) -- 0:00:11
836000 -- (-496.022) (-500.629) [-495.834] (-496.063) * (-494.843) [-494.403] (-498.099) (-495.026) -- 0:00:11
836500 -- (-496.955) (-496.506) (-495.804) [-495.071] * (-494.838) (-496.397) (-496.799) [-495.736] -- 0:00:11
837000 -- [-496.307] (-495.832) (-502.340) (-495.023) * (-497.610) [-496.065] (-495.149) (-497.129) -- 0:00:11
837500 -- (-497.177) (-496.396) (-496.069) [-496.092] * [-495.483] (-495.255) (-499.641) (-495.300) -- 0:00:11
838000 -- [-495.829] (-495.448) (-496.247) (-495.359) * (-500.632) (-497.342) (-497.223) [-495.649] -- 0:00:11
838500 -- (-497.283) [-499.292] (-496.324) (-495.390) * [-498.624] (-497.166) (-497.816) (-495.267) -- 0:00:11
839000 -- [-496.679] (-503.723) (-499.188) (-496.739) * [-498.015] (-496.260) (-500.412) (-495.975) -- 0:00:11
839500 -- (-495.414) (-501.520) (-497.100) [-496.053] * (-494.645) [-499.109] (-502.592) (-495.178) -- 0:00:11
840000 -- (-500.010) [-496.884] (-496.625) (-495.948) * (-498.291) (-495.942) (-495.279) [-497.726] -- 0:00:11
Average standard deviation of split frequencies: 0.008867
840500 -- [-496.075] (-497.763) (-500.408) (-495.375) * (-494.926) (-495.618) (-494.251) [-496.696] -- 0:00:11
841000 -- (-496.137) (-497.657) [-495.001] (-498.862) * (-495.967) (-498.079) (-498.145) [-495.423] -- 0:00:10
841500 -- (-498.334) (-496.820) (-500.622) [-495.094] * (-494.931) (-497.809) (-495.416) [-499.173] -- 0:00:10
842000 -- [-498.963] (-496.379) (-498.213) (-495.184) * (-495.156) [-497.106] (-497.578) (-502.554) -- 0:00:10
842500 -- (-497.113) (-495.789) [-497.274] (-494.979) * [-495.688] (-496.589) (-495.756) (-500.737) -- 0:00:10
843000 -- (-494.838) (-496.051) (-497.874) [-498.699] * (-497.491) [-495.089] (-496.270) (-501.333) -- 0:00:10
843500 -- (-494.730) [-494.698] (-497.419) (-494.657) * (-496.573) [-496.081] (-495.966) (-499.751) -- 0:00:10
844000 -- (-495.190) (-495.791) [-497.830] (-496.472) * [-494.932] (-495.081) (-494.225) (-502.705) -- 0:00:10
844500 -- [-495.274] (-495.633) (-494.360) (-495.228) * (-496.323) [-494.688] (-495.659) (-498.056) -- 0:00:10
845000 -- (-495.278) (-494.598) [-496.653] (-497.635) * (-496.323) (-494.735) (-496.743) [-496.048] -- 0:00:10
Average standard deviation of split frequencies: 0.008428
845500 -- (-494.630) (-496.336) [-497.726] (-497.447) * (-496.753) (-494.990) [-495.391] (-496.067) -- 0:00:10
846000 -- (-497.141) [-495.119] (-498.396) (-495.848) * (-496.056) (-500.068) [-496.292] (-495.356) -- 0:00:10
846500 -- (-496.356) [-495.126] (-497.407) (-497.125) * (-502.106) [-496.158] (-496.600) (-497.812) -- 0:00:10
847000 -- (-498.151) (-494.483) [-498.578] (-495.349) * (-495.553) [-496.798] (-496.945) (-499.700) -- 0:00:10
847500 -- (-499.849) [-499.449] (-499.993) (-502.062) * (-494.611) (-497.715) (-497.639) [-496.790] -- 0:00:10
848000 -- (-500.157) (-503.484) (-499.601) [-496.693] * (-496.494) [-498.505] (-498.587) (-499.641) -- 0:00:10
848500 -- (-497.240) (-496.970) [-496.047] (-496.048) * (-497.081) [-494.957] (-497.859) (-498.211) -- 0:00:10
849000 -- (-494.795) [-496.346] (-495.392) (-495.550) * (-495.747) (-494.817) [-497.068] (-498.793) -- 0:00:10
849500 -- (-494.958) (-500.394) (-495.595) [-499.203] * (-496.245) (-496.251) [-497.548] (-496.161) -- 0:00:10
850000 -- (-498.550) (-495.827) [-494.947] (-496.367) * (-499.729) (-495.387) (-497.064) [-495.109] -- 0:00:10
Average standard deviation of split frequencies: 0.008347
850500 -- (-498.959) (-495.884) [-496.471] (-501.092) * (-499.360) (-498.309) [-495.363] (-499.606) -- 0:00:10
851000 -- (-495.176) [-498.117] (-496.166) (-495.096) * (-502.239) (-495.669) [-496.951] (-495.212) -- 0:00:10
851500 -- (-497.609) (-496.201) (-497.348) [-496.194] * (-497.643) (-497.912) [-499.831] (-494.886) -- 0:00:10
852000 -- (-501.653) (-495.425) [-495.046] (-497.733) * (-495.722) [-497.237] (-499.892) (-496.755) -- 0:00:10
852500 -- (-494.809) (-495.321) [-494.824] (-496.489) * [-501.855] (-495.422) (-499.340) (-499.601) -- 0:00:10
853000 -- [-495.876] (-496.324) (-495.198) (-495.510) * (-497.679) [-496.017] (-497.873) (-494.994) -- 0:00:10
853500 -- [-495.752] (-497.232) (-496.264) (-498.328) * (-495.923) [-496.996] (-494.769) (-498.652) -- 0:00:10
854000 -- (-499.959) (-495.441) [-495.603] (-497.353) * [-496.172] (-495.157) (-495.957) (-497.171) -- 0:00:10
854500 -- (-497.297) (-495.732) (-495.562) [-496.873] * (-495.746) (-497.179) [-496.458] (-498.856) -- 0:00:10
855000 -- [-496.026] (-495.346) (-496.533) (-498.943) * [-496.002] (-499.701) (-498.033) (-499.144) -- 0:00:10
Average standard deviation of split frequencies: 0.008261
855500 -- (-497.773) (-498.021) [-495.064] (-498.142) * (-495.500) (-494.715) [-496.273] (-494.986) -- 0:00:09
856000 -- (-497.564) (-501.955) [-494.972] (-496.464) * [-495.950] (-496.312) (-500.703) (-495.549) -- 0:00:09
856500 -- (-499.514) (-499.984) (-494.429) [-498.514] * (-494.910) (-495.526) [-496.884] (-495.029) -- 0:00:09
857000 -- (-500.258) (-495.675) (-496.905) [-494.636] * (-495.592) (-495.305) (-497.496) [-496.368] -- 0:00:09
857500 -- (-497.800) (-496.138) (-495.523) [-497.769] * (-500.271) (-494.908) (-496.426) [-501.404] -- 0:00:09
858000 -- (-495.418) [-494.936] (-496.452) (-498.139) * (-498.544) [-496.160] (-496.533) (-497.491) -- 0:00:09
858500 -- (-495.881) (-496.542) (-495.377) [-494.890] * (-499.677) [-496.914] (-496.671) (-496.482) -- 0:00:09
859000 -- (-498.805) (-500.108) [-497.100] (-495.390) * (-496.710) (-499.589) [-495.897] (-496.638) -- 0:00:09
859500 -- (-495.524) [-496.741] (-495.645) (-501.039) * (-497.197) (-498.587) (-498.660) [-495.628] -- 0:00:09
860000 -- (-494.619) [-495.528] (-496.358) (-496.398) * (-495.389) [-495.080] (-497.538) (-495.994) -- 0:00:09
Average standard deviation of split frequencies: 0.008284
860500 -- [-495.333] (-494.724) (-495.586) (-495.004) * [-495.390] (-494.573) (-499.892) (-497.691) -- 0:00:09
861000 -- [-494.685] (-495.267) (-497.167) (-495.905) * (-495.660) (-494.590) (-495.352) [-496.319] -- 0:00:09
861500 -- (-498.716) (-494.914) [-495.990] (-495.945) * (-495.673) (-495.118) (-496.271) [-496.982] -- 0:00:09
862000 -- (-495.467) [-496.354] (-498.119) (-495.008) * (-501.120) (-495.857) [-495.002] (-499.337) -- 0:00:09
862500 -- (-495.567) (-494.908) (-498.246) [-498.454] * (-499.266) [-495.166] (-494.568) (-495.662) -- 0:00:09
863000 -- (-497.934) (-494.976) [-496.305] (-496.755) * (-495.532) (-495.245) [-496.299] (-499.312) -- 0:00:09
863500 -- (-497.815) (-494.484) (-496.016) [-495.245] * [-496.276] (-495.442) (-499.110) (-498.476) -- 0:00:09
864000 -- (-496.508) (-496.072) (-501.022) [-495.560] * (-494.950) [-497.497] (-498.684) (-497.867) -- 0:00:09
864500 -- [-499.801] (-495.422) (-500.343) (-499.560) * (-496.076) [-497.033] (-497.690) (-498.713) -- 0:00:09
865000 -- (-499.385) (-498.504) (-499.608) [-498.086] * [-495.143] (-497.397) (-496.393) (-494.465) -- 0:00:09
Average standard deviation of split frequencies: 0.008335
865500 -- (-496.089) (-498.888) (-501.273) [-498.319] * (-496.586) (-497.675) (-494.378) [-496.518] -- 0:00:09
866000 -- [-496.513] (-497.297) (-494.550) (-495.988) * (-497.039) [-498.026] (-499.452) (-497.265) -- 0:00:09
866500 -- (-498.812) (-494.698) [-497.323] (-496.878) * [-494.982] (-496.541) (-503.606) (-496.417) -- 0:00:09
867000 -- (-502.562) (-496.646) (-497.068) [-494.909] * (-498.281) (-494.574) [-495.900] (-496.150) -- 0:00:09
867500 -- (-496.703) (-495.383) [-496.733] (-495.655) * (-495.924) (-494.838) [-497.336] (-497.209) -- 0:00:09
868000 -- (-500.395) (-496.599) [-497.437] (-497.527) * (-498.510) (-495.121) (-499.741) [-498.968] -- 0:00:09
868500 -- (-499.303) [-496.599] (-497.488) (-497.361) * (-498.577) [-498.339] (-500.086) (-495.773) -- 0:00:09
869000 -- (-496.414) (-495.404) [-497.846] (-495.755) * [-498.470] (-499.340) (-499.396) (-495.540) -- 0:00:09
869500 -- (-497.089) (-496.149) (-499.646) [-494.616] * (-495.449) (-497.501) [-497.077] (-497.995) -- 0:00:09
870000 -- (-499.839) (-498.523) [-497.686] (-494.721) * (-495.983) (-508.669) (-499.284) [-496.280] -- 0:00:08
Average standard deviation of split frequencies: 0.008460
870500 -- (-496.565) (-497.575) (-497.011) [-494.751] * [-498.381] (-500.277) (-496.122) (-497.225) -- 0:00:08
871000 -- [-496.247] (-497.292) (-494.576) (-497.469) * (-497.523) (-497.703) [-499.596] (-497.001) -- 0:00:08
871500 -- (-498.472) (-495.143) [-496.369] (-495.502) * (-495.541) (-495.403) [-499.020] (-498.274) -- 0:00:08
872000 -- (-495.335) (-495.817) (-499.032) [-495.224] * (-497.053) (-495.781) (-495.066) [-494.729] -- 0:00:08
872500 -- (-495.160) [-496.194] (-495.327) (-498.742) * (-496.258) (-496.528) [-494.750] (-495.716) -- 0:00:08
873000 -- (-496.208) (-498.093) [-498.132] (-495.478) * [-495.716] (-495.808) (-495.997) (-495.298) -- 0:00:08
873500 -- (-497.499) (-495.688) (-499.497) [-495.976] * (-495.991) (-499.150) [-496.547] (-498.714) -- 0:00:08
874000 -- [-497.141] (-497.245) (-496.244) (-496.979) * (-495.933) [-497.474] (-496.349) (-496.975) -- 0:00:08
874500 -- (-495.503) (-495.480) [-496.028] (-496.202) * (-494.606) [-494.508] (-495.729) (-495.713) -- 0:00:08
875000 -- (-497.170) (-495.019) [-495.456] (-496.974) * (-494.615) (-495.691) (-500.172) [-496.255] -- 0:00:08
Average standard deviation of split frequencies: 0.008442
875500 -- (-497.085) (-496.097) (-495.106) [-496.435] * (-495.566) (-497.483) (-497.088) [-495.788] -- 0:00:08
876000 -- [-497.268] (-495.597) (-495.714) (-496.507) * [-496.207] (-496.387) (-496.079) (-495.760) -- 0:00:08
876500 -- [-495.542] (-494.512) (-496.459) (-495.796) * [-496.921] (-495.798) (-494.700) (-499.808) -- 0:00:08
877000 -- (-496.520) [-494.504] (-497.099) (-494.301) * [-498.092] (-495.416) (-496.124) (-494.452) -- 0:00:08
877500 -- (-495.308) (-494.896) (-496.191) [-495.450] * (-496.579) (-495.704) (-496.193) [-494.435] -- 0:00:08
878000 -- (-494.909) (-498.536) [-496.980] (-496.872) * (-499.291) (-496.123) [-496.146] (-494.313) -- 0:00:08
878500 -- (-494.554) (-496.992) [-497.340] (-498.043) * [-494.926] (-499.771) (-497.382) (-497.479) -- 0:00:08
879000 -- (-495.080) (-495.966) (-499.219) [-498.115] * [-494.926] (-495.237) (-495.388) (-496.951) -- 0:00:08
879500 -- (-500.341) (-500.431) [-495.574] (-495.609) * (-496.546) [-497.515] (-498.948) (-497.261) -- 0:00:08
880000 -- [-497.856] (-497.856) (-495.418) (-496.159) * [-497.639] (-496.371) (-498.260) (-496.191) -- 0:00:08
Average standard deviation of split frequencies: 0.008565
880500 -- (-495.736) (-495.038) [-495.668] (-498.192) * [-494.703] (-494.928) (-498.629) (-495.088) -- 0:00:08
881000 -- [-495.681] (-498.571) (-497.919) (-498.660) * (-495.476) (-496.192) (-498.692) [-497.501] -- 0:00:08
881500 -- (-494.882) [-498.902] (-498.889) (-496.254) * (-498.118) [-496.969] (-498.372) (-501.125) -- 0:00:08
882000 -- (-496.799) (-496.444) [-497.503] (-494.891) * (-497.524) (-496.376) [-496.276] (-498.036) -- 0:00:08
882500 -- (-496.442) (-498.694) (-495.857) [-495.393] * [-494.894] (-496.128) (-496.324) (-497.391) -- 0:00:08
883000 -- (-496.504) (-498.248) [-496.267] (-496.475) * [-495.492] (-494.999) (-497.165) (-497.451) -- 0:00:08
883500 -- (-496.318) (-495.347) (-495.564) [-495.465] * (-494.389) [-498.130] (-500.360) (-494.644) -- 0:00:08
884000 -- (-496.628) (-495.176) (-501.435) [-495.920] * (-496.888) (-497.885) (-496.771) [-495.759] -- 0:00:08
884500 -- (-497.035) (-496.280) (-496.699) [-496.955] * (-499.238) [-496.954] (-497.956) (-494.828) -- 0:00:07
885000 -- (-495.810) [-495.965] (-495.939) (-496.083) * (-499.866) (-495.156) [-497.548] (-495.693) -- 0:00:07
Average standard deviation of split frequencies: 0.008280
885500 -- (-496.669) [-495.666] (-495.587) (-495.934) * (-495.521) [-496.962] (-498.318) (-497.959) -- 0:00:07
886000 -- (-500.401) (-497.270) [-496.411] (-495.300) * [-498.524] (-499.188) (-494.717) (-497.669) -- 0:00:07
886500 -- (-496.578) (-496.553) (-496.586) [-495.120] * (-495.409) (-496.135) [-495.700] (-498.921) -- 0:00:07
887000 -- [-495.894] (-501.694) (-496.173) (-496.965) * (-496.964) (-497.025) (-495.655) [-494.654] -- 0:00:07
887500 -- [-495.624] (-499.163) (-498.776) (-499.066) * (-498.998) (-497.385) (-495.748) [-496.082] -- 0:00:07
888000 -- (-497.755) (-499.643) (-497.839) [-497.370] * (-496.328) [-501.375] (-496.581) (-495.258) -- 0:00:07
888500 -- (-497.960) [-495.668] (-495.188) (-495.467) * (-499.521) [-496.508] (-500.029) (-496.062) -- 0:00:07
889000 -- (-494.683) [-494.622] (-496.525) (-494.873) * (-499.754) (-496.415) [-495.702] (-498.764) -- 0:00:07
889500 -- (-496.099) (-496.644) (-495.556) [-498.451] * (-500.225) (-497.464) (-496.994) [-498.155] -- 0:00:07
890000 -- (-495.675) [-496.497] (-495.303) (-496.027) * (-496.924) (-496.800) (-496.911) [-497.467] -- 0:00:07
Average standard deviation of split frequencies: 0.008171
890500 -- [-496.152] (-498.175) (-496.054) (-496.029) * (-496.307) (-496.247) (-495.315) [-494.414] -- 0:00:07
891000 -- (-497.678) (-496.150) (-498.296) [-494.539] * (-496.473) [-497.020] (-497.561) (-498.475) -- 0:00:07
891500 -- (-495.758) (-497.126) [-500.420] (-496.196) * (-497.907) [-495.799] (-495.554) (-496.416) -- 0:00:07
892000 -- (-494.924) [-495.443] (-500.385) (-496.500) * (-499.545) (-495.332) [-495.831] (-497.470) -- 0:00:07
892500 -- (-496.386) [-494.983] (-497.573) (-497.496) * (-497.609) (-496.851) (-495.587) [-495.095] -- 0:00:07
893000 -- (-497.509) (-496.336) (-497.655) [-494.377] * [-498.013] (-495.463) (-496.328) (-498.926) -- 0:00:07
893500 -- [-496.164] (-495.641) (-498.240) (-495.894) * [-495.858] (-494.894) (-497.229) (-495.922) -- 0:00:07
894000 -- (-496.030) [-499.313] (-495.556) (-497.720) * (-495.144) [-499.149] (-496.344) (-498.318) -- 0:00:07
894500 -- (-495.076) (-495.826) [-498.018] (-495.679) * [-498.194] (-496.219) (-495.258) (-495.649) -- 0:00:07
895000 -- (-494.721) (-494.887) (-501.450) [-496.377] * (-498.673) (-497.276) (-496.004) [-495.927] -- 0:00:07
Average standard deviation of split frequencies: 0.008056
895500 -- (-495.822) [-496.124] (-496.168) (-496.135) * (-496.672) (-496.085) (-497.064) [-495.692] -- 0:00:07
896000 -- [-495.129] (-497.016) (-495.387) (-495.405) * (-496.214) (-496.475) (-498.371) [-497.495] -- 0:00:07
896500 -- (-499.101) (-495.951) [-495.389] (-496.282) * (-496.327) (-497.244) (-499.889) [-497.128] -- 0:00:07
897000 -- (-496.223) [-495.058] (-496.381) (-495.005) * [-497.696] (-497.140) (-496.322) (-496.731) -- 0:00:07
897500 -- (-495.907) (-495.919) (-495.531) [-494.777] * (-500.612) (-496.733) (-497.170) [-496.259] -- 0:00:07
898000 -- (-496.882) (-496.132) [-495.021] (-496.090) * (-498.066) (-500.404) [-494.824] (-495.689) -- 0:00:07
898500 -- (-502.687) (-495.082) (-496.722) [-496.921] * (-497.814) (-497.723) [-496.466] (-496.487) -- 0:00:07
899000 -- [-495.407] (-495.520) (-498.329) (-497.858) * (-498.835) (-495.899) [-496.389] (-494.943) -- 0:00:06
899500 -- [-495.765] (-498.083) (-502.479) (-498.069) * (-495.806) (-498.126) [-497.161] (-496.135) -- 0:00:06
900000 -- (-495.756) (-494.744) (-502.332) [-496.903] * (-494.559) [-498.943] (-495.862) (-495.470) -- 0:00:06
Average standard deviation of split frequencies: 0.008025
900500 -- [-498.393] (-495.216) (-498.892) (-496.607) * (-494.765) (-498.890) (-495.461) [-495.347] -- 0:00:06
901000 -- (-495.951) (-496.920) (-498.130) [-494.678] * (-498.010) (-496.237) (-496.121) [-495.242] -- 0:00:06
901500 -- (-497.392) [-496.528] (-497.359) (-495.500) * (-496.522) (-495.486) (-496.034) [-498.605] -- 0:00:06
902000 -- [-499.197] (-497.640) (-495.358) (-495.859) * (-494.880) (-501.759) [-498.168] (-498.001) -- 0:00:06
902500 -- (-495.285) [-495.073] (-496.496) (-502.484) * [-498.557] (-495.016) (-495.288) (-496.126) -- 0:00:06
903000 -- (-496.593) (-497.323) (-496.433) [-496.261] * (-500.903) (-501.146) (-496.253) [-495.741] -- 0:00:06
903500 -- (-500.668) (-498.161) (-498.863) [-498.623] * [-497.550] (-498.576) (-495.972) (-495.039) -- 0:00:06
904000 -- (-499.340) [-497.088] (-496.818) (-495.692) * [-495.765] (-498.541) (-498.257) (-495.578) -- 0:00:06
904500 -- (-496.696) (-499.377) (-496.642) [-498.175] * (-495.251) (-498.378) [-498.237] (-494.855) -- 0:00:06
905000 -- (-495.674) (-499.617) [-497.864] (-496.967) * (-495.521) (-496.881) (-496.151) [-495.673] -- 0:00:06
Average standard deviation of split frequencies: 0.008394
905500 -- (-503.015) (-506.790) (-496.525) [-496.507] * (-495.609) (-497.619) (-495.260) [-497.859] -- 0:00:06
906000 -- [-495.856] (-494.545) (-495.022) (-495.901) * (-497.414) (-496.510) [-494.555] (-500.304) -- 0:00:06
906500 -- (-496.372) (-496.659) [-496.298] (-495.974) * [-495.562] (-494.881) (-501.269) (-497.349) -- 0:00:06
907000 -- [-497.206] (-499.953) (-495.829) (-496.667) * (-496.074) [-498.043] (-495.213) (-496.520) -- 0:00:06
907500 -- (-496.887) (-499.377) (-499.413) [-495.967] * (-496.665) [-495.904] (-496.898) (-501.058) -- 0:00:06
908000 -- [-496.437] (-496.457) (-500.710) (-495.650) * (-496.502) [-496.298] (-496.201) (-498.401) -- 0:00:06
908500 -- (-494.684) (-496.123) (-499.503) [-498.780] * (-497.602) (-495.575) [-497.217] (-500.638) -- 0:00:06
909000 -- [-495.063] (-495.864) (-500.060) (-495.347) * (-496.440) (-495.858) (-494.202) [-498.386] -- 0:00:06
909500 -- [-497.245] (-497.734) (-500.057) (-498.141) * (-495.974) (-499.483) [-495.970] (-501.843) -- 0:00:06
910000 -- (-494.724) (-500.532) [-497.078] (-499.793) * (-498.850) (-495.462) [-495.875] (-499.026) -- 0:00:06
Average standard deviation of split frequencies: 0.008627
910500 -- (-497.373) (-494.533) (-501.494) [-495.908] * [-498.712] (-497.000) (-494.759) (-498.451) -- 0:00:06
911000 -- [-495.798] (-496.635) (-497.410) (-495.644) * (-499.777) (-497.196) (-495.819) [-495.917] -- 0:00:06
911500 -- (-498.640) [-496.337] (-494.820) (-496.771) * (-496.195) (-498.077) (-497.341) [-497.247] -- 0:00:06
912000 -- (-501.348) [-495.146] (-497.894) (-501.634) * (-497.766) [-495.024] (-499.061) (-500.141) -- 0:00:06
912500 -- (-499.133) (-498.996) (-495.702) [-496.238] * (-494.875) (-501.848) [-495.349] (-497.624) -- 0:00:06
913000 -- (-497.796) (-499.337) [-495.358] (-495.598) * [-495.987] (-499.893) (-494.617) (-497.678) -- 0:00:06
913500 -- [-500.039] (-496.307) (-498.332) (-494.563) * [-497.092] (-498.489) (-494.927) (-494.750) -- 0:00:05
914000 -- (-496.300) (-496.997) [-497.110] (-498.755) * (-497.019) (-500.212) (-495.797) [-497.943] -- 0:00:05
914500 -- (-494.656) [-498.270] (-498.629) (-497.054) * (-499.270) (-497.464) (-498.536) [-496.364] -- 0:00:05
915000 -- [-497.890] (-495.319) (-497.611) (-498.091) * (-498.765) (-496.527) [-496.550] (-499.669) -- 0:00:05
Average standard deviation of split frequencies: 0.008131
915500 -- (-496.158) [-494.879] (-497.864) (-496.739) * [-495.485] (-496.447) (-497.363) (-497.148) -- 0:00:05
916000 -- (-500.512) (-494.995) (-495.197) [-496.714] * (-497.558) (-497.745) [-495.476] (-497.570) -- 0:00:05
916500 -- [-498.923] (-500.372) (-494.220) (-496.120) * (-495.995) (-496.525) [-497.372] (-498.416) -- 0:00:05
917000 -- (-498.363) (-494.854) (-496.459) [-495.553] * (-494.898) [-495.378] (-498.664) (-496.438) -- 0:00:05
917500 -- (-497.555) [-495.987] (-497.477) (-495.460) * (-495.599) (-495.381) [-496.020] (-498.587) -- 0:00:05
918000 -- [-495.799] (-496.816) (-496.364) (-497.931) * (-495.946) (-495.317) [-496.691] (-495.842) -- 0:00:05
918500 -- [-495.821] (-496.830) (-499.410) (-495.036) * (-495.040) [-494.793] (-495.295) (-499.312) -- 0:00:05
919000 -- (-494.686) [-496.188] (-497.303) (-496.705) * (-495.619) [-496.840] (-495.983) (-500.979) -- 0:00:05
919500 -- (-496.229) (-496.457) (-497.932) [-496.706] * [-496.756] (-498.118) (-496.124) (-499.940) -- 0:00:05
920000 -- (-494.940) (-496.182) [-497.788] (-496.436) * (-498.353) (-495.091) [-497.901] (-498.925) -- 0:00:05
Average standard deviation of split frequencies: 0.007578
920500 -- [-497.529] (-498.692) (-498.964) (-498.873) * (-503.010) (-496.779) (-495.294) [-495.989] -- 0:00:05
921000 -- (-498.401) (-499.399) [-500.677] (-496.155) * (-494.503) [-497.244] (-495.337) (-496.071) -- 0:00:05
921500 -- [-497.206] (-498.426) (-500.453) (-496.579) * (-496.690) (-496.357) (-494.877) [-495.422] -- 0:00:05
922000 -- (-498.550) (-497.358) [-496.852] (-498.405) * [-495.814] (-497.140) (-496.495) (-495.970) -- 0:00:05
922500 -- (-495.663) (-494.867) [-498.086] (-495.918) * (-495.126) (-497.933) (-499.057) [-494.592] -- 0:00:05
923000 -- (-495.476) [-495.254] (-496.465) (-494.854) * (-496.574) (-498.163) (-499.180) [-494.166] -- 0:00:05
923500 -- (-500.735) (-501.899) (-497.646) [-496.339] * [-498.479] (-496.292) (-496.688) (-494.378) -- 0:00:05
924000 -- (-498.346) (-497.408) (-494.766) [-496.192] * (-499.831) [-497.131] (-497.544) (-495.794) -- 0:00:05
924500 -- (-500.465) (-498.768) (-496.227) [-497.019] * (-501.734) (-496.784) [-496.484] (-494.457) -- 0:00:05
925000 -- (-499.461) [-497.275] (-498.709) (-496.643) * [-498.155] (-495.102) (-498.906) (-494.280) -- 0:00:05
Average standard deviation of split frequencies: 0.007908
925500 -- (-495.152) (-496.794) (-496.735) [-494.924] * (-494.891) (-495.243) [-494.590] (-495.542) -- 0:00:05
926000 -- (-496.950) [-498.875] (-497.427) (-499.432) * (-498.213) (-497.696) (-498.178) [-494.660] -- 0:00:05
926500 -- (-495.219) [-499.180] (-495.140) (-495.656) * [-497.514] (-497.189) (-495.017) (-500.108) -- 0:00:05
927000 -- (-495.225) (-498.001) (-494.949) [-494.775] * (-497.433) (-496.400) (-495.100) [-496.024] -- 0:00:05
927500 -- (-498.477) (-498.943) (-497.534) [-496.209] * (-499.876) [-497.383] (-496.199) (-495.133) -- 0:00:05
928000 -- (-495.084) (-494.986) [-497.526] (-502.121) * (-500.553) (-495.925) [-495.713] (-495.527) -- 0:00:04
928500 -- (-494.759) [-496.087] (-497.143) (-501.261) * [-499.592] (-496.018) (-496.508) (-496.513) -- 0:00:04
929000 -- (-495.102) (-494.886) [-495.382] (-503.253) * [-499.490] (-498.704) (-495.620) (-500.971) -- 0:00:04
929500 -- (-495.547) (-495.568) [-498.891] (-504.175) * (-497.412) (-496.003) (-495.037) [-501.838] -- 0:00:04
930000 -- (-494.906) (-495.812) [-497.426] (-500.941) * (-499.535) [-496.033] (-495.641) (-497.908) -- 0:00:04
Average standard deviation of split frequencies: 0.007463
930500 -- [-495.759] (-495.720) (-495.070) (-503.354) * (-497.899) [-494.331] (-495.408) (-497.647) -- 0:00:04
931000 -- (-496.468) [-500.845] (-494.453) (-496.749) * [-496.874] (-495.983) (-497.818) (-501.196) -- 0:00:04
931500 -- (-497.376) (-496.087) [-494.781] (-498.597) * (-495.241) (-494.662) (-494.397) [-496.694] -- 0:00:04
932000 -- [-499.034] (-495.572) (-496.633) (-496.685) * [-496.014] (-499.912) (-494.656) (-499.322) -- 0:00:04
932500 -- (-497.270) [-494.344] (-496.896) (-495.490) * (-496.126) [-495.063] (-498.430) (-499.786) -- 0:00:04
933000 -- (-495.402) (-495.627) [-495.462] (-497.987) * (-498.274) (-496.409) (-498.467) [-497.499] -- 0:00:04
933500 -- (-496.693) [-495.447] (-498.651) (-497.624) * (-496.693) (-498.248) (-497.781) [-497.599] -- 0:00:04
934000 -- (-496.883) [-495.405] (-497.906) (-496.139) * (-496.369) (-498.383) (-495.476) [-495.818] -- 0:00:04
934500 -- [-495.924] (-495.071) (-497.838) (-497.114) * (-495.548) (-500.333) (-501.508) [-494.565] -- 0:00:04
935000 -- (-494.702) (-496.427) (-499.941) [-496.171] * (-494.933) [-500.837] (-498.630) (-497.082) -- 0:00:04
Average standard deviation of split frequencies: 0.008058
935500 -- [-497.524] (-496.122) (-497.089) (-501.053) * (-500.227) [-495.786] (-495.840) (-495.297) -- 0:00:04
936000 -- [-495.463] (-496.498) (-497.065) (-495.932) * (-501.017) (-495.534) [-495.419] (-497.759) -- 0:00:04
936500 -- (-497.973) [-496.644] (-497.821) (-496.571) * (-499.305) [-495.137] (-497.265) (-495.752) -- 0:00:04
937000 -- (-500.216) (-495.650) (-496.945) [-496.337] * (-496.605) [-499.591] (-496.042) (-497.354) -- 0:00:04
937500 -- [-498.550] (-497.786) (-495.295) (-496.659) * [-495.276] (-498.564) (-495.703) (-500.042) -- 0:00:04
938000 -- (-497.196) [-495.622] (-495.634) (-497.171) * (-496.147) (-498.183) [-496.070] (-496.669) -- 0:00:04
938500 -- (-495.715) [-495.357] (-501.547) (-499.205) * [-495.803] (-497.967) (-494.954) (-495.806) -- 0:00:04
939000 -- (-497.214) (-497.695) (-500.264) [-497.426] * (-495.787) (-495.432) [-495.105] (-497.215) -- 0:00:04
939500 -- (-499.788) (-500.619) [-495.810] (-497.926) * (-494.575) (-497.194) (-495.570) [-496.609] -- 0:00:04
940000 -- (-496.433) (-497.295) (-495.784) [-496.628] * (-495.886) (-495.670) (-495.015) [-496.925] -- 0:00:04
Average standard deviation of split frequencies: 0.007517
940500 -- (-503.002) (-495.633) (-495.333) [-495.291] * (-497.464) (-494.757) (-499.284) [-498.194] -- 0:00:04
941000 -- (-501.445) (-495.248) [-495.555] (-499.168) * (-496.686) [-495.466] (-496.968) (-496.634) -- 0:00:04
941500 -- [-497.335] (-496.840) (-496.073) (-502.486) * [-495.047] (-496.567) (-497.873) (-496.000) -- 0:00:04
942000 -- (-498.261) (-498.760) [-495.679] (-497.198) * [-495.059] (-496.976) (-498.766) (-500.729) -- 0:00:04
942500 -- (-496.325) (-496.285) (-497.473) [-496.152] * (-497.507) (-495.942) (-498.473) [-497.864] -- 0:00:03
943000 -- (-494.785) (-496.444) [-498.338] (-495.811) * (-498.272) (-495.196) (-497.479) [-495.560] -- 0:00:03
943500 -- (-498.169) [-496.218] (-496.111) (-500.245) * [-498.129] (-496.391) (-495.665) (-496.854) -- 0:00:03
944000 -- (-496.089) [-494.621] (-496.727) (-497.172) * (-499.703) (-494.365) [-496.611] (-496.447) -- 0:00:03
944500 -- (-495.750) (-495.408) [-494.761] (-495.836) * (-495.938) [-501.781] (-496.887) (-497.153) -- 0:00:03
945000 -- (-496.294) [-495.641] (-498.559) (-498.664) * (-494.812) (-498.088) (-498.433) [-495.525] -- 0:00:03
Average standard deviation of split frequencies: 0.007209
945500 -- (-496.886) (-495.461) [-497.897] (-495.191) * (-499.271) (-495.208) (-495.373) [-495.414] -- 0:00:03
946000 -- (-496.982) [-496.848] (-494.860) (-495.428) * (-495.784) (-497.929) [-498.570] (-499.963) -- 0:00:03
946500 -- [-496.699] (-496.533) (-495.098) (-495.223) * [-497.776] (-497.810) (-496.538) (-500.130) -- 0:00:03
947000 -- (-501.954) [-495.611] (-497.106) (-499.882) * (-497.143) [-496.743] (-497.720) (-498.528) -- 0:00:03
947500 -- (-497.563) (-495.514) (-498.805) [-495.229] * (-495.807) (-495.397) (-495.501) [-496.393] -- 0:00:03
948000 -- (-497.057) (-495.612) [-498.120] (-496.291) * (-496.006) (-496.297) (-495.143) [-495.158] -- 0:00:03
948500 -- (-495.010) (-498.476) (-499.116) [-496.333] * (-498.456) [-496.495] (-504.316) (-497.804) -- 0:00:03
949000 -- [-498.433] (-495.768) (-497.148) (-497.428) * (-498.874) [-502.024] (-495.396) (-497.792) -- 0:00:03
949500 -- [-495.496] (-495.752) (-495.260) (-500.231) * [-495.342] (-497.068) (-496.992) (-498.937) -- 0:00:03
950000 -- (-495.186) [-495.753] (-494.733) (-500.880) * (-498.333) (-498.891) (-495.971) [-495.561] -- 0:00:03
Average standard deviation of split frequencies: 0.007405
950500 -- (-496.196) (-498.349) [-494.996] (-497.165) * [-498.352] (-498.645) (-495.230) (-495.577) -- 0:00:03
951000 -- [-497.861] (-498.840) (-496.994) (-495.277) * (-497.156) (-497.167) (-495.626) [-497.209] -- 0:00:03
951500 -- (-496.108) (-497.665) [-500.170] (-494.818) * (-495.162) (-497.958) (-496.245) [-497.437] -- 0:00:03
952000 -- (-498.755) [-497.560] (-496.194) (-496.839) * [-498.899] (-499.312) (-496.275) (-497.532) -- 0:00:03
952500 -- (-496.785) (-498.837) [-495.210] (-497.337) * (-498.315) [-496.937] (-494.568) (-494.829) -- 0:00:03
953000 -- (-495.601) (-499.462) [-494.692] (-497.213) * (-494.309) (-496.297) (-497.837) [-500.669] -- 0:00:03
953500 -- [-495.011] (-495.304) (-497.468) (-496.575) * (-495.224) [-497.824] (-495.698) (-495.748) -- 0:00:03
954000 -- (-495.045) (-498.250) (-495.512) [-494.357] * (-496.218) (-497.257) [-496.731] (-498.986) -- 0:00:03
954500 -- (-495.174) (-498.246) [-496.038] (-496.303) * (-496.148) (-496.740) [-495.633] (-497.769) -- 0:00:03
955000 -- [-497.527] (-496.910) (-494.564) (-498.813) * (-494.361) [-496.231] (-497.606) (-495.740) -- 0:00:03
Average standard deviation of split frequencies: 0.007364
955500 -- (-497.067) (-498.285) [-494.604] (-496.174) * (-495.485) (-494.382) [-495.095] (-495.905) -- 0:00:03
956000 -- (-496.175) (-495.413) (-494.613) [-495.761] * (-496.774) [-497.521] (-496.100) (-497.436) -- 0:00:03
956500 -- (-498.357) (-495.401) (-498.147) [-496.600] * (-496.191) [-498.086] (-494.885) (-500.033) -- 0:00:03
957000 -- (-497.484) (-498.091) [-498.047] (-498.553) * (-495.813) [-494.963] (-496.376) (-496.522) -- 0:00:02
957500 -- (-495.657) [-498.393] (-497.177) (-494.992) * (-495.154) [-495.206] (-495.147) (-495.949) -- 0:00:02
958000 -- (-495.471) [-496.178] (-498.330) (-495.338) * (-501.699) (-495.017) [-498.361] (-496.837) -- 0:00:02
958500 -- (-496.715) (-497.033) [-495.931] (-497.570) * (-495.775) (-495.925) (-496.895) [-496.149] -- 0:00:02
959000 -- [-495.263] (-494.252) (-496.904) (-495.885) * (-497.298) [-499.150] (-499.863) (-496.158) -- 0:00:02
959500 -- (-496.467) [-494.252] (-498.463) (-495.509) * [-496.179] (-497.471) (-496.714) (-496.978) -- 0:00:02
960000 -- [-498.803] (-496.038) (-494.980) (-496.596) * (-496.802) (-500.436) [-500.011] (-498.225) -- 0:00:02
Average standard deviation of split frequencies: 0.007786
960500 -- [-500.771] (-495.618) (-496.135) (-497.304) * (-496.868) [-499.388] (-498.639) (-496.448) -- 0:00:02
961000 -- (-496.037) (-495.327) (-496.951) [-497.531] * (-495.946) [-495.194] (-495.506) (-498.322) -- 0:00:02
961500 -- (-496.607) (-498.643) [-494.883] (-497.162) * (-495.772) (-495.195) [-497.122] (-495.567) -- 0:00:02
962000 -- (-494.937) [-495.629] (-494.909) (-498.306) * (-497.368) (-497.922) [-494.391] (-498.794) -- 0:00:02
962500 -- (-495.738) [-496.470] (-496.600) (-496.114) * (-496.706) [-495.538] (-495.271) (-499.050) -- 0:00:02
963000 -- (-495.251) (-494.840) [-497.910] (-495.259) * (-495.984) (-497.684) [-500.430] (-500.673) -- 0:00:02
963500 -- (-496.004) [-495.186] (-496.725) (-494.944) * (-496.280) (-496.322) (-495.930) [-495.422] -- 0:00:02
964000 -- (-496.404) [-495.235] (-495.057) (-495.231) * [-497.274] (-496.092) (-495.182) (-497.864) -- 0:00:02
964500 -- (-495.028) (-494.811) [-495.492] (-498.642) * (-495.488) [-497.451] (-496.146) (-497.531) -- 0:00:02
965000 -- (-498.744) [-494.820] (-496.386) (-495.546) * [-499.459] (-496.158) (-499.015) (-497.541) -- 0:00:02
Average standard deviation of split frequencies: 0.007710
965500 -- [-496.379] (-496.694) (-496.004) (-494.858) * (-495.502) (-496.838) (-496.549) [-497.389] -- 0:00:02
966000 -- (-495.504) (-495.039) (-498.006) [-499.883] * (-495.246) (-497.545) [-495.723] (-496.560) -- 0:00:02
966500 -- [-495.489] (-496.990) (-496.745) (-501.397) * (-495.466) (-494.484) [-495.825] (-494.623) -- 0:00:02
967000 -- [-495.167] (-500.089) (-495.665) (-498.129) * (-497.278) (-495.213) (-498.988) [-494.708] -- 0:00:02
967500 -- (-497.081) (-495.699) (-499.364) [-495.338] * (-497.248) (-495.446) (-496.954) [-496.427] -- 0:00:02
968000 -- (-498.573) (-496.138) [-498.108] (-502.051) * (-498.832) (-502.907) [-496.003] (-500.418) -- 0:00:02
968500 -- (-503.586) (-495.792) [-497.637] (-500.667) * (-494.947) [-495.449] (-497.943) (-498.903) -- 0:00:02
969000 -- [-499.462] (-496.830) (-496.807) (-495.866) * [-497.634] (-498.651) (-496.428) (-503.129) -- 0:00:02
969500 -- [-499.964] (-498.083) (-497.257) (-496.855) * (-494.532) (-499.045) (-496.885) [-496.794] -- 0:00:02
970000 -- (-501.406) (-498.988) (-498.788) [-494.823] * (-495.799) [-494.151] (-497.803) (-500.991) -- 0:00:02
Average standard deviation of split frequencies: 0.007868
970500 -- (-502.140) (-496.348) (-496.917) [-494.732] * (-495.368) (-494.443) [-498.162] (-498.877) -- 0:00:02
971000 -- (-494.709) (-503.477) (-496.032) [-495.383] * [-495.363] (-495.746) (-497.949) (-499.672) -- 0:00:02
971500 -- (-496.112) [-501.094] (-495.816) (-495.286) * (-498.079) (-495.770) [-499.845] (-506.663) -- 0:00:01
972000 -- [-497.726] (-495.964) (-496.410) (-496.049) * [-497.409] (-495.897) (-495.107) (-498.061) -- 0:00:01
972500 -- (-503.501) (-495.600) (-497.355) [-499.497] * (-495.523) (-495.897) [-494.864] (-499.595) -- 0:00:01
973000 -- (-500.918) (-497.283) [-496.758] (-496.054) * (-496.253) (-498.527) (-495.949) [-495.062] -- 0:00:01
973500 -- (-499.547) (-494.916) [-496.468] (-499.955) * (-496.485) (-498.144) (-496.438) [-495.027] -- 0:00:01
974000 -- (-495.044) [-495.103] (-499.023) (-497.874) * [-494.536] (-495.912) (-496.740) (-496.718) -- 0:00:01
974500 -- (-496.324) (-501.099) [-496.712] (-503.034) * (-497.374) [-496.611] (-498.825) (-498.652) -- 0:00:01
975000 -- [-497.770] (-495.325) (-497.207) (-499.596) * (-497.757) (-497.377) (-495.830) [-496.737] -- 0:00:01
Average standard deviation of split frequencies: 0.007921
975500 -- (-503.905) (-495.775) (-500.379) [-498.013] * [-499.141] (-496.229) (-498.546) (-496.421) -- 0:00:01
976000 -- (-499.956) (-496.092) (-498.839) [-496.979] * (-495.754) (-497.473) (-499.151) [-496.452] -- 0:00:01
976500 -- (-497.879) (-496.651) [-501.581] (-501.347) * [-496.385] (-496.581) (-497.348) (-495.607) -- 0:00:01
977000 -- (-497.342) [-499.926] (-501.333) (-498.489) * (-496.753) (-500.739) [-495.713] (-496.490) -- 0:00:01
977500 -- (-497.379) (-495.150) [-498.050] (-502.186) * (-509.598) (-497.378) (-497.971) [-495.954] -- 0:00:01
978000 -- (-496.475) [-494.395] (-496.165) (-496.155) * (-498.812) [-496.982] (-494.406) (-494.483) -- 0:00:01
978500 -- (-497.811) [-498.348] (-496.857) (-495.842) * (-495.257) (-497.647) [-496.112] (-496.209) -- 0:00:01
979000 -- (-496.063) (-496.602) [-494.723] (-496.790) * [-495.216] (-500.387) (-495.776) (-496.710) -- 0:00:01
979500 -- (-495.613) (-499.301) (-494.768) [-496.825] * [-498.485] (-496.048) (-495.458) (-498.253) -- 0:00:01
980000 -- [-494.961] (-494.893) (-496.742) (-496.071) * (-496.685) (-497.567) [-497.265] (-497.453) -- 0:00:01
Average standard deviation of split frequencies: 0.007755
980500 -- (-495.635) (-497.418) [-496.850] (-495.654) * (-498.669) (-496.599) (-498.445) [-496.884] -- 0:00:01
981000 -- [-499.086] (-500.545) (-495.427) (-495.660) * [-498.028] (-494.677) (-501.089) (-496.899) -- 0:00:01
981500 -- (-501.621) (-496.608) (-494.355) [-497.324] * (-496.250) (-498.568) (-498.484) [-498.709] -- 0:00:01
982000 -- (-502.048) (-496.605) [-494.362] (-498.353) * (-499.812) [-497.305] (-502.327) (-497.062) -- 0:00:01
982500 -- (-496.821) [-497.216] (-494.649) (-494.744) * (-497.879) [-496.113] (-496.082) (-495.072) -- 0:00:01
983000 -- [-497.189] (-495.742) (-496.500) (-502.905) * (-496.293) (-496.464) [-495.637] (-495.316) -- 0:00:01
983500 -- (-495.672) (-500.883) [-496.214] (-497.437) * [-501.051] (-496.565) (-498.245) (-498.753) -- 0:00:01
984000 -- (-499.739) (-499.572) [-495.664] (-502.586) * (-497.624) [-495.884] (-495.909) (-498.422) -- 0:00:01
984500 -- (-495.652) [-497.315] (-494.751) (-498.991) * (-495.902) (-497.121) (-494.510) [-496.703] -- 0:00:01
985000 -- (-496.993) (-495.268) (-494.751) [-495.623] * [-497.629] (-502.329) (-495.391) (-496.272) -- 0:00:01
Average standard deviation of split frequencies: 0.007841
985500 -- (-495.496) (-495.707) [-496.583] (-496.202) * (-497.365) (-497.454) (-494.479) [-495.798] -- 0:00:01
986000 -- (-497.535) (-495.860) [-497.058] (-495.037) * (-495.164) [-496.864] (-496.224) (-499.496) -- 0:00:00
986500 -- [-497.009] (-496.212) (-497.325) (-495.199) * (-498.727) (-497.633) [-495.306] (-498.387) -- 0:00:00
987000 -- (-498.242) (-499.677) (-495.722) [-494.890] * (-496.207) (-495.240) (-495.707) [-494.832] -- 0:00:00
987500 -- (-496.691) (-496.143) [-496.063] (-497.347) * (-495.834) (-494.444) [-496.087] (-502.608) -- 0:00:00
988000 -- (-495.734) [-496.203] (-498.064) (-499.148) * (-497.837) [-494.949] (-499.202) (-496.217) -- 0:00:00
988500 -- [-496.666] (-494.671) (-496.477) (-498.257) * (-497.809) (-499.198) [-497.042] (-497.294) -- 0:00:00
989000 -- (-496.790) (-494.799) [-496.621] (-502.135) * (-505.923) (-504.176) (-496.535) [-498.317] -- 0:00:00
989500 -- (-495.905) [-495.028] (-501.389) (-500.912) * (-498.618) [-496.372] (-495.983) (-498.304) -- 0:00:00
990000 -- (-494.743) (-496.725) [-500.897] (-496.526) * (-497.286) (-495.546) (-502.804) [-497.714] -- 0:00:00
Average standard deviation of split frequencies: 0.008058
990500 -- [-495.902] (-496.735) (-494.850) (-499.240) * (-497.576) [-496.008] (-497.528) (-495.554) -- 0:00:00
991000 -- (-496.187) [-497.929] (-494.916) (-499.885) * [-495.538] (-496.473) (-498.003) (-495.897) -- 0:00:00
991500 -- (-495.662) [-496.109] (-495.591) (-500.116) * (-495.009) (-494.681) (-499.361) [-496.371] -- 0:00:00
992000 -- (-496.642) [-499.103] (-497.261) (-500.127) * (-495.275) [-495.691] (-496.395) (-499.890) -- 0:00:00
992500 -- (-498.562) (-494.775) (-497.954) [-502.017] * (-495.156) (-497.318) [-496.635] (-496.608) -- 0:00:00
993000 -- (-499.371) (-495.626) (-494.861) [-495.706] * (-496.385) [-498.843] (-496.301) (-496.191) -- 0:00:00
993500 -- (-496.452) [-494.672] (-497.510) (-494.613) * [-495.389] (-503.748) (-495.029) (-494.939) -- 0:00:00
994000 -- [-496.384] (-495.019) (-496.855) (-496.827) * (-496.507) (-498.323) [-498.168] (-495.352) -- 0:00:00
994500 -- (-494.866) (-495.266) (-496.343) [-494.327] * (-497.157) (-497.324) (-496.000) [-495.086] -- 0:00:00
995000 -- (-496.197) (-495.813) (-497.565) [-496.014] * (-498.634) [-496.808] (-495.594) (-496.194) -- 0:00:00
Average standard deviation of split frequencies: 0.008393
995500 -- [-496.676] (-497.750) (-495.523) (-495.266) * [-498.465] (-495.744) (-502.247) (-501.299) -- 0:00:00
996000 -- (-498.094) (-498.763) [-496.059] (-497.482) * (-498.608) (-496.264) [-499.963] (-496.055) -- 0:00:00
996500 -- (-496.944) (-500.062) [-494.627] (-495.459) * (-496.230) (-500.548) (-496.910) [-495.055] -- 0:00:00
997000 -- (-498.193) (-499.874) [-494.415] (-497.651) * (-497.037) (-496.035) (-494.919) [-495.576] -- 0:00:00
997500 -- [-497.673] (-498.311) (-495.228) (-496.624) * (-496.032) (-495.257) (-499.989) [-496.088] -- 0:00:00
998000 -- (-495.564) [-496.609] (-502.912) (-498.835) * (-499.629) [-497.528] (-499.588) (-497.627) -- 0:00:00
998500 -- (-494.861) [-495.745] (-504.422) (-498.520) * (-502.218) (-499.624) (-501.939) [-496.146] -- 0:00:00
999000 -- [-494.712] (-497.611) (-495.953) (-496.638) * (-499.631) [-498.665] (-504.474) (-495.303) -- 0:00:00
999500 -- (-499.078) (-499.384) (-497.339) [-495.378] * (-497.391) [-500.650] (-499.432) (-496.469) -- 0:00:00
1000000 -- [-496.794] (-496.678) (-496.593) (-496.112) * (-503.853) [-495.461] (-495.583) (-497.046) -- 0:00:00
Average standard deviation of split frequencies: 0.008480
Analysis completed in 1 mins 9 seconds
Analysis used 68.53 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -494.11
Likelihood of best state for "cold" chain of run 2 was -494.11
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
75.5 % ( 68 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
36.5 % ( 22 %) Dirichlet(Pi{all})
36.4 % ( 21 %) Slider(Pi{all})
79.0 % ( 57 %) Multiplier(Alpha{1,2})
77.8 % ( 59 %) Multiplier(Alpha{3})
25.1 % ( 26 %) Slider(Pinvar{all})
98.6 % ( 99 %) ExtSPR(Tau{all},V{all})
70.2 % ( 71 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.6 % ( 93 %) ParsSPR(Tau{all},V{all})
28.1 % ( 21 %) Multiplier(V{all})
97.5 % ( 99 %) Nodeslider(V{all})
30.8 % ( 32 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
74.7 % ( 71 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
35.6 % ( 25 %) Dirichlet(Pi{all})
36.3 % ( 28 %) Slider(Pi{all})
78.4 % ( 49 %) Multiplier(Alpha{1,2})
77.5 % ( 48 %) Multiplier(Alpha{3})
25.4 % ( 20 %) Slider(Pinvar{all})
98.5 % ( 98 %) ExtSPR(Tau{all},V{all})
70.3 % ( 75 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.4 % ( 89 %) ParsSPR(Tau{all},V{all})
28.1 % ( 29 %) Multiplier(V{all})
97.4 % ( 96 %) Nodeslider(V{all})
30.5 % ( 24 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.81 0.64 0.50
2 | 166717 0.82 0.67
3 | 167039 166760 0.84
4 | 166364 166644 166476
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.81 0.64 0.50
2 | 166534 0.82 0.67
3 | 166427 166319 0.84
4 | 167005 167148 166567
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p and /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p
Writing summary statistics to file /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -495.86
| 1 1 1 |
| 1 |
| 1 2 1 1 1 |
| 21 1 2 2 2 |
| 22 1 1 2 2 2 * 2 1 |
| 2 22 2 1 2 1 2 1 2 12 2 1 1 1|
| 1 2* 2 1 12 2 12 1 2 2 2 |
|1 2 * 1 1 2 1 1 2 1 1 1 |
| 1 2 11 2 1 2 11 22 21 2 |
| 2 2 1 1 2 2 2 1 1 2 2 122|
|2 1 1 2 1 1 2 21 1 1 |
| 1 1 1 2 2 |
| 2 1 1 2 |
| 2 |
| 2 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -497.45
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -495.83 -499.27
2 -495.85 -499.02
--------------------------------------
TOTAL -495.84 -499.16
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.894794 0.090541 0.366590 1.486165 0.867773 1501.00 1501.00 1.000
r(A<->C){all} 0.172540 0.019885 0.000008 0.451878 0.136883 196.25 249.93 1.006
r(A<->G){all} 0.164748 0.018710 0.000031 0.433407 0.129447 164.97 188.57 1.000
r(A<->T){all} 0.166116 0.020165 0.000082 0.446244 0.129437 141.84 184.71 1.000
r(C<->G){all} 0.164659 0.020992 0.000002 0.468278 0.122273 198.94 227.56 1.007
r(C<->T){all} 0.167516 0.020705 0.000072 0.447906 0.129617 180.73 203.31 1.000
r(G<->T){all} 0.164422 0.017665 0.000030 0.418061 0.133910 274.30 354.31 1.000
pi(A){all} 0.183652 0.000410 0.145234 0.222549 0.183123 1334.06 1354.12 1.001
pi(C){all} 0.276282 0.000541 0.232389 0.323024 0.276021 1137.29 1150.81 1.000
pi(G){all} 0.348832 0.000599 0.299571 0.396177 0.348527 1142.41 1162.18 1.000
pi(T){all} 0.191233 0.000434 0.150742 0.232149 0.191058 864.14 1084.96 1.000
alpha{1,2} 0.420395 0.236149 0.000135 1.444660 0.244740 1055.58 1150.89 1.000
alpha{3} 0.456416 0.249838 0.000168 1.505327 0.281660 1102.65 1118.90 1.000
pinvar{all} 0.995548 0.000027 0.985239 1.000000 0.997274 1303.10 1402.05 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a paramiter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
5 -- C5
6 -- C6
Key to taxon bipartitions (saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.parts"):
ID -- Partition
------------
1 -- .*****
2 -- .*....
3 -- ..*...
4 -- ...*..
5 -- ....*.
6 -- .....*
7 -- .*...*
8 -- .***.*
9 -- .*.***
10 -- .*.*..
11 -- ..*.*.
12 -- ...**.
13 -- .**.**
14 -- .**...
15 -- ..*..*
16 -- .****.
17 -- ...*.*
18 -- .*..*.
19 -- ..**..
20 -- ....**
21 -- ..****
------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
7 452 0.150566 0.016017 0.139241 0.161892 2
8 452 0.150566 0.003769 0.147901 0.153231 2
9 451 0.150233 0.002355 0.148568 0.151899 2
10 448 0.149234 0.012248 0.140573 0.157895 2
11 448 0.149234 0.000942 0.148568 0.149900 2
12 443 0.147568 0.011777 0.139241 0.155896 2
13 439 0.146236 0.007066 0.141239 0.151233 2
14 432 0.143904 0.005653 0.139907 0.147901 2
15 427 0.142239 0.006124 0.137908 0.146569 2
16 420 0.139907 0.022612 0.123917 0.155896 2
17 408 0.135909 0.004711 0.132578 0.139241 2
18 407 0.135576 0.011777 0.127249 0.143904 2
19 402 0.133911 0.010364 0.126582 0.141239 2
20 398 0.132578 0.002827 0.130580 0.134577 2
21 391 0.130247 0.008951 0.123917 0.136576 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.097750 0.009712 0.000028 0.285306 0.068726 1.000 2
length{all}[2] 0.097562 0.009798 0.000166 0.287596 0.066600 1.000 2
length{all}[3] 0.097796 0.010400 0.000022 0.292843 0.064454 1.000 2
length{all}[4] 0.101668 0.010340 0.000106 0.302271 0.071919 1.000 2
length{all}[5] 0.097891 0.009119 0.000020 0.291264 0.068628 1.000 2
length{all}[6] 0.100502 0.009857 0.000078 0.304959 0.070648 1.000 2
length{all}[7] 0.108241 0.011533 0.000043 0.337858 0.075922 0.998 2
length{all}[8] 0.106138 0.010711 0.000044 0.316796 0.077538 0.998 2
length{all}[9] 0.099845 0.009753 0.000078 0.292619 0.067930 1.000 2
length{all}[10] 0.092945 0.008831 0.000036 0.279322 0.063454 0.998 2
length{all}[11] 0.104005 0.010413 0.000283 0.307738 0.072035 1.006 2
length{all}[12] 0.107320 0.011842 0.000083 0.330134 0.070897 0.999 2
length{all}[13] 0.096951 0.010298 0.000244 0.314131 0.062547 1.005 2
length{all}[14] 0.089739 0.009333 0.000320 0.278401 0.063037 1.001 2
length{all}[15] 0.096042 0.007675 0.000142 0.267880 0.070326 1.005 2
length{all}[16] 0.111549 0.011806 0.000311 0.341695 0.080471 0.998 2
length{all}[17] 0.104464 0.009727 0.000019 0.294286 0.072987 1.004 2
length{all}[18] 0.097256 0.009008 0.000269 0.274334 0.072012 0.998 2
length{all}[19] 0.097940 0.010402 0.000007 0.312350 0.063283 1.000 2
length{all}[20] 0.094858 0.008961 0.000894 0.309087 0.068211 1.005 2
length{all}[21] 0.107015 0.010639 0.000225 0.321192 0.079178 0.997 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.008480
Maximum standard deviation of split frequencies = 0.022612
Average PSRF for parameter values ( excluding NA and >10.0 ) = 1.001
Maximum PSRF for parameter values = 1.006
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|------------------------------------------------------------------------ C5 (5)
|
\------------------------------------------------------------------------ C6 (6)
Phylogram (based on average branch lengths):
/--------------------------------------------------------------------- C1 (1)
|
|------------------------------------------------------------------- C2 (2)
|
|----------------------------------------------------------------- C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|--------------------------------------------------------------------- C5 (5)
|
\----------------------------------------------------------------------- C6 (6)
|---------| 0.010 expected changes per site
Calculating tree probabilities...
Credible sets of trees (105 trees sampled):
50 % credible set contains 46 trees
90 % credible set contains 91 trees
95 % credible set contains 98 trees
99 % credible set contains 104 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
MrBayes output code: 0
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 0 1 2 7 8
seq file is not paml/phylip format. Trying nexus format.ns = 6 ls = 369
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Sites with gaps or missing data are removed.
6 ambiguity characters in seq. 1
6 ambiguity characters in seq. 2
6 ambiguity characters in seq. 3
6 ambiguity characters in seq. 4
3 ambiguity characters in seq. 5
3 ambiguity characters in seq. 6
2 sites are removed. 1 123
Sequences read..
Counting site patterns.. 0:00
Compressing, 39 patterns at 121 / 121 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 39 patterns at 121 / 121 sites (100.0%), 0:00
Counting codons..
120 bytes for distance
38064 bytes for conP
3432 bytes for fhK
5000000 bytes for space
Model 0: one-ratio
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.067680 0.021697 0.042372 0.023242 0.098955 0.054772 0.300000 1.300000
ntime & nrate & np: 6 2 8
Bounds (np=8):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000100
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 999.000000
np = 8
lnL0 = -513.436768
Iterating by ming2
Initial: fx= 513.436768
x= 0.06768 0.02170 0.04237 0.02324 0.09896 0.05477 0.30000 1.30000
1 h-m-p 0.0000 0.0002 290.4297 +++ 498.058026 m 0.0002 14 | 1/8
2 h-m-p 0.0010 0.0134 49.0164 -----------.. | 1/8
3 h-m-p 0.0000 0.0000 265.8943 ++ 497.141909 m 0.0000 45 | 2/8
4 h-m-p 0.0001 0.0178 40.1103 ---------.. | 2/8
5 h-m-p 0.0000 0.0002 237.5128 +++ 488.039183 m 0.0002 75 | 3/8
6 h-m-p 0.0010 0.0229 32.0421 -----------.. | 3/8
7 h-m-p 0.0000 0.0001 206.1200 ++ 483.587970 m 0.0001 106 | 4/8
8 h-m-p 0.0007 0.0361 23.5831 -----------.. | 4/8
9 h-m-p 0.0000 0.0001 168.3847 ++ 480.488185 m 0.0001 137 | 5/8
10 h-m-p 0.0008 0.0585 15.6458 -----------.. | 5/8
11 h-m-p 0.0000 0.0003 119.0036 +++ 476.708149 m 0.0003 169 | 6/8
12 h-m-p 1.6000 8.0000 0.0000 ++ 476.708149 m 8.0000 180 | 6/8
13 h-m-p 0.0293 8.0000 0.0012 +++++ 476.708149 m 8.0000 196 | 6/8
14 h-m-p 0.0160 8.0000 2.5385 +++++ 476.708133 m 8.0000 212 | 6/8
15 h-m-p 1.6000 8.0000 0.6136 ++ 476.708132 m 8.0000 223 | 6/8
16 h-m-p 0.1166 8.0000 42.1086 ++++ 476.708129 m 8.0000 238 | 6/8
17 h-m-p 1.6000 8.0000 29.3317 ----------------.. | 6/8
18 h-m-p 0.0160 8.0000 0.0000 -----C 476.708129 0 0.0000 279 | 6/8
19 h-m-p 0.0160 8.0000 0.0000 ----Y 476.708129 0 0.0000 296
Out..
lnL = -476.708129
297 lfun, 297 eigenQcodon, 1782 P(t)
Time used: 0:00
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.098690 0.024801 0.096335 0.062851 0.083501 0.078785 346.988710 0.548600 0.506641
ntime & nrate & np: 6 2 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 0.063179
np = 9
lnL0 = -528.784671
Iterating by ming2
Initial: fx= 528.784671
x= 0.09869 0.02480 0.09633 0.06285 0.08350 0.07879 346.98871 0.54860 0.50664
1 h-m-p 0.0000 0.0002 278.8157 +++ 512.087140 m 0.0002 15 | 1/9
2 h-m-p 0.0005 0.0030 98.0734 ++ 488.633105 m 0.0030 27 | 2/9
3 h-m-p 0.0000 0.0000 4832.2896 ++ 481.107368 m 0.0000 39 | 3/9
4 h-m-p 0.0001 0.0003 283.2270 ++ 479.456122 m 0.0003 51 | 4/9
5 h-m-p 0.0002 0.0012 2.3125 ----------.. | 4/9
6 h-m-p 0.0000 0.0000 207.4054 ++ 479.294824 m 0.0000 83 | 5/9
7 h-m-p 0.0020 0.9993 0.8953 ------------.. | 5/9
8 h-m-p 0.0000 0.0001 169.0553 ++ 476.928131 m 0.0001 121 | 6/9
9 h-m-p 0.0047 0.2739 2.0754 ------------.. | 6/9
10 h-m-p 0.0000 0.0000 121.3077 ++ 476.708194 m 0.0000 155 | 7/9
11 h-m-p 1.6000 8.0000 0.0000 ++ 476.708194 m 8.0000 167 | 6/9
12 h-m-p 0.0000 0.0000 0.0108
h-m-p: 2.25328417e-16 1.12664209e-15 1.08086952e-02 476.708194
.. | 6/9
13 h-m-p 0.0160 8.0000 0.0001 +++++ 476.708194 m 8.0000 196 | 6/9
14 h-m-p 0.0043 2.1465 0.2875 +++++ 476.708168 m 2.1465 214 | 7/9
15 h-m-p 1.6000 8.0000 0.0000 ----C 476.708168 0 0.0016 233 | 7/9
16 h-m-p 0.0007 0.3650 1.9323 +++++ 476.708168 m 0.3650 250 | 7/9
17 h-m-p 0.0000 0.0000 0.0000
h-m-p: 0.00000000e+00 0.00000000e+00 1.13739658e-08 476.708168
.. | 8/9
18 h-m-p 0.0160 8.0000 0.0000 -C 476.708168 0 0.0010 274 | 8/9
19 h-m-p 0.3000 8.0000 0.0000 Y 476.708168 0 0.0750 287
Out..
lnL = -476.708168
288 lfun, 864 eigenQcodon, 3456 P(t)
Time used: 0:01
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.062159 0.091456 0.025479 0.039022 0.020915 0.082301 346.988716 1.168541 0.469015 0.111931 109.064690
ntime & nrate & np: 6 3 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 0.003583
np = 11
lnL0 = -494.663247
Iterating by ming2
Initial: fx= 494.663247
x= 0.06216 0.09146 0.02548 0.03902 0.02091 0.08230 346.98872 1.16854 0.46902 0.11193 109.06469
1 h-m-p 0.0000 0.0008 62.5546 ++++ 490.906768 m 0.0008 18 | 1/11
2 h-m-p 0.0039 0.0454 10.8781 ++ 485.604214 m 0.0454 32 | 2/11
3 h-m-p 0.0000 0.0000 2232.7465 ++ 485.289163 m 0.0000 46 | 3/11
4 h-m-p 0.0001 0.0005 166.3072 ++ 484.350287 m 0.0005 60 | 4/11
5 h-m-p 0.0001 0.0003 409.1645 ++ 483.835229 m 0.0003 74 | 5/11
6 h-m-p 0.0003 0.0017 118.9869 ++ 482.402323 m 0.0017 88 | 6/11
7 h-m-p 0.0999 8.0000 2.0378 --------------.. | 6/11
8 h-m-p 0.0000 0.0024 36.3146 ++++ 476.708133 m 0.0024 130 | 7/11
9 h-m-p 1.6000 8.0000 0.0000 ++ 476.708133 m 8.0000 144 | 7/11
10 h-m-p 0.3589 8.0000 0.0000 +++ 476.708133 m 8.0000 163 | 7/11
11 h-m-p 0.0160 8.0000 0.1715 -----C 476.708133 0 0.0000 186 | 7/11
12 h-m-p 0.0160 8.0000 0.0002 ----C 476.708133 0 0.0000 208 | 7/11
13 h-m-p 0.0160 8.0000 0.0000 -C 476.708133 0 0.0010 227
Out..
lnL = -476.708133
228 lfun, 912 eigenQcodon, 4104 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -476.706066 S = -476.705397 -0.000255
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 39 patterns 0:02
did 20 / 39 patterns 0:02
did 30 / 39 patterns 0:02
did 39 / 39 patterns 0:02
Time used: 0:02
Model 7: beta
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.084977 0.095626 0.097084 0.024461 0.105138 0.072898 346.988723 0.456582 1.843813
ntime & nrate & np: 6 1 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 0.122313
np = 9
lnL0 = -531.726169
Iterating by ming2
Initial: fx= 531.726169
x= 0.08498 0.09563 0.09708 0.02446 0.10514 0.07290 346.98872 0.45658 1.84381
1 h-m-p 0.0000 0.0002 264.1082 +++ 516.310500 m 0.0002 15 | 1/9
2 h-m-p 0.0050 0.1027 10.4620 ------------.. | 1/9
3 h-m-p 0.0000 0.0004 247.7642 +++ 488.365785 m 0.0004 50 | 2/9
4 h-m-p 0.0175 0.3434 5.5493 -------------.. | 2/9
5 h-m-p 0.0000 0.0001 237.4557 ++ 482.289678 m 0.0001 85 | 3/9
6 h-m-p 0.0047 0.6923 4.6519 ------------.. | 3/9
7 h-m-p 0.0000 0.0001 208.6808 ++ 478.155544 m 0.0001 119 | 4/9
8 h-m-p 0.0034 1.0755 4.7529 ------------.. | 4/9
9 h-m-p 0.0000 0.0000 172.5580 ++ 477.772441 m 0.0000 153 | 5/9
10 h-m-p 0.0032 1.6074 4.0790 ------------.. | 5/9
11 h-m-p 0.0000 0.0001 121.8096 ++ 476.708224 m 0.0001 187 | 6/9
12 h-m-p 0.9891 8.0000 0.0000 ++ 476.708224 m 8.0000 199 | 6/9
13 h-m-p 0.0160 8.0000 0.0038 ----------C 476.708224 0 0.0000 224 | 6/9
14 h-m-p 0.0160 8.0000 0.0000 -----N 476.708224 0 0.0000 244 | 6/9
15 h-m-p 0.0160 8.0000 0.0000 +++++ 476.708224 m 8.0000 262 | 6/9
16 h-m-p 0.0010 0.5000 15.8246 +++++ 476.708168 m 0.5000 280 | 7/9
17 h-m-p 1.6000 8.0000 0.0112 ------Y 476.708168 0 0.0001 298 | 7/9
18 h-m-p 1.0173 8.0000 0.0000 --Y 476.708168 0 0.0159 314
Out..
lnL = -476.708168
315 lfun, 3465 eigenQcodon, 18900 P(t)
Time used: 0:07
Model 8: beta&w>1
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.044017 0.013131 0.094929 0.098715 0.040564 0.103801 339.295936 0.900000 0.740178 1.555472 105.800483
ntime & nrate & np: 6 2 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 0.006343
np = 11
lnL0 = -490.913045
Iterating by ming2
Initial: fx= 490.913045
x= 0.04402 0.01313 0.09493 0.09871 0.04056 0.10380 339.29594 0.90000 0.74018 1.55547 105.80048
1 h-m-p 0.0000 0.0009 78.1075 ++++ 487.027732 m 0.0009 18 | 1/11
2 h-m-p 0.0002 0.0012 53.1244 ++ 484.226849 m 0.0012 32 | 2/11
3 h-m-p 0.0067 0.0335 6.3424 ++ 482.157504 m 0.0335 46 | 3/11
4 h-m-p 0.0005 0.0023 26.2642 ++ 480.747077 m 0.0023 60 | 4/11
5 h-m-p 0.0001 0.0003 377.1624 ++ 477.497280 m 0.0003 74 | 5/11
6 h-m-p 0.0011 0.0054 58.6673 ++ 476.708171 m 0.0054 88 | 6/11
7 h-m-p 1.6000 8.0000 0.0005 ++ 476.708170 m 8.0000 102 | 6/11
8 h-m-p 0.0603 8.0000 0.0661 ++++ 476.708137 m 8.0000 123 | 6/11
9 h-m-p 1.6000 8.0000 0.0238 ++ 476.708135 m 8.0000 142 | 6/11
10 h-m-p 0.6514 8.0000 0.2921 ++ 476.708130 m 8.0000 161 | 6/11
11 h-m-p 0.9778 4.8889 0.1827 +
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
+ 476.708130 m 4.8889 180
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98795, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98762, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 3.98779, 0.00500) = 1.000000e+00 2000 rounds
| 7/11
12 h-m-p 0.6303 6.1426 1.2799
QuantileBeta(0.85, 4.79127, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 7.20173, 0.00500) = 1.000000e+00 2000 rounds
+
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
+ 476.708129 m 6.1426 199
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 11.81834, 0.00500) = 1.000000e+00 2000 rounds
| 8/11
13 h-m-p 0.4777 2.3887 4.9466
QuantileBeta(0.85, 9.45567, 0.00500) = 1.000000e+00 2000 rounds
QuantileBeta(0.85, 2.36767, 0.00500) = 1.000000e+00 2000 rounds
++ 476.708129 m 2.3887 213 | 8/11
14 h-m-p 1.6000 8.0000 1.8865
QuantileBeta(0.85, 3.02274, 0.00500) = 1.000000e+00 2000 rounds
-----C 476.708129 0 0.0004 232 | 8/11
15 h-m-p 0.9999 4.9997 0.0001 ------C 476.708129 0 0.0001 252
Out..
lnL = -476.708129
253 lfun, 3036 eigenQcodon, 16698 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -476.705374 S = -476.705288 -0.000038
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 39 patterns 0:11
did 20 / 39 patterns 0:12
did 30 / 39 patterns 0:12
did 39 / 39 patterns 0:12
Time used: 0:12
CodeML output code: -1
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=123
NC_011896_1_WP_010908570_1_1969_MLBR_RS09345 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
NC_002677_1_NP_302249_1_1121_rplR -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150 VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415 VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV
*************************************************
NC_011896_1_WP_010908570_1_1969_MLBR_RS09345 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
NC_002677_1_NP_302249_1_1121_rplR TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415 TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG
**************************************************
NC_011896_1_WP_010908570_1_1969_MLBR_RS09345 GYTYGGRIAALADSVRENGLNFo
NC_002677_1_NP_302249_1_1121_rplR GYTYGGRIAALADSVRENGLNFo
NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340 GYTYGGRIAALADSVRENGLNFo
NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440 GYTYGGRIAALADSVRENGLNFo
NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150 GYTYGGRIAALADSVRENGLNF-
NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415 GYTYGGRIAALADSVRENGLNF-
**********************
>NC_011896_1_WP_010908570_1_1969_MLBR_RS09345 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA GAACGGATTGAATTTC--- >NC_002677_1_NP_302249_1_1121_rplR ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA GAACGGATTGAATTTC--- >NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA GAACGGATTGAATTTC--- >NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440 ---GTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA GAACGGATTGAATTTC--- >NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150 GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA GAACGGATTGAATTTC--- >NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415 GTGGTGCAGTCAGTTTCCGCGATTCGTAGGGTCTCTCGGCTGCGTAGGCA CGCGCGGCTGCGCAAGAAAGTGTCAGGCACCTCGGAGCGTCCACGGTTGG TGGTGAACCGGTCCGCGAGGCACATTCACGTGCAACTGGTTAACGACGTC ACCGGCACTACGGTGGCTGCTGCGTCATCGATCGAGGCCGACGTGCGCGG TCTGCAAGGTGACAAGAAAGTCCGCAGTGTGCGGGTCGGCCAATTGATCG CCGAGCGGGCCAAGGCCGCTGGCATTAACACGGTGGTATTCGACCGTGGC GGATACACCTACGGTGGACGCATCGCGGCGCTGGCCGATTCCGTGCGCGA GAACGGATTGAATTTC---
>NC_011896_1_WP_010908570_1_1969_MLBR_RS09345 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG GYTYGGRIAALADSVRENGLNF >NC_002677_1_NP_302249_1_1121_rplR -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG GYTYGGRIAALADSVRENGLNF >NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG GYTYGGRIAALADSVRENGLNF >NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440 -VQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG GYTYGGRIAALADSVRENGLNF >NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150 VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG GYTYGGRIAALADSVRENGLNF >NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415 VVQSVSAIRRVSRLRRHARLRKKVSGTSERPRLVVNRSARHIHVQLVNDV TGTTVAAASSIEADVRGLQGDKKVRSVRVGQLIAERAKAAGINTVVFDRG GYTYGGRIAALADSVRENGLNF
#NEXUS
[ID: 0755050800]
begin taxa;
dimensions ntax=6;
taxlabels
NC_011896_1_WP_010908570_1_1969_MLBR_RS09345
NC_002677_1_NP_302249_1_1121_rplR
NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340
NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440
NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150
NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415
;
end;
begin trees;
translate
1 NC_011896_1_WP_010908570_1_1969_MLBR_RS09345,
2 NC_002677_1_NP_302249_1_1121_rplR,
3 NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340,
4 NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440,
5 NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150,
6 NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:0.06872648,2:0.06660037,3:0.06445445,4:0.07191915,5:0.06862808,6:0.07064806);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:0.06872648,2:0.06660037,3:0.06445445,4:0.07191915,5:0.06862808,6:0.07064806);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -495.83 -499.27
2 -495.85 -499.02
--------------------------------------
TOTAL -495.84 -499.16
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/11res/rplR/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.894794 0.090541 0.366590 1.486165 0.867773 1501.00 1501.00 1.000
r(A<->C){all} 0.172540 0.019885 0.000008 0.451878 0.136883 196.25 249.93 1.006
r(A<->G){all} 0.164748 0.018710 0.000031 0.433407 0.129447 164.97 188.57 1.000
r(A<->T){all} 0.166116 0.020165 0.000082 0.446244 0.129437 141.84 184.71 1.000
r(C<->G){all} 0.164659 0.020992 0.000002 0.468278 0.122273 198.94 227.56 1.007
r(C<->T){all} 0.167516 0.020705 0.000072 0.447906 0.129617 180.73 203.31 1.000
r(G<->T){all} 0.164422 0.017665 0.000030 0.418061 0.133910 274.30 354.31 1.000
pi(A){all} 0.183652 0.000410 0.145234 0.222549 0.183123 1334.06 1354.12 1.001
pi(C){all} 0.276282 0.000541 0.232389 0.323024 0.276021 1137.29 1150.81 1.000
pi(G){all} 0.348832 0.000599 0.299571 0.396177 0.348527 1142.41 1162.18 1.000
pi(T){all} 0.191233 0.000434 0.150742 0.232149 0.191058 864.14 1084.96 1.000
alpha{1,2} 0.420395 0.236149 0.000135 1.444660 0.244740 1055.58 1150.89 1.000
alpha{3} 0.456416 0.249838 0.000168 1.505327 0.281660 1102.65 1118.90 1.000
pinvar{all} 0.995548 0.000027 0.985239 1.000000 0.997274 1303.10 1402.05 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
CODONML (in paml version 4.9h, March 2018) /data/11res/rplR/batch/allfiles/codeml/input.fasta.fasta.pnxs
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 6 ls = 121
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 0 0 0 0 0 0 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 2 2 2 2 2 2 | TCC 3 3 3 3 3 3 | TAC 2 2 2 2 2 2 | TGC 0 0 0 0 0 0
Leu TTA 0 0 0 0 0 0 | TCA 3 3 3 3 3 3 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 3 3 3 3 3 3 | TCG 2 2 2 2 2 2 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 4 4 4 4 4 4
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 3 3 3 3 3 3 | CGC 5 5 5 5 5 5
CTA 0 0 0 0 0 0 | CCA 1 1 1 1 1 1 | Gln CAA 3 3 3 3 3 3 | CGA 0 0 0 0 0 0
CTG 5 5 5 5 5 5 | CCG 0 0 0 0 0 0 | CAG 1 1 1 1 1 1 | CGG 6 6 6 6 6 6
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 3 3 3 3 3 3 | Thr ACT 1 1 1 1 1 1 | Asn AAT 1 1 1 1 1 1 | Ser AGT 1 1 1 1 1 1
ATC 3 3 3 3 3 3 | ACC 3 3 3 3 3 3 | AAC 4 4 4 4 4 4 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 2 2 2 2 2 2 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 2 2 2 2 2 2 | AAG 3 3 3 3 3 3 | AGG 3 3 3 3 3 3
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 2 2 2 2 2 2 | Ala GCT 3 3 3 3 3 3 | Asp GAT 1 1 1 1 1 1 | Gly GGT 3 3 3 3 3 3
GTC 4 4 4 4 4 4 | GCC 5 5 5 5 5 5 | GAC 4 4 4 4 4 4 | GGC 5 5 5 5 5 5
GTA 1 1 1 1 1 1 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 3 3 3 3 3 3
GTG 10 10 10 10 10 10 | GCG 6 6 6 6 6 6 | GAG 4 4 4 4 4 4 | GGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: NC_011896_1_WP_010908570_1_1969_MLBR_RS09345
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
#2: NC_002677_1_NP_302249_1_1121_rplR
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
#3: NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
#4: NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
#5: NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
#6: NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 0 | Ser S TCT 6 | Tyr Y TAT 0 | Cys C TGT 0
TTC 12 | TCC 18 | TAC 12 | TGC 0
Leu L TTA 0 | TCA 18 | *** * TAA 0 | *** * TGA 0
TTG 18 | TCG 12 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 0 | Pro P CCT 0 | His H CAT 0 | Arg R CGT 24
CTC 0 | CCC 0 | CAC 18 | CGC 30
CTA 0 | CCA 6 | Gln Q CAA 18 | CGA 0
CTG 30 | CCG 0 | CAG 6 | CGG 36
------------------------------------------------------------------------------
Ile I ATT 18 | Thr T ACT 6 | Asn N AAT 6 | Ser S AGT 6
ATC 18 | ACC 18 | AAC 24 | AGC 0
ATA 0 | ACA 0 | Lys K AAA 12 | Arg R AGA 0
Met M ATG 0 | ACG 12 | AAG 18 | AGG 18
------------------------------------------------------------------------------
Val V GTT 12 | Ala A GCT 18 | Asp D GAT 6 | Gly G GGT 18
GTC 24 | GCC 30 | GAC 24 | GGC 30
GTA 6 | GCA 0 | Glu E GAA 0 | GGA 18
GTG 60 | GCG 36 | GAG 24 | GGG 0
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.13223 C:0.23140 A:0.21488 G:0.42149
position 2: T:0.27273 C:0.24793 A:0.23140 G:0.24793
position 3: T:0.16529 C:0.35537 A:0.10744 G:0.37190
Average T:0.19008 C:0.27824 A:0.18457 G:0.34711
Model 0: one-ratio
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 8): -476.708129 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 346.988710 105.800483
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908570_1_1969_MLBR_RS09345: 0.000004, NC_002677_1_NP_302249_1_1121_rplR: 0.000004, NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340: 0.000004, NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440: 0.000004, NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150: 0.000004, NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 346.98871
omega (dN/dS) = 105.80048
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 264.1 98.9 105.8005 0.0000 0.0000 0.0 0.0
7..2 0.000 264.1 98.9 105.8005 0.0000 0.0000 0.0 0.0
7..3 0.000 264.1 98.9 105.8005 0.0000 0.0000 0.0 0.0
7..4 0.000 264.1 98.9 105.8005 0.0000 0.0000 0.0 0.0
7..5 0.000 264.1 98.9 105.8005 0.0000 0.0000 0.0 0.0
7..6 0.000 264.1 98.9 105.8005 0.0000 0.0000 0.0 0.0
tree length for dN: 0.0000
tree length for dS: 0.0000
Time used: 0:00
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -476.708168 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 346.988716 0.000010 1.000000
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908570_1_1969_MLBR_RS09345: 0.000004, NC_002677_1_NP_302249_1_1121_rplR: 0.000004, NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340: 0.000004, NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440: 0.000004, NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150: 0.000004, NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 346.98872
MLEs of dN/dS (w) for site classes (K=2)
p: 0.00001 0.99999
w: 1.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 264.1 98.9 1.0000 0.0000 0.0000 0.0 0.0
7..2 0.000 264.1 98.9 1.0000 0.0000 0.0000 0.0 0.0
7..3 0.000 264.1 98.9 1.0000 0.0000 0.0000 0.0 0.0
7..4 0.000 264.1 98.9 1.0000 0.0000 0.0000 0.0 0.0
7..5 0.000 264.1 98.9 1.0000 0.0000 0.0000 0.0 0.0
7..6 0.000 264.1 98.9 1.0000 0.0000 0.0000 0.0 0.0
Time used: 0:01
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -476.708133 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 346.988723 0.702202 0.207271 0.000001 109.066562
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908570_1_1969_MLBR_RS09345: 0.000004, NC_002677_1_NP_302249_1_1121_rplR: 0.000004, NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340: 0.000004, NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440: 0.000004, NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150: 0.000004, NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 346.98872
MLEs of dN/dS (w) for site classes (K=3)
p: 0.70220 0.20727 0.09053
w: 0.00000 1.00000 109.06656
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 264.1 98.9 10.0807 0.0000 0.0000 0.0 0.0
7..2 0.000 264.1 98.9 10.0807 0.0000 0.0000 0.0 0.0
7..3 0.000 264.1 98.9 10.0807 0.0000 0.0000 0.0 0.0
7..4 0.000 264.1 98.9 10.0807 0.0000 0.0000 0.0 0.0
7..5 0.000 264.1 98.9 10.0807 0.0000 0.0000 0.0 0.0
7..6 0.000 264.1 98.9 10.0807 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908570_1_1969_MLBR_RS09345)
Pr(w>1) post mean +- SE for w
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908570_1_1969_MLBR_RS09345)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
w2: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.010
0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
sum of density on p0-p1 = 1.000000
Time used: 0:02
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -476.708168 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 339.295936 0.260939 0.005000
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908570_1_1969_MLBR_RS09345: 0.000004, NC_002677_1_NP_302249_1_1121_rplR: 0.000004, NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340: 0.000004, NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440: 0.000004, NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150: 0.000004, NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 339.29594
Parameters in M7 (beta):
p = 0.26094 q = 0.00500
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.99891 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 264.1 98.9 0.9999 0.0000 0.0000 0.0 0.0
7..2 0.000 264.1 98.9 0.9999 0.0000 0.0000 0.0 0.0
7..3 0.000 264.1 98.9 0.9999 0.0000 0.0000 0.0 0.0
7..4 0.000 264.1 98.9 0.9999 0.0000 0.0000 0.0 0.0
7..5 0.000 264.1 98.9 0.9999 0.0000 0.0000 0.0 0.0
7..6 0.000 264.1 98.9 0.9999 0.0000 0.0000 0.0 0.0
Time used: 0:07
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -476.708129 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 339.295931 0.000010 0.005737 0.005000 105.816672
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908570_1_1969_MLBR_RS09345: 0.000004, NC_002677_1_NP_302249_1_1121_rplR: 0.000004, NZ_LVXE01000061_1_WP_010908570_1_2373_A3216_RS12340: 0.000004, NZ_LYPH01000044_1_WP_010908570_1_1770_A8144_RS08440: 0.000004, NZ_CP029543_1_WP_041323018_1_1994_DIJ64_RS10150: 0.000004, NZ_AP014567_1_WP_041323018_1_2047_JK2ML_RS10415: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 339.29593
Parameters in M8 (beta&w>1):
p0 = 0.00001 p = 0.00574 q = 0.00500
(p1 = 0.99999) w = 105.81667
MLEs of dN/dS (w) for site classes (K=11)
p: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.99999
w: 0.00000 0.00000 0.00000 0.00000 0.00252 1.00000 1.00000 1.00000 1.00000 1.00000 105.81667
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 264.1 98.9 105.8156 0.0000 0.0000 0.0 0.0
7..2 0.000 264.1 98.9 105.8156 0.0000 0.0000 0.0 0.0
7..3 0.000 264.1 98.9 105.8156 0.0000 0.0000 0.0 0.0
7..4 0.000 264.1 98.9 105.8156 0.0000 0.0000 0.0 0.0
7..5 0.000 264.1 98.9 105.8156 0.0000 0.0000 0.0 0.0
7..6 0.000 264.1 98.9 105.8156 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908570_1_1969_MLBR_RS09345)
Pr(w>1) post mean +- SE for w
1 V 1.000** 105.816
2 Q 1.000** 105.816
3 S 1.000** 105.816
4 V 1.000** 105.816
5 S 1.000** 105.816
6 A 1.000** 105.816
7 I 1.000** 105.816
8 R 1.000** 105.816
9 R 1.000** 105.816
10 V 1.000** 105.816
11 S 1.000** 105.816
12 R 1.000** 105.816
13 L 1.000** 105.816
14 R 1.000** 105.816
15 R 1.000** 105.816
16 H 1.000** 105.816
17 A 1.000** 105.816
18 R 1.000** 105.816
19 L 1.000** 105.816
20 R 1.000** 105.816
21 K 1.000** 105.816
22 K 1.000** 105.816
23 V 1.000** 105.816
24 S 1.000** 105.816
25 G 1.000** 105.816
26 T 1.000** 105.816
27 S 1.000** 105.816
28 E 1.000** 105.816
29 R 1.000** 105.816
30 P 1.000** 105.816
31 R 1.000** 105.816
32 L 1.000** 105.816
33 V 1.000** 105.816
34 V 1.000** 105.816
35 N 1.000** 105.816
36 R 1.000** 105.816
37 S 1.000** 105.816
38 A 1.000** 105.816
39 R 1.000** 105.816
40 H 1.000** 105.816
41 I 1.000** 105.816
42 H 1.000** 105.816
43 V 1.000** 105.816
44 Q 1.000** 105.816
45 L 1.000** 105.816
46 V 1.000** 105.816
47 N 1.000** 105.816
48 D 1.000** 105.816
49 V 1.000** 105.816
50 T 1.000** 105.816
51 G 1.000** 105.816
52 T 1.000** 105.816
53 T 1.000** 105.816
54 V 1.000** 105.816
55 A 1.000** 105.816
56 A 1.000** 105.816
57 A 1.000** 105.816
58 S 1.000** 105.816
59 S 1.000** 105.816
60 I 1.000** 105.816
61 E 1.000** 105.816
62 A 1.000** 105.816
63 D 1.000** 105.816
64 V 1.000** 105.816
65 R 1.000** 105.816
66 G 1.000** 105.816
67 L 1.000** 105.816
68 Q 1.000** 105.816
69 G 1.000** 105.816
70 D 1.000** 105.816
71 K 1.000** 105.816
72 K 1.000** 105.816
73 V 1.000** 105.816
74 R 1.000** 105.816
75 S 1.000** 105.816
76 V 1.000** 105.816
77 R 1.000** 105.816
78 V 1.000** 105.816
79 G 1.000** 105.816
80 Q 1.000** 105.816
81 L 1.000** 105.816
82 I 1.000** 105.816
83 A 1.000** 105.816
84 E 1.000** 105.816
85 R 1.000** 105.816
86 A 1.000** 105.816
87 K 1.000** 105.816
88 A 1.000** 105.816
89 A 1.000** 105.816
90 G 1.000** 105.816
91 I 1.000** 105.816
92 N 1.000** 105.816
93 T 1.000** 105.816
94 V 1.000** 105.816
95 V 1.000** 105.816
96 F 1.000** 105.816
97 D 1.000** 105.816
98 R 1.000** 105.816
99 G 1.000** 105.816
100 G 1.000** 105.816
101 Y 1.000** 105.816
102 T 1.000** 105.816
103 Y 1.000** 105.816
104 G 1.000** 105.816
105 G 1.000** 105.816
106 R 1.000** 105.816
107 I 1.000** 105.816
108 A 1.000** 105.816
109 A 1.000** 105.816
110 L 1.000** 105.816
111 A 1.000** 105.816
112 D 1.000** 105.816
113 S 1.000** 105.816
114 V 1.000** 105.816
115 R 1.000** 105.816
116 E 1.000** 105.816
117 N 1.000** 105.816
118 G 1.000** 105.816
119 L 1.000** 105.816
120 N 1.000** 105.816
121 F 1.000** 105.816
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908570_1_1969_MLBR_RS09345)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
p : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
q : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
ws: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Time used: 0:12
Model 1: NearlyNeutral -476.708168 Model 2: PositiveSelection -476.708133 Model 0: one-ratio -476.708129 Model 7: beta -476.708168 Model 8: beta&w>1 -476.708129 Model 0 vs 1 7.80000000304426E-5 Model 2 vs 1 7.000000005064066E-5 Model 8 vs 7 7.80000000304426E-5
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
