--- EXPERIMENT NOTES
--- EXPERIMENT PROPERTIES
#Fri Jan 24 08:57:26 GMT 2020
codeml.models=0 1 2 3 7 8
mrbayes.mpich=
mrbayes.ngen=500000
tcoffee.alignMethod=CLUSTALW2
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=1250
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=1250
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/8res/ML2129/input.fasta
input.names=
mrbayes.params=
codeml.params=
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -205.72 -208.93
2 -205.68 -208.69
--------------------------------------
TOTAL -205.70 -208.82
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 1502 samples from 2 runs.
Each run produced 1001 samples of which 751 samples were included.
Parameter summaries saved to file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.898244 0.084791 0.368905 1.473544 0.867733 530.27 640.64 0.999
r(A<->C){all} 0.176181 0.020355 0.000015 0.463495 0.140205 41.97 57.84 1.005
r(A<->G){all} 0.161328 0.020200 0.000593 0.455962 0.118005 70.57 120.31 1.024
r(A<->T){all} 0.160046 0.018649 0.000001 0.431529 0.124859 36.83 64.20 1.024
r(C<->G){all} 0.163439 0.022977 0.000154 0.502524 0.115052 36.94 75.78 0.999
r(C<->T){all} 0.162712 0.023799 0.000060 0.467921 0.114093 71.40 73.95 1.015
r(G<->T){all} 0.176294 0.020246 0.000166 0.444488 0.142586 26.11 85.37 1.033
pi(A){all} 0.098876 0.000537 0.054262 0.144941 0.097549 516.55 581.34 0.999
pi(C){all} 0.263359 0.001194 0.200306 0.336570 0.261727 601.72 644.18 1.000
pi(G){all} 0.397510 0.001445 0.324705 0.472775 0.397309 592.17 629.79 1.000
pi(T){all} 0.240255 0.001080 0.178129 0.302461 0.239035 619.20 668.86 0.999
alpha{1,2} 0.417149 0.217515 0.000193 1.364426 0.266907 259.39 332.91 1.000
alpha{3} 0.427993 0.208053 0.000717 1.304015 0.269087 491.81 505.95 1.001
pinvar{all} 0.988918 0.000185 0.964346 0.999985 0.993318 452.24 464.94 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
--- CODEML SUMMARY
Model 1: NearlyNeutral -182.263716
Model 2: PositiveSelection -182.263679
Model 0: one-ratio -182.263719
Model 3: discrete -182.263679
Model 7: beta -182.263739
Model 8: beta&w>1 -182.263702
Model 0 vs 1 6.000000041694875E-6
Model 2 vs 1 7.399999998369822E-5
Model 8 vs 7 7.399999998369822E-5
>C1
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C2
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C3
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C4
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C5
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C6
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=53
C1 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C2 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C3 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C4 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C5 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C6 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
**************************************************
C1 FSA
C2 FSA
C3 FSA
C4 FSA
C5 FSA
C6 FSA
***
PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log S [0]
-genepred_score S [0] nsd
-run_name S [0]
-mem_mode S [0] mem
-extend D [1] 1
-extend_mode S [0] very_fast_triplet
-max_n_pair D [0] 10
-seq_name_for_quadruplet S [0] all
-compact S [0] default
-clean S [0] no
-do_self FL [0] 0
-do_normalise D [0] 1000
-template_file S [0]
-setenv S [0] 0
-template_mode S [0]
-flip D [0] 0
-remove_template_file D [0] 0
-profile_template_file S [0]
-in S [0]
-seq S [0]
-aln S [0]
-method_limits S [0]
-method S [0]
-lib S [0]
-profile S [0]
-profile1 S [0]
-profile2 S [0]
-pdb S [0]
-relax_lib D [0] 1
-filter_lib D [0] 0
-shrink_lib D [0] 0
-out_lib W_F [0] no
-out_lib_mode S [0] primary
-lib_only D [0] 0
-outseqweight W_F [0] no
-dpa FL [0] 0
-seq_source S [0] ANY
-cosmetic_penalty D [0] 0
-gapopen D [0] 0
-gapext D [0] 0
-fgapopen D [0] 0
-fgapext D [0] 0
-nomatch D [0] 0
-newtree W_F [0] default
-tree W_F [0] NO
-usetree R_F [0]
-tree_mode S [0] nj
-distance_matrix_mode S [0] ktup
-distance_matrix_sim_mode S [0] idmat_sim1
-quicktree FL [0] 0
-outfile W_F [0] default
-maximise FL [1] 1
-output S [1] score_ascii html score_ascii
-len D [0] 0
-infile R_F [1] input.prot.fasta.clustalw2_rs_0_0.fasta.aln
-matrix S [0] default
-tg_mode D [0] 1
-profile_mode S [0] cw_profile_profile
-profile_comparison S [0] profile
-dp_mode S [0] linked_pair_wise
-ktuple D [0] 1
-ndiag D [0] 0
-diag_threshold D [0] 0
-diag_mode D [0] 0
-sim_matrix S [0] vasiliky
-transform S [0]
-extend_seq FL [0] 0
-outorder S [0] input
-inorder S [0] aligned
-seqnos S [0] off
-case S [0] keep
-cpu D [0] 0
-maxnseq D [0] 1000
-maxlen D [0] -1
-sample_dp D [0] 0
-weight S [0] default
-seq_weight S [0] no
-align FL [1] 1
-mocca FL [0] 0
-domain FL [0] 0
-start D [0] 0
-len D [0] 0
-scale D [0] 0
-mocca_interactive FL [0] 0
-method_evaluate_mode S [0] default
-evaluate_mode S [1] t_coffee_fast
-get_type FL [0] 0
-clean_aln D [0] 0
-clean_threshold D [1] 1
-clean_iteration D [1] 1
-clean_evaluate_mode S [0] t_coffee_fast
-extend_matrix FL [0] 0
-prot_min_sim D [40] 40
-prot_max_sim D [90] 90
-prot_min_cov D [40] 40
-pdb_type S [0] d
-pdb_min_sim D [35] 35
-pdb_max_sim D [100] 100
-pdb_min_cov D [50] 50
-pdb_blast_server W_F [0] EBI
-blast W_F [0]
-blast_server W_F [0] EBI
-pdb_db W_F [0] pdb
-protein_db W_F [0] uniprot
-method_log W_F [0] no
-struc_to_use S [0]
-cache W_F [0] use
-align_pdb_param_file W_F [0] no
-align_pdb_hasch_mode W_F [0] hasch_ca_trace_bubble
-external_aligner S [0] NO
-msa_mode S [0] tree
-master S [0] no
-blast_nseq D [0] 0
-lalign_n_top D [0] 10
-iterate D [1] 0
-trim D [0] 0
-split D [0] 0
-trimfile S [0] default
-split D [0] 0
-split_nseq_thres D [0] 0
-split_score_thres D [0] 0
-check_pdb_status D [0] 0
-clean_seq_name D [0] 0
-seq_to_keep S [0]
-dpa_master_aln S [0]
-dpa_maxnseq D [0] 0
-dpa_min_score1 D [0]
-dpa_min_score2 D [0]
-dpa_keep_tmpfile FL [0] 0
-dpa_debug D [0] 0
-multi_core S [0] templates_jobs_relax_msa_evaluate
-n_core D [0] 0
-max_n_proc D [0] 0
-lib_list S [0]
-prune_lib_mode S [0] 5
-tip S [0] none
-rna_lib S [0]
-no_warning D [0] 0
-run_local_script D [0] 0
-plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.alnset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
set
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 53 type PROTEIN Struct Unchecked
Input File input.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 53 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [1590]
Library Relaxation: Multi_proc [96]
Relaxation Summary: [1590]--->[1590]
UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1
OUTPUT RESULTS
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.clustalw2_rs_0_0.fasta.score_ascii
#### File Type= MSA Format= html Name= input.prot.fasta.clustalw2_rs_0_0.fasta.html
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.clustalw2_rs_0_0.fasta.score_ascii
# Command Line: t_coffee -infile input.prot.fasta.clustalw2_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.441 Mb, Max= 30.569 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/
FORMAT of file input.prot.fasta.clustalw2_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment
C1 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C2 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C3 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C4 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C5 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
C6 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
**************************************************
C1 FSA
C2 FSA
C3 FSA
C4 FSA
C5 FSA
C6 FSA
***
FORMAT of file input.prot.fasta.clustalw2_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.clustalw2_rs_0_0.fasta.aln I:96 S:100 BS:97
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES
BOT 0 1 100.00 C1 C2 100.00
TOP 1 0 100.00 C2 C1 100.00
BOT 0 2 100.00 C1 C3 100.00
TOP 2 0 100.00 C3 C1 100.00
BOT 0 3 100.00 C1 C4 100.00
TOP 3 0 100.00 C4 C1 100.00
BOT 0 4 100.00 C1 C5 100.00
TOP 4 0 100.00 C5 C1 100.00
BOT 0 5 100.00 C1 C6 100.00
TOP 5 0 100.00 C6 C1 100.00
BOT 1 2 100.00 C2 C3 100.00
TOP 2 1 100.00 C3 C2 100.00
BOT 1 3 100.00 C2 C4 100.00
TOP 3 1 100.00 C4 C2 100.00
BOT 1 4 100.00 C2 C5 100.00
TOP 4 1 100.00 C5 C2 100.00
BOT 1 5 100.00 C2 C6 100.00
TOP 5 1 100.00 C6 C2 100.00
BOT 2 3 100.00 C3 C4 100.00
TOP 3 2 100.00 C4 C3 100.00
BOT 2 4 100.00 C3 C5 100.00
TOP 4 2 100.00 C5 C3 100.00
BOT 2 5 100.00 C3 C6 100.00
TOP 5 2 100.00 C6 C3 100.00
BOT 3 4 100.00 C4 C5 100.00
TOP 4 3 100.00 C5 C4 100.00
BOT 3 5 100.00 C4 C6 100.00
TOP 5 3 100.00 C6 C4 100.00
BOT 4 5 100.00 C5 C6 100.00
TOP 5 4 100.00 C6 C5 100.00
AVG 0 C1 * 100.00
AVG 1 C2 * 100.00
AVG 2 C3 * 100.00
AVG 3 C4 * 100.00
AVG 4 C5 * 100.00
AVG 5 C6 * 100.00
TOT TOT * 100.00
CLUSTAL W (1.83) multiple sequence alignment
C1 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
C2 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
C3 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
C4 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
C5 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
C6 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
**************************************************
C1 GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
C2 GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
C3 GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
C4 GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
C5 GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
C6 GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
**************************************************
C1 CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
C2 CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
C3 CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
C4 CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
C5 CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
C6 CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
**************************************************
C1 TTTAGCGCT
C2 TTTAGCGCT
C3 TTTAGCGCT
C4 TTTAGCGCT
C5 TTTAGCGCT
C6 TTTAGCGCT
*********
>C1
GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
TTTAGCGCT
>C2
GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
TTTAGCGCT
>C3
GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
TTTAGCGCT
>C4
GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
TTTAGCGCT
>C5
GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
TTTAGCGCT
>C6
GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC
GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT
CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG
TTTAGCGCT
>C1
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C2
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C3
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C4
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C5
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
>C6
VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
FSA
MrBayes v3.2.2 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 6 taxa and 159 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Taxon 5 -> C5
Taxon 6 -> C6
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1579856185
Setting output file names to "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called first_pos
Defining charset called second_pos
Defining charset called third_pos
Defining partition called by_codon
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 2030381095
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 500000
Running Markov chain
MCMC stamp = 5166178727
Seed = 291843310
Swapseed = 1579856185
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Active parameters:
Partition(s)
Parameters 1 2 3
------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:Exponential(10.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.06 % Dirichlet(Revmat{all})
1.06 % Slider(Revmat{all})
1.06 % Dirichlet(Pi{all})
1.06 % Slider(Pi{all})
2.13 % Multiplier(Alpha{1,2})
2.13 % Multiplier(Alpha{3})
2.13 % Slider(Pinvar{all})
10.64 % ExtSPR(Tau{all},V{all})
10.64 % ExtTBR(Tau{all},V{all})
10.64 % NNI(Tau{all},V{all})
10.64 % ParsSPR(Tau{all},V{all})
31.91 % Multiplier(V{all})
10.64 % Nodeslider(V{all})
4.26 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -355.849599 -- -24.965149
Chain 2 -- -355.849620 -- -24.965149
Chain 3 -- -355.849620 -- -24.965149
Chain 4 -- -355.849620 -- -24.965149
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -355.849620 -- -24.965149
Chain 2 -- -355.849599 -- -24.965149
Chain 3 -- -355.849620 -- -24.965149
Chain 4 -- -355.849599 -- -24.965149
Using a relative burnin of 25.0 % for diagnostics
Chain results (500000 generations requested):
0 -- [-355.850] (-355.850) (-355.850) (-355.850) * [-355.850] (-355.850) (-355.850) (-355.850)
500 -- (-228.017) (-226.212) (-229.923) [-217.594] * (-222.548) (-217.834) [-220.436] (-222.576) -- 0:00:00
1000 -- (-222.574) (-224.079) (-214.594) [-214.033] * (-217.835) (-219.695) (-217.386) [-214.613] -- 0:00:00
1500 -- (-211.343) (-214.893) (-221.768) [-209.511] * (-222.424) (-217.088) (-218.554) [-214.090] -- 0:00:00
2000 -- (-213.261) (-215.134) [-217.375] (-216.191) * (-213.620) (-217.928) (-218.527) [-214.802] -- 0:00:00
2500 -- (-216.490) (-217.433) (-214.895) [-210.167] * (-218.809) (-214.788) [-213.807] (-221.348) -- 0:00:00
3000 -- (-220.046) [-216.986] (-219.931) (-221.775) * (-207.346) (-217.220) [-216.510] (-220.576) -- 0:00:00
3500 -- (-214.227) (-208.989) (-214.924) [-215.106] * (-218.934) (-213.382) (-222.967) [-213.694] -- 0:00:00
4000 -- (-211.709) (-213.271) (-213.402) [-213.346] * [-216.055] (-217.376) (-218.191) (-216.463) -- 0:00:00
4500 -- (-216.955) (-208.386) (-214.670) [-213.994] * (-216.454) (-212.995) [-220.793] (-215.308) -- 0:01:50
5000 -- (-217.826) (-215.726) [-210.121] (-220.111) * [-211.753] (-221.529) (-221.248) (-219.127) -- 0:01:39
Average standard deviation of split frequencies: 0.099995
5500 -- (-219.359) (-219.281) (-217.316) [-217.345] * (-218.666) [-213.688] (-219.829) (-213.464) -- 0:01:29
6000 -- [-215.368] (-216.122) (-217.503) (-218.685) * (-211.917) [-214.527] (-215.042) (-217.713) -- 0:01:22
6500 -- [-212.432] (-222.951) (-212.386) (-217.438) * (-212.576) (-216.316) [-207.427] (-215.166) -- 0:01:15
7000 -- (-218.437) (-215.449) (-212.439) [-212.603] * (-221.433) (-217.037) [-207.107] (-218.235) -- 0:01:10
7500 -- [-215.489] (-214.714) (-217.014) (-224.962) * (-215.627) (-217.863) [-209.183] (-228.191) -- 0:01:05
8000 -- [-208.930] (-214.183) (-223.539) (-212.444) * (-218.052) (-217.650) [-204.359] (-226.188) -- 0:01:01
8500 -- (-218.521) (-216.812) [-224.016] (-214.067) * [-216.553] (-217.444) (-205.142) (-218.812) -- 0:00:57
9000 -- (-214.913) (-213.552) [-217.350] (-218.050) * (-227.356) [-213.151] (-207.046) (-214.609) -- 0:00:54
9500 -- (-215.404) [-219.002] (-212.023) (-217.958) * (-226.462) (-219.229) (-206.135) [-208.722] -- 0:00:51
10000 -- (-215.482) (-221.668) (-218.418) [-221.201] * (-220.432) (-223.782) [-204.801] (-205.223) -- 0:00:49
Average standard deviation of split frequencies: 0.069448
10500 -- (-229.277) [-220.001] (-225.222) (-212.291) * (-226.865) (-219.479) (-205.685) [-204.991] -- 0:00:46
11000 -- [-214.835] (-216.298) (-216.809) (-217.104) * (-218.726) (-215.153) [-206.449] (-207.574) -- 0:00:44
11500 -- [-210.091] (-209.586) (-211.821) (-216.727) * (-223.470) [-215.099] (-211.287) (-204.519) -- 0:00:42
12000 -- (-213.180) (-205.444) [-212.707] (-217.369) * (-217.760) (-217.065) (-209.196) [-209.040] -- 0:00:40
12500 -- [-215.200] (-209.374) (-219.031) (-217.331) * (-217.594) (-211.348) [-204.703] (-204.513) -- 0:00:39
13000 -- (-215.604) (-207.722) (-228.164) [-213.540] * (-221.550) [-212.575] (-204.941) (-204.879) -- 0:00:37
13500 -- (-220.015) [-207.638] (-216.812) (-213.925) * (-215.599) [-217.080] (-210.695) (-208.734) -- 0:00:36
14000 -- [-216.342] (-204.843) (-221.513) (-218.131) * (-217.157) (-211.162) [-206.861] (-208.538) -- 0:00:34
14500 -- (-216.302) (-207.863) (-211.469) [-213.267] * (-214.701) (-224.529) [-207.512] (-209.252) -- 0:00:33
15000 -- (-215.170) [-206.706] (-206.059) (-219.949) * (-221.756) (-229.962) (-208.347) [-205.140] -- 0:00:32
Average standard deviation of split frequencies: 0.057084
15500 -- (-219.650) [-205.411] (-206.339) (-215.058) * (-215.816) (-235.674) [-206.111] (-206.530) -- 0:00:31
16000 -- [-214.922] (-204.945) (-211.513) (-217.135) * [-212.080] (-229.398) (-206.713) (-206.403) -- 0:00:30
16500 -- (-214.199) (-206.784) [-206.796] (-212.606) * (-212.584) (-223.275) [-205.595] (-208.960) -- 0:00:29
17000 -- [-211.329] (-204.811) (-204.305) (-218.159) * [-219.377] (-215.162) (-204.629) (-205.779) -- 0:00:28
17500 -- (-220.068) (-204.763) (-205.753) [-215.875] * (-215.307) (-220.238) [-204.745] (-206.079) -- 0:00:27
18000 -- (-212.227) (-205.909) (-206.766) [-214.738] * (-215.313) (-213.503) (-207.379) [-207.513] -- 0:00:26
18500 -- (-216.656) [-206.419] (-208.277) (-217.601) * (-217.638) (-212.156) [-205.455] (-209.303) -- 0:00:26
19000 -- (-228.759) [-206.697] (-206.327) (-218.678) * (-216.443) [-208.392] (-205.342) (-209.263) -- 0:00:25
19500 -- (-210.462) [-204.709] (-207.622) (-218.654) * (-213.636) (-211.883) (-208.706) [-205.139] -- 0:00:24
20000 -- (-214.499) [-207.666] (-205.723) (-216.104) * [-229.422] (-207.951) (-205.090) (-207.324) -- 0:00:48
Average standard deviation of split frequencies: 0.060826
20500 -- (-212.195) (-209.931) [-206.115] (-220.729) * (-216.479) (-207.643) (-205.957) [-207.788] -- 0:00:46
21000 -- (-219.526) (-205.430) (-206.042) [-220.461] * (-214.026) (-206.506) (-208.826) [-204.537] -- 0:00:45
21500 -- (-216.291) (-208.046) [-204.391] (-221.802) * [-214.251] (-205.074) (-206.736) (-204.457) -- 0:00:44
22000 -- (-213.817) [-206.619] (-206.189) (-213.599) * [-211.605] (-205.122) (-206.214) (-206.090) -- 0:00:43
22500 -- (-216.942) [-207.656] (-204.953) (-207.673) * (-211.726) [-204.298] (-204.376) (-205.859) -- 0:00:42
23000 -- [-212.401] (-207.810) (-204.755) (-208.833) * (-217.633) (-205.271) (-204.915) [-206.010] -- 0:00:41
23500 -- (-215.367) (-206.302) (-206.322) [-205.775] * (-219.245) [-205.706] (-207.088) (-206.113) -- 0:00:40
24000 -- (-214.755) (-208.451) [-206.006] (-205.001) * [-222.828] (-205.216) (-206.313) (-207.051) -- 0:00:39
24500 -- (-217.987) (-206.451) (-207.203) [-207.287] * [-210.030] (-208.003) (-206.366) (-204.465) -- 0:00:38
25000 -- (-216.571) (-209.435) [-208.896] (-207.510) * [-215.194] (-206.306) (-205.232) (-208.881) -- 0:00:38
Average standard deviation of split frequencies: 0.046234
25500 -- (-214.612) (-208.735) (-210.149) [-206.101] * (-222.549) (-204.992) [-206.071] (-204.976) -- 0:00:37
26000 -- [-222.063] (-212.234) (-207.286) (-205.128) * (-229.113) (-204.469) (-204.558) [-205.312] -- 0:00:36
26500 -- (-219.919) [-206.526] (-208.599) (-205.078) * (-219.819) (-209.490) [-205.991] (-205.048) -- 0:00:35
27000 -- [-211.927] (-207.236) (-208.439) (-205.702) * [-226.612] (-207.119) (-206.152) (-210.452) -- 0:00:35
27500 -- (-219.720) (-205.416) (-204.462) [-207.014] * (-212.985) (-210.408) (-206.455) [-206.107] -- 0:00:34
28000 -- (-216.499) (-205.122) [-205.479] (-210.651) * (-216.786) [-206.819] (-208.703) (-210.345) -- 0:00:33
28500 -- (-214.424) (-204.455) [-204.457] (-210.500) * [-214.143] (-205.642) (-212.458) (-210.504) -- 0:00:33
29000 -- (-223.499) (-205.330) (-204.283) [-206.630] * (-212.268) [-205.574] (-206.200) (-207.880) -- 0:00:32
29500 -- (-211.653) [-207.291] (-205.190) (-206.510) * (-221.127) (-204.248) [-206.113] (-206.996) -- 0:00:31
30000 -- (-224.627) (-206.644) (-205.287) [-207.724] * (-218.887) [-207.647] (-205.099) (-206.324) -- 0:00:31
Average standard deviation of split frequencies: 0.044498
30500 -- [-217.827] (-206.321) (-204.854) (-208.030) * (-217.641) (-205.943) (-208.083) [-208.922] -- 0:00:30
31000 -- (-231.414) (-205.698) [-206.618] (-208.461) * (-214.806) (-206.560) (-207.792) [-205.329] -- 0:00:30
31500 -- (-230.386) [-207.529] (-206.311) (-206.793) * [-220.110] (-210.584) (-206.647) (-206.277) -- 0:00:29
32000 -- (-231.018) (-210.007) [-206.132] (-204.687) * (-216.533) (-205.637) (-205.662) [-205.796] -- 0:00:29
32500 -- (-226.108) (-207.841) (-204.497) [-206.411] * [-216.615] (-206.783) (-205.186) (-209.945) -- 0:00:28
33000 -- (-225.622) (-206.157) [-206.055] (-205.489) * (-211.371) (-205.391) (-205.260) [-209.657] -- 0:00:28
33500 -- (-211.185) [-205.631] (-204.878) (-208.353) * [-218.338] (-207.813) (-204.887) (-206.330) -- 0:00:27
34000 -- (-207.675) [-207.626] (-205.385) (-205.588) * (-226.311) (-207.316) (-204.457) [-206.090] -- 0:00:27
34500 -- (-205.613) (-205.175) [-210.380] (-207.939) * (-216.162) [-207.033] (-207.076) (-208.400) -- 0:00:26
35000 -- [-207.100] (-205.134) (-206.208) (-204.981) * (-219.088) (-207.094) (-207.040) [-206.883] -- 0:00:39
Average standard deviation of split frequencies: 0.036527
35500 -- (-205.123) [-205.058] (-208.508) (-208.511) * (-225.500) (-205.636) [-206.172] (-209.772) -- 0:00:39
36000 -- (-207.194) [-206.593] (-206.855) (-206.126) * (-214.513) (-205.040) (-204.364) [-206.193] -- 0:00:38
36500 -- (-205.434) (-206.225) [-207.588] (-207.336) * (-224.472) (-207.860) [-205.881] (-205.618) -- 0:00:38
37000 -- [-207.489] (-208.753) (-206.873) (-210.166) * (-220.782) (-204.593) (-206.144) [-208.079] -- 0:00:37
37500 -- (-205.946) (-207.185) [-205.376] (-208.198) * (-219.472) (-206.939) [-205.502] (-208.887) -- 0:00:37
38000 -- (-205.557) [-206.636] (-204.527) (-204.751) * (-214.681) (-205.055) [-205.148] (-208.222) -- 0:00:36
38500 -- (-204.583) (-210.097) [-207.730] (-210.807) * [-206.195] (-204.857) (-206.276) (-207.017) -- 0:00:35
39000 -- [-207.032] (-205.251) (-207.190) (-204.798) * (-204.331) [-204.951] (-205.768) (-204.785) -- 0:00:35
39500 -- [-204.714] (-205.661) (-207.029) (-205.640) * (-207.117) (-208.407) (-205.607) [-207.101] -- 0:00:34
40000 -- (-207.213) [-206.557] (-210.807) (-205.857) * (-206.940) [-205.588] (-206.520) (-205.405) -- 0:00:34
Average standard deviation of split frequencies: 0.032844
40500 -- (-210.350) (-208.482) [-207.605] (-204.141) * (-211.228) (-209.389) (-206.339) [-205.048] -- 0:00:34
41000 -- (-205.841) (-206.484) (-209.744) [-204.760] * (-210.242) [-209.088] (-208.795) (-206.273) -- 0:00:33
41500 -- [-205.499] (-204.870) (-206.744) (-206.922) * (-206.015) [-205.570] (-205.497) (-206.427) -- 0:00:33
42000 -- [-208.109] (-205.054) (-205.353) (-206.846) * (-205.612) (-206.011) (-204.956) [-206.048] -- 0:00:32
42500 -- (-206.264) (-208.024) [-205.101] (-209.302) * (-205.373) (-205.012) (-207.830) [-205.160] -- 0:00:32
43000 -- (-207.780) (-206.769) [-205.590] (-205.749) * (-205.042) (-208.810) (-206.722) [-205.784] -- 0:00:31
43500 -- (-212.054) [-209.215] (-205.107) (-211.738) * (-207.597) [-206.749] (-206.261) (-207.539) -- 0:00:31
44000 -- [-206.588] (-211.284) (-206.297) (-207.562) * (-206.247) (-207.193) [-207.268] (-211.202) -- 0:00:31
44500 -- (-206.853) (-205.697) [-207.218] (-208.522) * [-205.830] (-208.492) (-205.568) (-210.665) -- 0:00:30
45000 -- (-209.576) (-204.897) [-206.608] (-206.131) * (-210.273) (-214.792) (-204.973) [-209.377] -- 0:00:30
Average standard deviation of split frequencies: 0.036380
45500 -- [-208.705] (-205.793) (-205.948) (-207.127) * (-205.310) (-209.746) (-215.188) [-207.392] -- 0:00:29
46000 -- (-211.114) (-204.542) [-206.870] (-205.079) * (-207.626) (-207.189) (-207.038) [-207.373] -- 0:00:29
46500 -- [-212.370] (-207.640) (-205.476) (-208.053) * (-207.015) (-208.072) (-206.888) [-205.689] -- 0:00:29
47000 -- (-209.035) (-205.194) (-211.715) [-206.838] * (-206.706) (-205.660) [-206.003] (-205.173) -- 0:00:28
47500 -- [-205.745] (-206.011) (-211.802) (-207.336) * (-204.927) (-206.974) [-205.983] (-209.039) -- 0:00:28
48000 -- (-207.985) [-205.624] (-206.835) (-207.057) * (-205.761) (-207.135) [-204.839] (-206.133) -- 0:00:28
48500 -- [-207.559] (-208.344) (-205.615) (-207.804) * [-206.195] (-205.903) (-204.848) (-209.008) -- 0:00:27
49000 -- (-206.635) [-206.224] (-204.958) (-205.183) * [-206.797] (-204.433) (-210.340) (-205.414) -- 0:00:27
49500 -- [-205.655] (-206.119) (-206.843) (-204.378) * (-205.641) (-205.513) (-204.547) [-207.559] -- 0:00:27
50000 -- (-204.700) (-207.703) (-206.736) [-205.691] * (-207.915) (-205.442) (-205.991) [-208.881] -- 0:00:27
Average standard deviation of split frequencies: 0.030570
50500 -- (-204.895) (-206.251) [-207.549] (-206.685) * (-207.232) (-205.914) (-205.880) [-205.580] -- 0:00:35
51000 -- (-208.699) (-204.853) (-209.457) [-207.030] * (-209.505) [-206.558] (-205.911) (-207.643) -- 0:00:35
51500 -- (-205.584) (-205.343) (-206.447) [-207.838] * [-208.078] (-207.746) (-208.418) (-206.589) -- 0:00:34
52000 -- (-206.430) [-206.538] (-208.386) (-206.515) * (-205.055) (-206.451) (-211.492) [-204.961] -- 0:00:34
52500 -- (-206.166) [-206.164] (-209.400) (-209.992) * (-206.048) (-206.563) [-210.385] (-205.741) -- 0:00:34
53000 -- (-204.806) (-205.829) [-206.037] (-210.769) * (-207.931) (-206.009) (-206.223) [-205.190] -- 0:00:33
53500 -- [-205.179] (-204.952) (-206.337) (-208.483) * (-210.515) (-211.700) [-205.372] (-205.806) -- 0:00:33
54000 -- (-204.362) [-206.805] (-207.272) (-207.903) * [-205.252] (-206.837) (-206.102) (-206.184) -- 0:00:33
54500 -- (-208.083) (-208.817) (-205.514) [-208.077] * (-208.852) (-206.591) [-208.019] (-204.746) -- 0:00:32
55000 -- [-209.245] (-207.343) (-207.725) (-207.357) * (-205.427) (-205.705) (-204.310) [-207.201] -- 0:00:32
Average standard deviation of split frequencies: 0.025254
55500 -- [-204.233] (-206.707) (-206.439) (-206.687) * (-206.511) [-204.968] (-209.126) (-208.850) -- 0:00:32
56000 -- (-205.683) (-206.930) (-205.455) [-204.760] * (-208.688) [-205.948] (-206.334) (-205.968) -- 0:00:31
56500 -- (-204.670) [-207.352] (-204.939) (-206.787) * (-206.249) (-208.084) (-206.784) [-206.184] -- 0:00:31
57000 -- [-204.517] (-210.337) (-205.622) (-205.881) * (-207.909) (-210.100) [-206.410] (-208.156) -- 0:00:31
57500 -- (-207.822) (-208.965) (-209.179) [-205.458] * (-208.930) (-206.551) [-206.251] (-206.444) -- 0:00:30
58000 -- (-205.950) (-207.542) [-204.550] (-204.673) * (-208.538) (-206.014) [-206.193] (-209.864) -- 0:00:30
58500 -- (-206.055) [-208.061] (-207.377) (-208.014) * (-208.864) [-205.332] (-206.278) (-206.383) -- 0:00:30
59000 -- (-206.796) (-206.106) (-206.745) [-206.786] * (-207.771) [-207.893] (-208.501) (-208.016) -- 0:00:29
59500 -- (-207.297) (-204.789) (-206.083) [-206.072] * [-211.878] (-206.437) (-208.615) (-206.936) -- 0:00:29
60000 -- (-206.654) (-205.313) (-208.035) [-208.156] * (-207.997) [-207.112] (-210.357) (-206.938) -- 0:00:29
Average standard deviation of split frequencies: 0.022493
60500 -- [-205.737] (-205.565) (-205.345) (-207.907) * (-206.814) (-208.494) (-208.898) [-207.999] -- 0:00:29
61000 -- (-206.460) (-206.046) [-206.642] (-204.893) * [-208.667] (-207.891) (-204.797) (-206.582) -- 0:00:28
61500 -- (-207.816) (-208.297) (-207.391) [-206.079] * [-208.280] (-205.778) (-206.207) (-208.030) -- 0:00:28
62000 -- (-205.521) (-211.794) (-208.348) [-206.098] * (-209.307) (-206.583) (-210.002) [-205.180] -- 0:00:28
62500 -- (-207.794) (-206.965) (-211.187) [-206.681] * [-208.411] (-207.941) (-207.715) (-205.022) -- 0:00:28
63000 -- (-206.181) (-205.858) (-205.026) [-205.336] * (-205.400) [-208.139] (-205.927) (-204.873) -- 0:00:27
63500 -- [-204.660] (-205.780) (-206.200) (-206.294) * [-206.386] (-209.298) (-209.741) (-209.797) -- 0:00:27
64000 -- (-206.902) (-207.563) [-206.167] (-206.699) * (-206.266) (-206.434) (-204.760) [-205.266] -- 0:00:27
64500 -- [-206.782] (-204.651) (-208.645) (-207.425) * (-207.642) (-207.696) [-204.973] (-206.988) -- 0:00:27
65000 -- (-205.342) (-204.967) (-207.069) [-208.905] * (-205.659) (-205.960) [-208.211] (-207.908) -- 0:00:26
Average standard deviation of split frequencies: 0.023808
65500 -- (-205.894) (-204.950) [-208.651] (-206.337) * (-208.145) [-205.389] (-209.582) (-207.665) -- 0:00:33
66000 -- (-208.427) [-205.064] (-205.421) (-205.453) * (-209.324) (-205.412) (-208.277) [-205.913] -- 0:00:32
66500 -- (-206.922) (-208.590) [-204.701] (-207.412) * [-208.808] (-210.873) (-206.546) (-208.725) -- 0:00:32
67000 -- [-207.679] (-206.929) (-207.589) (-206.725) * (-205.834) [-207.736] (-205.592) (-206.835) -- 0:00:32
67500 -- (-205.996) (-205.613) (-210.232) [-206.140] * (-205.753) [-204.905] (-209.564) (-204.796) -- 0:00:32
68000 -- (-206.206) [-205.544] (-211.325) (-207.696) * (-206.828) (-206.504) [-208.165] (-206.163) -- 0:00:31
68500 -- [-206.102] (-206.013) (-212.802) (-207.058) * (-205.816) (-205.588) [-205.995] (-209.288) -- 0:00:31
69000 -- (-205.109) (-207.938) [-206.193] (-205.272) * (-206.412) [-206.178] (-206.763) (-210.386) -- 0:00:31
69500 -- (-205.064) [-209.100] (-208.605) (-204.220) * [-205.113] (-207.809) (-212.046) (-207.110) -- 0:00:30
70000 -- (-205.278) (-206.029) (-207.719) [-204.740] * (-207.410) (-207.939) [-206.391] (-207.149) -- 0:00:30
Average standard deviation of split frequencies: 0.023718
70500 -- [-205.138] (-205.063) (-205.013) (-205.866) * [-205.818] (-207.064) (-207.285) (-207.086) -- 0:00:30
71000 -- (-208.040) [-207.913] (-205.190) (-205.448) * [-205.416] (-207.086) (-206.215) (-207.596) -- 0:00:30
71500 -- [-206.817] (-206.165) (-205.485) (-205.283) * (-205.495) (-205.853) [-207.002] (-210.150) -- 0:00:29
72000 -- (-205.751) (-206.410) [-208.126] (-206.842) * (-207.212) (-208.430) [-208.551] (-205.799) -- 0:00:29
72500 -- [-206.923] (-210.764) (-204.594) (-206.121) * (-205.448) [-206.632] (-204.629) (-205.551) -- 0:00:29
73000 -- (-206.890) (-207.287) [-205.082] (-206.288) * [-207.208] (-204.983) (-206.297) (-206.284) -- 0:00:29
73500 -- [-205.333] (-211.378) (-208.470) (-205.552) * (-206.059) [-205.141] (-204.882) (-208.341) -- 0:00:29
74000 -- (-206.254) [-204.735] (-205.118) (-205.613) * (-207.099) (-209.102) (-208.536) [-204.100] -- 0:00:28
74500 -- (-205.462) (-207.112) [-205.087] (-206.185) * [-205.557] (-206.351) (-207.805) (-206.672) -- 0:00:28
75000 -- (-206.102) (-207.513) [-207.216] (-205.364) * (-204.986) (-209.413) [-206.942] (-207.833) -- 0:00:28
Average standard deviation of split frequencies: 0.019297
75500 -- (-206.195) (-208.552) [-208.324] (-205.891) * (-205.599) (-209.218) (-205.068) [-207.339] -- 0:00:28
76000 -- (-205.780) (-206.807) (-204.859) [-205.105] * [-205.916] (-212.421) (-205.088) (-204.418) -- 0:00:27
76500 -- (-208.799) (-206.196) [-206.107] (-205.757) * (-207.030) (-206.205) [-206.963] (-205.424) -- 0:00:27
77000 -- (-205.360) [-204.489] (-208.232) (-205.085) * (-207.908) (-204.862) [-204.622] (-204.595) -- 0:00:27
77500 -- (-205.990) (-208.702) [-209.105] (-206.335) * (-205.912) (-204.651) (-207.432) [-210.319] -- 0:00:27
78000 -- (-207.914) (-205.342) (-208.267) [-208.120] * [-206.196] (-206.385) (-209.105) (-205.112) -- 0:00:27
78500 -- (-208.270) (-206.323) [-205.946] (-206.866) * (-208.046) [-207.170] (-211.321) (-206.581) -- 0:00:26
79000 -- (-204.819) [-205.365] (-204.365) (-205.803) * [-207.656] (-207.938) (-209.169) (-208.794) -- 0:00:26
79500 -- (-204.777) [-205.697] (-208.855) (-205.213) * (-210.057) (-207.501) [-205.704] (-204.660) -- 0:00:26
80000 -- (-206.156) (-206.424) [-205.232] (-206.548) * (-207.389) (-207.226) (-205.049) [-204.853] -- 0:00:26
Average standard deviation of split frequencies: 0.018116
80500 -- (-208.385) [-204.401] (-205.337) (-205.177) * (-208.010) (-208.553) [-205.238] (-205.935) -- 0:00:26
81000 -- (-204.793) (-207.584) [-206.106] (-206.476) * (-209.803) (-206.423) (-205.972) [-209.368] -- 0:00:25
81500 -- [-208.286] (-205.689) (-204.590) (-205.105) * (-204.743) (-205.161) [-206.795] (-206.011) -- 0:00:25
82000 -- (-207.765) (-205.496) [-206.539] (-207.437) * (-205.781) (-209.807) [-205.230] (-207.862) -- 0:00:25
82500 -- [-205.520] (-207.086) (-205.766) (-207.375) * (-206.747) [-206.876] (-207.465) (-205.401) -- 0:00:30
83000 -- (-207.165) (-206.068) [-207.567] (-205.242) * [-209.841] (-205.278) (-206.739) (-204.672) -- 0:00:30
83500 -- (-209.335) (-207.513) (-205.698) [-208.373] * (-205.784) (-205.450) (-206.693) [-206.689] -- 0:00:29
84000 -- [-213.145] (-204.419) (-205.465) (-209.717) * (-207.498) (-208.156) (-206.529) [-207.011] -- 0:00:29
84500 -- (-205.997) [-205.529] (-204.745) (-210.134) * (-206.583) (-208.007) (-206.516) [-208.438] -- 0:00:29
85000 -- (-207.497) [-206.877] (-206.117) (-205.740) * (-207.001) (-207.476) [-205.256] (-208.368) -- 0:00:29
Average standard deviation of split frequencies: 0.018637
85500 -- (-205.773) [-205.177] (-205.120) (-207.781) * [-205.813] (-209.870) (-211.326) (-204.817) -- 0:00:29
86000 -- (-204.984) [-205.512] (-204.512) (-206.076) * [-205.195] (-209.234) (-205.489) (-205.265) -- 0:00:28
86500 -- (-204.806) (-209.482) (-207.539) [-204.075] * (-206.289) (-205.491) [-212.517] (-208.521) -- 0:00:28
87000 -- [-209.358] (-205.319) (-206.530) (-205.622) * (-208.797) [-208.632] (-209.507) (-213.875) -- 0:00:28
87500 -- (-213.230) (-205.593) (-205.887) [-207.352] * (-206.929) (-205.069) [-204.773] (-206.563) -- 0:00:28
88000 -- (-209.730) (-208.150) (-206.798) [-208.382] * (-206.689) [-207.540] (-206.917) (-205.531) -- 0:00:28
88500 -- (-206.889) (-205.674) (-210.897) [-205.681] * (-205.156) (-206.214) [-207.576] (-210.278) -- 0:00:27
89000 -- (-208.865) (-205.992) (-205.990) [-204.649] * (-206.393) (-207.488) (-205.920) [-208.986] -- 0:00:27
89500 -- (-207.708) (-207.659) [-208.062] (-204.707) * [-206.053] (-206.703) (-206.158) (-207.274) -- 0:00:27
90000 -- (-206.782) (-207.044) (-204.854) [-205.900] * (-210.335) (-204.725) (-209.307) [-204.447] -- 0:00:27
Average standard deviation of split frequencies: 0.013865
90500 -- [-208.230] (-207.237) (-206.621) (-205.256) * (-209.606) (-209.259) (-211.622) [-207.859] -- 0:00:27
91000 -- (-204.599) [-205.705] (-205.151) (-209.742) * (-204.906) (-206.119) [-205.814] (-205.116) -- 0:00:26
91500 -- [-206.624] (-206.693) (-205.023) (-206.049) * (-207.485) (-210.340) (-208.080) [-205.899] -- 0:00:26
92000 -- (-209.453) [-207.481] (-204.347) (-206.989) * [-208.947] (-206.563) (-207.398) (-205.103) -- 0:00:26
92500 -- (-207.366) (-211.055) (-204.692) [-204.662] * (-209.661) (-205.945) (-213.095) [-206.094] -- 0:00:26
93000 -- [-209.166] (-210.872) (-205.101) (-206.547) * [-207.134] (-206.152) (-209.731) (-205.883) -- 0:00:26
93500 -- (-210.324) (-207.161) (-205.976) [-207.081] * (-208.027) [-208.487] (-209.563) (-207.349) -- 0:00:26
94000 -- [-207.075] (-205.496) (-205.310) (-206.509) * [-208.505] (-209.829) (-207.426) (-205.257) -- 0:00:25
94500 -- (-210.280) (-206.369) (-207.884) [-209.325] * (-212.010) [-205.849] (-205.045) (-207.864) -- 0:00:25
95000 -- (-208.181) (-207.165) (-204.395) [-206.006] * [-208.073] (-206.115) (-205.551) (-205.146) -- 0:00:25
Average standard deviation of split frequencies: 0.013504
95500 -- (-205.127) (-204.509) (-207.010) [-204.714] * (-212.526) [-206.381] (-205.814) (-206.517) -- 0:00:25
96000 -- (-207.083) [-204.990] (-205.494) (-204.452) * (-209.490) [-208.924] (-206.972) (-206.850) -- 0:00:25
96500 -- (-205.571) (-205.031) (-206.615) [-204.635] * (-209.874) [-206.822] (-207.137) (-206.573) -- 0:00:25
97000 -- (-208.183) (-208.385) (-205.803) [-205.862] * (-204.753) [-205.751] (-206.858) (-206.368) -- 0:00:24
97500 -- [-205.938] (-207.037) (-206.874) (-209.227) * [-205.728] (-207.143) (-206.979) (-209.177) -- 0:00:24
98000 -- [-205.449] (-208.909) (-206.125) (-205.384) * [-205.540] (-206.895) (-206.979) (-206.891) -- 0:00:24
98500 -- (-206.225) (-207.269) [-204.996] (-206.994) * [-205.091] (-210.814) (-206.623) (-208.405) -- 0:00:24
99000 -- (-206.519) (-204.852) (-205.936) [-207.725] * [-208.143] (-205.691) (-207.424) (-208.133) -- 0:00:24
99500 -- (-204.747) (-204.384) (-207.804) [-204.968] * [-205.549] (-206.113) (-212.532) (-211.147) -- 0:00:28
100000 -- (-207.681) [-205.442] (-212.996) (-208.272) * [-207.710] (-207.157) (-207.348) (-205.825) -- 0:00:27
Average standard deviation of split frequencies: 0.018965
100500 -- [-205.860] (-208.220) (-206.801) (-205.269) * (-206.776) (-208.914) [-207.408] (-207.989) -- 0:00:27
101000 -- (-206.758) (-204.869) (-206.573) [-209.383] * (-208.370) (-206.909) [-205.351] (-211.097) -- 0:00:27
101500 -- [-206.616] (-207.404) (-205.846) (-205.769) * [-207.508] (-205.643) (-204.442) (-208.386) -- 0:00:27
102000 -- [-206.480] (-206.035) (-206.957) (-205.197) * (-205.045) (-206.767) (-207.248) [-207.452] -- 0:00:27
102500 -- (-205.607) [-207.000] (-208.674) (-206.001) * (-204.859) [-206.156] (-210.330) (-206.031) -- 0:00:27
103000 -- (-206.488) [-205.943] (-210.470) (-211.386) * [-208.972] (-205.848) (-206.149) (-206.673) -- 0:00:26
103500 -- (-206.323) [-204.589] (-207.618) (-207.309) * (-209.724) [-206.346] (-206.032) (-207.265) -- 0:00:26
104000 -- (-208.543) (-204.499) (-208.170) [-207.419] * (-207.162) [-205.551] (-207.086) (-207.751) -- 0:00:26
104500 -- [-207.554] (-205.459) (-204.454) (-210.455) * [-206.673] (-207.827) (-208.609) (-207.038) -- 0:00:26
105000 -- (-208.132) (-206.848) (-209.181) [-206.132] * (-209.520) (-204.545) [-206.091] (-205.233) -- 0:00:26
Average standard deviation of split frequencies: 0.019059
105500 -- (-209.786) (-210.447) [-205.200] (-206.013) * (-206.102) (-205.191) (-205.886) [-207.849] -- 0:00:26
106000 -- (-208.930) (-206.594) (-207.638) [-205.034] * (-207.388) (-204.588) (-206.565) [-207.748] -- 0:00:26
106500 -- (-210.827) (-207.249) [-207.699] (-205.088) * [-207.635] (-206.560) (-206.074) (-206.570) -- 0:00:25
107000 -- (-207.606) [-204.799] (-206.094) (-206.905) * (-207.025) (-206.215) (-205.786) [-206.909] -- 0:00:25
107500 -- (-207.775) [-205.123] (-206.516) (-209.700) * (-208.747) (-206.027) [-206.218] (-205.760) -- 0:00:25
108000 -- (-205.954) [-205.963] (-206.660) (-207.840) * (-204.455) [-205.633] (-208.784) (-208.526) -- 0:00:25
108500 -- [-205.052] (-205.883) (-204.890) (-208.970) * (-205.794) (-206.061) [-205.395] (-208.795) -- 0:00:25
109000 -- (-205.585) (-208.224) [-204.483] (-208.822) * (-206.541) [-209.021] (-206.443) (-206.160) -- 0:00:25
109500 -- (-205.378) (-205.103) (-210.459) [-206.916] * (-207.620) [-208.133] (-207.346) (-205.071) -- 0:00:24
110000 -- [-210.265] (-205.881) (-208.714) (-204.928) * (-209.255) [-207.129] (-207.634) (-205.947) -- 0:00:24
Average standard deviation of split frequencies: 0.019169
110500 -- (-211.943) [-208.006] (-208.295) (-205.183) * (-207.648) [-204.493] (-206.710) (-204.711) -- 0:00:24
111000 -- [-208.001] (-205.088) (-207.055) (-205.966) * [-206.967] (-207.251) (-205.442) (-207.499) -- 0:00:24
111500 -- (-208.718) [-204.967] (-206.021) (-205.961) * [-207.714] (-208.209) (-206.757) (-206.619) -- 0:00:24
112000 -- (-208.349) (-205.348) [-204.651] (-208.947) * (-206.199) [-205.827] (-208.051) (-206.716) -- 0:00:24
112500 -- [-207.590] (-206.129) (-211.492) (-206.282) * (-205.209) [-204.400] (-205.106) (-204.258) -- 0:00:24
113000 -- (-208.987) [-205.291] (-206.854) (-206.992) * (-206.766) [-204.991] (-205.631) (-206.458) -- 0:00:23
113500 -- (-208.181) [-205.050] (-208.754) (-207.738) * (-211.668) (-206.550) (-207.643) [-205.378] -- 0:00:23
114000 -- (-204.454) (-204.308) [-206.302] (-214.072) * (-210.613) [-205.823] (-207.974) (-207.085) -- 0:00:23
114500 -- (-206.851) (-206.587) (-205.528) [-209.471] * (-207.155) [-204.703] (-213.730) (-207.430) -- 0:00:23
115000 -- [-205.684] (-204.580) (-206.324) (-205.655) * [-205.717] (-205.710) (-209.883) (-206.377) -- 0:00:23
Average standard deviation of split frequencies: 0.021287
115500 -- [-205.992] (-205.946) (-209.588) (-205.149) * (-208.487) (-204.941) (-206.498) [-206.380] -- 0:00:23
116000 -- (-211.995) (-205.413) [-206.881] (-207.003) * [-204.729] (-206.327) (-208.816) (-205.380) -- 0:00:26
116500 -- (-209.624) (-205.877) (-204.881) [-211.063] * [-207.600] (-214.082) (-205.225) (-206.148) -- 0:00:26
117000 -- [-208.897] (-206.659) (-205.099) (-206.872) * (-209.483) [-207.215] (-204.800) (-206.330) -- 0:00:26
117500 -- (-206.705) (-206.635) (-207.191) [-204.899] * (-207.954) [-207.181] (-204.952) (-206.752) -- 0:00:26
118000 -- (-205.456) (-206.267) (-207.122) [-207.295] * (-206.847) (-204.935) (-207.541) [-206.922] -- 0:00:25
118500 -- (-206.101) [-206.631] (-211.527) (-205.883) * (-204.595) [-207.531] (-204.897) (-205.684) -- 0:00:25
119000 -- (-205.085) [-204.653] (-206.612) (-206.980) * (-205.692) [-206.132] (-205.707) (-209.203) -- 0:00:25
119500 -- (-205.382) [-204.742] (-207.060) (-205.041) * (-207.698) (-205.609) (-206.377) [-209.103] -- 0:00:25
120000 -- (-210.193) (-206.290) [-207.661] (-206.128) * [-206.265] (-205.782) (-207.317) (-208.446) -- 0:00:25
Average standard deviation of split frequencies: 0.021682
120500 -- [-208.583] (-207.952) (-208.582) (-205.184) * (-205.805) [-208.975] (-206.129) (-205.743) -- 0:00:25
121000 -- (-206.361) (-208.037) (-207.301) [-205.195] * (-204.293) (-211.445) [-206.508] (-204.435) -- 0:00:25
121500 -- (-205.439) (-208.610) (-206.022) [-204.399] * [-205.369] (-207.473) (-206.538) (-204.430) -- 0:00:24
122000 -- [-205.803] (-206.280) (-205.374) (-213.303) * (-207.516) (-205.731) [-204.850] (-209.665) -- 0:00:24
122500 -- (-206.546) [-207.377] (-205.274) (-207.021) * (-205.296) (-207.637) [-206.041] (-210.194) -- 0:00:24
123000 -- (-205.758) (-210.695) (-208.518) [-206.693] * (-204.970) [-206.049] (-207.208) (-205.117) -- 0:00:24
123500 -- (-205.839) (-206.068) (-205.215) [-208.940] * (-205.631) (-205.843) [-206.952] (-205.840) -- 0:00:24
124000 -- (-208.877) (-207.497) (-206.357) [-208.299] * (-206.693) (-210.794) (-209.091) [-205.464] -- 0:00:24
124500 -- (-205.901) (-205.643) [-205.099] (-205.154) * (-206.674) (-209.830) (-206.645) [-207.107] -- 0:00:24
125000 -- (-209.916) (-206.822) [-205.423] (-204.591) * [-206.344] (-204.996) (-206.639) (-205.547) -- 0:00:24
Average standard deviation of split frequencies: 0.021138
125500 -- (-208.486) (-205.214) [-209.975] (-205.487) * (-209.595) (-204.336) [-206.968] (-207.588) -- 0:00:23
126000 -- (-205.895) (-205.405) [-209.263] (-204.147) * (-205.555) [-206.098] (-205.704) (-208.356) -- 0:00:23
126500 -- [-206.603] (-204.573) (-206.378) (-205.801) * (-207.264) (-208.154) (-205.307) [-205.650] -- 0:00:23
127000 -- (-209.002) [-204.746] (-205.141) (-206.679) * [-206.021] (-206.374) (-207.929) (-208.406) -- 0:00:23
127500 -- (-206.474) (-205.323) [-205.202] (-215.173) * (-206.159) [-205.406] (-205.347) (-204.475) -- 0:00:23
128000 -- (-206.780) (-210.860) (-204.864) [-208.782] * (-205.345) (-205.484) [-206.191] (-204.108) -- 0:00:23
128500 -- [-208.047] (-206.760) (-207.905) (-206.443) * (-205.579) (-205.043) [-206.228] (-210.011) -- 0:00:23
129000 -- (-206.804) (-204.923) [-208.022] (-208.360) * (-205.436) (-207.925) [-206.244] (-204.907) -- 0:00:23
129500 -- (-207.442) (-207.509) (-208.387) [-205.147] * (-207.863) [-206.166] (-205.650) (-205.377) -- 0:00:22
130000 -- (-207.881) [-205.593] (-206.856) (-207.781) * (-204.370) (-207.722) [-207.566] (-207.881) -- 0:00:22
Average standard deviation of split frequencies: 0.021285
130500 -- (-205.655) (-207.527) (-207.949) [-207.782] * (-206.466) (-204.992) (-206.447) [-206.452] -- 0:00:22
131000 -- (-209.038) (-205.995) (-210.153) [-204.660] * [-204.815] (-205.325) (-207.384) (-206.388) -- 0:00:22
131500 -- (-204.575) [-205.126] (-205.324) (-207.724) * (-205.595) (-211.431) [-209.243] (-206.186) -- 0:00:22
132000 -- [-208.208] (-204.950) (-205.287) (-207.725) * (-206.239) [-209.556] (-209.009) (-207.579) -- 0:00:22
132500 -- (-209.516) (-206.494) [-206.719] (-205.070) * [-206.146] (-206.455) (-208.655) (-206.946) -- 0:00:22
133000 -- (-206.012) [-205.567] (-206.429) (-206.045) * (-207.130) [-204.979] (-204.910) (-206.704) -- 0:00:24
133500 -- [-205.297] (-206.698) (-206.915) (-206.683) * [-207.836] (-206.510) (-207.200) (-208.919) -- 0:00:24
134000 -- (-206.079) (-205.595) [-204.183] (-207.259) * (-204.934) [-207.442] (-205.692) (-206.794) -- 0:00:24
134500 -- (-207.393) [-204.666] (-204.926) (-206.751) * (-204.681) (-204.556) [-207.435] (-206.007) -- 0:00:24
135000 -- (-210.928) (-205.163) (-207.066) [-207.053] * [-205.818] (-205.136) (-209.139) (-206.866) -- 0:00:24
Average standard deviation of split frequencies: 0.020624
135500 -- (-204.983) (-213.745) (-209.429) [-204.744] * [-207.406] (-205.778) (-206.988) (-206.231) -- 0:00:24
136000 -- [-205.905] (-204.577) (-204.835) (-210.409) * (-206.727) (-207.873) (-208.294) [-205.053] -- 0:00:24
136500 -- (-207.654) [-208.310] (-208.268) (-206.141) * (-206.618) (-205.381) (-208.301) [-206.001] -- 0:00:23
137000 -- (-207.137) (-208.016) [-206.629] (-206.174) * (-208.714) [-209.326] (-205.206) (-205.815) -- 0:00:23
137500 -- [-205.114] (-205.182) (-205.321) (-208.485) * (-206.405) [-208.460] (-205.515) (-207.121) -- 0:00:23
138000 -- (-210.784) [-209.019] (-207.215) (-205.407) * [-206.180] (-206.734) (-208.249) (-206.927) -- 0:00:23
138500 -- [-210.011] (-206.319) (-205.770) (-205.635) * [-206.735] (-206.675) (-204.749) (-207.764) -- 0:00:23
139000 -- (-209.813) (-205.249) (-205.020) [-205.883] * (-206.428) (-205.729) [-206.313] (-207.339) -- 0:00:23
139500 -- (-210.730) [-204.766] (-210.743) (-206.157) * (-208.989) (-207.708) (-207.632) [-204.495] -- 0:00:23
140000 -- (-206.303) (-208.747) [-205.259] (-207.575) * (-206.272) (-204.922) (-206.155) [-206.503] -- 0:00:23
Average standard deviation of split frequencies: 0.019940
140500 -- (-204.568) (-206.512) (-206.573) [-205.551] * (-205.641) (-205.532) (-209.734) [-205.624] -- 0:00:23
141000 -- (-205.790) (-209.923) [-208.171] (-206.994) * [-204.379] (-204.661) (-214.878) (-205.344) -- 0:00:22
141500 -- [-206.051] (-207.178) (-208.505) (-204.558) * (-207.081) (-204.867) [-206.680] (-210.437) -- 0:00:22
142000 -- (-210.493) (-210.632) (-210.188) [-207.312] * (-215.418) (-208.774) (-207.899) [-207.153] -- 0:00:22
142500 -- [-206.149] (-205.511) (-205.497) (-205.225) * (-210.560) (-206.796) (-209.618) [-205.214] -- 0:00:22
143000 -- [-206.213] (-205.695) (-204.640) (-209.509) * [-205.544] (-208.180) (-206.493) (-208.611) -- 0:00:22
143500 -- (-207.143) (-210.030) [-205.086] (-206.870) * (-207.095) (-205.469) [-205.088] (-208.523) -- 0:00:22
144000 -- (-206.566) (-206.224) (-205.662) [-205.444] * [-205.282] (-206.474) (-206.890) (-206.446) -- 0:00:22
144500 -- (-205.661) (-207.316) (-206.077) [-207.252] * (-210.145) (-204.930) (-207.120) [-208.116] -- 0:00:22
145000 -- [-207.254] (-205.623) (-204.750) (-208.001) * (-204.320) (-204.445) [-205.934] (-208.085) -- 0:00:22
Average standard deviation of split frequencies: 0.018450
145500 -- (-205.291) (-204.925) [-205.796] (-209.941) * (-209.139) (-204.934) [-205.402] (-207.267) -- 0:00:21
146000 -- (-209.246) (-206.146) (-204.894) [-206.217] * [-206.598] (-207.427) (-204.483) (-205.928) -- 0:00:21
146500 -- (-206.755) [-204.615] (-204.430) (-206.498) * [-208.298] (-207.202) (-207.376) (-212.666) -- 0:00:21
147000 -- (-208.061) [-206.943] (-204.988) (-205.889) * (-207.643) [-205.001] (-206.538) (-208.850) -- 0:00:21
147500 -- (-208.432) (-205.331) [-205.153] (-205.798) * [-206.342] (-207.746) (-207.853) (-207.135) -- 0:00:21
148000 -- (-209.818) (-205.090) [-206.174] (-208.067) * [-205.449] (-205.515) (-207.220) (-204.453) -- 0:00:21
148500 -- (-209.281) (-205.105) [-205.728] (-209.260) * (-211.713) (-205.979) [-205.716] (-205.437) -- 0:00:21
149000 -- (-204.568) (-207.113) (-204.625) [-206.400] * (-206.016) (-206.970) [-205.819] (-209.434) -- 0:00:21
149500 -- (-204.515) (-205.171) [-208.156] (-205.712) * (-211.525) (-207.744) (-205.335) [-208.276] -- 0:00:21
150000 -- (-204.862) [-206.250] (-205.193) (-205.252) * (-207.489) [-207.400] (-206.550) (-209.167) -- 0:00:23
Average standard deviation of split frequencies: 0.019242
150500 -- [-206.410] (-208.620) (-205.326) (-207.236) * (-205.292) (-207.456) [-205.954] (-207.395) -- 0:00:23
151000 -- (-205.854) (-207.337) [-206.981] (-206.357) * (-206.128) [-206.864] (-206.051) (-206.717) -- 0:00:23
151500 -- (-206.208) (-206.898) [-206.719] (-207.022) * (-208.918) (-205.788) [-204.270] (-205.385) -- 0:00:23
152000 -- (-209.893) (-204.694) [-205.049] (-206.639) * [-204.751] (-207.108) (-207.180) (-207.494) -- 0:00:22
152500 -- (-213.939) (-205.113) [-205.300] (-206.810) * (-205.968) (-210.414) (-207.330) [-205.302] -- 0:00:22
153000 -- (-212.936) (-209.147) [-205.772] (-209.307) * (-204.736) (-205.284) [-207.708] (-206.103) -- 0:00:22
153500 -- [-207.685] (-210.883) (-207.232) (-208.296) * (-205.662) (-206.543) (-208.573) [-208.339] -- 0:00:22
154000 -- (-208.350) (-210.109) [-206.519] (-204.944) * (-207.825) (-207.842) [-205.272] (-205.487) -- 0:00:22
154500 -- (-210.466) (-205.068) (-209.073) [-205.498] * [-204.449] (-210.055) (-206.717) (-204.551) -- 0:00:22
155000 -- (-208.793) [-205.291] (-210.306) (-207.048) * [-206.890] (-209.605) (-207.129) (-206.612) -- 0:00:22
Average standard deviation of split frequencies: 0.019491
155500 -- (-210.010) [-205.372] (-207.955) (-207.871) * (-206.821) [-207.700] (-207.515) (-209.206) -- 0:00:22
156000 -- (-204.996) [-207.311] (-207.662) (-204.914) * (-210.386) (-205.603) [-208.476] (-208.470) -- 0:00:22
156500 -- (-206.808) [-204.413] (-210.445) (-209.317) * (-205.295) (-212.564) (-204.878) [-206.329] -- 0:00:21
157000 -- (-208.751) (-205.838) (-204.717) [-209.780] * [-204.511] (-206.805) (-207.069) (-205.156) -- 0:00:21
157500 -- (-205.865) (-204.428) [-205.987] (-208.937) * (-208.310) (-205.445) (-205.086) [-211.144] -- 0:00:21
158000 -- (-206.194) [-207.442] (-205.109) (-206.308) * (-206.185) (-209.310) [-205.038] (-204.918) -- 0:00:21
158500 -- (-204.726) (-205.006) [-206.547] (-205.082) * (-206.563) (-212.693) (-206.617) [-212.840] -- 0:00:21
159000 -- [-206.275] (-205.288) (-208.927) (-207.117) * (-209.043) (-213.919) [-206.670] (-207.147) -- 0:00:21
159500 -- (-206.235) (-207.608) (-207.946) [-210.265] * (-204.759) [-207.913] (-208.904) (-204.212) -- 0:00:21
160000 -- (-205.448) [-209.134] (-206.709) (-210.026) * (-206.378) (-205.603) (-207.644) [-205.198] -- 0:00:21
Average standard deviation of split frequencies: 0.019805
160500 -- (-207.966) [-205.768] (-204.381) (-204.974) * [-205.688] (-206.007) (-207.656) (-205.031) -- 0:00:21
161000 -- (-207.792) (-205.297) (-206.517) [-205.126] * (-206.121) [-205.438] (-205.580) (-206.008) -- 0:00:21
161500 -- (-205.420) (-205.344) (-207.952) [-207.455] * (-206.593) (-205.793) (-205.554) [-207.601] -- 0:00:20
162000 -- [-205.737] (-207.391) (-206.247) (-208.523) * (-205.847) (-205.410) [-207.655] (-211.041) -- 0:00:20
162500 -- (-207.570) (-204.868) (-204.553) [-210.040] * (-206.757) (-204.786) [-208.135] (-207.510) -- 0:00:20
163000 -- (-207.537) (-205.498) (-206.495) [-205.086] * [-204.209] (-204.901) (-205.300) (-206.933) -- 0:00:20
163500 -- (-209.647) (-205.350) (-209.279) [-207.114] * (-205.604) [-204.749] (-207.037) (-206.307) -- 0:00:20
164000 -- [-206.639] (-206.132) (-206.688) (-207.429) * [-206.000] (-207.380) (-207.506) (-206.573) -- 0:00:20
164500 -- (-205.497) (-209.100) (-204.993) [-205.620] * (-206.947) (-206.583) [-205.762] (-211.530) -- 0:00:20
165000 -- (-207.045) (-206.548) [-205.240] (-205.943) * (-206.987) [-204.908] (-205.783) (-210.008) -- 0:00:20
Average standard deviation of split frequencies: 0.019879
165500 -- (-207.117) (-205.543) (-207.314) [-206.377] * (-208.073) (-205.138) (-207.690) [-204.418] -- 0:00:20
166000 -- (-204.811) (-207.043) (-206.177) [-208.261] * (-206.377) (-207.869) [-206.857] (-205.278) -- 0:00:20
166500 -- (-205.671) (-206.205) (-204.889) [-206.570] * (-204.060) (-205.900) [-209.412] (-207.241) -- 0:00:20
167000 -- (-206.619) [-205.707] (-210.598) (-211.601) * (-208.909) (-205.166) [-205.137] (-209.459) -- 0:00:21
167500 -- (-204.868) (-206.370) [-209.988] (-207.955) * [-208.770] (-205.787) (-204.765) (-212.250) -- 0:00:21
168000 -- (-205.678) (-205.853) (-208.307) [-209.521] * (-207.754) (-208.962) [-204.228] (-211.091) -- 0:00:21
168500 -- (-207.623) (-205.286) [-204.975] (-209.175) * (-205.878) [-208.216] (-204.717) (-208.983) -- 0:00:21
169000 -- (-209.740) (-205.942) (-204.913) [-204.526] * (-206.244) (-207.367) [-204.406] (-205.997) -- 0:00:21
169500 -- (-205.590) (-207.434) [-206.480] (-210.180) * (-209.786) [-207.272] (-204.602) (-205.949) -- 0:00:21
170000 -- (-205.515) [-204.627] (-208.830) (-207.225) * [-207.705] (-206.093) (-211.858) (-206.093) -- 0:00:21
Average standard deviation of split frequencies: 0.019771
170500 -- (-204.334) [-205.621] (-209.014) (-206.371) * [-205.791] (-208.534) (-209.015) (-205.936) -- 0:00:21
171000 -- (-207.540) [-205.271] (-205.967) (-205.152) * [-205.074] (-212.409) (-206.229) (-205.586) -- 0:00:21
171500 -- [-207.554] (-208.550) (-208.607) (-209.144) * (-207.431) (-211.282) [-206.977] (-205.433) -- 0:00:21
172000 -- [-205.044] (-205.452) (-208.146) (-208.470) * (-206.165) (-209.073) (-205.637) [-204.461] -- 0:00:20
172500 -- [-204.701] (-208.885) (-205.272) (-206.758) * (-208.048) [-204.969] (-211.616) (-206.949) -- 0:00:20
173000 -- (-210.466) (-206.558) [-205.230] (-207.508) * (-208.108) [-205.602] (-208.546) (-211.404) -- 0:00:20
173500 -- [-204.793] (-205.599) (-208.746) (-205.735) * (-205.035) (-209.151) [-206.675] (-210.118) -- 0:00:20
174000 -- (-205.940) (-206.252) [-209.898] (-205.611) * (-205.375) (-212.004) [-206.080] (-205.897) -- 0:00:20
174500 -- (-205.130) (-216.452) [-204.274] (-205.383) * [-205.094] (-208.605) (-205.700) (-205.901) -- 0:00:20
175000 -- (-206.982) (-205.306) [-205.344] (-206.176) * [-207.158] (-205.570) (-209.339) (-207.119) -- 0:00:20
Average standard deviation of split frequencies: 0.021005
175500 -- (-205.109) [-205.784] (-206.603) (-205.709) * (-210.028) [-205.866] (-206.114) (-205.844) -- 0:00:20
176000 -- [-210.117] (-205.307) (-206.796) (-207.086) * [-205.244] (-206.644) (-204.441) (-206.331) -- 0:00:20
176500 -- (-205.696) [-205.167] (-206.389) (-207.244) * (-204.610) (-206.691) (-204.712) [-207.948] -- 0:00:20
177000 -- [-204.462] (-206.238) (-211.995) (-205.531) * (-205.901) (-205.443) (-207.741) [-207.053] -- 0:00:20
177500 -- [-205.117] (-207.153) (-211.040) (-204.372) * [-205.660] (-207.856) (-207.616) (-205.995) -- 0:00:19
178000 -- [-208.858] (-207.112) (-210.593) (-204.404) * (-213.690) (-204.225) (-208.716) [-207.152] -- 0:00:19
178500 -- [-209.500] (-207.340) (-207.362) (-205.853) * (-208.720) (-206.206) (-207.532) [-209.556] -- 0:00:19
179000 -- (-208.448) [-204.516] (-209.504) (-206.283) * (-210.868) (-212.428) (-207.618) [-207.386] -- 0:00:19
179500 -- (-210.693) (-210.401) (-208.896) [-204.607] * (-210.188) (-207.433) [-205.911] (-211.701) -- 0:00:19
180000 -- (-206.584) [-206.732] (-209.769) (-206.124) * (-207.425) [-211.675] (-205.760) (-208.305) -- 0:00:19
Average standard deviation of split frequencies: 0.022659
180500 -- (-206.284) [-205.185] (-206.842) (-210.517) * [-208.409] (-205.857) (-207.869) (-207.341) -- 0:00:19
181000 -- (-206.309) (-204.891) (-206.989) [-207.596] * [-204.088] (-205.183) (-205.649) (-206.614) -- 0:00:19
181500 -- (-207.046) (-206.491) (-204.663) [-204.779] * [-204.250] (-207.440) (-206.370) (-208.082) -- 0:00:19
182000 -- (-204.471) (-208.257) (-206.567) [-205.042] * (-206.550) [-208.361] (-207.055) (-208.976) -- 0:00:19
182500 -- [-204.904] (-205.623) (-205.392) (-211.460) * (-205.862) (-207.377) [-208.419] (-206.285) -- 0:00:19
183000 -- (-205.433) (-204.361) (-209.972) [-212.504] * (-208.469) (-206.034) [-205.559] (-206.549) -- 0:00:19
183500 -- (-207.293) (-204.993) [-207.468] (-205.392) * (-205.019) [-204.826] (-207.017) (-209.521) -- 0:00:18
184000 -- (-209.514) [-205.027] (-206.369) (-205.916) * (-206.536) [-206.358] (-204.588) (-211.437) -- 0:00:20
184500 -- [-206.443] (-205.818) (-206.946) (-209.867) * (-209.248) (-206.951) (-209.478) [-209.978] -- 0:00:20
185000 -- (-205.467) (-206.964) [-206.396] (-210.100) * (-205.701) (-208.778) [-206.584] (-205.198) -- 0:00:20
Average standard deviation of split frequencies: 0.021923
185500 -- (-207.288) [-207.039] (-209.988) (-207.634) * (-206.167) (-207.102) [-206.734] (-207.419) -- 0:00:20
186000 -- (-204.820) [-208.792] (-209.917) (-207.653) * [-205.376] (-209.986) (-205.458) (-207.301) -- 0:00:20
186500 -- (-207.105) (-205.492) (-207.078) [-206.897] * (-206.223) [-204.230] (-207.565) (-209.406) -- 0:00:20
187000 -- (-209.124) (-210.361) [-208.013] (-205.129) * (-207.833) [-205.269] (-208.651) (-206.749) -- 0:00:20
187500 -- [-208.869] (-205.569) (-208.086) (-204.453) * [-210.330] (-204.691) (-208.047) (-208.026) -- 0:00:20
188000 -- (-204.961) [-206.052] (-206.161) (-204.726) * (-207.584) (-215.211) (-207.691) [-205.114] -- 0:00:19
188500 -- (-204.563) [-205.829] (-205.797) (-204.847) * [-205.213] (-205.360) (-204.778) (-206.783) -- 0:00:19
189000 -- (-205.243) [-206.411] (-205.931) (-205.040) * (-204.972) (-207.956) [-204.512] (-208.816) -- 0:00:19
189500 -- (-207.487) (-206.084) [-207.163] (-206.061) * (-210.216) [-206.384] (-205.662) (-205.105) -- 0:00:19
190000 -- (-205.111) (-206.856) (-206.894) [-207.814] * [-206.975] (-205.013) (-208.119) (-206.572) -- 0:00:19
Average standard deviation of split frequencies: 0.021139
190500 -- (-207.177) (-205.616) [-212.798] (-204.866) * (-205.021) (-207.477) (-207.656) [-206.311] -- 0:00:19
191000 -- (-213.789) (-205.089) [-206.913] (-206.141) * (-204.853) (-209.532) [-204.671] (-207.487) -- 0:00:19
191500 -- [-204.736] (-210.022) (-205.372) (-210.855) * (-204.388) (-208.217) [-205.014] (-208.563) -- 0:00:19
192000 -- [-207.491] (-208.136) (-205.641) (-207.582) * (-205.361) (-204.883) [-205.412] (-206.153) -- 0:00:19
192500 -- [-210.916] (-209.752) (-205.297) (-204.955) * (-205.471) (-207.445) (-207.951) [-206.981] -- 0:00:19
193000 -- (-205.567) (-209.609) [-205.192] (-206.125) * (-205.457) (-209.783) (-205.694) [-207.433] -- 0:00:19
193500 -- (-207.233) (-208.040) [-205.708] (-207.355) * (-205.137) [-207.133] (-206.269) (-206.796) -- 0:00:19
194000 -- (-207.272) (-204.189) (-206.325) [-207.500] * (-206.814) (-206.203) (-208.091) [-204.657] -- 0:00:18
194500 -- (-205.190) (-215.577) [-207.740] (-204.658) * [-209.317] (-206.734) (-206.112) (-211.893) -- 0:00:18
195000 -- (-207.657) (-207.114) [-206.668] (-205.634) * (-206.693) [-206.874] (-205.984) (-206.248) -- 0:00:18
Average standard deviation of split frequencies: 0.021285
195500 -- (-205.475) (-208.771) [-204.789] (-206.939) * [-207.098] (-205.284) (-208.163) (-206.387) -- 0:00:18
196000 -- (-206.491) (-210.211) [-205.419] (-204.544) * (-206.811) (-208.935) (-208.377) [-204.902] -- 0:00:18
196500 -- [-206.420] (-206.775) (-207.375) (-204.645) * [-205.028] (-209.985) (-206.466) (-206.385) -- 0:00:18
197000 -- (-205.427) (-206.261) (-205.744) [-205.763] * (-207.843) [-207.559] (-205.423) (-207.112) -- 0:00:18
197500 -- (-208.663) (-213.811) (-205.970) [-206.194] * (-205.431) [-205.480] (-206.153) (-207.546) -- 0:00:18
198000 -- (-206.385) (-205.223) [-206.822] (-206.703) * (-210.312) [-204.510] (-205.366) (-205.733) -- 0:00:18
198500 -- (-205.978) (-206.571) [-211.715] (-210.067) * (-205.484) (-207.061) [-206.165] (-206.457) -- 0:00:18
199000 -- (-207.355) (-206.358) (-207.585) [-207.301] * (-204.818) [-205.085] (-209.122) (-206.994) -- 0:00:18
199500 -- [-205.454] (-204.496) (-208.273) (-211.502) * (-208.366) [-204.741] (-209.307) (-206.206) -- 0:00:18
200000 -- [-204.617] (-206.133) (-205.963) (-209.502) * [-206.271] (-205.504) (-209.812) (-206.177) -- 0:00:18
Average standard deviation of split frequencies: 0.021019
200500 -- [-204.704] (-210.643) (-207.026) (-209.053) * (-206.853) (-205.982) [-208.700] (-211.942) -- 0:00:17
201000 -- (-208.090) [-204.888] (-207.235) (-204.745) * (-206.883) [-207.607] (-205.324) (-208.792) -- 0:00:19
201500 -- [-205.984] (-206.474) (-208.427) (-206.914) * (-207.978) [-205.990] (-210.093) (-207.062) -- 0:00:19
202000 -- [-206.254] (-204.590) (-206.171) (-206.986) * [-208.863] (-205.882) (-208.524) (-208.162) -- 0:00:19
202500 -- (-206.755) (-208.701) [-205.774] (-210.521) * (-209.836) (-204.161) (-205.025) [-204.892] -- 0:00:19
203000 -- (-206.763) (-207.253) [-205.187] (-210.839) * (-207.814) (-206.616) (-205.503) [-204.460] -- 0:00:19
203500 -- (-212.621) (-207.745) (-204.602) [-205.027] * (-206.710) (-205.983) (-205.131) [-207.046] -- 0:00:18
204000 -- (-208.020) (-208.851) [-206.140] (-205.528) * (-206.604) (-206.206) [-206.837] (-206.114) -- 0:00:18
204500 -- (-208.647) [-206.099] (-206.744) (-205.323) * (-207.137) (-209.775) [-208.442] (-204.796) -- 0:00:18
205000 -- (-204.746) (-204.905) [-206.146] (-205.032) * (-205.108) [-205.560] (-207.019) (-206.955) -- 0:00:18
Average standard deviation of split frequencies: 0.021198
205500 -- (-209.357) (-206.183) (-207.008) [-205.734] * (-207.411) (-204.365) [-204.629] (-208.107) -- 0:00:18
206000 -- (-206.871) (-207.751) (-208.846) [-207.536] * (-206.576) (-205.825) [-205.140] (-205.618) -- 0:00:18
206500 -- (-205.455) (-205.214) [-205.232] (-212.791) * (-205.987) (-205.851) [-205.802] (-207.930) -- 0:00:18
207000 -- [-206.192] (-206.139) (-204.441) (-205.343) * [-207.185] (-204.583) (-207.220) (-212.517) -- 0:00:18
207500 -- [-205.170] (-211.294) (-207.866) (-206.226) * (-207.126) (-204.951) (-207.071) [-208.900] -- 0:00:18
208000 -- [-206.502] (-208.692) (-205.280) (-204.969) * (-206.646) (-206.121) (-204.425) [-208.019] -- 0:00:18
208500 -- [-204.912] (-206.945) (-205.187) (-206.012) * [-205.582] (-205.892) (-208.798) (-205.844) -- 0:00:18
209000 -- (-204.542) [-205.503] (-210.226) (-205.968) * (-208.618) (-209.504) (-204.205) [-205.421] -- 0:00:18
209500 -- (-204.544) (-208.384) [-210.950] (-210.540) * [-212.269] (-204.875) (-207.098) (-207.897) -- 0:00:18
210000 -- (-208.532) (-205.392) [-205.927] (-206.763) * (-205.941) [-205.790] (-204.808) (-207.132) -- 0:00:17
Average standard deviation of split frequencies: 0.020610
210500 -- (-210.388) (-206.096) (-207.809) [-205.658] * (-207.206) (-204.635) [-206.980] (-208.282) -- 0:00:17
211000 -- (-208.066) (-205.828) (-206.020) [-205.560] * (-209.919) (-207.357) [-207.109] (-208.451) -- 0:00:17
211500 -- (-209.420) (-205.437) (-207.748) [-205.581] * (-209.240) (-205.747) [-205.861] (-208.094) -- 0:00:17
212000 -- (-208.542) (-207.172) (-206.468) [-204.576] * (-208.516) [-205.782] (-204.866) (-205.787) -- 0:00:17
212500 -- (-209.550) (-206.984) (-205.486) [-204.128] * (-207.936) (-205.485) (-208.028) [-205.062] -- 0:00:17
213000 -- (-206.402) (-205.305) (-209.338) [-207.158] * (-204.573) (-205.609) (-207.456) [-205.325] -- 0:00:17
213500 -- (-206.711) [-204.838] (-210.253) (-208.659) * (-205.404) (-205.560) (-205.701) [-205.495] -- 0:00:17
214000 -- (-207.616) (-208.419) [-208.168] (-207.332) * (-205.314) (-205.807) (-207.752) [-206.875] -- 0:00:17
214500 -- [-206.939] (-208.230) (-209.579) (-205.796) * (-205.797) (-205.493) (-204.608) [-205.532] -- 0:00:17
215000 -- [-204.990] (-205.133) (-206.020) (-209.304) * (-205.821) (-207.257) (-206.645) [-206.791] -- 0:00:17
Average standard deviation of split frequencies: 0.021595
215500 -- (-204.130) (-207.094) [-208.491] (-208.006) * (-209.110) (-208.369) (-206.039) [-204.417] -- 0:00:17
216000 -- [-205.824] (-209.115) (-210.137) (-206.699) * (-207.061) [-206.313] (-211.702) (-204.290) -- 0:00:17
216500 -- (-205.312) (-205.168) [-205.243] (-204.544) * [-211.373] (-205.463) (-204.492) (-209.562) -- 0:00:17
217000 -- (-206.126) [-207.249] (-208.418) (-204.242) * (-206.550) [-210.703] (-205.320) (-207.283) -- 0:00:16
217500 -- (-210.237) (-206.889) (-208.475) [-206.730] * (-205.840) [-206.153] (-208.641) (-206.188) -- 0:00:16
218000 -- (-211.129) (-210.603) (-205.937) [-207.607] * (-207.081) [-208.928] (-207.662) (-207.964) -- 0:00:18
218500 -- [-206.992] (-212.091) (-206.425) (-205.647) * (-206.906) [-208.517] (-208.538) (-205.934) -- 0:00:18
219000 -- [-206.958] (-208.124) (-204.704) (-205.925) * (-205.890) (-205.486) (-209.270) [-205.470] -- 0:00:17
219500 -- [-205.606] (-208.369) (-207.123) (-205.636) * [-205.357] (-206.846) (-210.058) (-210.571) -- 0:00:17
220000 -- (-210.412) [-211.587] (-206.735) (-206.878) * (-209.236) (-210.163) (-207.079) [-206.619] -- 0:00:17
Average standard deviation of split frequencies: 0.019901
220500 -- [-211.218] (-212.740) (-205.380) (-206.822) * (-208.202) [-208.363] (-206.997) (-205.375) -- 0:00:17
221000 -- (-206.790) [-211.719] (-205.179) (-205.204) * [-208.083] (-209.099) (-208.864) (-204.780) -- 0:00:17
221500 -- (-211.820) [-207.045] (-205.277) (-207.996) * [-206.684] (-209.179) (-204.720) (-205.545) -- 0:00:17
222000 -- [-206.083] (-206.678) (-208.647) (-206.467) * (-207.107) (-207.960) (-204.553) [-205.406] -- 0:00:17
222500 -- [-205.467] (-209.204) (-205.534) (-208.446) * [-206.014] (-205.560) (-207.615) (-205.019) -- 0:00:17
223000 -- (-207.292) (-205.371) [-207.965] (-209.759) * (-205.689) [-207.392] (-211.617) (-205.350) -- 0:00:17
223500 -- (-206.086) (-207.172) (-207.064) [-205.701] * (-209.423) (-208.890) (-208.999) [-204.862] -- 0:00:17
224000 -- [-206.189] (-208.431) (-205.615) (-205.838) * [-210.020] (-209.320) (-205.354) (-208.360) -- 0:00:17
224500 -- (-207.381) [-207.616] (-207.181) (-209.383) * [-206.299] (-206.390) (-210.005) (-208.227) -- 0:00:17
225000 -- [-206.614] (-204.661) (-206.680) (-207.992) * (-205.906) [-205.005] (-205.937) (-209.042) -- 0:00:17
Average standard deviation of split frequencies: 0.019980
225500 -- (-205.006) (-205.766) [-206.731] (-214.604) * (-207.217) [-205.488] (-204.931) (-207.814) -- 0:00:17
226000 -- (-205.356) (-205.277) (-207.016) [-209.131] * (-206.920) (-205.768) [-205.746] (-209.577) -- 0:00:16
226500 -- (-208.349) [-210.098] (-210.059) (-205.366) * (-208.645) (-206.133) [-205.195] (-206.835) -- 0:00:16
227000 -- (-206.810) (-205.385) (-204.830) [-205.120] * (-207.498) [-207.906] (-208.494) (-206.915) -- 0:00:16
227500 -- (-205.761) (-204.588) (-206.394) [-204.827] * (-205.494) (-207.359) (-210.284) [-205.986] -- 0:00:16
228000 -- (-209.693) (-204.807) [-208.746] (-206.908) * [-205.814] (-207.298) (-206.427) (-206.159) -- 0:00:16
228500 -- (-217.928) (-204.256) (-210.674) [-206.051] * (-204.947) (-207.895) [-204.762] (-204.500) -- 0:00:16
229000 -- (-207.335) (-205.503) (-205.763) [-206.340] * (-206.673) (-205.138) [-204.508] (-204.463) -- 0:00:16
229500 -- [-204.973] (-205.599) (-204.878) (-206.023) * [-210.062] (-204.444) (-206.102) (-206.817) -- 0:00:16
230000 -- (-208.864) [-204.536] (-205.696) (-206.195) * [-210.165] (-205.953) (-207.966) (-206.076) -- 0:00:16
Average standard deviation of split frequencies: 0.019791
230500 -- [-204.445] (-205.484) (-205.115) (-204.798) * (-210.073) [-205.797] (-205.875) (-205.477) -- 0:00:16
231000 -- [-209.227] (-205.714) (-205.244) (-206.543) * (-208.482) [-207.972] (-205.996) (-205.507) -- 0:00:16
231500 -- [-205.829] (-205.967) (-205.189) (-206.853) * (-206.887) (-206.595) (-207.199) [-204.954] -- 0:00:16
232000 -- (-204.936) (-205.651) (-206.900) [-205.976] * [-204.512] (-206.932) (-205.065) (-205.558) -- 0:00:16
232500 -- (-208.054) (-205.837) (-205.251) [-207.804] * (-207.504) (-204.975) [-205.662] (-205.704) -- 0:00:16
233000 -- (-207.754) [-205.275] (-205.156) (-212.424) * (-207.537) (-206.222) [-207.521] (-206.861) -- 0:00:16
233500 -- (-210.141) (-205.082) (-205.311) [-210.067] * (-208.750) (-208.579) (-206.027) [-205.978] -- 0:00:15
234000 -- (-210.629) [-204.599] (-208.084) (-208.658) * (-206.136) (-205.383) [-206.068] (-207.963) -- 0:00:15
234500 -- [-210.856] (-204.608) (-206.035) (-206.070) * (-205.406) (-205.136) (-205.086) [-206.210] -- 0:00:15
235000 -- (-206.924) (-205.057) [-205.162] (-207.478) * (-206.326) [-205.645] (-206.076) (-204.680) -- 0:00:16
Average standard deviation of split frequencies: 0.018713
235500 -- (-204.338) (-206.301) (-205.773) [-205.558] * (-209.372) (-205.902) (-209.355) [-204.831] -- 0:00:16
236000 -- [-206.784] (-209.076) (-205.912) (-207.775) * (-205.967) [-205.330] (-205.424) (-207.829) -- 0:00:16
236500 -- [-209.776] (-212.264) (-207.103) (-212.181) * (-209.940) [-204.436] (-207.281) (-205.486) -- 0:00:16
237000 -- (-209.288) [-205.497] (-206.309) (-210.432) * [-206.817] (-210.615) (-206.020) (-205.963) -- 0:00:16
237500 -- [-209.273] (-205.392) (-206.204) (-208.679) * (-206.885) (-209.900) (-204.379) [-204.848] -- 0:00:16
238000 -- (-207.962) (-213.234) (-206.151) [-205.259] * (-204.565) [-207.026] (-207.306) (-210.905) -- 0:00:16
238500 -- (-205.606) (-212.050) [-204.621] (-206.815) * (-205.931) [-205.053] (-206.352) (-209.555) -- 0:00:16
239000 -- (-205.220) (-205.405) [-206.533] (-206.127) * (-205.960) (-205.988) (-206.498) [-208.428] -- 0:00:16
239500 -- (-205.581) (-207.593) (-206.013) [-204.224] * (-205.964) (-205.318) (-211.734) [-205.334] -- 0:00:16
240000 -- (-204.994) [-205.798] (-209.369) (-209.273) * (-204.834) [-204.766] (-206.247) (-207.806) -- 0:00:16
Average standard deviation of split frequencies: 0.020676
240500 -- (-205.857) [-207.238] (-209.484) (-206.692) * [-205.185] (-206.128) (-210.129) (-208.092) -- 0:00:16
241000 -- (-207.177) (-207.221) (-205.897) [-205.846] * (-205.774) (-205.911) (-208.019) [-205.206] -- 0:00:16
241500 -- [-207.486] (-208.364) (-206.670) (-205.488) * (-205.008) (-204.937) (-206.310) [-205.651] -- 0:00:16
242000 -- (-205.843) (-208.128) (-207.499) [-206.804] * (-205.634) (-207.201) (-206.207) [-206.762] -- 0:00:15
242500 -- (-206.324) [-204.597] (-205.011) (-205.273) * [-204.364] (-209.352) (-207.578) (-208.557) -- 0:00:15
243000 -- (-205.225) (-205.049) (-209.313) [-204.806] * (-208.688) (-209.049) (-206.893) [-205.917] -- 0:00:15
243500 -- (-205.068) (-204.191) (-207.886) [-206.308] * (-206.019) (-206.550) (-206.938) [-204.605] -- 0:00:15
244000 -- (-208.876) (-205.266) (-205.613) [-205.264] * (-208.213) [-206.082] (-205.648) (-206.730) -- 0:00:15
244500 -- (-206.431) (-206.298) (-206.626) [-207.930] * (-205.231) (-206.839) (-204.474) [-206.422] -- 0:00:15
245000 -- (-207.364) [-206.054] (-206.945) (-205.111) * (-206.063) (-205.945) [-205.024] (-207.380) -- 0:00:15
Average standard deviation of split frequencies: 0.021382
245500 -- [-205.249] (-209.421) (-206.641) (-208.357) * (-207.524) (-205.108) (-206.156) [-204.371] -- 0:00:15
246000 -- (-205.853) (-209.347) [-205.633] (-207.439) * [-204.845] (-206.807) (-210.861) (-207.290) -- 0:00:15
246500 -- (-204.667) [-206.884] (-207.285) (-205.162) * (-205.567) [-208.399] (-210.642) (-205.832) -- 0:00:15
247000 -- (-205.003) (-206.766) [-205.202] (-206.320) * (-209.321) (-204.881) (-211.868) [-205.439] -- 0:00:15
247500 -- (-204.952) [-209.526] (-204.600) (-207.262) * (-204.743) [-205.218] (-205.528) (-209.752) -- 0:00:15
248000 -- (-208.896) [-206.102] (-207.648) (-205.846) * (-206.887) (-207.402) (-205.642) [-210.655] -- 0:00:15
248500 -- (-209.804) (-206.491) (-207.682) [-208.972] * (-213.505) (-205.670) [-206.938] (-211.256) -- 0:00:15
249000 -- (-206.893) (-206.649) [-206.848] (-213.587) * (-207.654) [-205.556] (-205.807) (-208.742) -- 0:00:15
249500 -- (-206.209) (-212.237) (-209.080) [-205.812] * (-208.192) [-206.958] (-207.565) (-209.387) -- 0:00:15
250000 -- (-204.415) (-208.410) (-209.283) [-206.609] * [-206.169] (-206.285) (-204.922) (-207.402) -- 0:00:15
Average standard deviation of split frequencies: 0.021775
250500 -- (-207.041) (-205.430) (-204.438) [-205.752] * (-204.988) [-206.276] (-204.869) (-206.218) -- 0:00:14
251000 -- (-205.146) (-205.071) (-206.967) [-206.277] * (-206.736) [-205.228] (-205.288) (-207.318) -- 0:00:14
251500 -- (-214.275) (-206.236) (-208.900) [-205.371] * (-207.087) (-206.042) (-205.143) [-206.588] -- 0:00:14
252000 -- (-205.778) (-206.146) (-207.018) [-208.931] * (-209.847) [-206.280] (-208.632) (-208.058) -- 0:00:15
252500 -- [-207.167] (-205.005) (-205.234) (-207.093) * (-207.179) (-205.881) [-208.398] (-205.237) -- 0:00:15
253000 -- (-206.094) (-205.860) [-209.424] (-204.007) * (-208.857) (-207.375) (-207.704) [-206.606] -- 0:00:15
253500 -- (-207.140) [-207.028] (-206.308) (-205.429) * (-206.349) (-205.910) (-206.896) [-208.421] -- 0:00:15
254000 -- (-205.691) [-206.076] (-206.311) (-207.432) * (-207.480) (-211.166) [-207.995] (-211.586) -- 0:00:15
254500 -- (-208.995) (-205.877) (-204.598) [-205.556] * [-206.901] (-205.106) (-204.319) (-210.072) -- 0:00:15
255000 -- (-207.608) [-207.835] (-204.955) (-206.817) * (-204.023) (-208.239) (-204.291) [-206.761] -- 0:00:15
Average standard deviation of split frequencies: 0.020062
255500 -- (-210.704) [-210.834] (-209.369) (-205.120) * (-205.553) (-207.857) (-206.263) [-206.403] -- 0:00:15
256000 -- (-207.880) (-205.387) [-206.539] (-204.833) * [-207.897] (-207.561) (-206.602) (-209.909) -- 0:00:15
256500 -- (-205.826) (-205.808) [-207.335] (-205.287) * [-206.298] (-205.377) (-205.769) (-210.603) -- 0:00:15
257000 -- [-205.613] (-206.309) (-207.434) (-207.709) * (-207.064) [-206.795] (-210.068) (-205.724) -- 0:00:15
257500 -- [-204.593] (-205.576) (-206.355) (-206.583) * (-206.356) (-206.732) (-205.108) [-205.563] -- 0:00:15
258000 -- (-205.071) (-208.361) (-206.297) [-207.163] * (-204.699) (-208.918) (-206.792) [-205.786] -- 0:00:15
258500 -- (-207.282) (-206.466) [-205.351] (-207.323) * (-208.035) (-205.857) [-205.511] (-205.244) -- 0:00:14
259000 -- (-210.330) (-204.488) (-209.159) [-206.023] * (-208.627) (-207.078) [-207.460] (-204.499) -- 0:00:14
259500 -- (-205.650) (-204.921) (-205.831) [-204.733] * [-206.977] (-206.561) (-209.974) (-208.055) -- 0:00:14
260000 -- (-206.479) [-204.791] (-205.642) (-211.271) * [-206.856] (-205.931) (-212.903) (-206.059) -- 0:00:14
Average standard deviation of split frequencies: 0.020094
260500 -- (-211.260) [-204.558] (-207.919) (-208.910) * (-204.410) [-208.300] (-205.888) (-205.949) -- 0:00:14
261000 -- (-208.288) [-205.037] (-207.089) (-205.991) * (-206.408) (-205.641) (-207.220) [-207.698] -- 0:00:14
261500 -- [-205.312] (-208.852) (-207.946) (-205.705) * (-210.663) (-206.543) [-204.442] (-206.464) -- 0:00:14
262000 -- [-204.534] (-212.389) (-207.807) (-207.584) * (-208.905) [-204.850] (-205.781) (-211.404) -- 0:00:14
262500 -- (-205.316) (-207.612) (-206.779) [-206.742] * (-208.828) (-204.374) [-208.165] (-208.073) -- 0:00:14
263000 -- (-205.222) [-209.061] (-205.075) (-207.312) * (-205.851) [-207.682] (-204.700) (-209.788) -- 0:00:14
263500 -- (-209.264) (-208.326) [-205.380] (-206.374) * (-206.806) (-206.767) [-206.456] (-206.071) -- 0:00:14
264000 -- (-207.455) [-212.638] (-211.583) (-206.487) * (-204.514) [-205.119] (-205.497) (-206.900) -- 0:00:14
264500 -- (-206.064) (-205.061) [-208.781] (-206.102) * (-211.572) [-205.103] (-205.557) (-205.428) -- 0:00:14
265000 -- [-205.752] (-206.815) (-206.455) (-207.081) * [-206.446] (-208.408) (-205.504) (-205.429) -- 0:00:14
Average standard deviation of split frequencies: 0.020147
265500 -- (-206.559) [-206.926] (-208.102) (-206.310) * (-206.096) [-207.858] (-204.857) (-206.542) -- 0:00:14
266000 -- (-205.259) (-204.393) (-205.556) [-205.967] * [-206.923] (-208.573) (-207.965) (-206.005) -- 0:00:14
266500 -- (-206.114) [-207.376] (-205.018) (-208.014) * (-205.331) [-208.117] (-206.241) (-207.320) -- 0:00:14
267000 -- (-209.127) (-207.391) [-206.403] (-206.703) * (-205.673) (-204.774) (-207.066) [-205.352] -- 0:00:13
267500 -- [-206.625] (-207.439) (-206.101) (-205.088) * (-206.790) [-204.738] (-206.545) (-204.642) -- 0:00:13
268000 -- [-207.360] (-204.447) (-205.254) (-208.627) * (-205.510) (-204.504) [-207.139] (-209.742) -- 0:00:13
268500 -- (-205.872) (-206.342) (-206.288) [-211.840] * [-204.196] (-208.041) (-209.668) (-206.532) -- 0:00:13
269000 -- [-210.702] (-205.478) (-208.546) (-205.979) * (-206.218) [-206.335] (-204.689) (-208.164) -- 0:00:14
269500 -- (-209.538) (-205.036) (-206.380) [-204.963] * (-206.724) [-206.255] (-207.223) (-208.383) -- 0:00:14
270000 -- (-206.953) (-205.793) [-206.254] (-205.749) * (-209.961) [-207.877] (-206.424) (-204.792) -- 0:00:14
Average standard deviation of split frequencies: 0.018883
270500 -- (-208.150) (-206.388) (-205.614) [-208.034] * (-206.636) (-210.625) [-205.615] (-207.345) -- 0:00:14
271000 -- (-210.959) [-207.270] (-205.161) (-210.647) * [-204.951] (-204.958) (-206.914) (-206.202) -- 0:00:14
271500 -- [-207.264] (-205.837) (-204.802) (-205.096) * (-205.681) [-206.122] (-207.720) (-208.083) -- 0:00:14
272000 -- (-210.377) (-205.496) [-205.649] (-208.061) * [-207.723] (-205.136) (-205.357) (-206.226) -- 0:00:14
272500 -- (-210.692) [-205.403] (-205.449) (-205.134) * (-206.540) (-207.013) [-207.050] (-209.174) -- 0:00:14
273000 -- (-208.065) [-206.391] (-206.958) (-212.096) * (-205.140) (-206.678) (-207.571) [-206.590] -- 0:00:14
273500 -- [-208.471] (-210.219) (-207.818) (-205.150) * (-205.886) (-208.724) (-208.780) [-208.078] -- 0:00:14
274000 -- (-205.321) [-211.954] (-206.365) (-207.605) * [-205.186] (-205.932) (-205.846) (-205.446) -- 0:00:14
274500 -- (-208.484) (-211.457) (-206.231) [-204.407] * (-207.623) (-205.675) [-207.275] (-205.807) -- 0:00:13
275000 -- (-206.238) [-205.132] (-204.767) (-209.544) * [-208.238] (-209.896) (-207.840) (-204.456) -- 0:00:13
Average standard deviation of split frequencies: 0.018788
275500 -- (-205.105) (-204.600) [-204.724] (-206.395) * (-206.386) (-206.940) [-204.410] (-208.983) -- 0:00:13
276000 -- [-205.025] (-206.960) (-205.390) (-208.174) * (-206.190) (-205.962) [-211.249] (-206.416) -- 0:00:13
276500 -- (-207.322) [-209.280] (-204.358) (-208.760) * (-210.986) (-212.680) (-205.147) [-204.882] -- 0:00:13
277000 -- (-209.483) (-205.119) [-206.145] (-209.283) * (-208.740) (-204.696) [-204.344] (-207.465) -- 0:00:13
277500 -- (-209.830) [-205.725] (-205.610) (-206.148) * (-205.703) [-205.081] (-205.223) (-208.706) -- 0:00:13
278000 -- (-208.621) (-205.369) (-205.483) [-204.804] * (-208.919) (-205.218) [-204.573] (-205.822) -- 0:00:13
278500 -- (-207.502) (-209.177) [-204.767] (-205.181) * [-208.528] (-206.365) (-206.097) (-205.501) -- 0:00:13
279000 -- (-204.727) (-207.785) [-206.949] (-208.353) * (-207.545) (-206.299) (-207.671) [-206.674] -- 0:00:13
279500 -- (-205.448) [-204.890] (-205.620) (-204.835) * [-206.867] (-208.279) (-207.428) (-207.899) -- 0:00:13
280000 -- (-207.607) (-204.541) [-205.487] (-204.665) * [-206.318] (-204.985) (-206.322) (-207.511) -- 0:00:13
Average standard deviation of split frequencies: 0.019222
280500 -- [-206.843] (-204.890) (-205.281) (-206.413) * (-205.409) [-204.396] (-206.220) (-207.270) -- 0:00:13
281000 -- (-205.798) [-206.890] (-209.146) (-207.979) * [-208.309] (-206.042) (-207.263) (-205.788) -- 0:00:13
281500 -- (-208.720) (-208.052) [-206.126] (-205.276) * (-209.555) [-207.326] (-206.209) (-208.293) -- 0:00:13
282000 -- (-210.100) (-206.003) (-211.618) [-204.839] * (-209.547) [-205.175] (-205.341) (-205.088) -- 0:00:13
282500 -- [-206.665] (-206.639) (-208.402) (-205.772) * (-209.996) (-209.039) (-205.969) [-210.531] -- 0:00:13
283000 -- [-209.446] (-205.282) (-204.971) (-205.168) * (-208.187) (-205.652) (-207.265) [-210.125] -- 0:00:13
283500 -- (-206.476) [-205.465] (-204.914) (-206.838) * (-205.724) (-208.362) (-208.298) [-205.119] -- 0:00:12
284000 -- (-205.516) [-208.862] (-207.190) (-204.862) * (-205.508) [-205.559] (-209.001) (-207.927) -- 0:00:12
284500 -- (-206.971) [-205.716] (-207.468) (-210.131) * (-205.274) [-204.822] (-205.142) (-206.368) -- 0:00:12
285000 -- (-204.880) [-205.820] (-206.345) (-211.364) * (-205.141) [-204.659] (-204.392) (-207.460) -- 0:00:12
Average standard deviation of split frequencies: 0.019413
285500 -- [-206.068] (-208.533) (-211.090) (-205.565) * (-204.895) [-208.594] (-205.413) (-207.429) -- 0:00:12
286000 -- (-213.165) [-205.485] (-207.261) (-207.645) * (-208.411) (-209.666) (-204.568) [-205.776] -- 0:00:13
286500 -- (-205.392) (-205.458) [-209.467] (-206.451) * (-210.674) (-208.724) (-207.581) [-204.512] -- 0:00:13
287000 -- (-208.216) (-204.698) [-206.886] (-206.137) * (-210.767) (-209.499) (-206.066) [-207.987] -- 0:00:13
287500 -- (-204.858) (-205.842) [-208.083] (-206.114) * (-207.324) (-212.668) [-204.603] (-207.800) -- 0:00:13
288000 -- (-205.773) [-205.649] (-204.113) (-207.242) * [-207.833] (-205.815) (-205.489) (-206.110) -- 0:00:13
288500 -- [-207.708] (-207.657) (-204.819) (-209.661) * (-206.249) [-206.466] (-206.161) (-205.212) -- 0:00:13
289000 -- (-204.979) (-206.703) [-206.324] (-208.398) * (-205.898) (-205.217) [-207.836] (-205.909) -- 0:00:13
289500 -- (-205.296) (-204.847) (-207.370) [-207.365] * (-204.547) (-205.326) (-205.960) [-205.956] -- 0:00:13
290000 -- [-208.207] (-207.533) (-208.328) (-207.314) * (-206.821) (-205.522) (-206.546) [-206.893] -- 0:00:13
Average standard deviation of split frequencies: 0.018651
290500 -- (-205.962) (-204.746) [-205.364] (-206.642) * (-207.367) (-206.227) (-206.695) [-205.534] -- 0:00:12
291000 -- (-207.575) (-206.856) [-204.814] (-208.763) * (-206.508) (-205.028) [-204.949] (-210.740) -- 0:00:12
291500 -- (-211.340) (-207.481) [-207.744] (-211.686) * (-205.495) [-207.357] (-206.607) (-212.022) -- 0:00:12
292000 -- (-209.073) (-212.402) [-207.459] (-206.395) * (-206.336) (-208.579) [-206.106] (-207.918) -- 0:00:12
292500 -- (-212.209) [-208.113] (-209.567) (-209.048) * (-204.267) [-206.421] (-205.459) (-205.016) -- 0:00:12
293000 -- (-206.172) (-205.163) (-205.560) [-205.639] * (-205.837) (-208.766) (-206.128) [-208.599] -- 0:00:12
293500 -- (-206.788) (-205.496) (-207.763) [-206.324] * (-206.442) (-207.131) (-205.960) [-209.040] -- 0:00:12
294000 -- (-206.687) (-206.456) (-205.064) [-206.140] * [-206.184] (-208.133) (-204.602) (-211.760) -- 0:00:12
294500 -- (-204.845) (-204.694) [-205.951] (-207.065) * (-205.062) (-205.972) [-205.681] (-214.810) -- 0:00:12
295000 -- (-209.737) (-204.540) (-210.051) [-207.915] * [-204.912] (-206.642) (-206.856) (-212.031) -- 0:00:12
Average standard deviation of split frequencies: 0.017518
295500 -- (-205.702) (-205.199) [-206.458] (-210.364) * [-204.784] (-207.580) (-212.922) (-206.932) -- 0:00:12
296000 -- (-204.438) [-206.956] (-206.005) (-208.597) * (-205.413) (-209.549) [-207.145] (-207.998) -- 0:00:12
296500 -- (-204.899) (-205.467) [-207.738] (-206.487) * (-206.006) (-205.331) [-207.081] (-208.491) -- 0:00:12
297000 -- (-206.959) (-205.168) (-206.955) [-206.422] * (-208.697) [-205.064] (-207.458) (-207.029) -- 0:00:12
297500 -- (-205.527) (-204.998) (-206.262) [-207.698] * [-205.019] (-208.005) (-204.907) (-205.220) -- 0:00:12
298000 -- (-205.689) [-205.638] (-205.814) (-207.042) * (-206.076) (-208.153) (-205.893) [-207.283] -- 0:00:12
298500 -- (-205.963) [-209.205] (-207.578) (-205.555) * (-208.964) [-205.195] (-207.883) (-209.017) -- 0:00:12
299000 -- (-206.641) [-206.042] (-211.289) (-207.989) * [-211.688] (-204.196) (-208.076) (-210.017) -- 0:00:12
299500 -- (-206.411) (-207.018) (-206.178) [-208.484] * (-206.094) [-208.133] (-210.316) (-207.572) -- 0:00:12
300000 -- (-205.948) (-206.119) (-207.619) [-204.500] * [-204.611] (-206.642) (-207.553) (-204.913) -- 0:00:12
Average standard deviation of split frequencies: 0.017595
300500 -- (-205.492) (-205.476) [-205.076] (-206.072) * (-204.474) [-205.792] (-205.579) (-207.811) -- 0:00:11
301000 -- (-206.989) [-206.220] (-206.263) (-207.741) * (-207.487) (-208.680) (-207.582) [-209.189] -- 0:00:11
301500 -- [-207.300] (-208.091) (-208.332) (-205.744) * (-205.254) (-205.520) (-207.931) [-204.665] -- 0:00:11
302000 -- [-207.782] (-208.389) (-207.083) (-211.225) * (-205.379) (-205.037) [-207.750] (-205.420) -- 0:00:11
302500 -- (-208.695) (-204.543) [-206.444] (-204.711) * (-207.311) [-208.269] (-207.165) (-205.765) -- 0:00:11
303000 -- (-205.210) [-208.584] (-207.150) (-205.770) * (-204.713) (-208.341) (-206.609) [-206.344] -- 0:00:12
303500 -- [-204.668] (-205.554) (-206.595) (-207.074) * [-204.288] (-208.814) (-205.196) (-205.193) -- 0:00:12
304000 -- (-205.983) (-206.487) (-204.625) [-204.132] * (-205.579) (-211.321) [-207.187] (-206.903) -- 0:00:12
304500 -- (-205.246) (-205.579) (-207.296) [-207.385] * (-207.911) (-205.945) [-208.975] (-208.535) -- 0:00:12
305000 -- (-205.331) [-208.189] (-206.798) (-207.862) * (-209.464) (-204.465) (-205.953) [-204.817] -- 0:00:12
Average standard deviation of split frequencies: 0.016775
305500 -- (-206.163) [-205.384] (-204.701) (-206.727) * (-205.846) (-206.289) [-205.796] (-212.257) -- 0:00:12
306000 -- (-207.197) (-204.558) (-205.697) [-210.499] * [-205.086] (-205.116) (-209.845) (-207.677) -- 0:00:12
306500 -- [-207.843] (-204.603) (-206.853) (-208.503) * [-205.216] (-208.769) (-208.244) (-208.654) -- 0:00:11
307000 -- (-206.838) (-206.623) [-205.924] (-205.351) * (-205.477) (-206.384) [-206.683] (-205.727) -- 0:00:11
307500 -- (-207.429) [-205.446] (-206.436) (-205.481) * (-207.322) [-205.792] (-206.622) (-205.935) -- 0:00:11
308000 -- (-206.693) [-206.146] (-214.106) (-209.496) * (-205.856) (-207.627) (-207.069) [-205.128] -- 0:00:11
308500 -- (-211.601) [-208.104] (-205.303) (-205.718) * (-207.092) (-206.027) (-206.530) [-204.677] -- 0:00:11
309000 -- (-208.437) [-206.430] (-206.475) (-207.549) * (-207.138) (-208.703) [-207.448] (-204.745) -- 0:00:11
309500 -- (-206.140) [-207.553] (-207.338) (-206.833) * [-207.816] (-204.618) (-206.261) (-205.128) -- 0:00:11
310000 -- (-204.303) (-210.107) [-205.649] (-207.792) * (-209.367) (-204.606) [-205.416] (-206.005) -- 0:00:11
Average standard deviation of split frequencies: 0.015933
310500 -- (-205.635) (-205.254) (-204.482) [-205.591] * (-209.336) (-206.968) [-207.250] (-204.534) -- 0:00:11
311000 -- (-209.485) [-205.455] (-206.166) (-208.121) * (-207.016) (-212.362) (-206.585) [-204.722] -- 0:00:11
311500 -- (-211.136) (-207.784) [-207.108] (-206.138) * (-205.229) (-204.948) [-205.281] (-208.618) -- 0:00:11
312000 -- [-208.807] (-208.918) (-211.183) (-206.598) * (-205.327) (-209.511) [-205.151] (-206.328) -- 0:00:11
312500 -- (-211.394) (-206.659) (-205.344) [-205.969] * (-207.464) (-208.631) [-205.080] (-206.062) -- 0:00:11
313000 -- (-207.682) [-207.059] (-212.091) (-207.565) * (-209.478) [-206.783] (-206.442) (-205.841) -- 0:00:11
313500 -- (-207.029) (-204.530) [-208.224] (-210.629) * [-206.146] (-207.707) (-205.661) (-206.563) -- 0:00:11
314000 -- [-210.321] (-207.647) (-206.977) (-209.524) * (-206.870) [-207.550] (-208.286) (-210.411) -- 0:00:11
314500 -- (-205.628) (-206.482) [-210.300] (-206.807) * [-209.187] (-205.943) (-207.448) (-206.994) -- 0:00:11
315000 -- (-205.182) [-206.524] (-206.658) (-204.774) * (-207.762) (-208.417) (-205.584) [-205.670] -- 0:00:11
Average standard deviation of split frequencies: 0.016244
315500 -- (-206.708) (-207.248) [-206.020] (-208.371) * (-205.315) (-206.078) (-205.410) [-205.484] -- 0:00:11
316000 -- (-205.837) [-205.901] (-205.729) (-206.662) * (-211.679) (-206.902) (-205.034) [-209.676] -- 0:00:11
316500 -- (-205.259) (-206.988) [-206.902] (-206.383) * (-209.356) (-205.825) (-204.850) [-205.161] -- 0:00:11
317000 -- (-210.404) (-208.165) [-205.995] (-205.319) * (-209.777) (-208.544) [-206.679] (-209.739) -- 0:00:10
317500 -- (-206.643) (-204.981) (-205.510) [-206.013] * (-207.996) (-205.380) (-209.267) [-204.934] -- 0:00:10
318000 -- (-205.818) (-207.998) [-205.046] (-205.777) * (-205.585) [-206.049] (-208.662) (-206.175) -- 0:00:10
318500 -- (-206.838) [-205.006] (-204.972) (-207.909) * [-205.702] (-205.653) (-206.326) (-206.949) -- 0:00:10
319000 -- (-204.519) (-206.288) (-210.379) [-209.695] * (-207.675) (-207.300) [-207.499] (-205.075) -- 0:00:10
319500 -- [-206.355] (-207.221) (-208.799) (-207.677) * (-209.316) (-206.031) [-206.057] (-207.937) -- 0:00:10
320000 -- [-209.019] (-204.394) (-208.420) (-205.879) * (-206.676) [-205.669] (-205.968) (-213.658) -- 0:00:11
Average standard deviation of split frequencies: 0.016416
320500 -- (-210.943) (-206.898) [-208.556] (-206.057) * [-207.092] (-205.797) (-208.900) (-208.296) -- 0:00:11
321000 -- (-205.580) [-207.043] (-207.354) (-206.677) * (-205.919) (-206.722) [-206.212] (-206.767) -- 0:00:11
321500 -- (-204.158) [-208.225] (-207.466) (-209.005) * (-204.868) [-207.256] (-204.094) (-207.052) -- 0:00:11
322000 -- (-206.287) (-208.239) [-204.400] (-205.900) * (-205.220) [-205.842] (-205.559) (-208.714) -- 0:00:11
322500 -- (-206.082) (-204.821) (-205.844) [-207.571] * [-207.572] (-204.834) (-204.569) (-204.555) -- 0:00:11
323000 -- [-206.452] (-205.698) (-205.743) (-207.639) * [-208.886] (-206.876) (-204.501) (-205.751) -- 0:00:10
323500 -- [-212.229] (-205.138) (-206.457) (-204.714) * [-210.998] (-205.578) (-207.611) (-207.985) -- 0:00:10
324000 -- (-205.333) [-206.026] (-207.755) (-206.375) * (-210.060) [-204.725] (-209.731) (-206.167) -- 0:00:10
324500 -- (-211.369) (-206.286) [-207.969] (-208.381) * [-207.727] (-206.383) (-211.493) (-205.736) -- 0:00:10
325000 -- (-205.752) (-206.794) (-211.709) [-205.538] * (-207.200) [-205.383] (-205.158) (-209.415) -- 0:00:10
Average standard deviation of split frequencies: 0.016710
325500 -- [-205.499] (-208.556) (-205.817) (-208.621) * [-206.772] (-206.006) (-205.086) (-205.358) -- 0:00:10
326000 -- (-205.679) [-206.071] (-206.873) (-207.493) * (-205.519) [-207.884] (-204.779) (-205.928) -- 0:00:10
326500 -- [-206.251] (-207.443) (-207.911) (-210.651) * (-206.390) (-207.549) [-204.271] (-205.881) -- 0:00:10
327000 -- [-207.076] (-205.867) (-206.871) (-207.627) * (-205.368) (-207.934) [-209.529] (-206.787) -- 0:00:10
327500 -- (-209.420) (-207.644) [-206.103] (-204.777) * (-208.097) (-206.528) (-208.797) [-205.396] -- 0:00:10
328000 -- (-209.899) (-209.530) (-205.648) [-205.151] * (-206.670) (-209.320) [-203.988] (-209.075) -- 0:00:10
328500 -- (-206.569) (-207.969) [-208.465] (-205.099) * [-206.505] (-206.953) (-207.010) (-206.666) -- 0:00:10
329000 -- (-208.943) [-207.505] (-206.011) (-206.463) * (-205.980) (-206.344) [-207.693] (-206.630) -- 0:00:10
329500 -- (-209.795) (-208.823) (-205.013) [-206.459] * (-208.265) [-205.938] (-206.145) (-205.305) -- 0:00:10
330000 -- (-208.666) (-208.747) (-205.330) [-205.500] * (-208.953) [-204.464] (-206.543) (-206.737) -- 0:00:10
Average standard deviation of split frequencies: 0.015444
330500 -- (-209.024) (-207.533) (-208.265) [-206.017] * (-204.575) (-206.486) (-206.948) [-205.605] -- 0:00:10
331000 -- [-207.292] (-207.559) (-204.134) (-207.248) * (-207.114) (-206.838) (-211.012) [-206.273] -- 0:00:10
331500 -- (-205.656) [-207.925] (-206.306) (-208.628) * [-209.621] (-205.985) (-213.273) (-208.356) -- 0:00:10
332000 -- [-206.466] (-207.221) (-208.199) (-206.575) * (-206.339) (-213.563) (-208.071) [-208.413] -- 0:00:10
332500 -- (-208.890) (-205.858) (-210.558) [-205.510] * (-208.152) (-206.449) [-204.112] (-205.096) -- 0:00:10
333000 -- (-207.429) [-206.571] (-207.069) (-211.944) * (-209.048) (-207.073) [-206.081] (-204.536) -- 0:00:10
333500 -- (-207.004) (-206.307) [-205.704] (-208.749) * (-204.873) (-207.777) (-204.748) [-206.432] -- 0:00:09
334000 -- [-207.653] (-205.593) (-207.431) (-210.462) * (-205.207) [-207.062] (-205.717) (-206.729) -- 0:00:09
334500 -- (-205.252) (-207.243) (-207.595) [-206.908] * (-213.015) (-207.200) [-205.624] (-207.044) -- 0:00:09
335000 -- (-206.164) (-210.014) [-205.410] (-207.106) * (-207.762) (-210.227) [-204.505] (-208.644) -- 0:00:09
Average standard deviation of split frequencies: 0.013735
335500 -- (-206.021) [-205.328] (-205.689) (-205.531) * (-206.082) [-205.001] (-206.198) (-209.361) -- 0:00:09
336000 -- [-207.148] (-206.852) (-207.654) (-205.939) * (-206.422) (-206.640) [-207.055] (-206.497) -- 0:00:09
336500 -- (-206.815) [-207.452] (-204.969) (-205.581) * (-206.200) [-204.442] (-207.971) (-206.087) -- 0:00:09
337000 -- (-204.943) (-206.575) [-204.562] (-205.703) * (-206.310) [-206.539] (-208.672) (-207.397) -- 0:00:10
337500 -- (-211.954) [-206.095] (-208.249) (-207.803) * [-205.310] (-207.714) (-208.587) (-204.590) -- 0:00:10
338000 -- (-207.994) (-207.958) (-205.077) [-205.694] * (-206.589) (-206.014) (-205.801) [-205.059] -- 0:00:10
338500 -- (-205.207) (-210.779) (-205.923) [-206.909] * (-208.924) [-205.526] (-205.020) (-205.491) -- 0:00:10
339000 -- [-206.145] (-206.735) (-209.745) (-205.608) * [-208.486] (-204.664) (-207.612) (-206.940) -- 0:00:09
339500 -- (-207.206) (-207.256) (-211.949) [-204.333] * (-206.321) (-209.101) [-207.343] (-204.401) -- 0:00:09
340000 -- (-204.377) [-206.850] (-212.380) (-205.552) * [-206.640] (-207.128) (-206.347) (-207.110) -- 0:00:09
Average standard deviation of split frequencies: 0.012685
340500 -- [-205.033] (-205.199) (-207.106) (-205.970) * (-209.583) [-209.387] (-205.703) (-206.548) -- 0:00:09
341000 -- (-205.743) (-207.189) (-206.297) [-206.162] * (-206.701) (-207.831) [-204.707] (-210.465) -- 0:00:09
341500 -- [-204.499] (-208.924) (-204.981) (-206.009) * (-205.745) (-208.891) [-204.663] (-205.646) -- 0:00:09
342000 -- (-206.875) (-205.833) [-205.497] (-208.788) * (-207.387) [-206.298] (-205.266) (-205.234) -- 0:00:09
342500 -- (-205.225) (-205.627) [-204.642] (-205.910) * (-206.178) (-208.306) (-209.003) [-210.939] -- 0:00:09
343000 -- (-205.476) [-205.598] (-207.291) (-211.745) * (-204.949) (-205.051) [-204.962] (-206.763) -- 0:00:09
343500 -- (-206.393) (-207.171) (-208.239) [-209.274] * (-206.614) [-204.181] (-210.298) (-210.591) -- 0:00:09
344000 -- [-205.987] (-208.265) (-207.155) (-207.683) * (-210.226) (-208.849) [-206.509] (-207.030) -- 0:00:09
344500 -- (-205.233) (-208.724) [-204.549] (-205.301) * (-208.213) (-206.981) [-204.525] (-207.501) -- 0:00:09
345000 -- (-206.367) [-207.636] (-205.386) (-205.307) * [-206.042] (-209.242) (-210.340) (-207.257) -- 0:00:09
Average standard deviation of split frequencies: 0.012979
345500 -- (-207.428) (-205.306) [-205.997] (-206.477) * [-204.876] (-206.185) (-212.346) (-207.206) -- 0:00:09
346000 -- (-210.262) (-205.870) (-204.993) [-205.141] * (-208.861) (-204.313) [-206.304] (-205.527) -- 0:00:09
346500 -- (-209.961) [-207.226] (-205.534) (-204.612) * (-206.321) (-207.377) [-205.946] (-209.056) -- 0:00:09
347000 -- (-210.347) (-207.701) [-205.602] (-207.369) * (-204.230) (-206.963) (-205.962) [-206.756] -- 0:00:09
347500 -- (-208.970) (-205.089) (-210.904) [-205.569] * (-205.243) [-204.234] (-207.337) (-205.453) -- 0:00:09
348000 -- [-206.288] (-205.631) (-205.277) (-205.742) * (-207.931) (-205.740) [-207.203] (-205.835) -- 0:00:09
348500 -- (-206.101) (-204.900) (-205.659) [-205.101] * (-205.402) (-204.969) (-205.491) [-205.901] -- 0:00:09
349000 -- (-208.925) (-204.982) (-205.716) [-206.784] * (-205.338) (-204.309) [-205.370] (-207.639) -- 0:00:09
349500 -- (-210.176) [-208.680] (-206.866) (-206.809) * (-215.267) (-205.283) (-206.611) [-208.483] -- 0:00:09
350000 -- (-210.227) (-206.088) (-211.079) [-207.717] * [-204.900] (-207.928) (-207.004) (-206.440) -- 0:00:09
Average standard deviation of split frequencies: 0.012472
350500 -- (-205.853) (-207.133) (-206.606) [-205.215] * (-208.508) (-208.297) (-208.914) [-204.808] -- 0:00:08
351000 -- (-207.501) (-208.908) (-208.237) [-206.022] * [-207.274] (-209.447) (-209.183) (-204.589) -- 0:00:08
351500 -- (-207.935) (-208.895) [-206.476] (-206.067) * (-205.274) (-207.768) (-206.190) [-205.978] -- 0:00:08
352000 -- (-206.178) (-206.324) (-208.440) [-204.274] * (-206.966) (-206.353) [-205.798] (-206.289) -- 0:00:08
352500 -- [-208.676] (-207.346) (-207.740) (-208.360) * (-206.476) (-205.529) [-205.672] (-205.692) -- 0:00:08
353000 -- (-208.919) (-205.769) (-208.123) [-205.911] * (-206.801) (-207.292) (-206.099) [-205.424] -- 0:00:08
353500 -- [-205.906] (-210.038) (-205.731) (-208.414) * (-204.683) (-210.196) [-204.730] (-205.302) -- 0:00:08
354000 -- (-207.853) (-206.775) [-208.097] (-207.753) * (-212.204) (-207.835) (-207.313) [-207.761] -- 0:00:09
354500 -- (-206.100) (-205.395) (-208.330) [-204.846] * [-208.510] (-205.030) (-205.065) (-207.366) -- 0:00:09
355000 -- (-205.004) [-205.408] (-209.998) (-207.734) * (-208.997) (-205.389) [-206.333] (-213.797) -- 0:00:08
Average standard deviation of split frequencies: 0.013021
355500 -- (-208.110) (-204.993) (-208.071) [-206.231] * (-205.735) (-206.445) (-205.476) [-205.322] -- 0:00:08
356000 -- (-205.594) (-205.776) (-211.679) [-206.573] * (-206.060) (-208.182) [-207.684] (-205.123) -- 0:00:08
356500 -- (-206.265) (-205.498) (-208.613) [-204.426] * [-205.151] (-208.728) (-210.542) (-207.355) -- 0:00:08
357000 -- (-205.707) [-205.492] (-205.656) (-205.809) * (-206.942) [-204.549] (-205.591) (-207.221) -- 0:00:08
357500 -- (-207.349) (-204.217) (-207.278) [-205.780] * (-205.855) [-205.683] (-205.410) (-205.887) -- 0:00:08
358000 -- (-205.310) (-204.820) (-207.447) [-205.889] * (-208.354) (-208.290) (-205.606) [-207.307] -- 0:00:08
358500 -- (-206.540) [-206.992] (-206.848) (-207.417) * (-206.289) [-205.775] (-205.564) (-205.744) -- 0:00:08
359000 -- (-207.882) [-205.069] (-204.816) (-205.123) * [-205.486] (-205.932) (-206.042) (-204.820) -- 0:00:08
359500 -- (-206.136) (-210.766) [-205.625] (-204.643) * (-206.676) (-205.467) (-208.271) [-206.663] -- 0:00:08
360000 -- (-206.499) (-207.183) (-207.137) [-205.931] * [-206.181] (-206.768) (-204.916) (-214.075) -- 0:00:08
Average standard deviation of split frequencies: 0.013827
360500 -- (-206.050) (-204.949) (-206.511) [-205.116] * (-206.112) (-209.421) [-208.777] (-205.304) -- 0:00:08
361000 -- (-205.726) (-205.275) (-210.602) [-204.951] * (-204.547) [-207.116] (-209.369) (-206.890) -- 0:00:08
361500 -- (-209.271) (-207.930) (-209.745) [-204.639] * (-205.266) (-207.971) (-205.558) [-207.441] -- 0:00:08
362000 -- (-206.459) [-205.316] (-208.698) (-204.262) * (-206.993) [-207.808] (-206.556) (-208.117) -- 0:00:08
362500 -- (-209.152) [-206.093] (-207.241) (-205.636) * (-206.320) (-209.190) (-204.334) [-205.551] -- 0:00:08
363000 -- (-208.190) [-205.959] (-206.305) (-206.310) * (-205.336) [-209.711] (-206.659) (-206.021) -- 0:00:08
363500 -- (-208.123) (-204.504) [-207.245] (-206.231) * (-205.129) (-205.384) [-204.897] (-207.019) -- 0:00:08
364000 -- (-206.413) (-209.091) [-205.181] (-205.835) * [-205.731] (-204.663) (-208.391) (-206.982) -- 0:00:08
364500 -- [-208.955] (-206.920) (-209.567) (-206.963) * [-204.737] (-207.792) (-208.220) (-206.511) -- 0:00:08
365000 -- [-205.012] (-206.875) (-206.853) (-207.500) * [-209.664] (-206.775) (-210.024) (-206.928) -- 0:00:08
Average standard deviation of split frequencies: 0.012665
365500 -- (-206.378) (-208.339) (-206.331) [-206.805] * (-206.649) [-210.361] (-209.948) (-205.334) -- 0:00:08
366000 -- (-205.147) [-209.233] (-206.691) (-204.418) * [-205.523] (-205.835) (-206.814) (-205.040) -- 0:00:08
366500 -- (-205.445) [-207.267] (-205.498) (-207.093) * [-206.721] (-209.217) (-208.843) (-205.833) -- 0:00:08
367000 -- (-205.855) (-204.405) [-207.809] (-207.724) * (-204.902) (-207.074) [-204.269] (-205.914) -- 0:00:07
367500 -- (-205.335) (-204.168) [-212.249] (-204.908) * (-211.021) (-205.345) (-204.765) [-207.179] -- 0:00:07
368000 -- (-209.433) (-204.325) [-206.032] (-206.361) * (-206.384) (-207.006) [-206.914] (-205.629) -- 0:00:07
368500 -- (-205.845) [-205.676] (-205.776) (-205.235) * [-206.818] (-208.104) (-206.484) (-204.873) -- 0:00:07
369000 -- [-205.279] (-209.437) (-207.395) (-204.499) * (-205.062) (-205.253) [-207.557] (-207.534) -- 0:00:07
369500 -- (-206.756) [-206.479] (-210.493) (-211.153) * (-205.982) [-211.529] (-206.392) (-208.566) -- 0:00:07
370000 -- [-206.541] (-208.022) (-208.367) (-209.796) * (-205.579) (-210.553) (-207.552) [-205.913] -- 0:00:07
Average standard deviation of split frequencies: 0.014131
370500 -- (-206.333) [-208.288] (-207.278) (-206.820) * (-204.119) (-206.730) (-209.011) [-204.491] -- 0:00:07
371000 -- (-207.377) [-205.267] (-206.135) (-204.761) * (-213.958) (-206.383) [-207.037] (-205.184) -- 0:00:07
371500 -- (-210.967) (-206.132) [-210.887] (-208.098) * [-205.193] (-205.143) (-207.446) (-206.309) -- 0:00:07
372000 -- [-205.284] (-205.303) (-206.573) (-207.190) * (-207.999) (-204.399) (-208.193) [-205.063] -- 0:00:07
372500 -- (-207.124) (-205.779) [-208.694] (-207.387) * (-207.231) (-206.228) (-204.659) [-204.750] -- 0:00:07
373000 -- (-211.277) (-206.542) (-209.370) [-205.944] * (-207.630) (-204.592) (-206.881) [-205.308] -- 0:00:07
373500 -- [-205.848] (-205.828) (-207.593) (-205.455) * (-206.898) (-204.517) [-207.148] (-205.556) -- 0:00:07
374000 -- (-208.137) (-204.280) [-205.526] (-205.826) * (-205.224) [-206.728] (-207.056) (-209.843) -- 0:00:07
374500 -- (-208.686) (-204.769) (-207.754) [-207.537] * (-204.648) (-206.873) [-208.564] (-212.366) -- 0:00:07
375000 -- (-210.517) (-207.411) (-208.128) [-206.768] * (-204.774) (-206.128) [-205.174] (-210.312) -- 0:00:07
Average standard deviation of split frequencies: 0.014139
375500 -- (-208.219) (-209.963) [-209.238] (-207.454) * (-205.030) [-204.820] (-204.880) (-211.220) -- 0:00:07
376000 -- (-210.752) (-209.154) (-205.859) [-205.454] * (-208.872) [-208.616] (-205.387) (-207.453) -- 0:00:07
376500 -- (-210.303) (-205.450) (-206.375) [-205.926] * (-205.223) [-208.324] (-207.566) (-206.942) -- 0:00:07
377000 -- [-209.817] (-206.478) (-209.711) (-206.037) * (-207.013) (-210.404) [-205.307] (-204.918) -- 0:00:07
377500 -- [-205.913] (-205.077) (-206.596) (-212.163) * (-208.104) (-206.101) [-208.232] (-206.673) -- 0:00:07
378000 -- (-206.892) [-205.892] (-205.809) (-209.070) * [-206.509] (-207.622) (-208.255) (-215.021) -- 0:00:07
378500 -- (-205.665) (-204.899) (-205.545) [-206.866] * (-207.048) [-205.686] (-207.535) (-205.517) -- 0:00:07
379000 -- (-205.821) (-206.453) (-209.016) [-210.696] * (-206.848) (-207.998) (-205.368) [-211.255] -- 0:00:07
379500 -- (-204.855) (-205.123) [-207.514] (-208.508) * (-205.460) (-205.960) [-208.635] (-205.626) -- 0:00:07
380000 -- (-207.580) (-204.163) [-205.952] (-207.077) * (-205.570) (-205.622) (-205.484) [-206.893] -- 0:00:07
Average standard deviation of split frequencies: 0.014929
380500 -- (-208.572) (-206.008) (-205.365) [-208.640] * [-205.059] (-207.770) (-205.316) (-206.163) -- 0:00:07
381000 -- (-204.288) (-204.123) (-207.836) [-204.561] * (-205.638) [-206.735] (-208.780) (-206.092) -- 0:00:07
381500 -- (-204.908) (-206.598) (-206.600) [-205.152] * (-206.715) (-204.717) (-204.895) [-209.321] -- 0:00:07
382000 -- (-208.826) (-205.989) (-205.594) [-206.091] * (-207.884) (-207.306) (-205.833) [-206.410] -- 0:00:07
382500 -- (-208.236) (-208.134) [-205.348] (-205.562) * (-209.578) [-206.152] (-205.383) (-209.048) -- 0:00:07
383000 -- (-205.861) (-207.265) [-206.273] (-204.518) * (-209.761) [-206.727] (-209.640) (-204.998) -- 0:00:07
383500 -- (-212.782) (-208.163) (-206.885) [-204.819] * (-207.009) (-208.825) (-211.312) [-204.571] -- 0:00:06
384000 -- (-207.159) (-206.215) (-205.535) [-206.224] * (-209.452) [-208.222] (-211.558) (-207.244) -- 0:00:06
384500 -- (-207.131) (-204.594) [-206.839] (-206.298) * (-208.485) (-207.540) [-207.717] (-207.889) -- 0:00:06
385000 -- [-208.844] (-207.545) (-206.953) (-205.786) * (-205.483) (-205.165) [-208.317] (-207.862) -- 0:00:06
Average standard deviation of split frequencies: 0.014519
385500 -- (-207.418) (-205.905) [-206.043] (-207.763) * [-206.574] (-205.833) (-207.526) (-205.911) -- 0:00:06
386000 -- (-207.515) (-204.753) (-206.457) [-204.611] * (-206.837) (-205.980) (-207.432) [-205.249] -- 0:00:06
386500 -- (-206.592) (-207.749) [-208.064] (-204.695) * [-207.174] (-206.407) (-208.772) (-208.144) -- 0:00:06
387000 -- (-204.176) (-207.684) [-207.066] (-205.480) * (-207.656) (-206.310) (-205.449) [-207.658] -- 0:00:06
387500 -- (-204.331) (-205.337) (-210.018) [-206.107] * (-205.130) (-205.517) (-206.959) [-206.007] -- 0:00:06
388000 -- (-205.183) [-205.745] (-205.531) (-205.598) * [-205.176] (-206.188) (-205.643) (-205.919) -- 0:00:06
388500 -- (-206.017) (-206.615) (-205.966) [-207.226] * (-207.305) (-205.027) [-206.778] (-212.386) -- 0:00:06
389000 -- (-205.226) [-205.988] (-206.151) (-204.506) * (-206.143) (-206.008) [-205.223] (-208.813) -- 0:00:06
389500 -- [-204.696] (-204.854) (-205.390) (-206.300) * [-205.437] (-206.000) (-205.534) (-206.257) -- 0:00:06
390000 -- [-205.011] (-206.426) (-205.241) (-210.181) * (-206.533) [-204.890] (-204.656) (-208.608) -- 0:00:06
Average standard deviation of split frequencies: 0.014607
390500 -- [-206.001] (-208.587) (-204.868) (-204.785) * (-205.177) (-205.241) [-207.713] (-213.644) -- 0:00:06
391000 -- (-205.328) (-205.084) [-209.655] (-205.107) * (-204.364) [-206.923] (-205.555) (-209.210) -- 0:00:06
391500 -- (-206.197) (-207.208) (-206.498) [-206.969] * (-207.945) [-208.180] (-205.293) (-208.266) -- 0:00:06
392000 -- [-208.096] (-208.241) (-209.043) (-206.516) * [-207.709] (-207.375) (-210.936) (-211.657) -- 0:00:06
392500 -- (-212.661) (-204.410) [-204.748] (-205.136) * (-206.908) (-208.113) [-206.179] (-206.497) -- 0:00:06
393000 -- (-205.290) (-210.255) [-205.824] (-208.978) * (-207.044) (-210.996) [-204.354] (-207.081) -- 0:00:06
393500 -- (-208.295) [-205.292] (-204.603) (-205.378) * (-207.454) (-209.080) (-205.025) [-206.938] -- 0:00:06
394000 -- (-206.046) [-204.607] (-204.856) (-207.065) * (-204.578) (-205.639) (-208.905) [-208.494] -- 0:00:06
394500 -- (-205.697) (-206.438) [-206.537] (-210.552) * (-206.986) [-206.468] (-210.536) (-204.331) -- 0:00:06
395000 -- (-208.647) [-204.567] (-204.516) (-209.710) * (-206.775) [-205.822] (-208.408) (-205.517) -- 0:00:06
Average standard deviation of split frequencies: 0.013721
395500 -- [-207.865] (-207.580) (-204.575) (-210.384) * (-209.032) [-206.732] (-207.100) (-208.154) -- 0:00:06
396000 -- (-210.223) (-209.792) (-204.454) [-207.178] * (-204.359) (-204.341) (-206.071) [-205.767] -- 0:00:06
396500 -- [-204.339] (-207.608) (-207.447) (-211.335) * (-207.816) [-208.825] (-205.780) (-207.952) -- 0:00:06
397000 -- (-208.547) [-205.235] (-204.853) (-206.343) * (-205.988) (-205.979) [-206.279] (-205.360) -- 0:00:06
397500 -- (-209.075) [-205.840] (-206.579) (-208.765) * (-205.922) (-206.045) [-208.010] (-206.513) -- 0:00:06
398000 -- [-208.040] (-206.286) (-207.732) (-208.145) * [-204.868] (-204.685) (-204.859) (-207.348) -- 0:00:06
398500 -- (-206.646) (-204.999) [-206.936] (-215.075) * (-206.436) [-205.789] (-206.996) (-204.401) -- 0:00:06
399000 -- (-206.517) (-206.636) [-206.617] (-208.887) * (-206.917) (-205.929) [-206.720] (-206.368) -- 0:00:06
399500 -- (-206.176) (-207.424) [-206.663] (-210.209) * (-205.799) (-206.118) (-204.937) [-207.143] -- 0:00:06
400000 -- (-206.382) (-211.767) [-206.780] (-206.409) * (-207.621) (-204.800) [-205.449] (-208.346) -- 0:00:06
Average standard deviation of split frequencies: 0.013623
400500 -- (-206.607) (-212.997) (-208.253) [-207.256] * (-207.457) (-206.907) [-205.514] (-206.035) -- 0:00:05
401000 -- (-207.290) (-207.138) (-208.708) [-205.275] * (-207.259) [-205.867] (-205.193) (-207.189) -- 0:00:05
401500 -- [-206.084] (-208.069) (-209.623) (-205.616) * (-205.489) [-205.105] (-205.301) (-206.383) -- 0:00:05
402000 -- (-206.785) [-205.230] (-205.797) (-204.250) * (-206.584) (-206.291) [-206.351] (-204.891) -- 0:00:05
402500 -- [-206.209] (-206.209) (-206.389) (-206.922) * (-206.105) (-206.331) (-205.496) [-209.859] -- 0:00:05
403000 -- (-205.893) (-207.374) [-210.129] (-207.407) * (-205.005) (-205.738) (-204.828) [-205.250] -- 0:00:05
403500 -- [-206.590] (-206.496) (-205.323) (-205.466) * (-206.005) (-210.520) [-207.094] (-205.045) -- 0:00:05
404000 -- (-206.370) [-205.351] (-206.527) (-205.919) * [-212.617] (-208.666) (-204.633) (-205.341) -- 0:00:05
404500 -- (-206.292) [-205.035] (-205.678) (-207.404) * [-208.139] (-207.236) (-205.354) (-207.257) -- 0:00:05
405000 -- (-205.383) (-205.867) [-207.450] (-206.756) * [-206.220] (-213.432) (-204.394) (-204.485) -- 0:00:05
Average standard deviation of split frequencies: 0.014055
405500 -- [-207.241] (-205.124) (-205.361) (-208.020) * (-206.976) (-207.666) (-205.896) [-204.994] -- 0:00:05
406000 -- (-206.986) [-205.438] (-206.162) (-206.966) * (-207.174) (-209.108) [-207.306] (-205.893) -- 0:00:05
406500 -- (-206.637) (-209.269) (-204.792) [-207.769] * [-207.957] (-206.758) (-210.048) (-206.756) -- 0:00:05
407000 -- (-207.941) [-206.663] (-204.886) (-209.489) * [-206.765] (-206.447) (-213.480) (-205.830) -- 0:00:05
407500 -- (-206.823) [-204.293] (-204.756) (-208.410) * (-210.157) (-206.963) [-205.443] (-205.577) -- 0:00:05
408000 -- (-205.687) [-207.636] (-207.634) (-208.442) * (-207.833) (-204.288) [-207.438] (-206.304) -- 0:00:05
408500 -- (-205.495) [-209.632] (-204.311) (-205.325) * (-209.142) (-205.746) (-204.317) [-206.064] -- 0:00:05
409000 -- (-204.887) [-204.767] (-205.350) (-204.539) * (-207.636) (-205.192) (-204.822) [-205.583] -- 0:00:05
409500 -- (-205.391) [-206.757] (-207.347) (-206.108) * (-206.498) (-211.065) (-206.520) [-204.650] -- 0:00:05
410000 -- (-206.224) (-204.495) (-209.399) [-206.489] * (-209.170) (-208.507) (-208.587) [-207.322] -- 0:00:05
Average standard deviation of split frequencies: 0.013328
410500 -- (-206.219) [-212.529] (-206.554) (-208.370) * [-206.033] (-206.013) (-208.601) (-213.021) -- 0:00:05
411000 -- [-206.468] (-208.698) (-205.191) (-211.707) * (-205.003) (-205.276) [-207.574] (-205.606) -- 0:00:05
411500 -- (-208.707) [-204.526] (-207.383) (-205.097) * (-204.917) (-211.335) [-207.576] (-205.991) -- 0:00:05
412000 -- [-206.908] (-204.903) (-209.513) (-205.348) * (-207.446) (-207.564) [-207.298] (-204.526) -- 0:00:05
412500 -- (-213.650) (-206.367) (-208.544) [-206.465] * [-205.676] (-206.821) (-207.666) (-214.020) -- 0:00:05
413000 -- (-206.734) (-206.287) (-208.307) [-205.649] * (-207.706) (-205.813) [-205.381] (-206.125) -- 0:00:05
413500 -- (-209.093) (-206.860) [-205.327] (-208.247) * (-207.657) [-210.465] (-206.337) (-206.245) -- 0:00:05
414000 -- (-205.947) (-208.165) (-206.522) [-211.473] * (-206.488) (-212.672) [-206.546] (-208.529) -- 0:00:05
414500 -- (-207.804) (-206.164) (-207.253) [-207.895] * (-206.671) [-204.882] (-207.452) (-207.729) -- 0:00:05
415000 -- (-205.595) (-204.468) (-208.414) [-205.389] * [-207.198] (-204.429) (-206.236) (-207.143) -- 0:00:05
Average standard deviation of split frequencies: 0.013472
415500 -- (-208.685) (-205.432) (-205.632) [-204.426] * [-206.136] (-205.031) (-211.968) (-206.826) -- 0:00:05
416000 -- (-207.734) (-207.273) [-207.667] (-204.895) * (-206.500) (-207.258) [-205.972] (-206.156) -- 0:00:05
416500 -- (-206.455) (-205.893) [-205.694] (-206.149) * (-204.553) (-206.930) [-209.528] (-207.263) -- 0:00:05
417000 -- (-205.248) [-205.895] (-205.073) (-204.777) * (-205.221) (-208.558) (-208.814) [-206.075] -- 0:00:04
417500 -- [-204.357] (-206.237) (-207.146) (-204.283) * (-204.640) (-209.776) (-218.246) [-206.198] -- 0:00:04
418000 -- (-209.198) (-205.451) (-208.841) [-207.884] * [-209.316] (-207.843) (-218.964) (-208.897) -- 0:00:04
418500 -- (-214.086) [-204.943] (-207.458) (-205.354) * (-207.570) (-206.128) (-216.666) [-205.351] -- 0:00:04
419000 -- (-205.994) [-204.484] (-204.496) (-206.733) * [-212.295] (-206.962) (-212.965) (-207.175) -- 0:00:04
419500 -- [-205.698] (-206.121) (-205.428) (-206.203) * (-222.514) [-208.055] (-209.435) (-205.724) -- 0:00:04
420000 -- [-205.731] (-204.595) (-204.688) (-209.778) * (-205.249) [-205.016] (-204.850) (-206.591) -- 0:00:04
Average standard deviation of split frequencies: 0.013385
420500 -- (-205.773) (-205.512) (-207.849) [-206.294] * (-204.426) (-204.330) (-206.479) [-204.905] -- 0:00:04
421000 -- (-205.176) [-206.887] (-211.225) (-205.469) * (-207.327) (-209.089) [-204.892] (-208.318) -- 0:00:04
421500 -- (-205.403) (-209.545) (-205.876) [-206.631] * (-207.689) (-205.159) (-206.736) [-205.072] -- 0:00:04
422000 -- (-210.911) (-212.685) [-206.552] (-210.983) * (-205.644) (-204.922) (-205.479) [-207.911] -- 0:00:04
422500 -- [-204.856] (-207.938) (-204.673) (-205.447) * [-207.378] (-208.079) (-205.703) (-205.654) -- 0:00:04
423000 -- (-205.683) [-209.042] (-206.390) (-207.104) * (-206.370) (-207.479) (-205.365) [-205.464] -- 0:00:04
423500 -- (-207.849) (-206.913) [-204.962] (-206.842) * (-205.924) (-210.712) (-208.134) [-207.237] -- 0:00:04
424000 -- (-209.144) (-205.849) [-204.711] (-209.719) * (-210.664) [-209.157] (-206.411) (-207.236) -- 0:00:04
424500 -- (-205.886) [-205.744] (-204.838) (-212.246) * (-207.411) (-206.444) (-208.385) [-204.292] -- 0:00:04
425000 -- (-210.126) [-206.657] (-207.761) (-206.951) * (-207.517) [-205.352] (-209.527) (-205.865) -- 0:00:04
Average standard deviation of split frequencies: 0.014502
425500 -- [-211.298] (-205.777) (-204.934) (-205.820) * (-205.440) (-208.227) (-205.080) [-205.628] -- 0:00:04
426000 -- (-207.142) [-204.833] (-210.690) (-208.638) * [-207.448] (-205.400) (-209.067) (-214.186) -- 0:00:04
426500 -- (-204.712) (-205.050) (-207.981) [-207.217] * (-206.794) (-205.301) [-209.386] (-205.964) -- 0:00:04
427000 -- (-205.565) (-204.974) (-205.601) [-205.225] * (-205.330) (-205.723) [-208.067] (-211.705) -- 0:00:04
427500 -- (-205.031) (-205.703) [-208.035] (-205.558) * [-205.049] (-206.415) (-206.035) (-205.513) -- 0:00:04
428000 -- (-218.708) (-204.693) [-204.263] (-211.531) * (-205.029) (-208.545) (-209.144) [-204.796] -- 0:00:04
428500 -- (-210.790) (-206.469) [-204.416] (-205.482) * [-204.616] (-206.441) (-209.402) (-205.670) -- 0:00:04
429000 -- (-205.992) [-205.544] (-212.196) (-206.190) * [-205.074] (-205.400) (-212.523) (-206.633) -- 0:00:04
429500 -- (-205.938) [-205.272] (-212.848) (-206.031) * [-204.673] (-204.899) (-205.327) (-206.488) -- 0:00:04
430000 -- (-207.801) (-205.613) [-205.737] (-205.907) * (-205.708) (-205.334) (-205.149) [-204.291] -- 0:00:04
Average standard deviation of split frequencies: 0.014595
430500 -- (-205.665) (-206.306) (-206.250) [-207.094] * [-205.368] (-207.172) (-204.847) (-205.736) -- 0:00:04
431000 -- (-205.559) [-206.544] (-206.260) (-207.718) * [-205.167] (-204.874) (-206.045) (-207.266) -- 0:00:04
431500 -- (-204.725) (-208.027) [-205.098] (-206.160) * (-205.348) (-205.622) [-206.051] (-209.988) -- 0:00:04
432000 -- (-206.069) (-207.734) (-204.484) [-207.580] * (-206.945) [-207.405] (-205.901) (-206.574) -- 0:00:04
432500 -- [-205.379] (-205.022) (-205.355) (-208.945) * (-208.919) (-206.205) (-215.600) [-205.765] -- 0:00:04
433000 -- [-204.841] (-206.092) (-208.197) (-205.808) * (-206.177) [-204.767] (-204.757) (-207.020) -- 0:00:04
433500 -- (-205.883) (-204.462) (-206.776) [-205.728] * (-206.948) [-205.415] (-211.614) (-205.872) -- 0:00:03
434000 -- (-206.653) (-209.919) [-207.016] (-206.316) * [-206.025] (-208.085) (-209.191) (-206.297) -- 0:00:03
434500 -- (-204.817) (-206.167) [-207.532] (-205.101) * [-208.138] (-206.379) (-206.902) (-206.087) -- 0:00:03
435000 -- (-207.003) [-205.486] (-208.178) (-206.604) * (-208.406) [-207.733] (-207.126) (-206.554) -- 0:00:03
Average standard deviation of split frequencies: 0.014296
435500 -- [-204.992] (-208.146) (-213.656) (-205.306) * (-207.570) (-204.975) (-207.508) [-205.074] -- 0:00:03
436000 -- [-206.725] (-205.966) (-207.844) (-206.383) * [-208.029] (-205.320) (-206.799) (-204.686) -- 0:00:03
436500 -- [-206.854] (-205.305) (-206.121) (-212.179) * (-207.648) (-206.720) (-205.972) [-206.573] -- 0:00:03
437000 -- (-205.214) [-208.418] (-207.387) (-204.245) * (-207.502) (-205.533) [-206.245] (-206.157) -- 0:00:03
437500 -- (-206.480) (-204.834) [-206.915] (-204.378) * [-205.963] (-205.218) (-210.560) (-208.121) -- 0:00:03
438000 -- (-204.920) [-208.325] (-208.526) (-204.585) * (-204.234) (-207.379) (-204.977) [-207.245] -- 0:00:03
438500 -- [-204.140] (-206.520) (-206.264) (-206.434) * [-209.045] (-207.497) (-205.930) (-207.663) -- 0:00:03
439000 -- (-208.080) [-204.692] (-208.685) (-207.560) * [-207.207] (-208.664) (-206.345) (-207.246) -- 0:00:03
439500 -- (-207.196) (-204.851) (-205.688) [-205.428] * (-208.009) (-209.586) [-207.096] (-205.836) -- 0:00:03
440000 -- (-208.977) [-206.572] (-205.025) (-204.722) * [-205.237] (-208.433) (-208.151) (-207.506) -- 0:00:03
Average standard deviation of split frequencies: 0.014263
440500 -- (-208.085) [-206.404] (-206.532) (-205.865) * (-204.921) (-204.314) (-206.344) [-207.347] -- 0:00:03
441000 -- (-205.954) [-204.572] (-205.008) (-208.040) * [-206.620] (-205.517) (-205.857) (-211.690) -- 0:00:03
441500 -- (-205.062) [-207.748] (-205.814) (-208.277) * (-207.393) (-204.515) [-205.621] (-211.392) -- 0:00:03
442000 -- (-208.836) (-204.188) (-206.776) [-207.230] * (-212.368) (-204.549) (-207.746) [-207.549] -- 0:00:03
442500 -- (-208.751) (-205.719) (-207.203) [-204.957] * (-212.400) [-205.309] (-206.954) (-206.869) -- 0:00:03
443000 -- (-208.860) (-207.325) (-207.251) [-205.342] * (-208.345) [-205.537] (-208.892) (-205.273) -- 0:00:03
443500 -- (-205.945) (-206.769) [-206.808] (-206.546) * (-208.606) (-205.793) (-207.511) [-204.116] -- 0:00:03
444000 -- (-205.461) [-209.222] (-205.766) (-206.353) * [-206.030] (-206.307) (-207.467) (-209.611) -- 0:00:03
444500 -- (-207.559) (-207.370) [-205.803] (-208.390) * (-211.212) (-208.175) (-204.540) [-205.359] -- 0:00:03
445000 -- (-206.959) [-207.158] (-205.948) (-207.860) * [-209.847] (-207.643) (-210.157) (-205.899) -- 0:00:03
Average standard deviation of split frequencies: 0.014152
445500 -- (-207.517) [-208.066] (-209.089) (-204.665) * (-209.866) (-208.269) (-204.833) [-206.052] -- 0:00:03
446000 -- (-207.868) (-205.573) (-207.842) [-208.394] * (-205.793) [-205.090] (-207.902) (-204.895) -- 0:00:03
446500 -- (-211.067) (-206.254) (-209.736) [-206.416] * (-205.761) (-205.408) [-208.008] (-206.442) -- 0:00:03
447000 -- [-204.904] (-205.892) (-205.707) (-211.236) * (-207.491) [-205.337] (-205.255) (-209.867) -- 0:00:03
447500 -- (-204.717) [-205.496] (-207.023) (-206.150) * [-207.269] (-207.653) (-207.587) (-205.652) -- 0:00:03
448000 -- (-206.006) (-206.705) (-211.742) [-205.748] * (-205.941) (-205.246) (-212.845) [-206.993] -- 0:00:03
448500 -- [-207.466] (-208.216) (-205.889) (-206.204) * (-205.651) (-204.921) [-209.619] (-208.907) -- 0:00:03
449000 -- (-204.594) [-205.479] (-208.281) (-205.939) * [-207.248] (-206.988) (-207.765) (-206.046) -- 0:00:03
449500 -- [-206.135] (-206.624) (-204.646) (-204.963) * [-209.025] (-206.132) (-208.327) (-207.958) -- 0:00:03
450000 -- [-207.156] (-208.119) (-204.503) (-206.421) * (-206.627) [-205.660] (-205.559) (-206.563) -- 0:00:03
Average standard deviation of split frequencies: 0.014237
450500 -- (-211.619) (-206.378) (-205.541) [-205.487] * (-205.460) (-208.386) [-205.486] (-207.454) -- 0:00:02
451000 -- [-205.963] (-208.364) (-205.956) (-208.542) * (-206.011) [-205.816] (-209.970) (-205.249) -- 0:00:02
451500 -- (-207.538) (-206.406) [-208.603] (-210.557) * (-204.719) (-213.013) [-205.812] (-211.183) -- 0:00:02
452000 -- (-206.001) [-205.603] (-205.993) (-208.848) * (-204.607) (-209.971) [-206.211] (-205.221) -- 0:00:02
452500 -- (-204.853) (-207.149) [-208.098] (-207.365) * [-206.410] (-210.678) (-206.161) (-207.130) -- 0:00:02
453000 -- (-205.895) (-206.048) [-208.809] (-207.337) * (-208.742) (-205.312) [-205.974] (-205.893) -- 0:00:02
453500 -- [-206.069] (-206.673) (-205.695) (-208.264) * (-205.832) [-205.425] (-209.080) (-209.695) -- 0:00:02
454000 -- [-205.165] (-205.680) (-205.163) (-206.889) * (-206.582) [-204.278] (-208.985) (-207.023) -- 0:00:02
454500 -- [-204.178] (-206.629) (-204.604) (-205.506) * (-204.555) (-207.029) (-206.014) [-206.769] -- 0:00:02
455000 -- (-207.482) [-208.158] (-205.357) (-208.131) * (-206.774) (-205.405) [-206.353] (-204.326) -- 0:00:02
Average standard deviation of split frequencies: 0.014186
455500 -- (-207.970) (-207.069) [-204.735] (-214.210) * [-206.074] (-207.811) (-208.027) (-205.400) -- 0:00:02
456000 -- [-209.493] (-206.816) (-204.753) (-206.130) * [-204.471] (-206.266) (-205.687) (-206.718) -- 0:00:02
456500 -- (-205.547) (-206.178) (-205.822) [-206.439] * (-206.855) (-207.141) (-209.431) [-204.580] -- 0:00:02
457000 -- (-204.684) [-208.957] (-217.769) (-206.760) * (-204.715) [-206.026] (-207.734) (-204.496) -- 0:00:02
457500 -- (-205.984) (-206.944) [-204.907] (-204.620) * (-206.005) [-207.431] (-204.728) (-204.686) -- 0:00:02
458000 -- (-204.741) (-205.540) [-214.093] (-207.427) * (-205.950) [-207.237] (-205.537) (-206.182) -- 0:00:02
458500 -- (-206.151) [-205.851] (-206.548) (-206.677) * [-205.370] (-206.150) (-205.883) (-205.783) -- 0:00:02
459000 -- (-206.353) (-205.528) [-206.644] (-208.476) * (-204.428) (-205.381) (-205.147) [-205.563] -- 0:00:02
459500 -- [-206.044] (-206.430) (-208.273) (-205.356) * [-205.964] (-206.591) (-204.554) (-206.744) -- 0:00:02
460000 -- (-206.505) (-207.060) (-204.504) [-206.845] * (-212.575) (-205.950) (-204.975) [-205.573] -- 0:00:02
Average standard deviation of split frequencies: 0.013872
460500 -- (-205.578) (-206.239) (-206.964) [-208.708] * (-205.357) (-209.629) [-205.802] (-205.520) -- 0:00:02
461000 -- [-204.697] (-211.212) (-206.569) (-206.581) * (-206.439) (-205.582) (-208.932) [-207.442] -- 0:00:02
461500 -- [-210.231] (-205.402) (-208.924) (-207.258) * (-204.875) [-207.012] (-209.052) (-207.393) -- 0:00:02
462000 -- (-206.661) (-205.458) (-205.981) [-206.450] * (-204.999) (-205.635) [-204.717] (-206.558) -- 0:00:02
462500 -- (-205.358) (-204.539) (-207.698) [-205.355] * (-207.949) [-205.286] (-206.019) (-206.689) -- 0:00:02
463000 -- (-205.813) [-205.769] (-207.041) (-206.892) * (-206.208) [-206.646] (-205.778) (-206.192) -- 0:00:02
463500 -- (-205.395) (-204.397) [-205.394] (-207.337) * (-209.681) [-208.480] (-204.872) (-206.187) -- 0:00:02
464000 -- (-207.205) (-205.031) [-205.507] (-208.072) * (-212.322) (-205.902) [-204.405] (-206.613) -- 0:00:02
464500 -- (-210.008) [-205.167] (-208.042) (-207.529) * (-207.552) (-207.695) [-204.566] (-205.564) -- 0:00:02
465000 -- [-205.368] (-204.779) (-206.843) (-209.743) * [-206.889] (-206.685) (-206.425) (-207.555) -- 0:00:02
Average standard deviation of split frequencies: 0.013523
465500 -- (-204.602) (-204.238) (-207.394) [-204.945] * [-207.359] (-204.794) (-205.016) (-208.194) -- 0:00:02
466000 -- (-207.184) (-206.170) (-206.936) [-209.152] * (-205.517) (-205.886) (-207.136) [-206.361] -- 0:00:02
466500 -- (-207.996) (-209.738) (-206.969) [-205.127] * (-205.260) (-210.538) [-205.232] (-210.110) -- 0:00:02
467000 -- (-205.779) [-210.539] (-205.354) (-204.541) * (-207.773) [-207.077] (-208.411) (-207.192) -- 0:00:01
467500 -- [-210.272] (-208.781) (-206.002) (-211.679) * (-204.944) (-206.634) (-212.120) [-206.780] -- 0:00:01
468000 -- (-204.672) (-206.556) [-206.345] (-205.550) * (-205.329) [-205.563] (-207.710) (-207.170) -- 0:00:01
468500 -- (-205.611) [-205.250] (-204.804) (-204.783) * (-209.872) (-205.498) (-205.816) [-205.814] -- 0:00:01
469000 -- (-206.548) (-204.230) (-205.234) [-204.380] * [-207.371] (-209.816) (-204.484) (-206.968) -- 0:00:01
469500 -- (-208.742) (-207.648) [-204.806] (-205.693) * (-208.942) (-207.542) [-206.902] (-204.540) -- 0:00:01
470000 -- [-207.308] (-207.737) (-206.543) (-206.010) * (-208.336) [-204.941] (-206.540) (-207.676) -- 0:00:01
Average standard deviation of split frequencies: 0.013744
470500 -- (-206.000) (-206.020) (-205.524) [-205.926] * (-209.240) [-205.144] (-204.952) (-206.737) -- 0:00:01
471000 -- (-205.510) [-206.179] (-207.757) (-205.413) * (-206.698) [-208.778] (-205.631) (-208.928) -- 0:00:01
471500 -- (-205.577) (-206.735) [-204.812] (-207.324) * [-208.805] (-213.059) (-205.269) (-208.297) -- 0:00:01
472000 -- (-205.688) (-207.621) [-206.233] (-206.365) * (-204.469) (-210.695) (-206.848) [-204.912] -- 0:00:01
472500 -- (-204.670) (-205.333) [-207.570] (-207.792) * (-206.792) [-205.933] (-211.349) (-206.996) -- 0:00:01
473000 -- (-206.626) (-206.116) [-207.597] (-205.435) * (-205.517) (-207.864) [-209.725] (-207.135) -- 0:00:01
473500 -- (-212.035) [-205.170] (-204.959) (-205.591) * (-206.543) (-208.504) [-205.368] (-207.093) -- 0:00:01
474000 -- (-205.905) (-207.358) [-205.351] (-210.398) * (-205.792) [-208.579] (-208.842) (-206.823) -- 0:00:01
474500 -- (-204.778) [-206.433] (-205.598) (-206.985) * (-207.303) (-205.583) [-205.032] (-208.123) -- 0:00:01
475000 -- [-209.649] (-204.930) (-209.415) (-205.862) * (-207.654) (-206.161) [-204.671] (-206.550) -- 0:00:01
Average standard deviation of split frequencies: 0.013920
475500 -- (-205.127) (-206.914) (-209.681) [-207.137] * [-205.175] (-205.827) (-205.146) (-204.967) -- 0:00:01
476000 -- (-210.396) (-206.429) (-205.742) [-206.363] * (-205.031) (-205.197) (-206.561) [-206.044] -- 0:00:01
476500 -- [-206.268] (-205.895) (-209.197) (-208.595) * (-206.496) [-207.114] (-205.621) (-204.801) -- 0:00:01
477000 -- (-207.821) (-208.877) [-209.919] (-204.980) * (-208.020) [-207.120] (-206.777) (-208.684) -- 0:00:01
477500 -- [-204.941] (-209.481) (-209.211) (-208.680) * (-206.636) (-205.796) (-205.856) [-208.932] -- 0:00:01
478000 -- (-204.576) (-208.775) (-215.482) [-204.664] * [-205.580] (-206.536) (-207.526) (-207.051) -- 0:00:01
478500 -- (-204.820) [-206.917] (-212.262) (-205.527) * [-208.720] (-206.273) (-207.463) (-204.586) -- 0:00:01
479000 -- (-205.712) (-206.845) [-208.214] (-205.024) * (-206.714) (-206.385) [-206.489] (-205.822) -- 0:00:01
479500 -- (-205.723) (-207.287) (-208.013) [-204.812] * (-204.224) (-209.293) [-205.216] (-208.291) -- 0:00:01
480000 -- (-206.729) (-205.822) (-208.551) [-204.778] * [-205.371] (-204.447) (-205.583) (-205.518) -- 0:00:01
Average standard deviation of split frequencies: 0.014350
480500 -- (-204.913) (-206.048) [-207.622] (-208.866) * (-207.554) [-206.339] (-205.762) (-212.333) -- 0:00:01
481000 -- (-206.343) [-207.636] (-208.286) (-208.110) * [-205.103] (-206.860) (-205.501) (-209.534) -- 0:00:01
481500 -- (-206.489) (-206.730) (-207.626) [-206.685] * [-207.004] (-206.552) (-207.711) (-207.867) -- 0:00:01
482000 -- (-204.217) [-205.053] (-206.499) (-205.730) * [-205.510] (-205.949) (-209.131) (-204.620) -- 0:00:01
482500 -- (-205.695) [-206.118] (-206.026) (-206.040) * [-205.605] (-204.903) (-207.661) (-204.353) -- 0:00:01
483000 -- (-205.702) [-206.064] (-210.617) (-208.111) * [-205.266] (-208.500) (-206.550) (-208.447) -- 0:00:01
483500 -- (-205.536) [-208.731] (-218.481) (-207.860) * (-206.357) (-209.653) (-205.841) [-206.701] -- 0:00:00
484000 -- (-207.740) (-207.156) (-205.140) [-204.403] * (-204.743) [-204.280] (-209.680) (-210.462) -- 0:00:00
484500 -- (-207.788) [-207.099] (-206.742) (-207.078) * (-207.377) [-206.399] (-208.472) (-206.466) -- 0:00:00
485000 -- [-206.367] (-205.272) (-205.458) (-206.817) * (-206.623) (-204.494) [-206.609] (-206.814) -- 0:00:00
Average standard deviation of split frequencies: 0.014090
485500 -- [-206.442] (-205.190) (-205.070) (-208.223) * [-207.845] (-206.000) (-208.253) (-205.697) -- 0:00:00
486000 -- [-205.008] (-205.898) (-208.543) (-206.481) * (-204.324) (-208.557) [-206.468] (-204.859) -- 0:00:00
486500 -- (-208.751) (-204.994) [-205.463] (-205.823) * [-204.997] (-210.253) (-204.961) (-204.958) -- 0:00:00
487000 -- (-205.439) [-206.397] (-212.371) (-206.021) * (-205.612) (-208.052) (-204.849) [-208.589] -- 0:00:00
487500 -- (-208.701) (-205.521) (-209.204) [-204.912] * (-206.397) (-207.009) (-204.423) [-205.398] -- 0:00:00
488000 -- (-206.287) [-207.540] (-205.524) (-207.030) * (-214.403) (-206.350) [-204.422] (-206.620) -- 0:00:00
488500 -- (-206.817) (-206.729) (-205.700) [-205.623] * (-207.659) (-205.274) (-205.548) [-206.967] -- 0:00:00
489000 -- (-204.966) (-212.213) (-205.321) [-206.122] * (-210.332) (-205.750) [-208.116] (-205.564) -- 0:00:00
489500 -- (-205.018) (-208.416) [-204.755] (-206.902) * (-206.860) (-207.638) (-210.297) [-204.849] -- 0:00:00
490000 -- [-207.987] (-209.020) (-208.664) (-207.725) * [-206.454] (-207.263) (-210.366) (-205.931) -- 0:00:00
Average standard deviation of split frequencies: 0.013956
490500 -- (-209.349) (-205.442) [-205.873] (-205.706) * (-205.244) (-204.679) (-209.515) [-207.898] -- 0:00:00
491000 -- (-204.943) [-208.994] (-206.578) (-205.724) * (-207.968) (-207.096) (-206.635) [-213.962] -- 0:00:00
491500 -- (-204.409) (-208.686) (-208.119) [-206.829] * (-204.937) (-204.860) (-206.547) [-204.186] -- 0:00:00
492000 -- (-207.358) [-204.348] (-206.827) (-205.516) * (-205.867) [-206.412] (-205.954) (-204.350) -- 0:00:00
492500 -- [-206.049] (-208.745) (-204.713) (-208.266) * (-206.549) (-210.485) [-206.179] (-205.942) -- 0:00:00
493000 -- (-205.173) [-204.931] (-211.979) (-209.667) * (-205.522) [-208.881] (-206.475) (-206.989) -- 0:00:00
493500 -- (-210.048) [-205.787] (-204.855) (-204.891) * (-206.111) (-206.411) [-204.983] (-208.228) -- 0:00:00
494000 -- (-209.614) [-206.051] (-207.223) (-207.183) * (-206.529) (-206.581) [-207.540] (-216.431) -- 0:00:00
494500 -- (-206.409) (-207.150) [-206.553] (-205.663) * [-208.882] (-208.507) (-213.984) (-211.254) -- 0:00:00
495000 -- (-207.407) (-206.645) (-209.984) [-204.584] * (-208.405) [-208.182] (-214.228) (-206.426) -- 0:00:00
Average standard deviation of split frequencies: 0.013306
495500 -- (-207.746) [-205.225] (-207.155) (-206.968) * (-205.777) (-204.953) (-205.036) [-205.692] -- 0:00:00
496000 -- [-206.769] (-205.062) (-204.530) (-211.027) * (-204.526) [-205.733] (-205.866) (-204.527) -- 0:00:00
496500 -- [-205.509] (-207.159) (-209.751) (-207.297) * (-205.068) [-208.431] (-212.431) (-206.080) -- 0:00:00
497000 -- (-206.167) (-204.535) (-206.376) [-204.670] * (-205.308) [-208.317] (-206.993) (-205.369) -- 0:00:00
497500 -- (-207.183) [-204.737] (-206.366) (-205.478) * (-207.477) (-207.422) (-208.776) [-205.589] -- 0:00:00
498000 -- (-206.317) [-205.533] (-209.148) (-204.229) * (-207.674) (-209.452) (-206.410) [-206.104] -- 0:00:00
498500 -- (-206.881) [-206.023] (-209.194) (-208.513) * (-208.089) [-207.147] (-207.418) (-206.590) -- 0:00:00
499000 -- [-204.060] (-206.581) (-204.697) (-209.313) * (-208.375) [-205.820] (-208.789) (-209.049) -- 0:00:00
499500 -- (-205.946) (-205.059) [-205.164] (-210.623) * (-204.822) (-204.866) (-205.986) [-207.803] -- 0:00:00
500000 -- (-206.508) [-206.603] (-204.873) (-205.861) * (-207.873) (-209.243) [-205.720] (-210.344) -- 0:00:00
Average standard deviation of split frequencies: 0.013286
Analysis completed in 30 seconds
Analysis used 29.29 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -204.00
Likelihood of best state for "cold" chain of run 2 was -204.00
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
76.9 % ( 75 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
56.4 % ( 47 %) Dirichlet(Pi{all})
57.4 % ( 39 %) Slider(Pi{all})
87.8 % ( 89 %) Multiplier(Alpha{1,2})
88.0 % ( 85 %) Multiplier(Alpha{3})
31.9 % ( 24 %) Slider(Pinvar{all})
98.6 % ( 98 %) ExtSPR(Tau{all},V{all})
70.5 % ( 67 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.4 % ( 91 %) ParsSPR(Tau{all},V{all})
30.6 % ( 28 %) Multiplier(V{all})
97.4 % ( 99 %) Nodeslider(V{all})
35.7 % ( 25 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
78.8 % ( 87 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
56.1 % ( 43 %) Dirichlet(Pi{all})
55.0 % ( 42 %) Slider(Pi{all})
88.2 % ( 80 %) Multiplier(Alpha{1,2})
88.1 % ( 77 %) Multiplier(Alpha{3})
31.2 % ( 30 %) Slider(Pinvar{all})
98.6 % ( 99 %) ExtSPR(Tau{all},V{all})
70.4 % ( 63 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.7 % ( 92 %) ParsSPR(Tau{all},V{all})
30.8 % ( 24 %) Multiplier(V{all})
97.4 % ( 98 %) Nodeslider(V{all})
35.1 % ( 29 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
------------------------------
1 | 0.81 0.64 0.50
2 | 83046 0.82 0.67
3 | 83236 83459 0.83
4 | 83741 83256 83262
Chain swap information for run 2:
1 2 3 4
------------------------------
1 | 0.81 0.64 0.50
2 | 83366 0.82 0.66
3 | 83299 83100 0.83
4 | 83628 83484 83123
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 1250
Summarizing parameters in files /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p and /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p
Writing summary statistics to file /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -205.42
| 1 1 1|
| 1 1 22 |
| 2 2 2 2 |
| 12 2 1 1 12 1 1 |
|2 1 1 2 2 1 1 22 11 |
| * 2 22 2 2 2 11 1* 11 22 |
| 1 2 1 2 1 2 22 2 2 2 112 2 1 1 22 1 |
| 1 1 2 2 11 2 2 |
| 1 2 1* 21 2 22 11 21 2 |
|1 1 1 1 2 1 2 2|
| 1 22 1 2 22 1 2 |
| 2 2 2 1 1 1 1 |
| 1 |
| 1 |
| 1 1 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -207.79
^ ^
125000 500000
Estimated marginal likelihoods for runs sampled in files
"/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -205.72 -208.93
2 -205.68 -208.69
--------------------------------------
TOTAL -205.70 -208.82
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 1502 samples from 2 runs.
Each run produced 1001 samples of which 751 samples were included.
Parameter summaries saved to file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.898244 0.084791 0.368905 1.473544 0.867733 530.27 640.64 0.999
r(A<->C){all} 0.176181 0.020355 0.000015 0.463495 0.140205 41.97 57.84 1.005
r(A<->G){all} 0.161328 0.020200 0.000593 0.455962 0.118005 70.57 120.31 1.024
r(A<->T){all} 0.160046 0.018649 0.000001 0.431529 0.124859 36.83 64.20 1.024
r(C<->G){all} 0.163439 0.022977 0.000154 0.502524 0.115052 36.94 75.78 0.999
r(C<->T){all} 0.162712 0.023799 0.000060 0.467921 0.114093 71.40 73.95 1.015
r(G<->T){all} 0.176294 0.020246 0.000166 0.444488 0.142586 26.11 85.37 1.033
pi(A){all} 0.098876 0.000537 0.054262 0.144941 0.097549 516.55 581.34 0.999
pi(C){all} 0.263359 0.001194 0.200306 0.336570 0.261727 601.72 644.18 1.000
pi(G){all} 0.397510 0.001445 0.324705 0.472775 0.397309 592.17 629.79 1.000
pi(T){all} 0.240255 0.001080 0.178129 0.302461 0.239035 619.20 668.86 0.999
alpha{1,2} 0.417149 0.217515 0.000193 1.364426 0.266907 259.39 332.91 1.000
alpha{3} 0.427993 0.208053 0.000717 1.304015 0.269087 491.81 505.95 1.001
pinvar{all} 0.988918 0.000185 0.964346 0.999985 0.993318 452.24 464.94 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 1250
Summarizing trees in files "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" with 1001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 2002 trees in 2 files (sampling 1502 of them)
(Each file contained 1001 trees of which 751 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a paramiter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
5 -- C5
6 -- C6
Key to taxon bipartitions (saved to file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.parts"):
ID -- Partition
------------
1 -- .*****
2 -- .*....
3 -- ..*...
4 -- ...*..
5 -- ....*.
6 -- .....*
7 -- .*..*.
8 -- .*.***
9 -- ...*.*
10 -- ..****
11 -- .**...
12 -- .****.
13 -- ...**.
14 -- ..*..*
15 -- .**.**
16 -- .*.*..
17 -- ..*.*.
18 -- .***.*
19 -- .*...*
20 -- ....**
21 -- ..**..
22 -- .*.**.
23 -- ..*.**
24 -- .**.*.
------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
7 248 0.165113 0.013182 0.155792 0.174434 2
8 224 0.149134 0.011299 0.141145 0.157124 2
9 222 0.147803 0.018831 0.134487 0.161119 2
10 222 0.147803 0.028247 0.127830 0.167776 2
11 221 0.147137 0.010357 0.139814 0.154461 2
12 219 0.145806 0.000942 0.145140 0.146471 2
13 218 0.145140 0.005649 0.141145 0.149134 2
14 213 0.141811 0.016006 0.130493 0.153129 2
15 213 0.141811 0.025422 0.123835 0.159787 2
16 212 0.141145 0.024480 0.123835 0.158455 2
17 210 0.139814 0.003766 0.137150 0.142477 2
18 206 0.137150 0.020714 0.122503 0.151798 2
19 201 0.133822 0.000942 0.133156 0.134487 2
20 200 0.133156 0.001883 0.131824 0.134487 2
21 191 0.127164 0.002825 0.125166 0.129161 2
22 153 0.101864 0.017890 0.089214 0.114514 2
23 142 0.094541 0.013182 0.085220 0.103862 2
24 131 0.087217 0.023539 0.070573 0.103862 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.097487 0.008830 0.000038 0.281511 0.068992 1.000 2
length{all}[2] 0.097075 0.008632 0.000010 0.288450 0.070745 1.000 2
length{all}[3] 0.099911 0.009162 0.000006 0.285262 0.071839 0.999 2
length{all}[4] 0.098466 0.010360 0.000030 0.299903 0.065574 1.000 2
length{all}[5] 0.102758 0.010457 0.000119 0.307411 0.070002 1.000 2
length{all}[6] 0.099528 0.009673 0.000229 0.303229 0.069966 0.999 2
length{all}[7] 0.102076 0.009249 0.000083 0.285048 0.074403 0.999 2
length{all}[8] 0.095529 0.007866 0.000055 0.263281 0.074003 0.998 2
length{all}[9] 0.094723 0.007443 0.001564 0.264275 0.075449 0.998 2
length{all}[10] 0.107157 0.009982 0.000045 0.315454 0.079058 0.996 2
length{all}[11] 0.099146 0.010898 0.000169 0.291814 0.068178 1.005 2
length{all}[12] 0.098396 0.009492 0.000709 0.279481 0.070032 0.996 2
length{all}[13] 0.101923 0.009195 0.000342 0.279694 0.077363 0.996 2
length{all}[14] 0.100711 0.010679 0.000502 0.277071 0.069685 1.001 2
length{all}[15] 0.096112 0.008026 0.000451 0.274823 0.070122 0.998 2
length{all}[16] 0.105295 0.009360 0.000210 0.298411 0.076395 0.995 2
length{all}[17] 0.100248 0.009594 0.000287 0.289271 0.074538 0.996 2
length{all}[18] 0.097387 0.009182 0.000805 0.292715 0.067262 1.002 2
length{all}[19] 0.092579 0.008765 0.000178 0.252732 0.065337 0.997 2
length{all}[20] 0.108704 0.013942 0.000546 0.380400 0.069718 0.995 2
length{all}[21] 0.103714 0.010158 0.001054 0.307980 0.077298 0.996 2
length{all}[22] 0.104174 0.009495 0.001094 0.291386 0.083281 0.994 2
length{all}[23] 0.099150 0.010467 0.000109 0.336073 0.068294 0.997 2
length{all}[24] 0.104589 0.010534 0.000593 0.299487 0.069320 0.995 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.013286
Maximum standard deviation of split frequencies = 0.028247
Average PSRF for parameter values ( excluding NA and >10.0 ) = 0.998
Maximum PSRF for parameter values = 1.005
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|------------------------------------------------------------------------ C5 (5)
|
\------------------------------------------------------------------------ C6 (6)
Phylogram (based on average branch lengths):
/--------------------------------------------------------------------- C1 (1)
|
|----------------------------------------------------------------------- C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
|------------------------------------------------------------------ C4 (4)
|
|---------------------------------------------------------------------- C5 (5)
|
\---------------------------------------------------------------------- C6 (6)
|---------| 0.010 expected changes per site
Calculating tree probabilities...
Credible sets of trees (105 trees sampled):
50 % credible set contains 43 trees
90 % credible set contains 89 trees
95 % credible set contains 96 trees
99 % credible set contains 103 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
MrBayes output code: 0
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 0 1 2 3 7 8
seq file is not paml/phylip format. Trying nexus format.ns = 6 ls = 159
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Sequences read..
Counting site patterns.. 0:00
Compressing, 27 patterns at 53 / 53 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 27 patterns at 53 / 53 sites (100.0%), 0:00
Counting codons..
120 bytes for distance
26352 bytes for conP
2376 bytes for fhK
5000000 bytes for space
Model 0: one-ratio
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.077271 0.071203 0.057566 0.044931 0.093429 0.092113 0.300000 1.300000
ntime & nrate & np: 6 2 8
Bounds (np=8):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000100
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 999.000000
np = 8
lnL0 = -204.494991
Iterating by ming2
Initial: fx= 204.494991
x= 0.07727 0.07120 0.05757 0.04493 0.09343 0.09211 0.30000 1.30000
1 h-m-p 0.0000 0.0009 123.3349 ++++ 190.947465 m 0.0009 15 | 1/8
2 h-m-p 0.0005 0.0025 46.4507 ++ 187.802324 m 0.0025 26 | 2/8
3 h-m-p 0.0003 0.0013 16.4884 ++ 185.831131 m 0.0013 37 | 3/8
4 h-m-p 0.0003 0.0013 62.7277 ++ 182.876483 m 0.0013 48 | 4/8
5 h-m-p 0.0000 0.0000 72629.2679 ++ 182.833938 m 0.0000 59 | 5/8
6 h-m-p 0.0001 0.0017 25.9005 +++ 182.263719 m 0.0017 71 | 6/8
7 h-m-p 1.6000 8.0000 0.0001 -------C 182.263719 0 0.0000 89
Out..
lnL = -182.263719
90 lfun, 90 eigenQcodon, 540 P(t)
Time used: 0:00
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.089118 0.036770 0.021251 0.022426 0.034539 0.020496 0.151127 0.607263 0.317341
ntime & nrate & np: 6 2 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 7.197426
np = 9
lnL0 = -193.662763
Iterating by ming2
Initial: fx= 193.662763
x= 0.08912 0.03677 0.02125 0.02243 0.03454 0.02050 0.15113 0.60726 0.31734
1 h-m-p 0.0000 0.0004 122.4283 +++ 187.501553 m 0.0004 15 | 1/9
2 h-m-p 0.0005 0.0024 18.9378 ++ 187.252762 m 0.0024 27 | 2/9
3 h-m-p 0.0000 0.0001 148.9339 ++ 187.180763 m 0.0001 39 | 3/9
4 h-m-p 0.0001 0.0009 80.1317 ++ 185.870212 m 0.0009 51 | 4/9
5 h-m-p 0.0000 0.0002 181.0506 ++ 185.673356 m 0.0002 63 | 5/9
6 h-m-p 0.0013 0.0110 29.4938 ++ 185.141163 m 0.0110 75 | 6/9
7 h-m-p 0.0009 0.0043 6.4247 ++ 185.000630 m 0.0043 87 | 7/9
8 h-m-p 0.0013 0.0527 8.9409 -----------.. | 7/9
9 h-m-p 0.0000 0.0011 49.4410 ++++ 182.263736 m 0.0011 122 | 8/9
10 h-m-p 1.6000 8.0000 0.0000 ++ 182.263736 m 8.0000 134 | 7/9
11 h-m-p 0.0160 8.0000 0.0008 +++++ 182.263735 m 8.0000 150 | 7/9
12 h-m-p 0.0136 1.1776 0.4545 ++++ 182.263716 m 1.1776 166 | 8/9
13 h-m-p 1.6000 8.0000 0.0000 Y 182.263716 0 1.6000 180 | 8/9
14 h-m-p 0.0012 0.5752 1.6062 +++++ 182.263716 m 0.5752 196 | 9/9
15 h-m-p 0.0160 8.0000 0.0000 Y 182.263716 0 0.0160 208 | 9/9
16 h-m-p 0.0160 8.0000 0.0000 Y 182.263716 0 0.0160 220
Out..
lnL = -182.263716
221 lfun, 663 eigenQcodon, 2652 P(t)
Time used: 0:01
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.016004 0.034262 0.038685 0.085577 0.057393 0.011544 0.000100 1.404827 0.511502 0.112269 1.445922
ntime & nrate & np: 6 3 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 8.139519
np = 11
lnL0 = -194.284588
Iterating by ming2
Initial: fx= 194.284588
x= 0.01600 0.03426 0.03869 0.08558 0.05739 0.01154 0.00011 1.40483 0.51150 0.11227 1.44592
1 h-m-p 0.0000 0.0000 116.4655 ++ 194.122670 m 0.0000 16 | 1/11
2 h-m-p 0.0001 0.0044 26.7153 ++++ 191.698150 m 0.0044 32 | 2/11
3 h-m-p 0.0000 0.0001 60.6690 ++ 191.283203 m 0.0001 46 | 3/11
4 h-m-p 0.0005 0.0111 11.7586 +++ 188.231828 m 0.0111 61 | 4/11
5 h-m-p 0.0005 0.0027 82.2169 ++ 184.155501 m 0.0027 75 | 5/11
6 h-m-p 0.0004 0.0022 109.2933 ++ 183.289643 m 0.0022 89 | 6/11
7 h-m-p 0.0006 0.0030 25.1431 -----------.. | 6/11
8 h-m-p 0.0000 0.0002 72.0783 +++ 182.390403 m 0.0002 127 | 7/11
9 h-m-p 0.0160 8.0000 1.0816 -------------.. | 7/11
10 h-m-p 0.0000 0.0000 51.6200 ++ 182.263731 m 0.0000 166 | 8/11
11 h-m-p 0.1138 8.0000 0.0000 ++++ 182.263731 m 8.0000 182 | 7/11
12 h-m-p 0.0160 8.0000 0.0032 +++++ 182.263731 m 8.0000 202 | 7/11
13 h-m-p 0.0010 0.0049 5.2076 -------Y 182.263731 0 0.0000 227 | 7/11
14 h-m-p 0.0160 8.0000 0.0010 ----------C 182.263731 0 0.0000 251 | 7/11
15 h-m-p 0.0054 2.7247 0.3551 +++++ 182.263729 m 2.7247 272 | 7/11
16 h-m-p -0.0000 -0.0000 3.5366
h-m-p: -0.00000000e+00 -0.00000000e+00 3.53661399e+00 182.263729
.. | 7/11
17 h-m-p 0.0160 8.0000 0.0000 +++++ 182.263729 m 8.0000 304 | 7/11
18 h-m-p 0.0003 0.0015 0.1221 --------Y 182.263729 0 0.0000 330 | 7/11
19 h-m-p 0.0160 8.0000 0.0000 +++++ 182.263729 m 8.0000 351 | 7/11
20 h-m-p 0.0099 4.9621 0.9116 ++++Y 182.263714 0 3.7354 373 | 7/11
21 h-m-p 1.6000 8.0000 0.0294 ++ 182.263714 m 8.0000 391 | 7/11
22 h-m-p 1.6000 8.0000 0.0737 Y 182.263714 0 0.8021 409 | 7/11
23 h-m-p 1.6000 8.0000 0.0001 ++ 182.263714 m 8.0000 427 | 7/11
24 h-m-p 0.0061 3.0297 0.4652 ------Y 182.263714 0 0.0000 451 | 7/11
25 h-m-p 0.0160 8.0000 0.0018 +++++ 182.263714 m 8.0000 472 | 7/11
26 h-m-p 0.0122 1.6103 1.1924 ----------Y 182.263714 0 0.0000 500 | 7/11
27 h-m-p 0.0160 8.0000 0.0004 +++++ 182.263714 m 8.0000 517 | 7/11
28 h-m-p 0.0047 1.9794 0.7541 ++++Y 182.263714 0 1.5759 539 | 7/11
29 h-m-p 1.6000 8.0000 0.0099 Y 182.263714 0 3.2083 557 | 7/11
30 h-m-p 1.6000 8.0000 0.0006 ++ 182.263714 m 8.0000 575 | 7/11
31 h-m-p 0.0154 7.6855 0.4899 +++C 182.263714 0 1.1448 596 | 7/11
32 h-m-p 1.6000 8.0000 0.2746 Y 182.263714 0 2.5897 614 | 7/11
33 h-m-p 0.6894 3.6191 1.0316 C 182.263712 0 0.9791 632 | 7/11
34 h-m-p 0.0502 0.2510 12.5835 Y 182.263711 0 0.0870 646 | 7/11
35 h-m-p 0.2636 1.3180 2.4499 ++ 182.263704 m 1.3180 660 | 7/11
36 h-m-p -0.0000 -0.0000 6.1405
h-m-p: -1.47784271e-17 -7.38921355e-17 6.14046621e+00 182.263704
.. | 7/11
37 h-m-p 0.0160 8.0000 0.0000 +++++ 182.263704 m 8.0000 688 | 7/11
38 h-m-p 0.0160 8.0000 0.2850 +++++ 182.263692 m 8.0000 709 | 7/11
39 h-m-p 0.1169 0.5844 0.7551 ++ 182.263691 m 0.5844 727 | 8/11
40 h-m-p 0.2005 8.0000 2.0465 +++ 182.263682 m 8.0000 746 | 8/11
41 h-m-p 1.6000 8.0000 1.1734 ++ 182.263681 m 8.0000 760 | 8/11
42 h-m-p 1.3987 8.0000 6.7117 ++ 182.263679 m 8.0000 774 | 8/11
43 h-m-p 1.6000 8.0000 4.6472 ++ 182.263679 m 8.0000 788 | 8/11
44 h-m-p 1.6000 8.0000 3.4774 ----------------.. | 8/11
45 h-m-p 0.0160 8.0000 0.0000 -----N 182.263679 0 0.0000 835
Out..
lnL = -182.263679
836 lfun, 3344 eigenQcodon, 15048 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -182.262530 S = -182.262498 -0.000012
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 27 patterns 0:05
did 20 / 27 patterns 0:05
did 27 / 27 patterns 0:05
Time used: 0:05
Model 3: discrete
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.028917 0.076689 0.050066 0.030511 0.011946 0.030619 0.000100 0.159093 0.390975 0.664384 1.631990 2.572072
ntime & nrate & np: 6 4 12
Bounds (np=12):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 0.000001 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 999.000000 999.000000 999.000000
Qfactor_NS = 4.161364
np = 12
lnL0 = -193.556948
Iterating by ming2
Initial: fx= 193.556948
x= 0.02892 0.07669 0.05007 0.03051 0.01195 0.03062 0.00011 0.15909 0.39098 0.66438 1.63199 2.57207
1 h-m-p 0.0000 0.0000 118.3862 ++ 193.465877 m 0.0000 17 | 1/12
2 h-m-p 0.0001 0.0657 12.5532 ----------.. | 1/12
3 h-m-p 0.0000 0.0002 118.4302 +++ 190.111976 m 0.0002 56 | 2/12
4 h-m-p 0.0024 0.0793 10.5482 ------------.. | 2/12
5 h-m-p 0.0000 0.0003 109.4011 +++ 185.925668 m 0.0003 97 | 3/12
6 h-m-p 0.0056 0.1511 6.0078 ------------.. | 3/12
7 h-m-p 0.0000 0.0000 99.5806 ++ 185.605960 m 0.0000 137 | 4/12
8 h-m-p 0.0008 0.3051 3.5992 -----------.. | 4/12
9 h-m-p 0.0000 0.0000 86.1420 ++ 185.589880 m 0.0000 176 | 5/12
10 h-m-p 0.0007 0.3610 3.1078 -----------.. | 5/12
11 h-m-p 0.0000 0.0004 69.9531 +++ 183.635759 m 0.0004 216 | 6/12
12 h-m-p 0.0094 0.6841 2.0617 -------------.. | 6/12
13 h-m-p 0.0000 0.0005 49.8600 +++ 182.263706 m 0.0005 258 | 7/12
14 h-m-p 0.9023 8.0000 0.0000 ++ 182.263706 m 8.0000 273 | 7/12
15 h-m-p 0.0188 8.0000 0.0023 +++++ 182.263706 m 8.0000 296 | 7/12
16 h-m-p 0.0152 7.6229 1.3366 +++++ 182.263691 m 7.6229 319 | 7/12
17 h-m-p 0.0000 0.0000 1.7249
h-m-p: 6.43164430e-17 3.21582215e-16 1.72489633e+00 182.263691
.. | 7/12
18 h-m-p 0.0160 8.0000 0.0000 +++++ 182.263691 m 8.0000 349 | 7/12
19 h-m-p 0.0424 8.0000 0.0005 ++++ 182.263691 m 8.0000 371 | 7/12
20 h-m-p 0.0160 8.0000 2.9274 +++++ 182.263681 m 8.0000 394 | 7/12
21 h-m-p 1.6000 8.0000 0.9022 ++ 182.263680 m 8.0000 409 | 7/12
22 h-m-p 0.9109 8.0000 7.9234 ++ 182.263679 m 8.0000 429 | 7/12
23 h-m-p 1.6000 8.0000 18.1973 ++ 182.263679 m 8.0000 444 | 7/12
24 h-m-p 0.3477 1.7386 24.4453 ++ 182.263679 m 1.7386 459 | 7/12
25 h-m-p 0.5308 3.5233 80.0691 ---------Y 182.263679 0 0.0000 483 | 7/12
26 h-m-p 1.1429 8.0000 0.0000 --C 182.263679 0 0.0179 500 | 7/12
27 h-m-p 0.8714 8.0000 0.0000 Y 182.263679 0 0.8714 520
Out..
lnL = -182.263679
521 lfun, 2084 eigenQcodon, 9378 P(t)
Time used: 0:08
Model 7: beta
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.028058 0.032305 0.098337 0.025152 0.061855 0.085928 0.000100 0.700096 1.134293
ntime & nrate & np: 6 1 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 9.416381
np = 9
lnL0 = -198.918789
Iterating by ming2
Initial: fx= 198.918789
x= 0.02806 0.03231 0.09834 0.02515 0.06186 0.08593 0.00011 0.70010 1.13429
1 h-m-p 0.0000 0.0000 119.5665 ++ 198.786542 m 0.0000 14 | 1/9
2 h-m-p 0.0003 0.1693 5.2580 ----------.. | 1/9
3 h-m-p 0.0000 0.0005 119.6300 +++ 191.581648 m 0.0005 47 | 2/9
4 h-m-p 0.0136 0.3050 3.9593 -------------.. | 2/9
5 h-m-p 0.0000 0.0001 112.0083 ++ 190.856612 m 0.0001 82 | 3/9
6 h-m-p 0.0020 0.4940 2.9330 ------------.. | 3/9
7 h-m-p 0.0000 0.0001 99.9710 ++ 190.010732 m 0.0001 116 | 4/9
8 h-m-p 0.0029 0.6245 2.5204 ------------.. | 4/9
9 h-m-p 0.0000 0.0006 86.2502 +++ 185.503451 m 0.0006 151 | 5/9
10 h-m-p 0.0199 0.7958 2.0969 -------------.. | 5/9
11 h-m-p 0.0000 0.0005 71.9006 +++ 182.943695 m 0.0005 187 | 6/9
12 h-m-p 0.0118 0.9592 2.1117 -------------.. | 6/9
13 h-m-p 0.0000 0.0003 51.6794 +++ 182.263741 m 0.0003 223 | 7/9
14 h-m-p 1.6000 8.0000 0.0000 ++ 182.263741 m 8.0000 235 | 7/9
15 h-m-p 0.0598 8.0000 0.0001 ++++ 182.263741 m 8.0000 251 | 7/9
16 h-m-p 0.0160 8.0000 0.5360 +++++ 182.263740 m 8.0000 268 | 7/9
17 h-m-p 1.6000 8.0000 0.2920 ++ 182.263740 m 8.0000 282 | 7/9
18 h-m-p 0.9649 8.0000 2.4209 ++ 182.263739 m 8.0000 296 | 7/9
19 h-m-p 1.6000 8.0000 7.3534 ++ 182.263739 m 8.0000 308 | 7/9
20 h-m-p 1.6000 8.0000 9.7231 ---------N 182.263739 0 0.0000 329 | 7/9
21 h-m-p 1.6000 8.0000 0.0000 Y 182.263739 0 0.4000 341 | 7/9
22 h-m-p 0.3834 8.0000 0.0000 ---C 182.263739 0 0.0015 358
Out..
lnL = -182.263739
359 lfun, 3949 eigenQcodon, 21540 P(t)
Time used: 0:14
Model 8: beta&w>1
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.056937 0.099014 0.051826 0.060147 0.085342 0.081123 0.000100 0.900000 0.311635 1.515610 1.328768
ntime & nrate & np: 6 2 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 10.490935
np = 11
lnL0 = -203.402128
Iterating by ming2
Initial: fx= 203.402128
x= 0.05694 0.09901 0.05183 0.06015 0.08534 0.08112 0.00011 0.90000 0.31163 1.51561 1.32877
1 h-m-p 0.0000 0.0000 111.5383 ++ 203.257745 m 0.0000 16 | 1/11
2 h-m-p 0.0000 0.0030 85.2204 ++++ 188.564163 m 0.0030 32 | 2/11
3 h-m-p 0.0000 0.0000 2562.5742 ++ 187.259298 m 0.0000 46 | 3/11
4 h-m-p 0.0007 0.0036 7.7122 -----------.. | 3/11
5 h-m-p 0.0000 0.0001 98.7811 ++ 186.623369 m 0.0001 83 | 4/11
6 h-m-p 0.0010 0.1001 5.3624 -----------.. | 4/11
7 h-m-p 0.0000 0.0004 85.6581 +++ 183.428263 m 0.0004 121 | 5/11
8 h-m-p 0.0077 0.2486 3.8800 -------------.. | 5/11
9 h-m-p 0.0000 0.0001 72.1441 ++ 182.987032 m 0.0001 160 | 6/11
10 h-m-p 0.0013 0.2266 3.3540 -----------.. | 6/11
11 h-m-p 0.0000 0.0003 51.0599 +++ 182.263731 m 0.0003 198 | 7/11
12 h-m-p 1.2671 8.0000 0.0000 ++ 182.263731 m 8.0000 212 | 7/11
13 h-m-p 0.0160 8.0000 0.0149 +++++ 182.263730 m 8.0000 233 | 7/11
14 h-m-p 0.3840 1.9202 0.1994 +Y 182.263730 0 1.1740 252 | 7/11
15 h-m-p 1.6000 8.0000 0.0014 C 182.263730 0 1.6000 270 | 7/11
16 h-m-p 1.6000 8.0000 0.0000 ++ 182.263730 m 8.0000 288 | 7/11
17 h-m-p 0.0160 8.0000 0.0365 +++Y 182.263730 0 1.9004 309 | 7/11
18 h-m-p 1.6000 8.0000 0.0177 ++ 182.263729 m 8.0000 327 | 7/11
19 h-m-p 0.0095 0.0474 14.1033 ------------C 182.263729 0 0.0000 357 | 7/11
20 h-m-p 0.0102 5.0970 0.0415 +++Y 182.263729 0 1.0581 374 | 7/11
21 h-m-p 1.6000 8.0000 0.0001 ++ 182.263729 m 8.0000 392 | 7/11
22 h-m-p 0.1256 8.0000 0.0070 ++C 182.263729 0 2.2120 412 | 7/11
23 h-m-p 1.6000 8.0000 0.0008 ++ 182.263729 m 8.0000 430 | 7/11
24 h-m-p 0.0113 5.6434 0.6353 ---------Y 182.263729 0 0.0000 457 | 7/11
25 h-m-p 0.0160 8.0000 0.1131 +++C 182.263729 0 1.0787 478 | 7/11
26 h-m-p 1.6000 8.0000 0.0017 -------C 182.263729 0 0.0000 503 | 7/11
27 h-m-p 0.0160 8.0000 0.0002 +++++ 182.263729 m 8.0000 524 | 7/11
28 h-m-p 0.0024 1.1888 1.2735 +++++ 182.263715 m 1.1888 545 | 8/11
29 h-m-p 0.0329 0.1647 5.9705 Y 182.263714 0 0.0633 559 | 8/11
30 h-m-p 1.6000 8.0000 0.0019 +Y 182.263714 0 4.1144 574 | 8/11
31 h-m-p 1.6000 8.0000 0.0003 ++ 182.263714 m 8.0000 591 | 8/11
32 h-m-p 0.0013 0.6660 1.9301 --------N 182.263714 0 0.0000 616 | 8/11
33 h-m-p 0.0005 0.2724 1.8218 ++++Y 182.263712 0 0.1395 634 | 8/11
34 h-m-p 0.0219 0.1095 8.2777 -------------.. | 8/11
35 h-m-p 0.0160 8.0000 0.0000 +++++ 182.263712 m 8.0000 676 | 8/11
36 h-m-p 0.0160 8.0000 0.0248 -------Y 182.263712 0 0.0000 700 | 8/11
37 h-m-p 0.0160 8.0000 0.0003 +++++ 182.263712 m 8.0000 720 | 8/11
38 h-m-p 0.0004 0.0653 4.6547 -----------.. | 8/11
39 h-m-p 0.0160 8.0000 0.0000 +++++ 182.263712 m 8.0000 763 | 8/11
40 h-m-p 0.0160 8.0000 0.0363 +++++ 182.263709 m 8.0000 783 | 8/11
41 h-m-p 0.0236 0.1182 5.1407 -----------C 182.263709 0 0.0000 811 | 8/11
42 h-m-p 0.0042 2.1245 0.2380 +++++ 182.263702 m 2.1245 828 | 9/11
43 h-m-p 0.0818 0.4089 2.2952 ------------Y 182.263702 0 0.0000 857 | 9/11
44 h-m-p 0.0160 8.0000 0.0000 ----Y 182.263702 0 0.0000 875 | 9/11
45 h-m-p 0.0160 8.0000 0.0000 ----------Y 182.263702 0 0.0000 901
Out..
lnL = -182.263702
902 lfun, 10824 eigenQcodon, 59532 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -182.264324 S = -182.262805 -0.000665
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 27 patterns 0:29
did 20 / 27 patterns 0:29
did 27 / 27 patterns 0:29
Time used: 0:29
CodeML output code: -1
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=53
NC_011896_1_WP_010908724_1_2267_MLBR_RS10750 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
NC_002677_1_NP_302404_1_1276_ML2129 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ
**************************************************
NC_011896_1_WP_010908724_1_2267_MLBR_RS10750 FSA
NC_002677_1_NP_302404_1_1276_ML2129 FSA
NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265 FSA
NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945 FSA
NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645 FSA
NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970 FSA
***
>NC_011896_1_WP_010908724_1_2267_MLBR_RS10750 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG TTTAGCGCT >NC_002677_1_NP_302404_1_1276_ML2129 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG TTTAGCGCT >NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG TTTAGCGCT >NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG TTTAGCGCT >NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG TTTAGCGCT >NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970 GTGGTGACGCTATGCGTGCTTCCGGAAGGCTTGGCGGCGGCCGGTGCCGC GGTACAAGCGCCGCCAGCTCGCCTGGTGGCTGCGCATGTTGCTGCAGCGT CGGTGGTGTCGTCGGCGGCTGATTTGGTGTCGGTGCAGACTGCGGTTCAG TTTAGCGCT
>NC_011896_1_WP_010908724_1_2267_MLBR_RS10750 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ FSA >NC_002677_1_NP_302404_1_1276_ML2129 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ FSA >NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ FSA >NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ FSA >NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ FSA >NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970 VVTLCVLPEGLAAAGAAVQAPPARLVAAHVAAASVVSSAADLVSVQTAVQ FSA
#NEXUS
[ID: 5166178727]
begin taxa;
dimensions ntax=6;
taxlabels
NC_011896_1_WP_010908724_1_2267_MLBR_RS10750
NC_002677_1_NP_302404_1_1276_ML2129
NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265
NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945
NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645
NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970
;
end;
begin trees;
translate
1 NC_011896_1_WP_010908724_1_2267_MLBR_RS10750,
2 NC_002677_1_NP_302404_1_1276_ML2129,
3 NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265,
4 NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945,
5 NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645,
6 NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:0.0689923,2:0.07074461,3:0.07183854,4:0.06557412,5:0.07000209,6:0.06996562);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:0.0689923,2:0.07074461,3:0.07183854,4:0.06557412,5:0.07000209,6:0.06996562);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -205.72 -208.93
2 -205.68 -208.69
--------------------------------------
TOTAL -205.70 -208.82
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 1502 samples from 2 runs.
Each run produced 1001 samples of which 751 samples were included.
Parameter summaries saved to file "/data/8res/ML2129/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.898244 0.084791 0.368905 1.473544 0.867733 530.27 640.64 0.999
r(A<->C){all} 0.176181 0.020355 0.000015 0.463495 0.140205 41.97 57.84 1.005
r(A<->G){all} 0.161328 0.020200 0.000593 0.455962 0.118005 70.57 120.31 1.024
r(A<->T){all} 0.160046 0.018649 0.000001 0.431529 0.124859 36.83 64.20 1.024
r(C<->G){all} 0.163439 0.022977 0.000154 0.502524 0.115052 36.94 75.78 0.999
r(C<->T){all} 0.162712 0.023799 0.000060 0.467921 0.114093 71.40 73.95 1.015
r(G<->T){all} 0.176294 0.020246 0.000166 0.444488 0.142586 26.11 85.37 1.033
pi(A){all} 0.098876 0.000537 0.054262 0.144941 0.097549 516.55 581.34 0.999
pi(C){all} 0.263359 0.001194 0.200306 0.336570 0.261727 601.72 644.18 1.000
pi(G){all} 0.397510 0.001445 0.324705 0.472775 0.397309 592.17 629.79 1.000
pi(T){all} 0.240255 0.001080 0.178129 0.302461 0.239035 619.20 668.86 0.999
alpha{1,2} 0.417149 0.217515 0.000193 1.364426 0.266907 259.39 332.91 1.000
alpha{3} 0.427993 0.208053 0.000717 1.304015 0.269087 491.81 505.95 1.001
pinvar{all} 0.988918 0.000185 0.964346 0.999985 0.993318 452.24 464.94 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
CODONML (in paml version 4.9h, March 2018) /data/8res/ML2129/batch/allfiles/codeml/input.fasta.fasta.pnxs
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 6 ls = 53
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 0 0 0 0 0 0 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 0 0 0 0 0 0 | TAC 0 0 0 0 0 0 | TGC 1 1 1 1 1 1
Leu TTA 0 0 0 0 0 0 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 2 2 2 2 2 2 | TCG 4 4 4 4 4 4 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 1 1 1 1 1 1 | Pro CCT 0 0 0 0 0 0 | His CAT 1 1 1 1 1 1 | Arg CGT 0 0 0 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 1 1 1 1 1 1
CTA 1 1 1 1 1 1 | CCA 1 1 1 1 1 1 | Gln CAA 1 1 1 1 1 1 | CGA 0 0 0 0 0 0
CTG 1 1 1 1 1 1 | CCG 2 2 2 2 2 2 | CAG 2 2 2 2 2 2 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 1 1 1 1 1 1 | Asn AAT 0 0 0 0 0 0 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 0 0 0 0 0 0 | AGC 1 1 1 1 1 1
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 0 0 0 0 0 0 | Arg AGA 0 0 0 0 0 0
Met ATG 0 0 0 0 0 0 | ACG 1 1 1 1 1 1 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 2 2 2 2 2 2 | Ala GCT 5 5 5 5 5 5 | Asp GAT 1 1 1 1 1 1 | Gly GGT 1 1 1 1 1 1
GTC 0 0 0 0 0 0 | GCC 2 2 2 2 2 2 | GAC 0 0 0 0 0 0 | GGC 1 1 1 1 1 1
GTA 1 1 1 1 1 1 | GCA 1 1 1 1 1 1 | Glu GAA 1 1 1 1 1 1 | GGA 0 0 0 0 0 0
GTG 8 8 8 8 8 8 | GCG 8 8 8 8 8 8 | GAG 0 0 0 0 0 0 | GGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: NC_011896_1_WP_010908724_1_2267_MLBR_RS10750
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
#2: NC_002677_1_NP_302404_1_1276_ML2129
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
#3: NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
#4: NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
#5: NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
#6: NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 6 | Ser S TCT 0 | Tyr Y TAT 0 | Cys C TGT 0
TTC 0 | TCC 0 | TAC 0 | TGC 6
Leu L TTA 0 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 12 | TCG 24 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 6 | Pro P CCT 0 | His H CAT 6 | Arg R CGT 0
CTC 0 | CCC 0 | CAC 0 | CGC 6
CTA 6 | CCA 6 | Gln Q CAA 6 | CGA 0
CTG 6 | CCG 12 | CAG 12 | CGG 0
------------------------------------------------------------------------------
Ile I ATT 0 | Thr T ACT 6 | Asn N AAT 0 | Ser S AGT 0
ATC 0 | ACC 0 | AAC 0 | AGC 6
ATA 0 | ACA 0 | Lys K AAA 0 | Arg R AGA 0
Met M ATG 0 | ACG 6 | AAG 0 | AGG 0
------------------------------------------------------------------------------
Val V GTT 12 | Ala A GCT 30 | Asp D GAT 6 | Gly G GGT 6
GTC 0 | GCC 12 | GAC 0 | GGC 6
GTA 6 | GCA 6 | Glu E GAA 6 | GGA 0
GTG 48 | GCG 48 | GAG 0 | GGG 0
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.15094 C:0.20755 A:0.05660 G:0.58491
position 2: T:0.32075 C:0.47170 A:0.11321 G:0.09434
position 3: T:0.24528 C:0.11321 A:0.11321 G:0.52830
Average T:0.23899 C:0.26415 A:0.09434 G:0.40252
Model 0: one-ratio
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 8): -182.263719 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.151127 1.328768
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908724_1_2267_MLBR_RS10750: 0.000004, NC_002677_1_NP_302404_1_1276_ML2129: 0.000004, NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265: 0.000004, NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945: 0.000004, NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645: 0.000004, NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.15113
omega (dN/dS) = 1.32877
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 102.1 56.9 1.3288 0.0000 0.0000 0.0 0.0
7..2 0.000 102.1 56.9 1.3288 0.0000 0.0000 0.0 0.0
7..3 0.000 102.1 56.9 1.3288 0.0000 0.0000 0.0 0.0
7..4 0.000 102.1 56.9 1.3288 0.0000 0.0000 0.0 0.0
7..5 0.000 102.1 56.9 1.3288 0.0000 0.0000 0.0 0.0
7..6 0.000 102.1 56.9 1.3288 0.0000 0.0000 0.0 0.0
tree length for dN: 0.0000
tree length for dS: 0.0000
Time used: 0:00
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -182.263716 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 1.000000
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908724_1_2267_MLBR_RS10750: 0.000004, NC_002677_1_NP_302404_1_1276_ML2129: 0.000004, NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265: 0.000004, NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945: 0.000004, NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645: 0.000004, NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
MLEs of dN/dS (w) for site classes (K=2)
p: 0.00001 0.99999
w: 1.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 101.4 57.6 1.0000 0.0000 0.0000 0.0 0.0
7..2 0.000 101.4 57.6 1.0000 0.0000 0.0000 0.0 0.0
7..3 0.000 101.4 57.6 1.0000 0.0000 0.0000 0.0 0.0
7..4 0.000 101.4 57.6 1.0000 0.0000 0.0000 0.0 0.0
7..5 0.000 101.4 57.6 1.0000 0.0000 0.0000 0.0 0.0
7..6 0.000 101.4 57.6 1.0000 0.0000 0.0000 0.0 0.0
Time used: 0:01
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -182.263679 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000000 0.001888 1.000000 88.967383
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908724_1_2267_MLBR_RS10750: 0.000004, NC_002677_1_NP_302404_1_1276_ML2129: 0.000004, NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265: 0.000004, NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945: 0.000004, NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645: 0.000004, NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
MLEs of dN/dS (w) for site classes (K=3)
p: 0.00000 0.00189 0.99811
w: 1.00000 1.00000 88.96738
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 101.4 57.6 88.8013 0.0000 0.0000 0.0 0.0
7..2 0.000 101.4 57.6 88.8013 0.0000 0.0000 0.0 0.0
7..3 0.000 101.4 57.6 88.8013 0.0000 0.0000 0.0 0.0
7..4 0.000 101.4 57.6 88.8013 0.0000 0.0000 0.0 0.0
7..5 0.000 101.4 57.6 88.8013 0.0000 0.0000 0.0 0.0
7..6 0.000 101.4 57.6 88.8013 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908724_1_2267_MLBR_RS10750)
Pr(w>1) post mean +- SE for w
1 V 0.998** 88.801
2 V 0.998** 88.801
3 T 0.998** 88.801
4 L 0.998** 88.801
5 C 0.998** 88.801
6 V 0.998** 88.801
7 L 0.998** 88.801
8 P 0.998** 88.801
9 E 0.998** 88.801
10 G 0.998** 88.801
11 L 0.998** 88.801
12 A 0.998** 88.801
13 A 0.998** 88.801
14 A 0.998** 88.801
15 G 0.998** 88.801
16 A 0.998** 88.801
17 A 0.998** 88.801
18 V 0.998** 88.801
19 Q 0.998** 88.801
20 A 0.998** 88.801
21 P 0.998** 88.801
22 P 0.998** 88.801
23 A 0.998** 88.801
24 R 0.998** 88.801
25 L 0.998** 88.801
26 V 0.998** 88.801
27 A 0.998** 88.801
28 A 0.998** 88.801
29 H 0.998** 88.801
30 V 0.998** 88.801
31 A 0.998** 88.801
32 A 0.998** 88.801
33 A 0.998** 88.801
34 S 0.998** 88.801
35 V 0.998** 88.801
36 V 0.998** 88.801
37 S 0.998** 88.801
38 S 0.998** 88.801
39 A 0.998** 88.801
40 A 0.998** 88.801
41 D 0.998** 88.801
42 L 0.998** 88.801
43 V 0.998** 88.801
44 S 0.998** 88.801
45 V 0.998** 88.801
46 Q 0.998** 88.801
47 T 0.998** 88.801
48 A 0.998** 88.801
49 V 0.998** 88.801
50 Q 0.998** 88.801
51 F 0.998** 88.801
52 S 0.998** 88.801
53 A 0.998** 88.801
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908724_1_2267_MLBR_RS10750)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
w2: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.010
0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
sum of density on p0-p1 = 1.000000
Time used: 0:05
Model 3: discrete (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 12): -182.263679 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000000 0.000000 11.627510 39.122387 266.608044
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908724_1_2267_MLBR_RS10750: 0.000004, NC_002677_1_NP_302404_1_1276_ML2129: 0.000004, NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265: 0.000004, NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945: 0.000004, NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645: 0.000004, NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
MLEs of dN/dS (w) for site classes (K=3)
p: 0.00000 0.00000 1.00000
w: 11.62751 39.12239 266.60804
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 101.4 57.6 266.6080 0.0000 0.0000 0.0 0.0
7..2 0.000 101.4 57.6 266.6080 0.0000 0.0000 0.0 0.0
7..3 0.000 101.4 57.6 266.6080 0.0000 0.0000 0.0 0.0
7..4 0.000 101.4 57.6 266.6080 0.0000 0.0000 0.0 0.0
7..5 0.000 101.4 57.6 266.6080 0.0000 0.0000 0.0 0.0
7..6 0.000 101.4 57.6 266.6080 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908724_1_2267_MLBR_RS10750)
Pr(w>1) post mean +- SE for w
1 V 1.000** 266.608
2 V 1.000** 266.608
3 T 1.000** 266.608
4 L 1.000** 266.608
5 C 1.000** 266.608
6 V 1.000** 266.608
7 L 1.000** 266.608
8 P 1.000** 266.608
9 E 1.000** 266.608
10 G 1.000** 266.608
11 L 1.000** 266.608
12 A 1.000** 266.608
13 A 1.000** 266.608
14 A 1.000** 266.608
15 G 1.000** 266.608
16 A 1.000** 266.608
17 A 1.000** 266.608
18 V 1.000** 266.608
19 Q 1.000** 266.608
20 A 1.000** 266.608
21 P 1.000** 266.608
22 P 1.000** 266.608
23 A 1.000** 266.608
24 R 1.000** 266.608
25 L 1.000** 266.608
26 V 1.000** 266.608
27 A 1.000** 266.608
28 A 1.000** 266.608
29 H 1.000** 266.608
30 V 1.000** 266.608
31 A 1.000** 266.608
32 A 1.000** 266.608
33 A 1.000** 266.608
34 S 1.000** 266.608
35 V 1.000** 266.608
36 V 1.000** 266.608
37 S 1.000** 266.608
38 S 1.000** 266.608
39 A 1.000** 266.608
40 A 1.000** 266.608
41 D 1.000** 266.608
42 L 1.000** 266.608
43 V 1.000** 266.608
44 S 1.000** 266.608
45 V 1.000** 266.608
46 Q 1.000** 266.608
47 T 1.000** 266.608
48 A 1.000** 266.608
49 V 1.000** 266.608
50 Q 1.000** 266.608
51 F 1.000** 266.608
52 S 1.000** 266.608
53 A 1.000** 266.608
Note: more than one w>1. Check rst for details
Time used: 0:08
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -182.263739 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 48.014130 71.530475
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908724_1_2267_MLBR_RS10750: 0.000004, NC_002677_1_NP_302404_1_1276_ML2129: 0.000004, NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265: 0.000004, NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945: 0.000004, NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645: 0.000004, NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M7 (beta):
p = 48.01413 q = 71.53047
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.32911 0.35523 0.37107 0.38387 0.39546 0.40674 0.41848 0.43161 0.44814 0.47606
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 101.4 57.6 0.4016 0.0000 0.0000 0.0 0.0
7..2 0.000 101.4 57.6 0.4016 0.0000 0.0000 0.0 0.0
7..3 0.000 101.4 57.6 0.4016 0.0000 0.0000 0.0 0.0
7..4 0.000 101.4 57.6 0.4016 0.0000 0.0000 0.0 0.0
7..5 0.000 101.4 57.6 0.4016 0.0000 0.0000 0.0 0.0
7..6 0.000 101.4 57.6 0.4016 0.0000 0.0000 0.0 0.0
Time used: 0:14
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -182.263702 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.232469 0.005000 1.938399
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908724_1_2267_MLBR_RS10750: 0.000004, NC_002677_1_NP_302404_1_1276_ML2129: 0.000004, NZ_LVXE01000011_1_WP_010908724_1_340_A3216_RS05265: 0.000004, NZ_LYPH01000017_1_WP_010908724_1_626_A8144_RS02945: 0.000004, NZ_CP029543_1_WP_010908724_1_2289_DIJ64_RS11645: 0.000004, NZ_AP014567_1_WP_010908724_1_2354_JK2ML_RS11970: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M8 (beta&w>1):
p0 = 0.00001 p = 0.23247 q = 0.00500
(p1 = 0.99999) w = 1.93840
MLEs of dN/dS (w) for site classes (K=11)
p: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.99999
w: 0.99822 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.00000 1.93840
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 101.4 57.6 1.9384 0.0000 0.0000 0.0 0.0
7..2 0.000 101.4 57.6 1.9384 0.0000 0.0000 0.0 0.0
7..3 0.000 101.4 57.6 1.9384 0.0000 0.0000 0.0 0.0
7..4 0.000 101.4 57.6 1.9384 0.0000 0.0000 0.0 0.0
7..5 0.000 101.4 57.6 1.9384 0.0000 0.0000 0.0 0.0
7..6 0.000 101.4 57.6 1.9384 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908724_1_2267_MLBR_RS10750)
Pr(w>1) post mean +- SE for w
1 V 1.000** 1.938
2 V 1.000** 1.938
3 T 1.000** 1.938
4 L 1.000** 1.938
5 C 1.000** 1.938
6 V 1.000** 1.938
7 L 1.000** 1.938
8 P 1.000** 1.938
9 E 1.000** 1.938
10 G 1.000** 1.938
11 L 1.000** 1.938
12 A 1.000** 1.938
13 A 1.000** 1.938
14 A 1.000** 1.938
15 G 1.000** 1.938
16 A 1.000** 1.938
17 A 1.000** 1.938
18 V 1.000** 1.938
19 Q 1.000** 1.938
20 A 1.000** 1.938
21 P 1.000** 1.938
22 P 1.000** 1.938
23 A 1.000** 1.938
24 R 1.000** 1.938
25 L 1.000** 1.938
26 V 1.000** 1.938
27 A 1.000** 1.938
28 A 1.000** 1.938
29 H 1.000** 1.938
30 V 1.000** 1.938
31 A 1.000** 1.938
32 A 1.000** 1.938
33 A 1.000** 1.938
34 S 1.000** 1.938
35 V 1.000** 1.938
36 V 1.000** 1.938
37 S 1.000** 1.938
38 S 1.000** 1.938
39 A 1.000** 1.938
40 A 1.000** 1.938
41 D 1.000** 1.938
42 L 1.000** 1.938
43 V 1.000** 1.938
44 S 1.000** 1.938
45 V 1.000** 1.938
46 Q 1.000** 1.938
47 T 1.000** 1.938
48 A 1.000** 1.938
49 V 1.000** 1.938
50 Q 1.000** 1.938
51 F 1.000** 1.938
52 S 1.000** 1.938
53 A 1.000** 1.938
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908724_1_2267_MLBR_RS10750)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
p : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
q : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
ws: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Time used: 0:29
Model 1: NearlyNeutral -182.263716 Model 2: PositiveSelection -182.263679 Model 0: one-ratio -182.263719 Model 3: discrete -182.263679 Model 7: beta -182.263739 Model 8: beta&w>1 -182.263702 Model 0 vs 1 6.000000041694875E-6 Model 2 vs 1 7.399999998369822E-5 Model 8 vs 7 7.399999998369822E-5
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
