--- EXPERIMENT NOTES
--- EXPERIMENT PROPERTIES
#Fri Jan 24 09:06:30 GMT 2020
codeml.models=0 1 2 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=MUSCLE
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/7res/ML1617/input.fasta
input.names=
mrbayes.params=
codeml.params=
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -324.94 -328.80
2 -324.95 -327.78
--------------------------------------
TOTAL -324.95 -328.42
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.887209 0.090465 0.352460 1.476372 0.849804 993.38 1247.19 1.000
r(A<->C){all} 0.173552 0.020928 0.000263 0.468217 0.137900 194.48 215.61 1.002
r(A<->G){all} 0.166515 0.018581 0.000108 0.433975 0.132206 164.67 216.61 1.007
r(A<->T){all} 0.166941 0.019281 0.000037 0.436188 0.130960 198.86 253.96 1.002
r(C<->G){all} 0.164789 0.019328 0.000024 0.451642 0.129558 184.44 273.50 1.001
r(C<->T){all} 0.170980 0.020244 0.000097 0.459726 0.135404 123.01 176.20 1.005
r(G<->T){all} 0.157224 0.018738 0.000079 0.440051 0.119406 153.41 183.16 1.002
pi(A){all} 0.168067 0.000576 0.124834 0.218742 0.166817 971.99 1108.09 1.000
pi(C){all} 0.250533 0.000727 0.199461 0.304236 0.250254 1258.91 1299.89 1.000
pi(G){all} 0.360351 0.000955 0.297933 0.419834 0.359864 1228.98 1274.09 1.000
pi(T){all} 0.221049 0.000728 0.171992 0.277887 0.220423 1098.75 1185.64 1.001
alpha{1,2} 0.406566 0.217145 0.000227 1.351545 0.238813 1069.03 1207.71 1.000
alpha{3} 0.450518 0.234719 0.000104 1.437480 0.283600 1157.19 1169.23 1.001
pinvar{all} 0.992967 0.000073 0.977878 0.999999 0.995671 1205.83 1276.10 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
--- CODEML SUMMARY
Model 1: NearlyNeutral -293.042599
Model 2: PositiveSelection -293.042546
Model 0: one-ratio -293.042546
Model 7: beta -293.04263
Model 8: beta&w>1 -293.042561
Model 0 vs 1 1.059999999597494E-4
Model 2 vs 1 1.059999999597494E-4
Model 8 vs 7 1.37999999992644E-4
>C1
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C2
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C3
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C4
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C5
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C6
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=80
C1 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C2 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C3 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C4 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C5 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C6 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
**************************************************
C1 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C2 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C3 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C4 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C5 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C6 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
******************************
PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log S [0]
-genepred_score S [0] nsd
-run_name S [0]
-mem_mode S [0] mem
-extend D [1] 1
-extend_mode S [0] very_fast_triplet
-max_n_pair D [0] 10
-seq_name_for_quadruplet S [0] all
-compact S [0] default
-clean S [0] no
-do_self FL [0] 0
-do_normalise D [0] 1000
-template_file S [0]
-setenv S [0] 0
-template_mode S [0]
-flip D [0] 0
-remove_template_file D [0] 0
-profile_template_file S [0]
-in S [0]
-seq S [0]
-aln S [0]
-method_limits S [0]
-method S [0]
-lib S [0]
-profile S [0]
-profile1 S [0]
-profile2 S [0]
-pdb S [0]
-relax_lib D [0] 1
-filter_lib D [0] 0
-shrink_lib D [0] 0
-out_lib W_F [0] no
-out_lib_mode S [0] primary
-lib_only D [0] 0
-outseqweight W_F [0] no
-dpa FL [0] 0
-seq_source S [0] ANY
-cosmetic_penalty D [0] 0
-gapopen D [0] 0
-gapext D [0] 0
-fgapopen D [0] 0
-fgapext D [0] 0
-nomatch D [0] 0
-newtree W_F [0] default
-tree W_F [0] NO
-usetree R_F [0]
-tree_mode S [0] nj
-distance_matrix_mode S [0] ktup
-distance_matrix_sim_mode S [0] idmat_sim1
-quicktree FL [0] 0
-outfile W_F [0] default
-maximise FL [1] 1
-output S [1] score_ascii html score_ascii
-len D [0] 0
-infile R_F [1] input.prot.fasta.muscle_rs_0_0.fasta.aln
-matrix S [0] default
-tg_mode D [0] 1
-profile_mode S [0] cw_profile_profile
-profile_comparison S [0] profile
-dp_mode S [0] linked_pair_wise
-ktuple D [0] 1
-ndiag D [0] 0
-diag_threshold D [0] 0
-diag_mode D [0] 0
-sim_matrix S [0] vasiliky
-transform S [0]
-extend_seq FL [0] 0
-outorder S [0] input
-inorder S [0] aligned
-seqnos S [0] off
-case S [0] keep
-cpu D [0] 0
-maxnseq D [0] 1000
-maxlen D [0] -1
-sample_dp D [0] 0
-weight S [0] default
-seq_weight S [0] no
-align FL [1] 1
-mocca FL [0] 0
-domain FL [0] 0
-start D [0] 0
-len D [0] 0
-scale D [0] 0
-mocca_interactive FL [0] 0
-method_evaluate_mode S [0] default
-evaluate_mode S [1] t_coffee_fast
-get_type FL [0] 0
-clean_aln D [0] 0
-clean_threshold D [1] 1
-clean_iteration D [1] 1
-clean_evaluate_mode S [0] t_coffee_fast
-extend_matrix FL [0] 0
-prot_min_sim D [40] 40
-prot_max_sim D [90] 90
-prot_min_cov D [40] 40
-pdb_type S [0] d
-pdb_min_sim D [35] 35
-pdb_max_sim D [100] 100
-pdb_min_cov D [50] 50
-pdb_blast_server W_F [0] EBI
-blast W_F [0]
-blast_server W_F [0] EBI
-pdb_db W_F [0] pdb
-protein_db W_F [0] uniprot
-method_log W_F [0] no
-struc_to_use S [0]
-cache W_F [0] use
-align_pdb_param_file W_F [0] no
-align_pdb_hasch_mode W_F [0] hasch_ca_trace_bubble
-external_aligner S [0] NO
-msa_mode S [0] tree
-master S [0] no
-blast_nseq D [0] 0
-lalign_n_top D [0] 10
-iterate D [1] 0
-trim D [0] 0
-split D [0] 0
-trimfile S [0] default
-split D [0] 0
-split_nseq_thres D [0] 0
-split_score_thres D [0] 0
-check_pdb_status D [0] 0
-clean_seq_name D [0] 0
-seq_to_keep S [0]
-dpa_master_aln S [0]
-dpa_maxnseq D [0] 0
-dpa_min_score1 D [0]
-dpa_min_score2 D [0]
-dpa_keep_tmpfile FL [0] 0
-dpa_debug D [0] 0
-multi_core S [0] templates_jobs_relax_msa_evaluate
-n_core D [0] 0
-max_n_proc D [0] 0
-lib_list S [0]
-prune_lib_mode S [0] 5
-tip S [0] none
-rna_lib S [0]
-no_warning D [0] 0
-run_local_script D [0] 0
-plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 80 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 80 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2400]
Library Relaxation: Multi_proc [96]
Relaxation Summary: [2400]--->[2400]
UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1
OUTPUT RESULTS
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
#### File Type= MSA Format= html Name= input.prot.fasta.muscle_rs_0_0.fasta.html
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
# Command Line: t_coffee -infile input.prot.fasta.muscle_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.448 Mb, Max= 30.601 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/
FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment
C1 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C2 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C3 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C4 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C5 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C6 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
**************************************************
C1 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C2 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C3 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C4 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C5 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C6 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
******************************
FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.muscle_rs_0_0.fasta.aln I:93 S:100 BS:94
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES
BOT 0 1 100.00 C1 C2 100.00
TOP 1 0 100.00 C2 C1 100.00
BOT 0 2 100.00 C1 C3 100.00
TOP 2 0 100.00 C3 C1 100.00
BOT 0 3 100.00 C1 C4 100.00
TOP 3 0 100.00 C4 C1 100.00
BOT 0 4 100.00 C1 C5 100.00
TOP 4 0 100.00 C5 C1 100.00
BOT 0 5 100.00 C1 C6 100.00
TOP 5 0 100.00 C6 C1 100.00
BOT 1 2 100.00 C2 C3 100.00
TOP 2 1 100.00 C3 C2 100.00
BOT 1 3 100.00 C2 C4 100.00
TOP 3 1 100.00 C4 C2 100.00
BOT 1 4 100.00 C2 C5 100.00
TOP 4 1 100.00 C5 C2 100.00
BOT 1 5 100.00 C2 C6 100.00
TOP 5 1 100.00 C6 C2 100.00
BOT 2 3 100.00 C3 C4 100.00
TOP 3 2 100.00 C4 C3 100.00
BOT 2 4 100.00 C3 C5 100.00
TOP 4 2 100.00 C5 C3 100.00
BOT 2 5 100.00 C3 C6 100.00
TOP 5 2 100.00 C6 C3 100.00
BOT 3 4 100.00 C4 C5 100.00
TOP 4 3 100.00 C5 C4 100.00
BOT 3 5 100.00 C4 C6 100.00
TOP 5 3 100.00 C6 C4 100.00
BOT 4 5 100.00 C5 C6 100.00
TOP 5 4 100.00 C6 C5 100.00
AVG 0 C1 * 100.00
AVG 1 C2 * 100.00
AVG 2 C3 * 100.00
AVG 3 C4 * 100.00
AVG 4 C5 * 100.00
AVG 5 C6 * 100.00
TOT TOT * 100.00
CLUSTAL W (1.83) multiple sequence alignment
C1 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C2 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C3 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C4 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C5 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C6 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
**************************************************
C1 CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C2 CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C3 CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C4 CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C5 CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C6 CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
**************************************************
C1 GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C2 GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C3 GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C4 GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C5 GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C6 GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
**************************************************
C1 CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C2 CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C3 CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C4 CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C5 CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C6 CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
**************************************************
C1 TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C2 TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C3 TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C4 TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C5 TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C6 TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
****************************************
>C1
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C2
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C3
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C4
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C5
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C6
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C1
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C2
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C3
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C4
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C5
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C6
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
MrBayes v3.2.2 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 6 taxa and 240 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Taxon 5 -> C5
Taxon 6 -> C6
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1579856719
Setting output file names to "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called first_pos
Defining charset called second_pos
Defining charset called third_pos
Defining partition called by_codon
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1714890374
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 5415670298
Seed = 1911374757
Swapseed = 1579856719
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Active parameters:
Partition(s)
Parameters 1 2 3
------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:Exponential(10.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.06 % Dirichlet(Revmat{all})
1.06 % Slider(Revmat{all})
1.06 % Dirichlet(Pi{all})
1.06 % Slider(Pi{all})
2.13 % Multiplier(Alpha{1,2})
2.13 % Multiplier(Alpha{3})
2.13 % Slider(Pinvar{all})
10.64 % ExtSPR(Tau{all},V{all})
10.64 % ExtTBR(Tau{all},V{all})
10.64 % NNI(Tau{all},V{all})
10.64 % ParsSPR(Tau{all},V{all})
31.91 % Multiplier(V{all})
10.64 % Nodeslider(V{all})
4.26 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -537.131472 -- -24.965149
Chain 2 -- -537.131472 -- -24.965149
Chain 3 -- -537.131503 -- -24.965149
Chain 4 -- -537.131472 -- -24.965149
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -537.131503 -- -24.965149
Chain 2 -- -537.131472 -- -24.965149
Chain 3 -- -537.131472 -- -24.965149
Chain 4 -- -537.131503 -- -24.965149
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-537.131] (-537.131) (-537.132) (-537.131) * [-537.132] (-537.131) (-537.131) (-537.132)
500 -- (-332.801) (-338.416) (-336.007) [-330.153] * (-338.761) [-330.993] (-335.489) (-336.193) -- 0:00:00
1000 -- [-332.864] (-335.891) (-329.749) (-338.590) * [-332.381] (-335.352) (-341.105) (-340.445) -- 0:00:00
1500 -- (-332.626) (-343.357) [-336.913] (-332.871) * (-331.884) (-336.157) (-337.953) [-333.400] -- 0:00:00
2000 -- (-336.802) [-331.533] (-336.163) (-335.836) * (-338.949) (-339.863) (-330.210) [-329.842] -- 0:00:00
2500 -- (-328.379) (-339.539) [-328.083] (-337.005) * (-332.603) [-339.670] (-334.958) (-336.839) -- 0:00:00
3000 -- [-332.759] (-331.746) (-331.094) (-329.235) * (-331.528) (-337.300) (-335.951) [-332.108] -- 0:00:00
3500 -- (-332.944) (-338.789) (-333.518) [-333.953] * (-335.112) [-333.734] (-336.946) (-338.605) -- 0:00:00
4000 -- (-334.692) [-334.218] (-332.730) (-336.220) * (-330.109) (-329.861) [-334.701] (-336.564) -- 0:00:00
4500 -- (-337.888) (-339.866) (-343.465) [-330.711] * (-332.051) [-335.475] (-333.418) (-336.302) -- 0:00:00
5000 -- (-333.008) (-335.084) (-327.382) [-329.644] * [-335.904] (-335.270) (-346.291) (-333.699) -- 0:00:00
Average standard deviation of split frequencies: 0.097274
5500 -- [-335.356] (-332.759) (-324.073) (-337.164) * [-337.758] (-337.241) (-344.831) (-335.599) -- 0:00:00
6000 -- [-334.623] (-333.217) (-325.573) (-334.945) * (-334.919) (-336.698) (-326.380) [-328.158] -- 0:00:00
6500 -- (-331.380) [-332.229] (-324.054) (-329.449) * (-334.000) [-332.616] (-325.472) (-339.168) -- 0:00:00
7000 -- [-336.112] (-338.550) (-328.994) (-343.095) * [-332.208] (-333.656) (-325.358) (-341.569) -- 0:00:00
7500 -- (-331.571) [-332.908] (-324.208) (-334.517) * (-340.277) (-333.331) [-325.859] (-338.304) -- 0:00:00
8000 -- (-337.452) (-334.391) (-325.059) [-330.217] * (-338.403) [-335.918] (-326.864) (-336.670) -- 0:00:00
8500 -- (-333.622) [-334.407] (-327.276) (-337.596) * (-333.329) (-342.533) [-327.130] (-340.788) -- 0:00:00
9000 -- (-333.648) (-333.449) (-323.844) [-330.100] * (-334.202) [-334.890] (-324.059) (-339.661) -- 0:01:50
9500 -- (-336.464) (-341.297) [-326.449] (-338.574) * (-345.709) (-337.790) [-325.076] (-341.658) -- 0:01:44
10000 -- (-334.533) (-337.703) [-323.607] (-336.350) * (-334.207) (-341.278) [-325.555] (-333.943) -- 0:01:39
Average standard deviation of split frequencies: 0.095017
10500 -- (-344.677) (-334.268) (-324.284) [-342.470] * (-337.810) (-347.233) (-324.672) [-340.187] -- 0:01:34
11000 -- (-338.917) [-339.300] (-325.729) (-335.633) * (-335.261) (-346.034) [-325.972] (-337.228) -- 0:01:29
11500 -- (-325.446) [-333.434] (-330.043) (-336.052) * [-334.538] (-338.076) (-326.054) (-330.895) -- 0:01:25
12000 -- (-325.217) [-337.846] (-325.655) (-333.862) * [-334.085] (-347.564) (-324.551) (-345.110) -- 0:01:22
12500 -- (-324.917) (-341.786) [-324.246] (-330.216) * (-333.197) (-350.617) [-328.917] (-334.315) -- 0:01:19
13000 -- (-324.318) (-341.761) (-323.884) [-329.685] * (-328.702) (-348.085) (-329.323) [-327.801] -- 0:01:15
13500 -- (-324.405) (-329.248) (-324.293) [-325.539] * (-334.527) (-345.688) (-326.631) [-324.005] -- 0:01:13
14000 -- (-324.238) (-331.688) [-325.752] (-324.055) * [-331.533] (-345.799) (-326.025) (-327.055) -- 0:01:10
14500 -- (-326.625) [-324.943] (-324.013) (-332.683) * (-333.780) (-336.216) [-326.622] (-327.175) -- 0:01:07
15000 -- (-326.112) (-325.380) [-324.740] (-327.674) * (-332.633) (-327.649) (-324.585) [-327.841] -- 0:01:05
Average standard deviation of split frequencies: 0.080204
15500 -- [-325.238] (-325.521) (-324.879) (-325.937) * [-336.459] (-329.502) (-327.186) (-325.456) -- 0:01:03
16000 -- [-326.808] (-324.636) (-326.269) (-324.575) * [-331.472] (-327.139) (-325.040) (-325.011) -- 0:01:01
16500 -- (-325.463) [-326.397] (-328.548) (-324.012) * (-353.176) (-324.829) (-324.520) [-326.001] -- 0:00:59
17000 -- (-324.136) [-326.386] (-324.045) (-323.960) * (-338.876) (-326.554) (-323.742) [-326.026] -- 0:00:57
17500 -- (-324.442) [-327.863] (-326.520) (-324.830) * (-339.805) (-326.433) (-324.888) [-324.357] -- 0:00:56
18000 -- (-326.309) [-324.426] (-325.957) (-327.965) * (-334.133) (-324.608) [-325.708] (-324.637) -- 0:00:54
18500 -- [-326.446] (-323.923) (-327.362) (-324.582) * (-334.444) [-324.124] (-326.657) (-324.777) -- 0:00:53
19000 -- (-326.454) (-332.380) (-326.638) [-326.071] * (-332.877) (-326.324) [-324.184] (-323.964) -- 0:00:51
19500 -- [-324.170] (-328.901) (-326.426) (-325.190) * (-334.069) (-325.829) [-325.061] (-325.341) -- 0:00:50
20000 -- [-324.286] (-323.901) (-324.623) (-329.126) * [-333.156] (-327.289) (-326.468) (-325.520) -- 0:00:49
Average standard deviation of split frequencies: 0.048303
20500 -- [-326.099] (-324.311) (-326.036) (-326.511) * (-334.897) [-324.553] (-324.871) (-326.671) -- 0:00:47
21000 -- (-323.951) (-325.220) [-326.006] (-323.768) * (-341.411) [-324.384] (-324.738) (-330.977) -- 0:00:46
21500 -- (-329.251) [-327.231] (-326.323) (-324.158) * [-331.754] (-323.910) (-326.325) (-329.143) -- 0:00:45
22000 -- [-327.308] (-324.537) (-330.893) (-323.508) * (-344.643) (-324.200) [-327.693] (-330.228) -- 0:00:44
22500 -- (-329.269) (-324.169) [-328.201] (-324.339) * (-340.853) (-323.881) [-327.226] (-328.328) -- 0:00:43
23000 -- (-326.949) [-324.007] (-327.221) (-325.688) * (-335.848) [-324.227] (-324.948) (-329.149) -- 0:00:42
23500 -- (-325.164) (-325.116) [-325.813] (-330.489) * [-336.977] (-323.676) (-327.429) (-324.233) -- 0:00:41
24000 -- [-326.148] (-326.052) (-326.601) (-328.639) * [-333.154] (-324.635) (-325.043) (-325.570) -- 0:00:40
24500 -- [-323.629] (-325.443) (-324.401) (-328.133) * (-357.096) [-326.421] (-326.299) (-324.372) -- 0:00:39
25000 -- (-324.937) [-323.759] (-329.416) (-325.587) * (-347.074) (-328.952) (-324.826) [-326.462] -- 0:00:39
Average standard deviation of split frequencies: 0.044145
25500 -- (-325.595) (-325.154) [-326.442] (-327.519) * (-333.232) [-326.810] (-326.259) (-325.994) -- 0:00:38
26000 -- (-325.476) [-325.361] (-324.233) (-329.011) * (-323.805) [-323.976] (-323.863) (-325.846) -- 0:01:14
26500 -- (-324.863) (-329.417) (-325.945) [-324.492] * [-324.786] (-326.019) (-325.665) (-326.878) -- 0:01:13
27000 -- (-324.035) (-326.983) [-323.678] (-324.731) * (-323.834) (-328.635) [-325.202] (-324.039) -- 0:01:12
27500 -- (-325.803) (-327.744) (-325.123) [-327.328] * [-324.513] (-331.056) (-325.614) (-326.797) -- 0:01:10
28000 -- (-323.848) (-326.528) (-324.767) [-326.573] * [-324.601] (-327.725) (-326.754) (-325.023) -- 0:01:09
28500 -- (-324.403) (-325.022) [-324.849] (-326.590) * [-324.105] (-325.556) (-328.327) (-323.895) -- 0:01:08
29000 -- (-324.971) (-324.669) (-325.387) [-325.511] * (-326.247) (-325.214) [-325.871] (-324.933) -- 0:01:06
29500 -- (-325.226) (-323.682) [-324.389] (-324.053) * (-324.748) (-326.317) (-328.360) [-326.100] -- 0:01:05
30000 -- (-324.966) (-325.586) [-324.881] (-332.959) * (-324.874) (-326.773) (-327.745) [-324.562] -- 0:01:04
Average standard deviation of split frequencies: 0.046814
30500 -- (-324.803) [-325.350] (-325.217) (-326.537) * (-325.685) (-325.338) [-327.781] (-327.080) -- 0:01:03
31000 -- (-329.653) (-326.535) [-323.613] (-326.775) * (-324.883) [-326.497] (-327.223) (-328.826) -- 0:01:02
31500 -- (-328.135) (-325.869) [-325.087] (-327.390) * (-324.473) (-327.249) [-326.575] (-326.287) -- 0:01:01
32000 -- (-327.688) (-324.864) (-328.666) [-326.711] * [-325.754] (-325.639) (-324.051) (-326.924) -- 0:01:00
32500 -- (-324.516) (-325.012) [-324.857] (-327.198) * (-328.483) [-327.013] (-329.006) (-327.490) -- 0:00:59
33000 -- (-327.491) (-326.998) (-325.178) [-327.292] * (-326.400) (-325.191) (-325.340) [-324.089] -- 0:00:58
33500 -- [-324.002] (-325.652) (-323.793) (-328.165) * [-329.343] (-323.786) (-324.851) (-324.896) -- 0:00:57
34000 -- (-323.945) (-325.653) (-325.641) [-325.439] * (-326.682) (-324.081) [-323.912] (-326.404) -- 0:00:56
34500 -- (-324.350) (-323.583) (-325.529) [-329.192] * (-325.205) (-324.125) [-325.034] (-324.042) -- 0:00:55
35000 -- (-325.266) [-325.993] (-326.070) (-325.098) * (-325.923) (-324.443) (-325.907) [-324.260] -- 0:00:55
Average standard deviation of split frequencies: 0.052378
35500 -- [-324.846] (-329.204) (-325.359) (-324.976) * (-324.921) (-326.153) [-325.120] (-325.021) -- 0:00:54
36000 -- (-326.301) (-323.723) [-327.101] (-325.275) * [-328.635] (-324.326) (-329.471) (-327.145) -- 0:00:53
36500 -- [-324.469] (-325.628) (-326.567) (-325.862) * [-325.043] (-327.209) (-325.520) (-326.523) -- 0:00:52
37000 -- (-329.580) [-323.797] (-325.327) (-327.126) * (-324.563) [-325.022] (-325.035) (-328.529) -- 0:00:52
37500 -- (-327.916) (-324.381) (-325.983) [-324.817] * (-323.983) (-328.104) (-324.562) [-326.518] -- 0:00:51
38000 -- [-326.728] (-325.215) (-325.880) (-326.003) * [-324.458] (-324.069) (-324.552) (-327.296) -- 0:00:50
38500 -- [-324.182] (-326.733) (-325.769) (-325.426) * (-325.875) (-325.073) (-326.584) [-324.914] -- 0:00:49
39000 -- [-324.952] (-325.753) (-326.815) (-324.932) * (-324.681) [-324.767] (-325.514) (-326.619) -- 0:00:49
39500 -- [-324.302] (-330.081) (-326.708) (-325.867) * [-326.438] (-325.393) (-326.107) (-325.744) -- 0:00:48
40000 -- (-326.767) (-324.952) (-326.368) [-326.347] * (-329.348) (-323.810) [-329.084] (-325.492) -- 0:00:48
Average standard deviation of split frequencies: 0.053902
40500 -- (-327.096) (-325.160) (-325.635) [-326.380] * (-325.701) (-325.922) (-328.306) [-325.122] -- 0:00:47
41000 -- (-328.233) (-327.375) [-324.715] (-327.805) * (-326.008) (-327.551) [-325.808] (-327.418) -- 0:00:46
41500 -- (-326.093) [-325.599] (-325.091) (-325.856) * (-326.475) (-325.551) (-323.686) [-326.023] -- 0:00:46
42000 -- [-325.905] (-324.055) (-327.936) (-327.070) * (-328.136) [-326.331] (-327.126) (-327.494) -- 0:00:45
42500 -- (-323.601) [-325.502] (-325.728) (-325.707) * (-328.165) (-325.864) [-324.921] (-326.171) -- 0:00:45
43000 -- [-325.013] (-326.173) (-324.877) (-324.404) * [-326.427] (-323.993) (-325.341) (-325.362) -- 0:01:06
43500 -- (-325.688) [-325.440] (-325.229) (-324.383) * [-325.104] (-324.058) (-325.322) (-323.771) -- 0:01:05
44000 -- (-324.063) (-328.073) [-327.370] (-326.872) * (-328.619) (-326.352) (-330.161) [-326.074] -- 0:01:05
44500 -- (-325.926) (-326.036) (-325.339) [-325.564] * [-332.849] (-326.763) (-324.408) (-332.183) -- 0:01:04
45000 -- [-331.094] (-323.903) (-325.176) (-324.944) * (-324.221) [-327.207] (-324.802) (-330.060) -- 0:01:03
Average standard deviation of split frequencies: 0.043787
45500 -- (-324.810) (-324.149) (-323.627) [-324.785] * [-326.666] (-327.360) (-324.284) (-324.457) -- 0:01:02
46000 -- [-328.692] (-324.599) (-325.510) (-333.662) * (-324.907) (-327.795) [-327.093] (-327.310) -- 0:01:02
46500 -- [-326.692] (-325.937) (-326.418) (-325.440) * [-326.089] (-324.485) (-326.714) (-326.124) -- 0:01:01
47000 -- (-325.562) (-328.521) [-328.188] (-326.782) * [-328.767] (-327.045) (-326.555) (-324.741) -- 0:01:00
47500 -- [-325.040] (-330.066) (-324.206) (-324.991) * (-324.113) (-324.465) (-326.983) [-324.947] -- 0:01:00
48000 -- (-324.092) (-324.082) [-325.854] (-324.432) * (-327.358) [-324.582] (-326.615) (-324.988) -- 0:00:59
48500 -- (-323.723) (-327.810) (-328.218) [-323.862] * (-324.212) (-329.840) (-330.119) [-325.990] -- 0:00:58
49000 -- [-325.091] (-325.199) (-327.046) (-328.292) * (-324.987) (-327.269) [-328.542] (-326.975) -- 0:00:58
49500 -- (-324.818) [-325.135] (-325.359) (-326.322) * (-326.184) [-324.050] (-324.557) (-324.768) -- 0:00:57
50000 -- [-325.673] (-325.766) (-325.115) (-325.388) * (-324.501) [-325.349] (-326.976) (-326.977) -- 0:00:57
Average standard deviation of split frequencies: 0.041204
50500 -- (-328.252) (-326.172) [-326.296] (-328.900) * [-325.314] (-329.880) (-324.554) (-330.920) -- 0:00:56
51000 -- [-328.334] (-327.862) (-326.936) (-323.559) * (-324.091) [-328.979] (-324.114) (-330.032) -- 0:00:55
51500 -- [-325.455] (-325.930) (-325.458) (-324.686) * [-325.013] (-328.672) (-324.327) (-328.274) -- 0:00:55
52000 -- (-324.848) (-325.670) (-328.925) [-325.147] * (-327.335) (-326.592) [-323.875] (-331.011) -- 0:00:54
52500 -- (-325.575) (-325.699) (-326.872) [-323.579] * (-325.899) [-327.386] (-324.553) (-323.915) -- 0:00:54
53000 -- (-325.868) [-329.146] (-327.279) (-323.557) * (-327.459) (-327.774) [-326.697] (-325.537) -- 0:00:53
53500 -- (-329.843) (-327.714) [-324.945] (-324.797) * (-326.527) (-325.531) (-327.151) [-325.249] -- 0:00:53
54000 -- [-327.629] (-323.752) (-325.164) (-324.293) * (-325.693) (-326.908) [-325.220] (-325.225) -- 0:00:52
54500 -- [-329.416] (-328.466) (-325.093) (-324.704) * (-326.902) (-329.230) [-323.856] (-323.688) -- 0:00:52
55000 -- [-327.186] (-327.435) (-327.597) (-327.388) * (-328.642) [-325.561] (-326.266) (-324.676) -- 0:00:51
Average standard deviation of split frequencies: 0.036618
55500 -- (-327.102) (-328.905) [-325.545] (-326.155) * (-326.077) (-324.231) [-327.394] (-329.070) -- 0:00:51
56000 -- (-324.231) [-325.334] (-325.609) (-325.965) * (-329.836) [-323.473] (-327.965) (-328.285) -- 0:00:50
56500 -- (-326.186) [-326.960] (-327.160) (-324.765) * (-324.452) (-324.442) (-329.064) [-326.993] -- 0:00:50
57000 -- (-327.729) (-330.608) [-324.058] (-324.186) * (-325.856) (-323.858) (-329.437) [-324.526] -- 0:00:49
57500 -- (-326.268) (-325.885) (-323.686) [-325.077] * (-323.530) [-326.561] (-326.642) (-323.774) -- 0:00:49
58000 -- [-324.259] (-325.608) (-329.595) (-327.328) * (-323.711) (-326.205) [-323.881] (-324.904) -- 0:00:48
58500 -- [-323.504] (-324.180) (-325.557) (-329.856) * (-326.739) (-329.085) (-325.296) [-325.824] -- 0:00:48
59000 -- (-324.062) (-324.808) [-324.413] (-323.628) * [-325.800] (-328.155) (-329.626) (-330.637) -- 0:00:47
59500 -- (-325.439) (-323.782) [-324.528] (-324.573) * (-324.108) (-327.670) (-324.869) [-327.680] -- 0:00:47
60000 -- (-324.178) (-325.616) [-325.765] (-329.574) * (-325.056) (-324.375) [-325.785] (-324.892) -- 0:01:02
Average standard deviation of split frequencies: 0.044987
60500 -- (-325.691) (-330.871) [-324.109] (-330.100) * [-324.493] (-329.176) (-326.542) (-324.967) -- 0:01:02
61000 -- (-326.265) (-325.183) [-324.186] (-327.537) * [-324.593] (-325.167) (-324.503) (-324.678) -- 0:01:01
61500 -- (-324.120) (-325.151) [-325.703] (-331.724) * [-324.353] (-325.434) (-324.483) (-332.812) -- 0:01:01
62000 -- [-325.736] (-327.863) (-325.992) (-328.378) * [-326.369] (-325.202) (-328.269) (-328.381) -- 0:01:00
62500 -- (-325.549) (-334.136) (-330.602) [-332.100] * (-324.623) (-325.388) (-325.647) [-325.563] -- 0:01:00
63000 -- (-325.064) (-331.425) [-327.128] (-331.734) * (-324.127) (-325.038) (-324.598) [-329.379] -- 0:00:59
63500 -- (-328.988) (-332.879) (-327.627) [-325.846] * (-325.313) (-326.466) [-327.228] (-328.446) -- 0:00:58
64000 -- (-328.798) (-327.556) [-323.788] (-325.536) * [-324.796] (-327.504) (-323.809) (-325.403) -- 0:00:58
64500 -- (-327.573) (-324.326) [-323.794] (-325.440) * [-323.981] (-327.859) (-324.417) (-324.855) -- 0:00:58
65000 -- (-326.221) (-324.280) (-324.224) [-324.145] * (-324.096) (-325.084) [-324.975] (-324.595) -- 0:00:57
Average standard deviation of split frequencies: 0.036037
65500 -- [-325.396] (-324.181) (-326.866) (-327.053) * (-324.235) (-332.945) (-330.205) [-326.173] -- 0:00:57
66000 -- (-328.795) (-327.067) [-326.504] (-326.365) * (-326.156) [-333.619] (-331.402) (-326.661) -- 0:00:56
66500 -- (-324.640) (-326.622) (-328.367) [-324.399] * (-324.148) [-326.813] (-323.679) (-327.252) -- 0:00:56
67000 -- (-328.567) (-326.274) (-323.571) [-324.541] * [-323.481] (-324.086) (-324.589) (-325.420) -- 0:00:55
67500 -- (-328.293) [-325.360] (-323.792) (-324.869) * [-324.601] (-327.515) (-323.995) (-323.817) -- 0:00:55
68000 -- (-325.037) (-325.201) (-327.276) [-324.712] * (-329.402) (-326.659) [-324.291] (-328.746) -- 0:00:54
68500 -- (-328.123) (-324.712) (-329.024) [-325.483] * (-326.516) (-328.120) [-326.525] (-325.868) -- 0:00:54
69000 -- (-324.225) (-325.849) [-325.691] (-327.198) * (-328.785) (-324.410) [-325.094] (-326.220) -- 0:00:53
69500 -- (-323.395) (-326.848) (-328.017) [-325.693] * (-327.509) (-325.231) [-324.840] (-328.136) -- 0:00:53
70000 -- (-328.276) (-323.357) [-326.336] (-326.481) * (-327.887) (-327.290) [-324.342] (-325.419) -- 0:00:53
Average standard deviation of split frequencies: 0.034307
70500 -- (-326.953) (-324.380) (-327.550) [-327.075] * (-324.284) [-324.543] (-323.856) (-325.134) -- 0:00:52
71000 -- (-325.096) (-324.289) [-325.023] (-331.293) * (-325.217) [-324.767] (-331.053) (-325.826) -- 0:00:52
71500 -- (-325.837) (-324.481) [-326.165] (-323.703) * (-327.370) (-324.624) [-328.059] (-326.604) -- 0:00:51
72000 -- [-325.789] (-325.027) (-328.914) (-326.623) * (-325.619) (-323.529) (-324.768) [-324.510] -- 0:00:51
72500 -- [-324.887] (-324.011) (-331.313) (-325.662) * [-325.483] (-323.929) (-323.704) (-324.465) -- 0:00:51
73000 -- [-328.054] (-325.325) (-327.434) (-325.128) * [-324.399] (-325.599) (-323.582) (-324.545) -- 0:00:50
73500 -- (-326.922) (-323.669) [-327.335] (-324.838) * (-324.955) (-324.949) (-326.415) [-323.307] -- 0:00:50
74000 -- (-326.892) (-326.171) [-326.864] (-323.926) * (-324.308) [-324.299] (-327.954) (-324.872) -- 0:00:50
74500 -- (-325.779) (-328.911) (-326.189) [-324.616] * (-325.217) (-326.412) [-326.619] (-325.515) -- 0:00:49
75000 -- (-326.834) [-329.157] (-324.321) (-327.182) * (-326.644) (-327.983) [-324.322] (-328.901) -- 0:00:49
Average standard deviation of split frequencies: 0.034115
75500 -- (-325.889) (-324.165) [-325.976] (-324.363) * (-327.202) (-327.662) (-324.193) [-326.125] -- 0:00:48
76000 -- (-326.505) (-326.051) [-327.475] (-329.527) * (-327.399) (-327.701) [-327.151] (-326.322) -- 0:00:48
76500 -- (-325.634) (-325.210) (-325.020) [-325.108] * (-324.588) (-324.368) (-326.848) [-327.052] -- 0:00:48
77000 -- (-326.240) [-325.282] (-325.564) (-330.256) * (-325.197) (-325.613) (-326.038) [-324.620] -- 0:00:59
77500 -- (-325.011) [-323.332] (-325.919) (-324.486) * (-324.171) (-325.702) [-325.057] (-325.303) -- 0:00:59
78000 -- (-328.199) (-325.250) (-326.281) [-324.062] * (-324.889) (-325.538) (-325.618) [-324.928] -- 0:00:59
78500 -- (-327.499) [-327.701] (-329.110) (-327.391) * (-330.126) (-324.952) (-326.586) [-325.355] -- 0:00:58
79000 -- (-325.058) (-325.645) (-330.292) [-327.839] * (-325.512) (-325.839) [-326.021] (-326.383) -- 0:00:58
79500 -- [-324.180] (-324.904) (-329.512) (-324.567) * (-323.983) (-325.983) (-324.792) [-326.517] -- 0:00:57
80000 -- (-326.631) [-323.861] (-324.535) (-325.386) * (-326.166) (-325.138) (-326.076) [-325.811] -- 0:00:57
Average standard deviation of split frequencies: 0.033218
80500 -- (-324.863) [-326.370] (-324.144) (-324.485) * (-326.858) (-331.370) (-328.551) [-326.171] -- 0:00:57
81000 -- (-325.799) (-324.044) (-331.634) [-327.035] * (-324.116) (-326.302) (-329.409) [-324.536] -- 0:00:56
81500 -- (-326.555) (-324.049) (-333.135) [-325.933] * (-324.038) (-327.479) (-327.891) [-326.305] -- 0:00:56
82000 -- (-327.826) (-324.273) [-330.938] (-325.298) * [-325.077] (-323.967) (-324.020) (-325.847) -- 0:00:55
82500 -- (-327.033) [-324.548] (-329.394) (-326.898) * (-327.917) [-325.164] (-327.553) (-324.752) -- 0:00:55
83000 -- (-326.686) (-326.687) (-326.983) [-326.275] * (-324.831) [-327.117] (-329.996) (-329.667) -- 0:00:55
83500 -- [-326.048] (-327.014) (-326.782) (-328.390) * (-325.170) [-326.044] (-325.556) (-331.173) -- 0:00:54
84000 -- (-326.363) [-324.051] (-323.939) (-328.443) * (-324.810) [-330.449] (-326.093) (-327.088) -- 0:00:54
84500 -- [-326.346] (-323.454) (-323.811) (-325.228) * [-325.870] (-332.841) (-324.021) (-324.114) -- 0:00:54
85000 -- (-331.676) (-324.669) (-326.682) [-325.901] * [-323.522] (-324.669) (-324.473) (-325.620) -- 0:00:53
Average standard deviation of split frequencies: 0.031062
85500 -- (-328.053) (-324.723) (-324.396) [-324.820] * (-329.835) (-325.011) [-326.113] (-323.446) -- 0:00:53
86000 -- (-325.578) (-326.770) [-327.230] (-324.099) * (-326.652) [-329.948] (-325.650) (-324.725) -- 0:00:53
86500 -- (-325.111) (-330.535) (-325.663) [-325.836] * [-327.066] (-325.560) (-326.770) (-324.022) -- 0:00:52
87000 -- (-327.701) (-327.422) (-326.207) [-324.962] * (-325.564) (-324.308) [-324.843] (-324.410) -- 0:00:52
87500 -- [-326.103] (-325.003) (-329.134) (-326.595) * (-326.640) (-326.002) (-324.446) [-325.433] -- 0:00:52
88000 -- (-324.755) (-330.127) [-326.695] (-326.028) * [-325.433] (-324.436) (-324.385) (-324.258) -- 0:00:51
88500 -- (-325.946) [-327.224] (-325.352) (-326.816) * (-325.879) (-324.835) (-325.686) [-325.829] -- 0:00:51
89000 -- (-326.385) (-327.609) [-323.916] (-328.492) * (-326.126) [-324.945] (-328.007) (-325.489) -- 0:00:51
89500 -- [-324.301] (-326.993) (-326.954) (-324.361) * (-325.071) [-325.309] (-325.401) (-328.709) -- 0:00:50
90000 -- (-323.998) [-326.259] (-324.070) (-328.294) * [-324.062] (-324.613) (-324.190) (-325.326) -- 0:00:50
Average standard deviation of split frequencies: 0.031196
90500 -- [-325.370] (-326.669) (-325.537) (-333.117) * (-323.800) (-326.539) (-326.056) [-325.343] -- 0:00:50
91000 -- (-327.215) (-324.941) (-324.034) [-325.539] * (-325.845) (-328.115) [-325.214] (-325.934) -- 0:00:49
91500 -- (-326.914) (-328.299) (-325.402) [-323.674] * [-326.209] (-328.027) (-325.935) (-325.899) -- 0:00:49
92000 -- (-325.710) (-326.133) (-328.188) [-323.797] * [-324.814] (-325.434) (-328.683) (-327.016) -- 0:00:49
92500 -- (-327.217) [-328.092] (-325.296) (-324.770) * [-328.435] (-327.529) (-326.131) (-324.768) -- 0:00:49
93000 -- (-324.789) (-327.333) [-326.764] (-324.685) * (-330.230) (-326.892) [-328.506] (-323.964) -- 0:00:48
93500 -- (-326.980) (-324.830) (-326.859) [-325.210] * (-328.859) (-328.265) [-325.907] (-323.525) -- 0:00:48
94000 -- [-325.913] (-324.795) (-325.712) (-325.072) * (-326.011) (-326.158) [-328.699] (-329.624) -- 0:00:48
94500 -- (-326.395) [-325.074] (-325.480) (-323.788) * (-325.292) (-326.935) (-326.172) [-326.753] -- 0:00:57
95000 -- (-327.161) [-324.944] (-328.142) (-325.028) * (-326.207) (-327.235) (-328.005) [-326.514] -- 0:00:57
Average standard deviation of split frequencies: 0.030497
95500 -- (-324.802) (-326.391) [-324.285] (-324.889) * (-324.877) [-330.938] (-327.267) (-327.722) -- 0:00:56
96000 -- (-323.770) [-324.337] (-324.423) (-324.202) * (-324.523) (-324.519) (-325.479) [-325.452] -- 0:00:56
96500 -- (-324.252) [-326.924] (-325.596) (-323.368) * (-324.648) (-326.379) [-326.538] (-324.799) -- 0:00:56
97000 -- (-323.905) [-327.636] (-323.937) (-324.061) * [-329.704] (-326.459) (-324.200) (-330.000) -- 0:00:55
97500 -- [-324.901] (-325.100) (-325.189) (-325.571) * (-325.548) (-325.671) [-324.778] (-324.095) -- 0:00:55
98000 -- (-325.672) (-324.170) (-324.620) [-326.112] * [-327.103] (-323.554) (-325.569) (-324.675) -- 0:00:55
98500 -- (-324.648) [-327.785] (-324.133) (-327.648) * [-329.904] (-323.680) (-328.034) (-327.073) -- 0:00:54
99000 -- (-325.058) (-325.457) (-325.109) [-325.999] * (-330.118) (-326.402) (-325.900) [-325.469] -- 0:00:54
99500 -- [-325.807] (-328.043) (-325.803) (-328.413) * (-329.932) [-325.775] (-326.810) (-323.909) -- 0:00:54
100000 -- [-324.813] (-334.512) (-323.688) (-330.772) * (-329.708) (-332.777) (-328.860) [-330.706] -- 0:00:54
Average standard deviation of split frequencies: 0.028617
100500 -- (-324.382) [-325.243] (-324.982) (-325.369) * (-326.622) (-324.619) [-326.498] (-325.237) -- 0:00:53
101000 -- (-326.265) [-326.297] (-327.278) (-324.972) * [-327.729] (-327.024) (-327.708) (-325.213) -- 0:00:53
101500 -- [-324.474] (-324.704) (-323.974) (-325.728) * [-327.120] (-324.779) (-324.390) (-325.660) -- 0:00:53
102000 -- [-324.956] (-328.496) (-327.695) (-325.845) * [-324.347] (-323.967) (-327.815) (-325.587) -- 0:00:52
102500 -- (-325.098) [-326.034] (-329.781) (-326.986) * [-328.200] (-326.313) (-327.825) (-323.570) -- 0:00:52
103000 -- (-328.955) [-326.809] (-329.152) (-326.751) * (-325.289) [-324.679] (-324.954) (-327.818) -- 0:00:52
103500 -- [-323.990] (-325.038) (-324.444) (-327.895) * (-324.677) (-325.149) [-325.956] (-328.852) -- 0:00:51
104000 -- [-325.686] (-328.156) (-324.163) (-327.403) * (-325.836) (-324.273) [-325.582] (-324.086) -- 0:00:51
104500 -- (-325.113) (-327.981) [-325.923] (-326.310) * (-324.333) [-324.488] (-330.796) (-324.467) -- 0:00:51
105000 -- (-325.275) (-326.836) [-325.590] (-324.292) * (-326.077) (-324.623) (-327.739) [-332.271] -- 0:00:51
Average standard deviation of split frequencies: 0.030896
105500 -- (-326.247) (-328.917) (-328.118) [-323.400] * (-324.422) (-325.223) (-329.634) [-324.034] -- 0:00:50
106000 -- (-328.379) (-326.601) [-325.208] (-324.435) * (-324.619) (-328.712) (-326.810) [-323.689] -- 0:00:50
106500 -- [-325.267] (-325.176) (-325.725) (-324.817) * (-327.893) (-329.132) [-324.215] (-324.490) -- 0:00:50
107000 -- (-324.670) (-329.899) (-327.798) [-323.903] * (-325.947) [-324.681] (-326.503) (-325.924) -- 0:00:50
107500 -- (-323.833) (-325.075) [-326.909] (-324.723) * (-323.737) (-327.554) (-328.277) [-326.783] -- 0:00:49
108000 -- (-324.787) (-325.959) (-328.202) [-325.433] * (-327.569) (-324.469) [-325.202] (-327.053) -- 0:00:49
108500 -- [-328.576] (-327.564) (-326.180) (-327.258) * (-325.913) (-324.846) [-324.568] (-327.577) -- 0:00:49
109000 -- [-325.357] (-325.008) (-325.085) (-328.070) * [-326.412] (-324.260) (-324.844) (-327.452) -- 0:00:49
109500 -- (-327.892) [-327.593] (-324.376) (-324.352) * (-323.636) (-325.840) [-323.413] (-324.816) -- 0:00:48
110000 -- (-327.509) (-326.879) [-324.917] (-324.082) * (-326.932) [-326.218] (-324.855) (-323.754) -- 0:00:48
Average standard deviation of split frequencies: 0.028398
110500 -- (-324.941) (-325.220) [-324.473] (-328.183) * (-324.380) (-326.077) [-323.882] (-325.838) -- 0:00:48
111000 -- (-324.859) (-324.860) [-325.687] (-325.304) * (-325.587) [-326.552] (-323.696) (-327.771) -- 0:00:48
111500 -- [-324.462] (-323.505) (-323.540) (-324.903) * (-325.223) (-327.739) (-328.628) [-324.035] -- 0:00:55
112000 -- (-324.827) (-324.829) (-327.379) [-326.988] * (-327.419) [-325.371] (-324.614) (-327.338) -- 0:00:55
112500 -- [-325.930] (-324.845) (-323.858) (-324.921) * [-324.410] (-323.642) (-326.170) (-324.247) -- 0:00:55
113000 -- (-333.709) (-325.702) [-324.440] (-326.226) * (-325.998) [-325.875] (-325.634) (-325.286) -- 0:00:54
113500 -- (-328.668) [-323.683] (-324.926) (-325.773) * (-326.478) (-324.893) [-327.580] (-326.240) -- 0:00:54
114000 -- (-323.609) [-325.727] (-324.423) (-325.487) * (-331.977) (-326.668) [-323.960] (-329.236) -- 0:00:54
114500 -- (-323.521) (-326.572) [-325.629] (-326.072) * (-335.063) [-325.133] (-326.923) (-326.493) -- 0:00:54
115000 -- (-323.543) (-329.783) [-324.281] (-326.581) * (-326.213) [-324.001] (-333.021) (-326.427) -- 0:00:53
Average standard deviation of split frequencies: 0.025512
115500 -- (-323.878) (-328.342) [-323.453] (-326.939) * (-324.195) [-325.809] (-325.805) (-327.478) -- 0:00:53
116000 -- (-323.789) (-325.791) [-326.524] (-324.792) * [-324.640] (-327.950) (-326.766) (-324.952) -- 0:00:53
116500 -- [-324.061] (-324.475) (-325.082) (-323.633) * (-327.640) (-325.595) (-324.096) [-325.458] -- 0:00:53
117000 -- (-324.020) (-325.520) (-323.433) [-324.843] * [-330.241] (-326.290) (-324.153) (-326.475) -- 0:00:52
117500 -- (-323.682) (-326.341) (-324.390) [-325.967] * (-324.470) (-326.596) (-327.364) [-324.148] -- 0:00:52
118000 -- (-326.360) (-325.776) (-328.233) [-325.310] * (-328.145) (-325.985) (-324.275) [-324.312] -- 0:00:52
118500 -- [-324.069] (-326.508) (-326.833) (-327.556) * [-324.531] (-327.352) (-324.253) (-324.012) -- 0:00:52
119000 -- [-325.284] (-326.655) (-326.432) (-326.760) * (-325.475) (-325.971) [-324.034] (-324.298) -- 0:00:51
119500 -- (-327.101) (-328.870) [-328.581] (-324.648) * (-326.661) (-326.348) [-329.327] (-325.754) -- 0:00:51
120000 -- (-325.757) (-325.728) (-326.242) [-324.647] * (-325.062) [-324.378] (-327.957) (-325.048) -- 0:00:51
Average standard deviation of split frequencies: 0.021831
120500 -- (-323.719) (-325.008) [-326.560] (-324.105) * (-324.536) (-323.797) (-328.633) [-325.389] -- 0:00:51
121000 -- (-331.470) (-326.315) (-325.889) [-324.777] * (-327.361) (-323.332) (-325.195) [-328.548] -- 0:00:50
121500 -- (-328.407) (-324.805) [-325.183] (-324.732) * [-323.582] (-324.260) (-332.508) (-324.670) -- 0:00:50
122000 -- [-325.145] (-326.164) (-329.895) (-325.479) * (-325.486) (-326.096) [-325.323] (-326.265) -- 0:00:50
122500 -- [-327.852] (-325.034) (-326.068) (-325.332) * (-327.800) (-324.994) [-326.820] (-326.190) -- 0:00:50
123000 -- (-325.425) [-324.674] (-328.913) (-325.277) * [-327.348] (-328.241) (-326.491) (-326.285) -- 0:00:49
123500 -- (-324.894) (-326.660) (-326.338) [-325.096] * (-327.422) [-325.242] (-328.387) (-330.564) -- 0:00:49
124000 -- [-325.511] (-325.090) (-325.979) (-323.975) * (-324.563) (-324.489) (-324.268) [-323.447] -- 0:00:49
124500 -- [-326.013] (-326.550) (-325.708) (-325.497) * [-327.371] (-325.961) (-326.474) (-328.016) -- 0:00:49
125000 -- (-327.512) [-329.028] (-327.030) (-327.314) * (-324.904) [-324.678] (-326.341) (-324.077) -- 0:00:49
Average standard deviation of split frequencies: 0.019954
125500 -- [-326.302] (-323.647) (-326.722) (-327.683) * (-324.896) [-323.933] (-324.214) (-323.778) -- 0:00:48
126000 -- (-324.440) (-325.046) (-326.687) [-323.983] * (-326.764) [-325.400] (-328.066) (-326.764) -- 0:00:48
126500 -- (-324.932) [-330.110] (-325.692) (-324.059) * (-327.352) [-323.402] (-329.479) (-323.803) -- 0:00:48
127000 -- (-325.195) (-325.460) (-324.017) [-324.110] * (-326.260) (-323.499) (-325.152) [-324.479] -- 0:00:48
127500 -- [-326.449] (-328.478) (-324.530) (-325.136) * [-330.997] (-324.180) (-324.850) (-326.389) -- 0:00:47
128000 -- (-325.295) (-325.006) (-327.002) [-323.292] * (-329.561) (-324.406) (-326.564) [-323.851] -- 0:00:47
128500 -- (-323.695) (-325.237) (-326.985) [-326.283] * (-327.639) (-324.736) (-323.953) [-323.401] -- 0:00:47
129000 -- [-324.098] (-323.937) (-326.130) (-324.606) * (-324.773) [-324.812] (-324.026) (-324.567) -- 0:00:54
129500 -- [-323.562] (-326.002) (-330.173) (-326.449) * (-326.553) (-324.634) (-324.425) [-325.097] -- 0:00:53
130000 -- [-323.776] (-326.679) (-324.778) (-323.866) * (-331.774) [-325.693] (-329.690) (-328.602) -- 0:00:53
Average standard deviation of split frequencies: 0.019041
130500 -- (-325.497) [-327.579] (-327.776) (-323.727) * [-324.805] (-325.495) (-334.920) (-325.792) -- 0:00:53
131000 -- [-325.211] (-326.643) (-331.635) (-326.603) * (-326.019) [-324.445] (-327.503) (-327.849) -- 0:00:53
131500 -- [-325.624] (-326.640) (-326.109) (-325.386) * (-326.991) (-327.386) [-325.093] (-324.101) -- 0:00:52
132000 -- (-324.784) (-327.566) (-324.833) [-324.285] * (-324.771) (-324.829) (-326.677) [-324.555] -- 0:00:52
132500 -- (-325.484) [-325.092] (-325.010) (-325.217) * (-330.126) (-324.966) (-332.394) [-325.604] -- 0:00:52
133000 -- (-324.681) (-324.476) [-327.321] (-327.092) * (-329.279) [-325.691] (-328.179) (-324.158) -- 0:00:52
133500 -- (-325.255) (-332.776) [-325.347] (-326.220) * (-325.553) [-324.577] (-326.875) (-325.946) -- 0:00:51
134000 -- [-325.953] (-327.366) (-326.589) (-326.209) * (-325.913) (-324.908) (-325.538) [-325.530] -- 0:00:51
134500 -- (-323.513) (-325.321) [-327.402] (-325.516) * (-326.537) [-325.806] (-326.703) (-326.020) -- 0:00:51
135000 -- (-324.551) [-323.715] (-329.907) (-324.220) * (-324.261) (-326.654) [-326.678] (-327.740) -- 0:00:51
Average standard deviation of split frequencies: 0.022338
135500 -- (-326.461) [-324.893] (-329.976) (-326.793) * [-324.645] (-324.514) (-325.272) (-326.076) -- 0:00:51
136000 -- (-324.105) [-325.088] (-328.894) (-325.787) * (-323.839) (-326.474) [-324.734] (-325.563) -- 0:00:50
136500 -- (-324.575) (-327.608) [-326.208] (-324.701) * (-330.055) [-326.699] (-330.165) (-326.782) -- 0:00:50
137000 -- (-326.100) (-323.929) (-325.423) [-325.770] * (-327.820) (-324.735) [-325.751] (-326.411) -- 0:00:50
137500 -- (-327.372) (-330.320) [-324.487] (-326.626) * [-324.264] (-326.660) (-324.743) (-326.445) -- 0:00:50
138000 -- [-327.371] (-326.061) (-325.368) (-325.267) * (-323.653) (-324.619) [-330.017] (-326.343) -- 0:00:49
138500 -- (-326.935) (-326.039) [-325.706] (-325.165) * (-325.172) [-323.763] (-327.638) (-332.039) -- 0:00:49
139000 -- (-323.423) [-326.187] (-325.943) (-325.008) * (-323.486) (-325.045) [-324.221] (-328.697) -- 0:00:49
139500 -- (-325.406) [-324.344] (-325.410) (-324.171) * [-325.246] (-325.307) (-326.311) (-324.062) -- 0:00:49
140000 -- (-325.285) (-325.060) [-327.094] (-328.000) * (-324.831) [-325.366] (-325.421) (-324.858) -- 0:00:49
Average standard deviation of split frequencies: 0.020989
140500 -- [-325.176] (-325.898) (-327.803) (-326.062) * (-325.630) [-324.910] (-326.020) (-327.181) -- 0:00:48
141000 -- (-324.353) (-324.654) [-324.448] (-328.069) * [-326.324] (-327.801) (-324.306) (-326.127) -- 0:00:48
141500 -- [-325.681] (-326.322) (-325.271) (-330.562) * (-328.434) [-326.804] (-323.840) (-334.418) -- 0:00:48
142000 -- (-325.289) (-325.262) (-325.808) [-326.748] * [-324.228] (-324.180) (-323.964) (-326.784) -- 0:00:48
142500 -- [-326.238] (-325.954) (-325.140) (-324.130) * (-325.346) (-324.300) (-325.949) [-326.451] -- 0:00:48
143000 -- (-326.043) [-323.245] (-325.762) (-326.674) * (-325.035) (-328.533) (-326.781) [-324.347] -- 0:00:47
143500 -- (-325.955) [-325.621] (-326.082) (-327.901) * (-327.872) (-329.185) [-324.669] (-326.135) -- 0:00:47
144000 -- (-323.682) (-331.145) [-325.291] (-327.165) * (-328.147) (-325.160) (-328.991) [-327.892] -- 0:00:47
144500 -- (-324.751) (-342.105) [-325.434] (-325.427) * (-328.563) (-326.615) (-324.002) [-325.506] -- 0:00:47
145000 -- (-325.843) (-324.868) [-325.483] (-326.928) * (-328.828) [-325.516] (-324.441) (-328.304) -- 0:00:47
Average standard deviation of split frequencies: 0.021794
145500 -- (-324.321) (-324.456) (-323.425) [-325.855] * [-325.728] (-325.069) (-323.699) (-326.116) -- 0:00:46
146000 -- (-328.400) (-324.623) [-327.240] (-326.079) * (-324.633) (-325.853) [-328.391] (-326.632) -- 0:00:46
146500 -- (-325.244) (-324.481) (-326.498) [-325.415] * [-324.982] (-330.367) (-327.756) (-326.958) -- 0:00:52
147000 -- (-326.491) (-325.436) [-324.281] (-331.191) * (-323.801) (-330.471) [-325.213] (-325.873) -- 0:00:52
147500 -- (-327.583) (-327.053) (-324.841) [-325.387] * [-323.439] (-328.667) (-326.547) (-324.379) -- 0:00:52
148000 -- (-325.111) (-323.406) (-324.201) [-327.889] * (-327.543) (-324.804) [-325.548] (-324.483) -- 0:00:51
148500 -- (-324.065) [-325.978] (-324.250) (-331.085) * (-324.223) (-324.725) (-325.415) [-324.878] -- 0:00:51
149000 -- (-324.418) (-324.163) (-324.387) [-324.275] * (-326.149) [-325.848] (-325.373) (-324.271) -- 0:00:51
149500 -- (-327.425) (-324.937) (-325.480) [-326.121] * (-325.848) (-329.755) (-330.160) [-324.433] -- 0:00:51
150000 -- (-328.964) (-328.284) [-324.190] (-325.197) * (-325.533) (-328.823) (-329.332) [-323.676] -- 0:00:51
Average standard deviation of split frequencies: 0.022371
150500 -- (-328.556) (-327.340) [-325.352] (-325.579) * (-327.516) (-324.600) (-328.339) [-324.030] -- 0:00:50
151000 -- (-327.316) (-330.312) [-325.761] (-326.045) * (-324.640) [-324.315] (-326.509) (-325.538) -- 0:00:50
151500 -- (-324.090) [-324.596] (-326.386) (-325.234) * [-325.614] (-325.533) (-325.729) (-324.059) -- 0:00:50
152000 -- (-324.356) (-325.115) [-323.848] (-328.040) * (-323.713) (-324.282) (-325.587) [-325.095] -- 0:00:50
152500 -- [-325.748] (-327.306) (-325.036) (-324.593) * (-325.210) (-324.898) (-323.857) [-326.476] -- 0:00:50
153000 -- (-337.486) (-324.858) [-326.823] (-326.329) * (-325.843) (-328.178) (-324.064) [-325.087] -- 0:00:49
153500 -- (-330.314) (-326.991) (-326.101) [-325.657] * (-328.775) (-326.451) (-324.887) [-328.079] -- 0:00:49
154000 -- (-328.617) (-326.688) [-325.656] (-326.308) * (-327.502) (-327.492) (-325.433) [-324.709] -- 0:00:49
154500 -- [-326.930] (-326.230) (-323.477) (-325.174) * (-325.575) (-325.543) (-328.104) [-327.568] -- 0:00:49
155000 -- (-325.858) (-324.109) [-325.495] (-326.215) * (-326.165) (-323.871) (-326.303) [-324.079] -- 0:00:49
Average standard deviation of split frequencies: 0.022266
155500 -- (-326.610) (-324.223) (-326.016) [-326.788] * (-325.077) [-323.611] (-325.821) (-324.913) -- 0:00:48
156000 -- (-326.168) (-325.560) (-326.307) [-325.978] * (-326.003) (-324.976) [-326.384] (-324.253) -- 0:00:48
156500 -- [-329.778] (-325.166) (-323.918) (-324.627) * [-326.345] (-325.805) (-325.956) (-323.627) -- 0:00:48
157000 -- (-325.380) (-325.902) (-326.198) [-326.186] * [-324.660] (-330.658) (-326.239) (-328.670) -- 0:00:48
157500 -- (-326.180) [-324.886] (-324.394) (-327.903) * (-325.134) (-326.069) [-328.665] (-323.722) -- 0:00:48
158000 -- [-327.147] (-324.332) (-324.738) (-323.778) * (-324.063) (-327.900) [-327.004] (-327.912) -- 0:00:47
158500 -- (-324.197) [-326.329] (-324.137) (-326.167) * [-324.325] (-329.146) (-324.995) (-325.059) -- 0:00:47
159000 -- (-324.215) [-325.141] (-328.646) (-324.960) * (-325.680) (-326.129) (-326.164) [-325.732] -- 0:00:47
159500 -- (-324.241) (-325.328) [-327.821] (-326.831) * [-326.153] (-326.305) (-325.598) (-324.420) -- 0:00:47
160000 -- [-326.304] (-326.019) (-327.087) (-325.912) * (-328.918) (-327.509) (-325.071) [-326.188] -- 0:00:47
Average standard deviation of split frequencies: 0.020538
160500 -- (-327.190) [-325.162] (-324.753) (-323.574) * [-325.459] (-327.269) (-327.018) (-327.223) -- 0:00:47
161000 -- (-324.925) (-329.469) (-323.475) [-324.931] * (-324.642) (-326.696) (-325.047) [-325.722] -- 0:00:46
161500 -- (-325.892) (-328.319) [-326.672] (-326.654) * [-325.638] (-324.649) (-329.604) (-326.658) -- 0:00:46
162000 -- [-324.243] (-325.042) (-326.149) (-325.303) * [-325.683] (-326.224) (-326.710) (-325.750) -- 0:00:46
162500 -- (-324.001) [-326.169] (-326.400) (-329.140) * (-323.822) (-325.949) [-325.549] (-327.587) -- 0:00:46
163000 -- (-324.829) [-327.021] (-324.325) (-325.659) * (-323.622) (-326.176) [-324.554] (-326.002) -- 0:00:46
163500 -- (-327.598) [-328.895] (-325.175) (-328.983) * (-326.370) (-326.786) [-326.173] (-327.642) -- 0:00:51
164000 -- [-326.043] (-325.787) (-323.632) (-327.310) * (-326.101) [-328.101] (-323.398) (-325.059) -- 0:00:50
164500 -- (-326.318) (-327.767) (-326.936) [-324.564] * (-329.214) [-324.010] (-324.322) (-329.604) -- 0:00:50
165000 -- [-327.645] (-326.706) (-324.750) (-324.648) * (-327.909) (-324.159) (-323.419) [-331.099] -- 0:00:50
Average standard deviation of split frequencies: 0.020730
165500 -- (-324.817) (-326.276) [-323.793] (-329.106) * (-328.107) (-324.921) [-323.750] (-324.899) -- 0:00:50
166000 -- [-327.036] (-327.327) (-326.455) (-326.452) * (-329.926) (-328.405) (-325.784) [-324.029] -- 0:00:50
166500 -- (-328.550) [-324.881] (-327.088) (-326.109) * [-327.495] (-325.567) (-324.185) (-325.874) -- 0:00:50
167000 -- [-324.631] (-325.663) (-328.340) (-324.372) * (-325.382) (-323.869) [-324.440] (-324.841) -- 0:00:49
167500 -- (-327.431) (-327.186) (-327.553) [-325.461] * (-326.913) [-325.128] (-327.374) (-324.032) -- 0:00:49
168000 -- (-324.804) (-329.504) (-332.476) [-325.163] * (-325.333) (-325.864) [-324.753] (-324.364) -- 0:00:49
168500 -- (-324.842) (-329.721) [-329.878] (-326.238) * (-328.046) (-324.409) [-326.352] (-325.585) -- 0:00:49
169000 -- (-324.143) (-330.750) (-327.577) [-323.522] * (-326.441) (-330.844) [-325.072] (-328.015) -- 0:00:49
169500 -- (-325.592) (-331.074) (-324.442) [-327.038] * (-325.420) (-327.858) (-324.974) [-328.002] -- 0:00:48
170000 -- (-327.542) (-323.733) (-326.298) [-324.842] * [-323.448] (-325.182) (-324.631) (-324.073) -- 0:00:48
Average standard deviation of split frequencies: 0.020302
170500 -- (-325.487) (-324.664) (-325.411) [-324.081] * (-324.670) (-324.455) [-324.591] (-325.340) -- 0:00:48
171000 -- (-329.079) (-324.755) (-324.487) [-324.338] * (-323.879) (-325.186) [-326.195] (-326.079) -- 0:00:48
171500 -- (-325.698) (-323.996) [-325.257] (-323.564) * (-324.996) (-326.486) (-324.348) [-327.009] -- 0:00:48
172000 -- [-327.304] (-324.848) (-323.996) (-325.818) * [-326.506] (-329.125) (-326.025) (-327.293) -- 0:00:48
172500 -- (-325.861) (-327.704) [-325.667] (-323.807) * [-324.420] (-326.795) (-327.017) (-326.029) -- 0:00:47
173000 -- (-326.945) [-324.846] (-324.630) (-324.396) * (-326.680) (-324.241) [-324.438] (-326.898) -- 0:00:47
173500 -- (-325.908) (-326.298) [-325.939] (-328.368) * (-324.655) (-324.277) (-326.113) [-324.968] -- 0:00:47
174000 -- (-324.526) [-325.496] (-324.602) (-323.528) * (-326.438) (-325.356) [-326.156] (-324.652) -- 0:00:47
174500 -- (-325.712) [-326.250] (-324.871) (-328.635) * (-327.859) (-325.273) (-324.775) [-325.064] -- 0:00:47
175000 -- (-329.723) (-327.634) [-325.420] (-325.886) * (-324.481) [-324.582] (-325.881) (-324.370) -- 0:00:47
Average standard deviation of split frequencies: 0.019877
175500 -- (-326.533) (-324.126) (-324.135) [-326.416] * (-324.480) (-325.336) (-325.474) [-325.788] -- 0:00:46
176000 -- [-326.166] (-326.079) (-324.529) (-326.029) * (-324.249) (-324.293) [-325.081] (-324.681) -- 0:00:46
176500 -- (-327.701) [-324.929] (-327.393) (-329.612) * (-323.983) [-324.111] (-325.831) (-324.825) -- 0:00:46
177000 -- (-324.860) (-325.078) [-326.491] (-327.933) * [-324.963] (-325.229) (-325.244) (-324.754) -- 0:00:46
177500 -- [-328.243] (-324.198) (-323.889) (-324.664) * (-325.880) (-324.263) (-328.810) [-323.918] -- 0:00:46
178000 -- (-327.292) (-324.253) [-324.692] (-325.037) * (-326.020) (-325.663) [-326.136] (-326.510) -- 0:00:46
178500 -- (-327.956) [-325.441] (-324.955) (-327.447) * (-327.539) [-324.924] (-326.020) (-324.372) -- 0:00:46
179000 -- (-328.206) (-326.999) (-325.744) [-325.099] * (-325.245) (-327.263) [-325.882] (-325.790) -- 0:00:45
179500 -- (-325.631) (-325.683) [-326.724] (-328.197) * (-323.949) (-325.295) (-325.049) [-324.307] -- 0:00:45
180000 -- (-326.382) (-323.555) [-325.381] (-328.774) * (-324.892) (-330.476) (-327.205) [-325.358] -- 0:00:45
Average standard deviation of split frequencies: 0.019714
180500 -- [-325.292] (-325.480) (-327.828) (-329.314) * [-324.532] (-324.247) (-325.713) (-324.055) -- 0:00:49
181000 -- (-325.310) (-327.876) [-326.469] (-328.636) * (-326.268) [-325.334] (-327.202) (-326.417) -- 0:00:49
181500 -- [-328.142] (-325.041) (-325.398) (-324.315) * (-324.505) (-324.818) (-325.407) [-326.192] -- 0:00:49
182000 -- [-331.069] (-327.911) (-325.084) (-323.733) * (-326.824) (-324.893) [-325.413] (-325.675) -- 0:00:49
182500 -- (-327.811) [-326.163] (-326.545) (-331.536) * (-326.499) (-327.450) (-326.852) [-327.786] -- 0:00:49
183000 -- [-324.961] (-325.926) (-326.848) (-328.195) * (-328.179) (-325.327) [-328.461] (-326.377) -- 0:00:49
183500 -- (-326.221) [-325.492] (-324.309) (-325.043) * (-325.111) [-323.504] (-327.475) (-328.954) -- 0:00:48
184000 -- (-326.138) (-325.679) (-324.313) [-325.867] * (-326.630) (-323.785) [-323.795] (-330.379) -- 0:00:48
184500 -- [-327.546] (-325.443) (-325.708) (-326.598) * [-327.311] (-324.769) (-324.715) (-325.539) -- 0:00:48
185000 -- (-325.451) (-325.952) [-323.896] (-325.792) * (-327.565) [-325.237] (-325.918) (-328.594) -- 0:00:48
Average standard deviation of split frequencies: 0.019642
185500 -- (-324.944) [-326.382] (-323.807) (-325.836) * (-327.496) (-324.372) [-328.188] (-325.293) -- 0:00:48
186000 -- (-325.098) (-327.340) (-331.407) [-325.642] * (-325.957) (-325.733) [-324.353] (-323.868) -- 0:00:48
186500 -- (-326.050) (-327.362) (-326.012) [-324.999] * (-324.803) [-327.684] (-326.202) (-326.350) -- 0:00:47
187000 -- (-324.927) (-324.720) (-329.386) [-324.964] * [-324.824] (-325.609) (-327.948) (-324.333) -- 0:00:47
187500 -- (-325.326) (-325.366) [-325.106] (-324.630) * (-325.301) [-324.992] (-324.977) (-327.166) -- 0:00:47
188000 -- (-327.153) [-325.343] (-328.183) (-330.541) * [-325.377] (-328.619) (-326.057) (-325.692) -- 0:00:47
188500 -- (-326.416) [-326.702] (-324.523) (-331.970) * [-324.559] (-325.708) (-327.437) (-324.797) -- 0:00:47
189000 -- (-327.312) (-327.784) (-324.479) [-325.183] * (-329.137) (-326.694) (-323.655) [-326.532] -- 0:00:47
189500 -- (-324.334) (-324.361) (-326.920) [-323.887] * (-330.253) (-325.661) (-326.110) [-323.703] -- 0:00:47
190000 -- [-324.032] (-328.899) (-323.501) (-327.969) * (-325.969) [-326.214] (-330.709) (-324.979) -- 0:00:46
Average standard deviation of split frequencies: 0.018720
190500 -- (-327.102) [-324.569] (-327.506) (-332.270) * (-325.775) (-329.846) [-326.713] (-328.247) -- 0:00:46
191000 -- (-324.488) (-324.025) [-326.717] (-324.998) * [-324.629] (-326.335) (-327.163) (-325.877) -- 0:00:46
191500 -- [-325.156] (-325.656) (-326.394) (-327.235) * (-329.109) (-325.887) [-324.700] (-328.494) -- 0:00:46
192000 -- (-325.290) (-326.623) [-330.574] (-325.857) * [-326.896] (-323.505) (-325.551) (-326.476) -- 0:00:46
192500 -- (-325.828) (-330.337) (-324.851) [-324.408] * [-324.115] (-327.659) (-329.351) (-325.789) -- 0:00:46
193000 -- (-323.616) (-325.555) [-323.491] (-326.384) * (-324.456) (-323.866) [-324.646] (-327.950) -- 0:00:45
193500 -- (-326.866) [-324.008] (-326.933) (-323.515) * (-324.531) (-324.402) [-325.047] (-325.012) -- 0:00:45
194000 -- (-330.487) [-323.803] (-325.182) (-330.724) * (-325.736) (-324.116) [-324.648] (-324.042) -- 0:00:45
194500 -- (-326.965) [-323.889] (-324.560) (-324.991) * (-327.440) (-325.342) [-324.187] (-326.182) -- 0:00:45
195000 -- (-331.776) (-325.131) [-325.411] (-325.220) * (-326.924) (-323.605) (-327.142) [-326.058] -- 0:00:45
Average standard deviation of split frequencies: 0.017678
195500 -- (-323.955) (-326.007) [-326.449] (-325.130) * (-327.482) (-324.607) (-327.661) [-328.097] -- 0:00:45
196000 -- (-324.846) (-325.860) (-323.961) [-324.520] * (-327.557) (-326.943) (-331.099) [-325.211] -- 0:00:45
196500 -- (-325.519) (-324.631) (-326.216) [-325.338] * (-324.951) (-325.975) (-324.400) [-324.286] -- 0:00:44
197000 -- [-324.358] (-327.949) (-330.330) (-325.110) * (-325.712) [-326.010] (-325.494) (-324.060) -- 0:00:44
197500 -- (-325.963) (-325.307) [-326.396] (-324.630) * (-330.202) (-324.486) (-325.214) [-324.303] -- 0:00:48
198000 -- (-324.972) (-324.893) (-325.445) [-326.058] * (-329.794) (-326.313) [-325.840] (-324.393) -- 0:00:48
198500 -- (-326.684) [-325.163] (-326.754) (-325.420) * (-324.898) (-323.754) (-326.455) [-325.288] -- 0:00:48
199000 -- (-326.636) (-331.565) (-328.361) [-327.350] * (-325.251) (-324.458) (-327.341) [-325.835] -- 0:00:48
199500 -- (-324.615) (-335.408) [-326.466] (-324.987) * (-326.724) (-323.920) (-324.409) [-324.803] -- 0:00:48
200000 -- (-325.314) [-325.368] (-327.246) (-327.016) * (-327.134) (-324.164) [-326.239] (-324.193) -- 0:00:48
Average standard deviation of split frequencies: 0.016939
200500 -- (-323.780) (-324.018) (-325.491) [-327.769] * (-324.132) [-325.117] (-325.746) (-323.725) -- 0:00:47
201000 -- (-326.145) (-324.196) (-324.290) [-324.541] * (-323.482) [-328.349] (-324.459) (-329.875) -- 0:00:47
201500 -- (-325.337) [-324.475] (-325.472) (-327.649) * (-325.265) [-326.767] (-326.638) (-323.590) -- 0:00:47
202000 -- (-324.329) (-327.246) [-324.445] (-325.096) * [-327.802] (-325.850) (-325.066) (-326.909) -- 0:00:47
202500 -- (-326.131) [-327.368] (-324.837) (-324.986) * (-326.010) (-325.738) (-329.558) [-324.294] -- 0:00:47
203000 -- (-325.523) (-324.373) [-326.111] (-327.202) * (-326.087) [-325.764] (-327.273) (-325.353) -- 0:00:47
203500 -- (-325.907) (-334.641) [-326.472] (-324.972) * (-323.849) [-328.511] (-328.839) (-326.524) -- 0:00:46
204000 -- (-326.541) (-325.037) (-325.083) [-325.647] * (-329.546) (-331.926) [-323.531] (-325.898) -- 0:00:46
204500 -- (-327.719) (-328.483) [-324.723] (-324.712) * [-326.977] (-325.117) (-323.722) (-324.889) -- 0:00:46
205000 -- [-323.809] (-327.335) (-328.129) (-324.384) * [-324.871] (-325.870) (-324.641) (-325.651) -- 0:00:46
Average standard deviation of split frequencies: 0.015176
205500 -- (-326.581) (-328.872) (-331.562) [-323.688] * (-324.893) (-326.664) (-325.317) [-328.404] -- 0:00:46
206000 -- (-325.931) (-327.070) [-325.955] (-324.608) * (-326.140) (-325.283) [-325.183] (-327.390) -- 0:00:46
206500 -- (-328.338) (-325.580) [-324.889] (-326.397) * (-325.721) [-326.747] (-326.324) (-325.248) -- 0:00:46
207000 -- (-331.633) [-327.952] (-326.588) (-326.854) * (-328.687) [-326.281] (-329.703) (-325.648) -- 0:00:45
207500 -- (-326.038) (-327.111) (-325.502) [-324.443] * (-325.579) (-330.199) (-324.888) [-327.671] -- 0:00:45
208000 -- (-327.210) [-325.010] (-324.200) (-327.366) * [-325.166] (-325.110) (-323.997) (-323.975) -- 0:00:45
208500 -- [-324.790] (-325.591) (-327.093) (-324.612) * (-325.862) [-324.792] (-326.814) (-326.237) -- 0:00:45
209000 -- [-325.918] (-324.360) (-324.865) (-323.804) * (-325.749) [-326.368] (-326.398) (-330.039) -- 0:00:45
209500 -- (-324.235) (-324.522) [-325.044] (-324.900) * (-324.685) (-327.721) [-325.672] (-326.256) -- 0:00:45
210000 -- [-324.255] (-325.955) (-328.135) (-325.053) * (-324.798) [-325.623] (-328.123) (-327.026) -- 0:00:45
Average standard deviation of split frequencies: 0.016161
210500 -- (-325.445) [-325.413] (-325.729) (-329.626) * (-328.885) [-324.995] (-324.323) (-328.448) -- 0:00:45
211000 -- (-325.979) (-324.122) (-324.503) [-324.251] * [-326.270] (-328.811) (-325.007) (-327.764) -- 0:00:44
211500 -- [-325.727] (-325.012) (-326.250) (-323.692) * (-326.145) (-326.673) [-325.109] (-326.770) -- 0:00:44
212000 -- (-325.714) [-323.574] (-324.288) (-324.585) * (-324.470) (-327.424) (-324.514) [-325.259] -- 0:00:44
212500 -- (-329.310) (-327.156) (-326.138) [-328.113] * (-326.772) (-326.784) [-325.113] (-325.786) -- 0:00:44
213000 -- (-331.400) (-325.523) (-325.500) [-326.326] * [-326.267] (-328.685) (-325.466) (-325.096) -- 0:00:44
213500 -- (-325.628) (-325.811) (-328.937) [-323.665] * (-328.510) (-324.148) (-325.637) [-324.710] -- 0:00:44
214000 -- (-325.087) (-326.148) (-324.552) [-324.752] * (-327.523) (-323.993) [-326.321] (-327.610) -- 0:00:44
214500 -- (-324.524) [-330.695] (-327.606) (-324.973) * (-324.464) (-326.144) (-326.054) [-326.242] -- 0:00:43
215000 -- (-325.693) [-329.715] (-328.488) (-324.375) * (-328.417) (-330.130) (-326.194) [-325.106] -- 0:00:47
Average standard deviation of split frequencies: 0.016611
215500 -- (-325.512) [-326.966] (-326.674) (-323.997) * (-329.106) (-328.419) (-327.245) [-325.277] -- 0:00:47
216000 -- (-328.248) [-329.251] (-324.833) (-324.189) * (-327.013) [-328.370] (-326.781) (-325.985) -- 0:00:47
216500 -- (-323.976) [-324.617] (-324.725) (-325.194) * (-330.171) [-325.829] (-324.836) (-329.234) -- 0:00:47
217000 -- (-326.016) [-324.948] (-328.771) (-325.043) * (-324.941) (-329.972) (-323.345) [-329.824] -- 0:00:46
217500 -- [-324.828] (-324.133) (-325.374) (-325.474) * (-323.449) (-326.691) (-324.628) [-329.650] -- 0:00:46
218000 -- (-327.701) (-325.188) (-326.527) [-325.347] * (-324.956) (-329.305) [-324.958] (-323.572) -- 0:00:46
218500 -- (-323.872) (-325.211) (-324.949) [-329.128] * [-329.811] (-324.312) (-331.400) (-326.943) -- 0:00:46
219000 -- [-323.877] (-325.801) (-324.691) (-326.733) * (-329.189) (-325.333) (-328.239) [-324.406] -- 0:00:46
219500 -- [-324.560] (-327.475) (-325.192) (-326.438) * [-326.353] (-323.770) (-329.485) (-327.931) -- 0:00:46
220000 -- (-324.865) (-329.456) (-325.565) [-331.614] * (-324.202) (-326.144) (-329.203) [-325.681] -- 0:00:46
Average standard deviation of split frequencies: 0.017090
220500 -- (-327.211) (-323.958) [-326.390] (-329.267) * (-326.460) (-326.471) (-333.248) [-326.172] -- 0:00:45
221000 -- [-326.378] (-326.574) (-324.297) (-324.801) * (-326.474) [-324.295] (-326.306) (-327.080) -- 0:00:45
221500 -- [-327.581] (-326.985) (-325.700) (-330.389) * (-324.821) (-325.369) [-325.271] (-328.605) -- 0:00:45
222000 -- (-325.529) [-324.174] (-325.848) (-324.730) * (-328.328) [-326.424] (-327.627) (-331.821) -- 0:00:45
222500 -- (-325.036) (-324.353) [-327.110] (-324.562) * (-325.863) (-326.034) [-323.325] (-326.789) -- 0:00:45
223000 -- [-325.314] (-324.372) (-326.490) (-323.696) * [-326.858] (-324.653) (-328.984) (-327.328) -- 0:00:45
223500 -- (-324.675) (-325.997) (-326.829) [-324.494] * (-327.844) (-323.621) [-325.739] (-325.870) -- 0:00:45
224000 -- [-325.045] (-323.981) (-326.001) (-323.958) * [-328.656] (-327.201) (-327.388) (-323.710) -- 0:00:45
224500 -- (-325.224) (-325.673) (-326.007) [-325.656] * (-328.246) [-324.473] (-327.096) (-324.842) -- 0:00:44
225000 -- (-326.310) (-325.433) (-327.515) [-325.014] * (-330.725) [-325.959] (-324.129) (-326.170) -- 0:00:44
Average standard deviation of split frequencies: 0.016571
225500 -- (-328.543) [-326.135] (-327.624) (-326.115) * [-324.115] (-325.748) (-326.166) (-324.070) -- 0:00:44
226000 -- [-325.895] (-325.652) (-323.743) (-327.719) * [-325.435] (-324.584) (-326.949) (-327.942) -- 0:00:44
226500 -- (-328.401) [-325.084] (-324.310) (-332.747) * (-330.050) (-324.889) [-325.204] (-326.325) -- 0:00:44
227000 -- (-325.426) (-326.950) (-324.625) [-329.384] * (-325.107) (-330.023) [-324.830] (-324.657) -- 0:00:44
227500 -- (-325.954) (-326.259) [-325.875] (-324.713) * (-326.022) (-327.444) (-327.628) [-324.329] -- 0:00:44
228000 -- (-325.177) (-326.502) [-325.123] (-326.329) * (-324.979) (-324.462) [-323.837] (-326.434) -- 0:00:44
228500 -- (-325.695) (-324.706) [-325.434] (-325.805) * (-327.036) (-326.386) (-325.907) [-326.000] -- 0:00:47
229000 -- (-324.471) (-326.217) [-324.713] (-324.800) * (-324.397) (-323.978) [-325.072] (-326.446) -- 0:00:47
229500 -- (-325.675) [-324.374] (-327.603) (-324.093) * (-324.227) [-326.434] (-324.002) (-323.778) -- 0:00:47
230000 -- (-327.746) [-324.494] (-326.492) (-324.432) * (-325.268) [-328.931] (-329.905) (-324.471) -- 0:00:46
Average standard deviation of split frequencies: 0.017371
230500 -- [-328.363] (-323.930) (-327.650) (-325.888) * (-325.807) [-326.480] (-324.882) (-326.237) -- 0:00:46
231000 -- (-325.360) (-324.512) [-326.006] (-326.232) * (-329.295) (-327.432) [-325.559] (-326.022) -- 0:00:46
231500 -- (-326.385) [-325.982] (-323.873) (-326.357) * [-325.761] (-325.537) (-325.559) (-326.575) -- 0:00:46
232000 -- (-324.819) (-325.601) (-325.327) [-325.821] * (-329.006) (-326.431) [-325.913] (-327.494) -- 0:00:46
232500 -- (-329.881) [-323.613] (-329.765) (-327.724) * (-325.248) [-327.376] (-324.198) (-324.728) -- 0:00:46
233000 -- (-328.283) (-326.002) (-326.839) [-327.678] * (-328.463) (-326.188) (-325.350) [-324.303] -- 0:00:46
233500 -- [-324.490] (-325.529) (-326.077) (-326.414) * (-327.811) [-326.827] (-323.808) (-323.791) -- 0:00:45
234000 -- (-324.966) (-323.850) (-324.502) [-327.458] * [-324.326] (-325.786) (-324.659) (-325.012) -- 0:00:45
234500 -- (-327.202) [-327.755] (-323.418) (-327.470) * (-330.910) (-325.982) [-326.635] (-331.865) -- 0:00:45
235000 -- [-324.169] (-324.284) (-324.071) (-326.446) * (-330.072) [-325.961] (-326.421) (-328.572) -- 0:00:45
Average standard deviation of split frequencies: 0.016757
235500 -- (-325.713) (-326.605) [-324.419] (-332.295) * (-327.572) (-325.584) (-327.459) [-324.845] -- 0:00:45
236000 -- (-327.290) (-327.152) (-325.336) [-331.498] * (-328.856) (-325.615) (-326.351) [-323.882] -- 0:00:45
236500 -- [-324.674] (-327.784) (-326.109) (-325.224) * (-323.731) (-326.295) (-326.113) [-323.782] -- 0:00:45
237000 -- (-323.824) [-324.569] (-325.268) (-327.800) * (-324.252) [-324.852] (-326.203) (-326.072) -- 0:00:45
237500 -- (-326.962) (-327.249) (-325.628) [-325.715] * (-327.120) (-326.644) [-329.285] (-324.441) -- 0:00:44
238000 -- (-324.875) (-324.171) (-328.019) [-325.447] * (-327.020) [-327.434] (-324.328) (-324.777) -- 0:00:44
238500 -- (-326.252) (-326.072) [-325.298] (-324.684) * (-325.784) (-326.422) [-324.596] (-325.291) -- 0:00:44
239000 -- (-327.238) (-324.575) [-327.344] (-328.071) * (-325.546) (-325.895) (-325.905) [-325.291] -- 0:00:44
239500 -- (-324.095) [-324.939] (-327.809) (-326.019) * (-325.793) (-327.632) [-325.877] (-325.492) -- 0:00:44
240000 -- [-324.336] (-329.274) (-326.696) (-325.141) * [-325.010] (-327.307) (-324.813) (-325.216) -- 0:00:44
Average standard deviation of split frequencies: 0.015888
240500 -- [-323.471] (-325.519) (-325.710) (-325.711) * [-326.330] (-325.493) (-325.326) (-325.261) -- 0:00:44
241000 -- [-324.795] (-325.863) (-323.941) (-324.422) * (-324.007) [-324.274] (-326.785) (-324.405) -- 0:00:44
241500 -- (-327.312) [-323.962] (-325.606) (-324.487) * (-326.506) (-324.712) [-327.240] (-324.642) -- 0:00:43
242000 -- (-327.943) (-323.746) (-324.696) [-325.745] * (-327.873) [-326.916] (-324.892) (-325.460) -- 0:00:43
242500 -- (-325.779) (-324.204) (-326.548) [-325.121] * (-324.469) (-332.556) (-326.253) [-326.693] -- 0:00:43
243000 -- [-324.723] (-323.970) (-326.274) (-323.933) * [-324.813] (-326.410) (-323.997) (-326.542) -- 0:00:46
243500 -- [-324.138] (-323.703) (-326.579) (-324.100) * (-323.492) (-326.282) (-324.586) [-326.000] -- 0:00:46
244000 -- (-324.570) (-325.029) [-327.179] (-326.071) * (-325.347) (-324.220) (-325.941) [-324.792] -- 0:00:46
244500 -- (-325.272) (-324.333) (-326.402) [-327.449] * (-324.112) (-325.373) [-325.106] (-326.256) -- 0:00:46
245000 -- [-325.203] (-323.941) (-327.229) (-327.906) * (-328.356) (-325.888) [-328.981] (-329.487) -- 0:00:46
Average standard deviation of split frequencies: 0.016238
245500 -- (-324.026) (-326.778) [-324.964] (-330.592) * (-328.929) (-328.035) (-325.309) [-326.755] -- 0:00:46
246000 -- (-325.715) (-328.570) (-324.684) [-327.049] * (-330.633) (-323.833) [-333.307] (-326.243) -- 0:00:45
246500 -- (-324.458) [-324.379] (-326.027) (-326.302) * (-332.664) [-325.750] (-329.986) (-326.329) -- 0:00:45
247000 -- (-327.251) [-325.178] (-327.224) (-325.674) * (-326.822) [-327.211] (-324.904) (-324.603) -- 0:00:45
247500 -- (-327.506) (-324.107) [-323.614] (-325.357) * (-324.403) (-326.618) (-325.880) [-323.736] -- 0:00:45
248000 -- (-326.081) [-324.569] (-323.800) (-324.935) * (-326.633) (-325.371) (-324.511) [-324.292] -- 0:00:45
248500 -- (-325.794) (-325.726) [-324.272] (-324.750) * [-329.703] (-328.228) (-326.656) (-327.678) -- 0:00:45
249000 -- (-325.685) (-324.864) (-324.654) [-325.763] * (-328.131) (-325.338) [-326.668] (-324.289) -- 0:00:45
249500 -- [-326.526] (-323.513) (-324.657) (-327.138) * (-328.398) [-325.587] (-331.093) (-324.934) -- 0:00:45
250000 -- (-325.542) [-328.157] (-324.488) (-327.635) * (-325.687) (-326.589) [-323.833] (-323.926) -- 0:00:45
Average standard deviation of split frequencies: 0.016151
250500 -- (-327.043) [-328.296] (-327.978) (-325.174) * (-327.509) [-324.894] (-325.154) (-328.980) -- 0:00:44
251000 -- (-327.581) (-327.351) (-323.762) [-324.691] * (-325.540) (-325.425) [-324.937] (-323.863) -- 0:00:44
251500 -- (-329.652) (-325.461) [-324.137] (-331.171) * (-326.049) (-325.067) [-324.223] (-327.727) -- 0:00:44
252000 -- (-328.509) (-328.668) [-324.526] (-329.341) * (-323.897) (-323.807) (-324.051) [-323.678] -- 0:00:44
252500 -- (-329.091) (-326.766) [-324.446] (-325.110) * (-324.040) (-330.163) [-323.693] (-323.662) -- 0:00:44
253000 -- (-325.189) [-325.652] (-325.503) (-324.427) * (-325.902) (-330.927) (-323.975) [-324.479] -- 0:00:44
253500 -- [-326.398] (-325.864) (-325.273) (-328.788) * (-324.659) [-327.750] (-325.104) (-323.887) -- 0:00:44
254000 -- (-326.156) (-325.475) (-328.472) [-325.790] * (-325.393) (-327.547) (-324.384) [-324.717] -- 0:00:44
254500 -- [-324.086] (-323.758) (-325.963) (-328.921) * (-329.621) [-326.668] (-324.925) (-326.778) -- 0:00:43
255000 -- (-325.470) [-323.624] (-324.641) (-328.051) * (-324.540) (-323.548) [-325.115] (-326.025) -- 0:00:43
Average standard deviation of split frequencies: 0.015422
255500 -- [-324.080] (-326.529) (-328.015) (-324.602) * (-323.929) [-325.113] (-324.224) (-327.358) -- 0:00:43
256000 -- (-324.568) (-324.458) (-326.073) [-323.667] * (-325.999) (-327.174) [-326.338] (-325.260) -- 0:00:43
256500 -- (-324.993) [-324.143] (-325.605) (-325.307) * (-326.043) (-325.498) [-325.661] (-324.834) -- 0:00:43
257000 -- [-324.808] (-324.994) (-323.802) (-323.938) * (-328.828) [-325.385] (-328.097) (-325.812) -- 0:00:43
257500 -- (-326.030) [-324.656] (-325.220) (-327.304) * [-325.291] (-325.165) (-329.464) (-327.227) -- 0:00:43
258000 -- [-326.843] (-325.627) (-326.073) (-329.536) * (-326.050) [-323.346] (-325.936) (-325.893) -- 0:00:43
258500 -- (-324.704) (-326.433) [-326.040] (-324.469) * (-323.823) [-325.028] (-324.749) (-326.730) -- 0:00:43
259000 -- (-324.234) [-324.380] (-324.695) (-325.010) * (-325.730) (-326.335) (-325.181) [-326.481] -- 0:00:42
259500 -- (-325.586) [-327.570] (-326.273) (-327.301) * (-325.026) (-328.290) [-325.773] (-324.985) -- 0:00:45
260000 -- (-325.337) [-325.104] (-325.743) (-324.919) * (-327.775) [-326.199] (-327.464) (-324.989) -- 0:00:45
Average standard deviation of split frequencies: 0.014807
260500 -- (-329.290) (-326.860) [-325.169] (-324.058) * (-326.118) (-325.415) [-327.301] (-324.869) -- 0:00:45
261000 -- (-327.276) (-327.021) (-323.481) [-324.297] * (-326.772) [-327.837] (-327.108) (-326.515) -- 0:00:45
261500 -- (-324.044) [-323.665] (-324.062) (-325.819) * (-327.699) [-324.782] (-326.563) (-327.700) -- 0:00:45
262000 -- [-325.107] (-325.685) (-324.246) (-324.803) * [-328.904] (-327.692) (-327.629) (-327.911) -- 0:00:45
262500 -- (-323.791) (-325.643) [-325.192] (-324.703) * (-328.309) (-330.526) [-324.172] (-327.391) -- 0:00:44
263000 -- (-325.642) [-325.713] (-324.056) (-324.969) * (-328.361) (-324.413) [-325.098] (-324.276) -- 0:00:44
263500 -- [-325.221] (-326.791) (-323.430) (-325.046) * (-327.045) (-325.175) (-327.074) [-326.153] -- 0:00:44
264000 -- [-323.873] (-324.089) (-324.814) (-324.556) * (-324.538) (-324.570) (-325.334) [-325.986] -- 0:00:44
264500 -- (-325.570) [-326.924] (-324.025) (-324.204) * (-329.521) (-325.523) [-329.004] (-325.751) -- 0:00:44
265000 -- [-325.522] (-325.842) (-325.576) (-326.619) * (-324.867) (-326.086) [-324.134] (-324.684) -- 0:00:44
Average standard deviation of split frequencies: 0.015741
265500 -- [-330.538] (-324.368) (-325.662) (-324.016) * (-323.906) [-326.342] (-327.859) (-327.560) -- 0:00:44
266000 -- (-325.606) (-323.557) [-323.726] (-325.731) * (-327.072) (-325.223) [-326.763] (-326.827) -- 0:00:44
266500 -- (-323.879) [-324.142] (-327.507) (-325.356) * (-325.725) (-325.492) (-324.333) [-323.794] -- 0:00:44
267000 -- (-326.143) (-325.259) (-325.659) [-324.989] * (-331.628) (-326.900) [-325.549] (-325.481) -- 0:00:43
267500 -- (-325.127) (-328.716) (-324.221) [-325.632] * (-326.076) (-324.458) (-326.648) [-327.596] -- 0:00:43
268000 -- (-323.360) (-323.513) [-324.889] (-325.216) * (-325.121) (-324.754) (-325.177) [-327.381] -- 0:00:43
268500 -- (-323.238) [-324.355] (-327.082) (-326.219) * (-326.225) (-324.739) [-327.694] (-325.218) -- 0:00:43
269000 -- (-327.474) (-325.145) [-324.972] (-324.199) * (-324.264) (-324.682) (-325.945) [-326.134] -- 0:00:43
269500 -- (-326.402) (-325.942) [-327.944] (-326.052) * (-324.335) (-326.077) [-325.720] (-324.820) -- 0:00:43
270000 -- (-325.446) [-323.729] (-326.838) (-323.724) * (-326.219) (-325.573) [-323.415] (-323.969) -- 0:00:43
Average standard deviation of split frequencies: 0.017029
270500 -- (-324.892) (-324.053) [-326.071] (-324.672) * (-327.662) (-327.647) [-325.463] (-323.696) -- 0:00:43
271000 -- [-328.952] (-325.919) (-326.767) (-325.684) * [-325.235] (-327.288) (-324.494) (-325.408) -- 0:00:43
271500 -- (-326.376) [-326.016] (-325.738) (-330.704) * (-324.616) (-324.326) [-324.414] (-331.939) -- 0:00:42
272000 -- [-324.768] (-325.219) (-330.166) (-324.265) * (-327.214) (-324.991) [-326.689] (-329.415) -- 0:00:42
272500 -- [-329.201] (-326.989) (-325.594) (-325.218) * [-326.653] (-326.191) (-328.039) (-326.120) -- 0:00:42
273000 -- (-325.644) (-327.854) (-325.387) [-326.293] * (-327.300) [-325.197] (-324.503) (-325.319) -- 0:00:42
273500 -- (-327.187) (-329.988) [-324.027] (-324.251) * (-323.836) (-325.556) (-325.294) [-325.268] -- 0:00:42
274000 -- (-325.304) (-326.779) [-323.891] (-325.108) * (-324.078) (-331.612) (-324.103) [-324.175] -- 0:00:42
274500 -- (-328.120) [-324.729] (-324.865) (-328.224) * [-323.745] (-325.909) (-324.141) (-325.241) -- 0:00:42
275000 -- (-330.624) (-326.668) (-325.153) [-329.088] * [-324.426] (-328.920) (-326.300) (-328.138) -- 0:00:42
Average standard deviation of split frequencies: 0.018085
275500 -- [-323.707] (-326.698) (-325.439) (-324.932) * [-323.425] (-325.021) (-328.087) (-324.402) -- 0:00:44
276000 -- (-328.271) (-326.004) (-327.551) [-325.390] * (-324.259) (-324.450) (-328.765) [-325.212] -- 0:00:44
276500 -- (-329.852) (-325.762) (-327.368) [-324.602] * (-325.374) (-324.580) (-326.635) [-324.853] -- 0:00:44
277000 -- [-327.002] (-324.164) (-326.402) (-327.138) * [-325.764] (-325.913) (-325.625) (-326.559) -- 0:00:44
277500 -- (-326.256) (-324.912) (-326.244) [-323.955] * (-325.410) (-328.941) (-327.651) [-327.717] -- 0:00:44
278000 -- (-325.388) (-328.906) (-325.407) [-327.025] * (-324.290) [-326.629] (-324.741) (-324.362) -- 0:00:44
278500 -- [-326.049] (-326.203) (-326.211) (-327.623) * (-323.785) (-324.653) (-324.496) [-325.532] -- 0:00:44
279000 -- (-324.506) (-324.295) [-330.560] (-328.267) * (-324.797) (-325.545) (-327.152) [-324.061] -- 0:00:43
279500 -- [-324.116] (-326.394) (-325.996) (-323.989) * [-326.181] (-323.580) (-324.284) (-325.245) -- 0:00:43
280000 -- (-326.906) (-325.495) (-325.549) [-330.612] * (-325.400) (-326.513) [-325.058] (-325.128) -- 0:00:43
Average standard deviation of split frequencies: 0.019365
280500 -- (-326.965) (-329.656) (-323.641) [-328.066] * (-324.701) [-325.084] (-327.228) (-326.694) -- 0:00:43
281000 -- [-324.349] (-324.252) (-324.997) (-327.522) * (-324.342) [-325.832] (-325.667) (-328.303) -- 0:00:43
281500 -- (-324.788) [-326.117] (-326.478) (-324.031) * (-327.736) (-326.087) (-324.676) [-328.024] -- 0:00:43
282000 -- [-324.413] (-325.355) (-324.144) (-326.683) * [-326.723] (-325.112) (-324.050) (-331.947) -- 0:00:43
282500 -- (-324.100) (-326.440) (-327.432) [-323.621] * (-326.108) (-325.216) [-324.808] (-327.106) -- 0:00:43
283000 -- (-324.110) (-323.840) [-326.576] (-326.441) * [-323.999] (-331.209) (-326.567) (-328.221) -- 0:00:43
283500 -- [-325.107] (-326.426) (-324.566) (-328.248) * (-325.527) (-324.765) [-326.585] (-328.152) -- 0:00:42
284000 -- (-325.864) (-327.239) [-327.034] (-327.602) * [-324.642] (-324.962) (-328.340) (-324.404) -- 0:00:42
284500 -- (-326.348) (-325.770) [-327.493] (-329.592) * (-324.404) (-324.279) (-326.315) [-324.178] -- 0:00:42
285000 -- (-327.018) (-329.318) [-328.004] (-326.688) * [-327.682] (-328.261) (-327.809) (-325.414) -- 0:00:42
Average standard deviation of split frequencies: 0.019101
285500 -- (-326.348) (-329.407) (-325.760) [-324.752] * [-329.753] (-325.983) (-324.864) (-324.710) -- 0:00:42
286000 -- (-325.371) (-324.385) [-326.553] (-323.980) * (-330.487) (-325.481) (-325.482) [-324.896] -- 0:00:42
286500 -- (-329.214) [-323.772] (-328.100) (-324.253) * (-325.960) [-324.407] (-331.679) (-324.955) -- 0:00:42
287000 -- [-325.431] (-324.163) (-328.149) (-325.038) * [-325.119] (-325.170) (-329.061) (-324.453) -- 0:00:42
287500 -- (-326.361) (-323.482) (-325.825) [-326.254] * [-325.128] (-325.509) (-327.263) (-324.111) -- 0:00:42
288000 -- (-325.321) (-324.191) (-324.246) [-325.805] * (-327.078) [-324.422] (-324.100) (-325.812) -- 0:00:42
288500 -- [-324.542] (-326.964) (-323.504) (-324.483) * (-325.688) [-325.414] (-327.461) (-328.997) -- 0:00:41
289000 -- (-326.893) [-324.045] (-323.893) (-326.282) * (-324.756) [-324.534] (-332.682) (-324.671) -- 0:00:41
289500 -- (-323.803) (-323.535) (-324.397) [-325.133] * (-328.178) (-324.433) (-325.250) [-325.027] -- 0:00:41
290000 -- (-330.741) (-324.230) [-324.230] (-329.217) * (-326.674) (-324.802) (-325.342) [-324.153] -- 0:00:41
Average standard deviation of split frequencies: 0.018448
290500 -- (-324.746) (-323.460) [-325.308] (-325.826) * (-328.890) (-327.411) [-323.803] (-326.849) -- 0:00:41
291000 -- [-325.479] (-323.839) (-326.525) (-325.008) * (-328.862) (-328.234) [-325.384] (-328.848) -- 0:00:43
291500 -- (-324.780) (-324.225) [-324.906] (-327.039) * (-328.783) (-326.225) [-328.543] (-325.749) -- 0:00:43
292000 -- (-325.173) (-325.351) [-324.932] (-325.872) * [-325.662] (-328.323) (-328.835) (-327.513) -- 0:00:43
292500 -- (-327.745) (-323.920) [-332.391] (-327.006) * (-329.030) (-329.487) (-324.996) [-326.727] -- 0:00:43
293000 -- (-327.838) (-327.921) (-327.065) [-326.108] * [-327.537] (-325.869) (-324.370) (-331.405) -- 0:00:43
293500 -- (-326.795) [-326.155] (-326.013) (-326.023) * (-325.795) [-326.743] (-325.340) (-326.776) -- 0:00:43
294000 -- [-325.054] (-324.664) (-324.296) (-330.065) * (-328.026) (-325.992) [-325.655] (-328.665) -- 0:00:43
294500 -- [-324.458] (-324.474) (-328.716) (-323.919) * (-328.944) (-323.828) [-325.003] (-325.982) -- 0:00:43
295000 -- (-324.913) (-331.786) [-327.033] (-327.248) * (-326.118) (-324.478) [-327.541] (-325.052) -- 0:00:43
Average standard deviation of split frequencies: 0.017319
295500 -- [-327.791] (-326.289) (-330.603) (-328.085) * (-324.131) [-325.304] (-323.993) (-324.833) -- 0:00:42
296000 -- (-324.115) (-324.848) (-326.708) [-325.320] * [-325.171] (-325.227) (-332.128) (-324.181) -- 0:00:42
296500 -- (-324.695) (-324.610) [-327.371] (-327.993) * [-325.271] (-326.701) (-330.026) (-326.405) -- 0:00:42
297000 -- (-330.428) (-328.113) [-324.694] (-329.436) * (-325.920) (-324.822) [-326.346] (-329.512) -- 0:00:42
297500 -- (-325.069) (-328.136) (-325.008) [-325.746] * (-323.520) (-325.560) [-325.145] (-323.953) -- 0:00:42
298000 -- (-325.876) (-325.712) [-328.244] (-324.398) * (-323.897) [-325.535] (-327.823) (-326.147) -- 0:00:42
298500 -- [-324.631] (-324.913) (-327.254) (-324.656) * (-325.628) (-324.574) [-326.029] (-326.487) -- 0:00:42
299000 -- [-323.489] (-323.624) (-330.492) (-326.666) * (-324.959) (-325.421) (-327.657) [-325.645] -- 0:00:42
299500 -- (-324.939) [-325.662] (-327.358) (-325.525) * [-325.040] (-327.550) (-327.699) (-324.051) -- 0:00:42
300000 -- (-323.806) [-323.844] (-327.822) (-329.607) * (-324.276) (-326.932) (-325.185) [-328.669] -- 0:00:42
Average standard deviation of split frequencies: 0.018814
300500 -- (-327.050) [-323.451] (-328.240) (-330.373) * (-325.606) (-326.373) (-324.996) [-324.033] -- 0:00:41
301000 -- (-325.455) [-326.473] (-327.632) (-325.505) * (-327.810) (-326.951) [-325.178] (-325.631) -- 0:00:41
301500 -- (-325.070) [-325.897] (-323.865) (-325.119) * (-328.556) (-323.624) [-325.298] (-327.499) -- 0:00:41
302000 -- (-324.892) [-325.909] (-323.423) (-327.497) * [-327.710] (-324.536) (-327.490) (-326.513) -- 0:00:41
302500 -- (-326.033) (-325.565) (-323.639) [-324.425] * (-329.599) (-326.188) [-325.687] (-324.837) -- 0:00:41
303000 -- [-327.319] (-324.355) (-329.260) (-325.116) * (-324.559) (-325.007) [-326.741] (-323.324) -- 0:00:41
303500 -- (-326.279) (-328.981) [-326.444] (-326.392) * (-324.998) [-324.671] (-325.440) (-327.087) -- 0:00:41
304000 -- (-325.388) (-329.691) [-326.264] (-324.879) * (-326.491) [-326.471] (-324.112) (-326.207) -- 0:00:41
304500 -- [-325.251] (-325.291) (-325.974) (-325.539) * (-326.161) [-324.007] (-324.270) (-328.300) -- 0:00:41
305000 -- (-324.580) (-327.018) (-325.078) [-324.624] * (-327.463) [-324.654] (-325.219) (-326.599) -- 0:00:41
Average standard deviation of split frequencies: 0.018124
305500 -- (-325.764) [-326.752] (-325.444) (-325.022) * (-326.854) [-326.602] (-323.894) (-325.180) -- 0:00:40
306000 -- [-324.245] (-327.656) (-325.331) (-324.033) * [-326.227] (-325.276) (-327.553) (-323.664) -- 0:00:40
306500 -- (-324.180) [-325.762] (-327.712) (-324.740) * (-325.661) [-326.653] (-325.511) (-325.305) -- 0:00:40
307000 -- [-325.179] (-326.817) (-330.070) (-324.836) * (-328.926) [-326.137] (-326.517) (-326.850) -- 0:00:40
307500 -- (-325.447) [-326.467] (-327.604) (-325.119) * (-324.754) [-324.203] (-328.076) (-326.103) -- 0:00:40
308000 -- [-324.998] (-326.097) (-324.827) (-326.520) * (-326.915) (-331.164) [-325.953] (-324.450) -- 0:00:42
308500 -- (-324.785) (-324.563) (-328.935) [-325.545] * [-327.678] (-326.161) (-327.116) (-328.593) -- 0:00:42
309000 -- (-331.654) [-328.140] (-329.091) (-328.140) * [-327.178] (-327.008) (-330.791) (-328.214) -- 0:00:42
309500 -- [-324.797] (-325.640) (-325.517) (-325.559) * (-326.215) (-324.941) [-324.802] (-326.458) -- 0:00:42
310000 -- (-326.150) [-325.634] (-326.830) (-325.768) * (-326.809) (-331.131) [-324.956] (-325.023) -- 0:00:42
Average standard deviation of split frequencies: 0.016959
310500 -- (-325.480) (-326.380) (-330.295) [-324.109] * (-327.988) (-324.725) [-325.447] (-327.971) -- 0:00:42
311000 -- (-326.144) (-325.615) [-326.166] (-324.166) * [-324.560] (-326.376) (-324.361) (-329.774) -- 0:00:42
311500 -- (-329.708) [-324.353] (-326.280) (-326.462) * [-324.508] (-328.736) (-325.067) (-324.450) -- 0:00:41
312000 -- (-326.553) (-325.767) [-326.954] (-326.560) * [-324.526] (-325.507) (-325.936) (-324.368) -- 0:00:41
312500 -- (-328.091) (-328.890) [-326.362] (-326.700) * (-327.700) (-325.005) (-327.049) [-324.980] -- 0:00:41
313000 -- [-326.437] (-326.861) (-325.588) (-327.204) * (-327.035) (-327.242) [-325.387] (-323.891) -- 0:00:41
313500 -- [-324.377] (-328.233) (-323.732) (-328.820) * [-324.926] (-326.490) (-325.963) (-324.105) -- 0:00:41
314000 -- (-324.339) [-325.149] (-327.465) (-326.453) * (-323.801) (-326.404) [-326.152] (-325.132) -- 0:00:41
314500 -- (-325.091) [-326.207] (-326.170) (-323.877) * [-325.320] (-326.670) (-326.374) (-326.226) -- 0:00:41
315000 -- [-327.320] (-326.379) (-324.596) (-326.323) * (-328.216) (-327.550) (-323.857) [-329.069] -- 0:00:41
Average standard deviation of split frequencies: 0.016969
315500 -- (-326.397) (-325.842) (-325.055) [-325.493] * [-324.084] (-325.118) (-324.632) (-323.782) -- 0:00:41
316000 -- [-327.552] (-323.971) (-329.317) (-324.684) * (-329.144) (-326.893) [-326.799] (-326.040) -- 0:00:41
316500 -- (-323.890) [-324.196] (-323.693) (-325.687) * [-325.079] (-330.934) (-324.593) (-324.889) -- 0:00:41
317000 -- (-327.034) (-328.194) [-324.065] (-323.802) * (-325.769) [-325.910] (-324.584) (-324.042) -- 0:00:40
317500 -- (-323.788) (-325.617) (-328.103) [-324.129] * [-325.403] (-326.717) (-327.721) (-327.525) -- 0:00:40
318000 -- (-328.808) [-325.150] (-329.119) (-323.906) * [-323.998] (-327.291) (-325.774) (-327.231) -- 0:00:40
318500 -- (-324.402) [-324.440] (-325.175) (-327.701) * (-325.193) [-327.302] (-329.190) (-329.854) -- 0:00:40
319000 -- (-324.261) [-324.566] (-327.683) (-326.278) * (-326.043) [-323.798] (-324.853) (-328.538) -- 0:00:40
319500 -- [-324.174] (-328.308) (-324.281) (-325.707) * (-325.954) (-324.522) [-326.477] (-327.803) -- 0:00:40
320000 -- (-324.241) [-325.076] (-327.136) (-323.467) * [-324.144] (-326.041) (-331.941) (-324.945) -- 0:00:40
Average standard deviation of split frequencies: 0.015711
320500 -- (-326.114) [-324.428] (-326.983) (-327.119) * [-325.108] (-324.709) (-328.151) (-325.170) -- 0:00:40
321000 -- (-328.040) (-325.392) (-325.072) [-325.328] * [-326.911] (-325.055) (-324.610) (-324.822) -- 0:00:40
321500 -- (-325.334) (-326.831) (-329.257) [-325.284] * (-326.874) (-326.448) [-324.840] (-329.996) -- 0:00:40
322000 -- (-325.166) (-326.048) [-325.061] (-326.367) * (-326.873) (-326.722) (-329.204) [-327.311] -- 0:00:40
322500 -- (-327.822) (-329.459) [-324.637] (-326.284) * (-329.614) (-325.874) [-323.731] (-325.582) -- 0:00:39
323000 -- [-324.860] (-325.810) (-326.092) (-325.181) * (-324.018) [-329.848] (-326.095) (-324.590) -- 0:00:39
323500 -- (-326.127) (-327.688) [-323.810] (-326.302) * [-327.078] (-325.069) (-324.093) (-328.371) -- 0:00:39
324000 -- (-325.502) (-324.590) (-326.767) [-326.323] * (-326.851) (-325.053) (-327.639) [-326.451] -- 0:00:39
324500 -- (-325.947) [-324.122] (-328.072) (-327.869) * (-325.149) (-323.783) [-326.582] (-326.032) -- 0:00:41
325000 -- (-328.171) [-324.704] (-326.429) (-327.495) * (-326.587) (-324.812) (-325.789) [-327.389] -- 0:00:41
Average standard deviation of split frequencies: 0.015183
325500 -- (-326.686) (-324.937) (-326.401) [-325.547] * [-325.972] (-325.840) (-325.043) (-332.859) -- 0:00:41
326000 -- (-326.870) (-325.332) (-328.094) [-325.184] * (-325.007) (-326.475) (-325.750) [-325.381] -- 0:00:41
326500 -- (-325.447) (-323.850) (-328.350) [-324.706] * (-325.228) (-328.900) (-324.405) [-326.102] -- 0:00:41
327000 -- (-327.448) (-324.280) [-323.745] (-328.230) * (-326.876) [-326.136] (-327.095) (-326.509) -- 0:00:41
327500 -- (-327.142) (-327.030) (-324.185) [-329.857] * (-324.438) (-325.656) (-324.887) [-325.767] -- 0:00:41
328000 -- (-324.491) [-324.413] (-326.354) (-329.583) * [-324.982] (-324.856) (-324.428) (-325.282) -- 0:00:40
328500 -- (-325.790) (-326.412) (-323.791) [-324.629] * (-337.176) (-324.848) [-326.481] (-327.438) -- 0:00:40
329000 -- (-324.771) (-325.683) [-325.090] (-324.419) * (-325.878) (-325.557) (-324.640) [-326.499] -- 0:00:40
329500 -- (-325.207) (-329.823) [-326.416] (-327.241) * (-324.065) (-326.687) (-325.686) [-325.798] -- 0:00:40
330000 -- [-324.967] (-328.197) (-330.079) (-326.416) * (-327.216) (-327.017) (-325.317) [-326.155] -- 0:00:40
Average standard deviation of split frequencies: 0.015147
330500 -- (-327.083) [-325.766] (-330.263) (-326.608) * (-329.272) (-326.419) (-326.858) [-326.977] -- 0:00:40
331000 -- (-327.645) (-324.766) (-329.243) [-324.846] * (-325.944) [-325.885] (-329.298) (-324.738) -- 0:00:40
331500 -- (-328.000) (-324.216) (-325.237) [-325.536] * [-325.124] (-326.284) (-330.800) (-325.450) -- 0:00:40
332000 -- (-326.047) (-325.985) (-325.960) [-327.310] * (-332.886) (-325.498) (-324.722) [-326.458] -- 0:00:40
332500 -- (-325.111) [-325.733] (-324.887) (-325.257) * (-326.615) (-328.189) [-327.317] (-325.789) -- 0:00:40
333000 -- (-325.176) (-324.633) [-325.389] (-326.757) * (-324.535) [-325.257] (-328.590) (-324.595) -- 0:00:40
333500 -- (-324.972) (-323.843) [-325.364] (-326.764) * [-325.650] (-323.992) (-327.712) (-324.662) -- 0:00:39
334000 -- [-328.026] (-325.279) (-324.185) (-327.397) * (-325.262) (-327.928) (-326.924) [-323.672] -- 0:00:39
334500 -- (-325.713) (-326.950) (-324.416) [-325.694] * (-323.831) (-324.407) (-324.879) [-325.930] -- 0:00:39
335000 -- [-324.450] (-323.237) (-323.639) (-325.485) * (-325.736) (-325.734) [-324.876] (-323.676) -- 0:00:39
Average standard deviation of split frequencies: 0.015521
335500 -- (-328.089) (-324.457) (-325.343) [-328.081] * (-324.140) (-325.717) (-325.680) [-325.064] -- 0:00:39
336000 -- (-328.140) [-324.487] (-324.085) (-324.921) * (-325.719) (-325.513) (-324.314) [-324.589] -- 0:00:39
336500 -- (-327.252) (-323.943) [-326.282] (-328.459) * (-326.344) [-324.129] (-324.401) (-327.841) -- 0:00:39
337000 -- (-329.940) (-326.345) (-325.365) [-328.605] * (-327.002) (-323.404) [-324.906] (-326.420) -- 0:00:39
337500 -- (-326.555) (-325.506) [-323.535] (-326.924) * (-330.137) [-323.697] (-329.170) (-328.672) -- 0:00:39
338000 -- (-324.936) (-325.274) [-324.411] (-324.305) * (-330.251) [-325.669] (-325.179) (-338.768) -- 0:00:39
338500 -- [-325.381] (-323.918) (-324.866) (-327.320) * (-331.287) (-326.995) [-326.083] (-323.349) -- 0:00:39
339000 -- (-325.329) [-324.837] (-323.970) (-324.495) * (-323.986) (-325.783) [-325.792] (-329.746) -- 0:00:38
339500 -- [-325.902] (-325.749) (-324.356) (-324.768) * (-324.978) (-327.154) [-326.500] (-326.561) -- 0:00:38
340000 -- [-323.659] (-324.894) (-324.332) (-325.730) * (-324.379) (-327.785) (-323.800) [-325.715] -- 0:00:38
Average standard deviation of split frequencies: 0.017124
340500 -- (-324.708) (-326.208) (-324.131) [-324.532] * (-326.401) (-325.302) (-324.736) [-324.241] -- 0:00:38
341000 -- [-325.048] (-326.630) (-326.687) (-327.538) * (-325.693) (-330.247) [-324.795] (-327.758) -- 0:00:40
341500 -- (-328.239) (-325.301) (-325.806) [-325.293] * [-325.251] (-325.169) (-326.814) (-323.702) -- 0:00:40
342000 -- [-325.740] (-326.355) (-326.672) (-324.613) * [-323.746] (-325.972) (-326.972) (-326.850) -- 0:00:40
342500 -- (-324.596) (-324.071) [-325.501] (-323.774) * (-325.567) (-324.747) [-325.896] (-326.370) -- 0:00:40
343000 -- [-329.205] (-324.691) (-324.524) (-325.183) * (-325.570) [-323.884] (-326.268) (-325.710) -- 0:00:40
343500 -- (-326.460) (-326.344) [-323.875] (-324.430) * [-324.904] (-326.167) (-324.782) (-327.700) -- 0:00:40
344000 -- (-324.508) (-325.441) [-324.871] (-323.768) * (-325.548) [-325.808] (-323.990) (-324.585) -- 0:00:40
344500 -- [-324.049] (-327.358) (-324.235) (-323.815) * (-325.422) [-326.109] (-325.052) (-327.123) -- 0:00:39
345000 -- (-324.977) (-327.357) (-324.249) [-325.366] * (-323.852) (-328.437) (-330.230) [-325.897] -- 0:00:39
Average standard deviation of split frequencies: 0.016670
345500 -- (-325.750) [-324.746] (-325.846) (-328.370) * (-325.197) [-326.566] (-327.591) (-325.766) -- 0:00:39
346000 -- (-325.441) (-326.775) [-326.774] (-326.157) * (-328.550) [-324.508] (-324.562) (-324.419) -- 0:00:39
346500 -- [-326.855] (-325.677) (-330.617) (-324.424) * (-325.639) (-325.602) (-327.104) [-325.650] -- 0:00:39
347000 -- (-326.182) (-324.270) [-326.940] (-326.596) * (-324.380) (-325.961) (-327.481) [-326.164] -- 0:00:39
347500 -- (-324.745) (-326.452) [-325.436] (-326.232) * (-325.721) (-323.763) [-325.832] (-324.338) -- 0:00:39
348000 -- (-324.531) (-328.161) (-327.404) [-326.528] * (-324.623) (-328.511) (-326.910) [-325.258] -- 0:00:39
348500 -- (-327.619) (-325.111) (-324.112) [-326.771] * (-325.222) (-329.079) (-327.235) [-326.062] -- 0:00:39
349000 -- [-325.419] (-329.124) (-327.956) (-331.651) * [-325.790] (-325.968) (-326.217) (-324.634) -- 0:00:39
349500 -- (-324.933) (-325.667) (-326.649) [-326.298] * (-323.483) (-324.617) [-325.581] (-325.271) -- 0:00:39
350000 -- (-326.593) (-326.921) (-329.598) [-324.111] * [-327.260] (-325.611) (-327.955) (-324.277) -- 0:00:39
Average standard deviation of split frequencies: 0.016685
350500 -- (-326.211) (-329.644) (-326.764) [-324.377] * [-329.381] (-326.060) (-326.418) (-324.054) -- 0:00:38
351000 -- (-324.578) [-323.860] (-325.627) (-327.286) * (-324.485) (-326.390) [-325.172] (-324.398) -- 0:00:38
351500 -- (-326.690) [-323.892] (-326.433) (-325.970) * (-323.674) [-325.571] (-326.638) (-326.058) -- 0:00:38
352000 -- [-325.620] (-324.118) (-325.786) (-329.706) * (-325.683) [-324.438] (-326.182) (-325.154) -- 0:00:38
352500 -- [-326.471] (-323.409) (-325.098) (-325.439) * (-329.953) (-325.985) [-325.414] (-324.715) -- 0:00:38
353000 -- (-325.634) (-324.218) (-328.728) [-324.367] * (-330.881) (-324.443) (-327.680) [-324.889] -- 0:00:38
353500 -- (-325.897) [-325.730] (-328.906) (-326.938) * (-328.382) [-324.777] (-326.370) (-327.285) -- 0:00:38
354000 -- (-323.998) [-325.954] (-326.372) (-331.025) * (-324.811) [-325.818] (-330.621) (-325.803) -- 0:00:38
354500 -- (-324.777) (-329.505) (-324.325) [-331.732] * [-324.341] (-326.571) (-328.904) (-326.573) -- 0:00:38
355000 -- (-325.044) [-325.489] (-324.564) (-327.975) * (-326.131) (-329.824) (-325.129) [-325.599] -- 0:00:38
Average standard deviation of split frequencies: 0.016635
355500 -- (-324.926) [-325.533] (-327.689) (-326.281) * (-327.018) (-326.759) (-325.072) [-326.892] -- 0:00:38
356000 -- (-325.215) (-325.503) (-328.258) [-323.784] * [-329.673] (-324.359) (-326.626) (-326.472) -- 0:00:37
356500 -- (-325.432) [-324.836] (-323.287) (-325.332) * (-327.966) (-327.114) (-328.291) [-323.966] -- 0:00:39
357000 -- (-325.850) (-323.904) (-325.998) [-324.630] * (-324.319) (-324.525) [-327.187] (-326.463) -- 0:00:39
357500 -- [-325.228] (-325.960) (-325.363) (-327.752) * (-325.394) (-324.369) (-329.652) [-325.857] -- 0:00:39
358000 -- [-327.034] (-327.194) (-326.994) (-327.400) * (-327.710) [-326.867] (-327.400) (-324.011) -- 0:00:39
358500 -- [-325.277] (-326.128) (-325.512) (-330.177) * (-323.571) [-324.794] (-324.203) (-325.640) -- 0:00:39
359000 -- (-325.383) (-324.996) (-327.479) [-324.518] * (-325.707) [-324.669] (-326.116) (-323.991) -- 0:00:39
359500 -- (-328.526) (-326.473) [-325.476] (-323.923) * (-324.491) (-326.677) (-325.997) [-325.349] -- 0:00:39
360000 -- (-329.989) (-325.797) (-325.748) [-325.167] * [-325.201] (-331.876) (-323.838) (-327.726) -- 0:00:39
Average standard deviation of split frequencies: 0.015521
360500 -- (-329.272) (-323.382) (-329.826) [-324.774] * [-326.115] (-327.992) (-324.403) (-325.755) -- 0:00:39
361000 -- (-328.369) [-324.331] (-327.840) (-324.901) * (-324.064) [-328.125] (-326.940) (-326.853) -- 0:00:38
361500 -- (-324.627) [-326.014] (-324.917) (-324.591) * (-324.151) [-328.592] (-323.567) (-325.580) -- 0:00:38
362000 -- (-327.844) (-331.049) (-325.017) [-325.765] * (-323.407) [-324.687] (-324.957) (-323.726) -- 0:00:38
362500 -- (-327.170) (-331.598) [-327.205] (-328.926) * (-325.956) (-324.031) [-326.135] (-331.547) -- 0:00:38
363000 -- [-324.257] (-329.692) (-326.995) (-327.589) * [-328.131] (-328.054) (-330.756) (-329.769) -- 0:00:38
363500 -- (-324.251) (-327.667) [-324.768] (-324.587) * (-323.892) (-326.568) (-324.306) [-330.031] -- 0:00:38
364000 -- (-326.550) [-327.707] (-325.762) (-324.151) * (-327.178) [-325.045] (-326.023) (-325.711) -- 0:00:38
364500 -- [-326.185] (-328.978) (-324.823) (-324.590) * (-326.793) (-329.311) [-325.335] (-324.464) -- 0:00:38
365000 -- [-325.306] (-325.821) (-323.898) (-326.066) * (-329.060) (-328.977) [-327.304] (-328.590) -- 0:00:38
Average standard deviation of split frequencies: 0.015134
365500 -- (-324.829) (-325.416) [-324.946] (-324.758) * [-326.847] (-325.813) (-326.738) (-328.953) -- 0:00:38
366000 -- (-323.689) (-328.292) [-326.524] (-325.017) * (-326.191) [-325.685] (-326.019) (-329.215) -- 0:00:38
366500 -- [-326.533] (-325.287) (-325.694) (-326.972) * (-325.492) [-325.332] (-326.573) (-330.397) -- 0:00:38
367000 -- (-326.140) [-324.805] (-325.584) (-326.895) * [-326.708] (-324.947) (-327.084) (-329.670) -- 0:00:37
367500 -- (-324.605) (-331.661) [-329.784] (-324.611) * [-331.682] (-328.066) (-326.288) (-327.234) -- 0:00:37
368000 -- [-324.086] (-327.653) (-324.591) (-326.723) * (-329.700) (-325.948) (-325.253) [-324.900] -- 0:00:37
368500 -- (-328.289) (-327.683) (-326.752) [-326.101] * (-326.312) [-326.034] (-326.177) (-328.683) -- 0:00:37
369000 -- (-329.276) (-326.194) (-327.361) [-324.883] * (-325.027) (-326.564) [-325.429] (-326.664) -- 0:00:37
369500 -- (-330.693) (-327.044) (-325.618) [-327.538] * (-324.458) (-328.439) (-327.451) [-327.361] -- 0:00:37
370000 -- (-326.694) (-324.910) [-325.163] (-327.651) * (-330.152) (-328.685) (-325.551) [-327.329] -- 0:00:37
Average standard deviation of split frequencies: 0.015579
370500 -- [-330.688] (-324.486) (-325.632) (-326.937) * (-331.673) [-327.742] (-325.060) (-330.672) -- 0:00:37
371000 -- (-326.569) (-327.404) (-325.148) [-325.621] * (-325.462) [-323.652] (-327.534) (-323.936) -- 0:00:37
371500 -- (-325.678) [-323.940] (-328.284) (-324.295) * [-325.786] (-329.290) (-327.825) (-324.423) -- 0:00:37
372000 -- (-325.582) (-325.751) [-326.095] (-328.802) * (-324.544) (-328.439) [-324.563] (-326.607) -- 0:00:37
372500 -- [-327.730] (-326.619) (-329.363) (-324.891) * (-326.694) (-324.059) [-328.598] (-324.823) -- 0:00:37
373000 -- [-327.433] (-324.329) (-325.579) (-324.487) * (-324.723) (-327.420) [-326.457] (-324.923) -- 0:00:36
373500 -- (-330.199) [-323.485] (-327.541) (-330.233) * (-324.464) (-327.482) (-324.641) [-323.377] -- 0:00:38
374000 -- (-325.861) (-326.544) (-329.563) [-327.348] * (-326.477) (-330.538) (-329.456) [-323.907] -- 0:00:38
374500 -- (-325.861) (-325.374) [-323.436] (-326.243) * (-325.450) [-324.052] (-327.396) (-324.665) -- 0:00:38
375000 -- (-328.233) [-326.381] (-324.543) (-328.269) * (-324.662) [-324.377] (-325.660) (-324.448) -- 0:00:38
Average standard deviation of split frequencies: 0.015515
375500 -- (-327.784) [-324.397] (-325.863) (-331.087) * (-325.192) [-324.392] (-329.600) (-324.295) -- 0:00:38
376000 -- (-330.247) [-325.051] (-328.744) (-328.104) * (-330.277) [-324.703] (-324.643) (-327.004) -- 0:00:38
376500 -- (-328.605) (-328.454) (-325.119) [-325.659] * (-325.262) (-326.544) [-326.341] (-324.409) -- 0:00:38
377000 -- [-325.304] (-327.683) (-331.072) (-326.415) * [-323.921] (-324.408) (-324.743) (-324.768) -- 0:00:38
377500 -- (-327.426) (-327.005) [-326.435] (-326.975) * (-324.024) (-327.025) (-323.896) [-324.096] -- 0:00:37
378000 -- [-326.625] (-327.816) (-324.489) (-328.373) * (-325.764) (-328.040) [-326.681] (-324.093) -- 0:00:37
378500 -- (-326.173) (-325.444) [-325.737] (-326.250) * (-324.332) [-326.150] (-324.747) (-327.060) -- 0:00:37
379000 -- [-325.763] (-326.687) (-323.864) (-328.415) * (-326.362) (-323.618) (-329.674) [-324.889] -- 0:00:37
379500 -- (-325.723) (-326.689) [-325.372] (-324.031) * (-325.897) [-326.376] (-324.487) (-326.328) -- 0:00:37
380000 -- [-327.021] (-326.290) (-326.980) (-324.022) * (-327.226) [-327.048] (-330.119) (-325.475) -- 0:00:37
Average standard deviation of split frequencies: 0.015325
380500 -- (-332.297) (-323.980) [-325.796] (-326.576) * (-325.420) [-324.594] (-325.920) (-333.437) -- 0:00:37
381000 -- (-328.284) (-325.334) (-328.605) [-323.917] * (-326.691) (-326.543) [-324.734] (-326.741) -- 0:00:37
381500 -- [-326.102] (-324.945) (-324.471) (-324.925) * (-327.497) (-325.373) [-327.339] (-329.708) -- 0:00:37
382000 -- (-325.384) [-325.814] (-328.190) (-326.217) * (-328.311) (-325.241) (-331.193) [-325.475] -- 0:00:37
382500 -- [-324.575] (-324.937) (-324.495) (-328.277) * (-329.300) (-324.792) [-323.970] (-325.222) -- 0:00:37
383000 -- (-326.254) (-325.229) [-323.570] (-326.390) * (-326.286) (-326.627) [-325.296] (-328.878) -- 0:00:37
383500 -- [-323.745] (-327.474) (-324.366) (-324.947) * (-325.096) (-324.273) [-326.696] (-324.666) -- 0:00:36
384000 -- (-324.221) [-326.091] (-327.315) (-324.401) * (-324.828) (-325.138) (-325.425) [-323.482] -- 0:00:36
384500 -- (-327.250) (-323.848) (-326.464) [-323.982] * (-325.099) (-325.526) [-324.507] (-325.775) -- 0:00:36
385000 -- [-324.481] (-325.385) (-324.754) (-323.930) * (-326.593) (-328.810) (-326.559) [-327.141] -- 0:00:36
Average standard deviation of split frequencies: 0.015113
385500 -- (-326.945) [-324.531] (-323.839) (-324.235) * (-324.891) (-325.182) [-326.511] (-324.110) -- 0:00:36
386000 -- [-326.087] (-324.745) (-326.778) (-327.863) * [-323.767] (-325.000) (-326.637) (-326.645) -- 0:00:36
386500 -- [-324.933] (-328.386) (-324.384) (-327.391) * (-327.733) (-325.078) [-326.091] (-326.451) -- 0:00:36
387000 -- (-328.423) (-325.332) [-325.562] (-324.520) * (-327.227) (-324.298) [-326.750] (-324.924) -- 0:00:36
387500 -- [-324.157] (-324.504) (-332.502) (-326.752) * (-326.631) [-328.184] (-325.093) (-324.791) -- 0:00:36
388000 -- (-325.162) [-324.853] (-324.429) (-330.367) * (-326.280) (-324.593) [-324.230] (-323.793) -- 0:00:36
388500 -- (-327.413) [-324.455] (-326.648) (-327.199) * (-326.555) (-325.440) (-327.215) [-324.182] -- 0:00:36
389000 -- (-328.471) [-326.186] (-325.974) (-326.273) * (-326.285) (-323.855) [-324.669] (-327.118) -- 0:00:36
389500 -- (-331.069) [-324.111] (-326.856) (-325.915) * (-325.978) [-323.893] (-326.300) (-326.421) -- 0:00:36
390000 -- (-324.877) [-323.860] (-324.926) (-325.683) * (-324.370) (-326.655) [-324.833] (-325.302) -- 0:00:35
Average standard deviation of split frequencies: 0.015159
390500 -- (-331.399) (-328.337) [-328.566] (-326.473) * (-325.609) (-326.253) (-327.790) [-323.910] -- 0:00:37
391000 -- (-329.067) (-325.579) [-327.362] (-326.231) * (-326.228) (-329.748) [-324.730] (-324.999) -- 0:00:37
391500 -- (-328.050) (-327.106) [-323.940] (-324.825) * [-324.459] (-325.939) (-329.586) (-327.667) -- 0:00:37
392000 -- (-327.116) [-323.494] (-323.985) (-324.782) * [-327.671] (-325.666) (-324.537) (-323.626) -- 0:00:37
392500 -- (-324.873) [-325.634] (-325.879) (-328.735) * (-327.292) [-325.688] (-326.492) (-329.023) -- 0:00:37
393000 -- (-328.848) (-325.968) (-325.857) [-324.968] * (-326.709) (-325.789) [-325.082] (-331.042) -- 0:00:37
393500 -- (-328.794) (-326.338) [-325.398] (-326.597) * (-325.226) [-327.519] (-325.421) (-328.682) -- 0:00:36
394000 -- (-326.154) (-326.054) [-323.939] (-324.630) * (-324.819) (-330.591) (-325.593) [-325.611] -- 0:00:36
394500 -- (-327.099) (-325.750) [-324.441] (-327.658) * (-323.986) (-329.243) (-323.543) [-326.874] -- 0:00:36
395000 -- [-324.933] (-324.841) (-323.524) (-324.342) * (-327.367) (-331.171) [-324.283] (-327.402) -- 0:00:36
Average standard deviation of split frequencies: 0.013839
395500 -- (-324.089) (-324.061) (-324.564) [-324.841] * (-326.141) (-327.012) (-325.679) [-327.919] -- 0:00:36
396000 -- (-331.236) (-324.810) [-326.390] (-324.075) * [-324.408] (-324.345) (-323.651) (-328.739) -- 0:00:36
396500 -- (-327.251) (-327.277) (-323.993) [-327.415] * (-326.699) (-324.078) (-323.843) [-326.617] -- 0:00:36
397000 -- (-324.446) [-325.922] (-327.500) (-325.717) * [-323.959] (-326.572) (-326.278) (-324.835) -- 0:00:36
397500 -- [-323.847] (-331.542) (-325.059) (-324.694) * [-324.074] (-325.653) (-325.824) (-327.393) -- 0:00:36
398000 -- [-325.637] (-328.028) (-326.412) (-324.528) * (-328.049) (-325.961) (-326.870) [-326.476] -- 0:00:36
398500 -- [-324.848] (-325.160) (-324.250) (-326.135) * (-324.211) (-324.131) (-324.499) [-325.202] -- 0:00:36
399000 -- (-324.907) (-326.715) (-324.698) [-324.684] * (-329.547) [-324.936] (-325.108) (-329.079) -- 0:00:36
399500 -- (-324.827) (-326.226) [-324.233] (-324.683) * [-328.891] (-326.667) (-325.370) (-327.336) -- 0:00:36
400000 -- (-327.680) [-325.174] (-328.798) (-326.460) * (-325.377) (-327.425) (-327.750) [-324.403] -- 0:00:36
Average standard deviation of split frequencies: 0.014266
400500 -- (-325.779) (-327.502) [-325.081] (-323.541) * (-323.629) (-325.697) [-327.558] (-324.429) -- 0:00:35
401000 -- (-323.792) (-327.914) (-324.988) [-326.764] * (-325.627) [-323.884] (-324.423) (-325.596) -- 0:00:35
401500 -- (-327.105) (-329.715) [-327.322] (-324.659) * (-326.035) [-323.582] (-325.812) (-325.049) -- 0:00:35
402000 -- [-325.836] (-325.613) (-330.459) (-324.267) * (-329.160) (-326.150) (-331.442) [-325.940] -- 0:00:35
402500 -- (-323.721) (-324.130) [-328.821] (-324.436) * (-324.714) [-332.136] (-325.543) (-330.946) -- 0:00:35
403000 -- (-325.190) (-323.910) [-324.007] (-325.987) * (-324.552) (-323.766) [-324.911] (-327.360) -- 0:00:35
403500 -- (-324.860) (-323.996) (-329.270) [-324.101] * (-326.157) [-328.091] (-326.281) (-326.661) -- 0:00:35
404000 -- (-324.409) (-327.853) (-325.011) [-328.247] * [-324.475] (-326.032) (-324.414) (-325.705) -- 0:00:35
404500 -- (-324.699) (-331.516) (-326.893) [-324.230] * (-323.792) [-324.952] (-323.744) (-324.338) -- 0:00:35
405000 -- (-330.656) (-336.347) (-327.277) [-325.846] * (-324.614) (-323.936) (-323.510) [-324.517] -- 0:00:35
Average standard deviation of split frequencies: 0.013498
405500 -- (-326.517) (-323.994) [-325.885] (-323.819) * (-326.239) (-326.383) (-324.887) [-324.254] -- 0:00:35
406000 -- (-325.222) [-324.789] (-324.690) (-324.759) * [-327.753] (-324.058) (-324.380) (-325.514) -- 0:00:35
406500 -- (-325.688) (-323.770) (-325.332) [-327.153] * [-324.327] (-324.606) (-326.807) (-324.003) -- 0:00:35
407000 -- (-327.388) [-324.546] (-325.432) (-326.104) * [-326.820] (-325.809) (-324.095) (-325.255) -- 0:00:34
407500 -- [-327.774] (-324.891) (-324.464) (-325.174) * (-325.390) (-325.597) (-326.582) [-324.040] -- 0:00:36
408000 -- [-324.213] (-324.622) (-325.329) (-327.993) * (-324.483) [-326.256] (-326.743) (-325.835) -- 0:00:36
408500 -- (-329.679) (-324.496) [-326.030] (-325.800) * [-328.575] (-326.057) (-329.780) (-330.208) -- 0:00:36
409000 -- (-326.399) [-324.678] (-327.904) (-327.701) * (-325.720) (-325.402) (-326.924) [-324.790] -- 0:00:36
409500 -- [-324.484] (-324.413) (-324.122) (-324.935) * (-326.385) [-325.119] (-325.568) (-324.121) -- 0:00:36
410000 -- (-325.664) (-327.296) [-324.777] (-327.497) * (-323.724) (-323.653) [-324.830] (-324.101) -- 0:00:35
Average standard deviation of split frequencies: 0.012699
410500 -- [-326.988] (-333.561) (-324.327) (-326.165) * (-325.273) (-328.470) (-328.694) [-326.198] -- 0:00:35
411000 -- (-323.541) [-333.177] (-326.721) (-324.017) * [-325.287] (-329.764) (-325.369) (-324.294) -- 0:00:35
411500 -- [-323.840] (-328.522) (-324.873) (-328.673) * (-324.458) [-324.348] (-328.071) (-326.361) -- 0:00:35
412000 -- (-324.021) (-326.247) (-327.569) [-325.250] * (-326.864) [-327.453] (-328.271) (-326.380) -- 0:00:35
412500 -- [-325.153] (-325.143) (-323.953) (-325.562) * (-324.499) (-326.075) [-325.738] (-328.981) -- 0:00:35
413000 -- (-324.899) [-327.180] (-325.159) (-324.225) * (-327.381) [-326.786] (-324.449) (-326.915) -- 0:00:35
413500 -- (-325.389) (-328.329) (-327.054) [-324.873] * (-329.622) (-325.059) (-326.088) [-326.516] -- 0:00:35
414000 -- (-327.695) (-326.394) [-326.980] (-332.733) * (-324.010) [-324.500] (-325.696) (-325.407) -- 0:00:35
414500 -- [-325.424] (-324.106) (-328.298) (-325.763) * (-325.264) (-326.358) [-327.274] (-328.534) -- 0:00:35
415000 -- (-324.473) (-327.111) [-325.082] (-324.356) * (-325.024) [-323.508] (-324.539) (-325.843) -- 0:00:35
Average standard deviation of split frequencies: 0.012748
415500 -- (-326.497) [-327.351] (-324.333) (-324.876) * [-324.652] (-326.520) (-327.833) (-328.098) -- 0:00:35
416000 -- [-326.035] (-332.935) (-325.257) (-324.388) * (-325.154) (-328.128) [-327.652] (-324.292) -- 0:00:35
416500 -- [-325.018] (-329.786) (-325.668) (-327.084) * (-332.352) [-328.114] (-325.877) (-324.387) -- 0:00:35
417000 -- (-326.652) (-323.806) (-326.089) [-326.695] * (-324.955) (-324.488) (-330.663) [-326.640] -- 0:00:34
417500 -- (-325.718) (-324.823) (-325.017) [-325.406] * (-326.496) (-324.952) (-330.631) [-328.445] -- 0:00:34
418000 -- (-325.800) [-324.082] (-327.276) (-327.090) * (-323.371) (-323.706) (-327.820) [-325.364] -- 0:00:34
418500 -- (-327.306) (-325.675) [-328.748] (-329.755) * (-324.910) (-323.854) [-325.511] (-327.560) -- 0:00:34
419000 -- (-328.787) [-326.437] (-326.770) (-327.233) * (-324.012) (-324.946) [-325.678] (-324.812) -- 0:00:34
419500 -- (-328.719) (-326.078) [-325.570] (-324.146) * (-324.075) (-324.571) [-326.170] (-326.401) -- 0:00:34
420000 -- (-325.023) [-326.156] (-327.900) (-323.747) * [-324.069] (-324.728) (-325.007) (-327.045) -- 0:00:34
Average standard deviation of split frequencies: 0.011556
420500 -- [-325.269] (-324.996) (-326.009) (-324.971) * (-324.849) [-326.785] (-324.155) (-324.235) -- 0:00:34
421000 -- (-331.535) (-326.170) (-326.374) [-325.264] * (-325.216) (-324.173) [-324.871] (-324.357) -- 0:00:34
421500 -- (-327.466) [-325.081] (-325.196) (-325.123) * (-327.327) (-324.519) [-324.318] (-328.681) -- 0:00:34
422000 -- [-326.520] (-324.345) (-325.279) (-327.093) * (-326.185) (-325.575) [-324.291] (-328.854) -- 0:00:34
422500 -- [-324.274] (-323.890) (-324.914) (-326.116) * (-327.066) [-325.202] (-326.081) (-327.198) -- 0:00:34
423000 -- (-328.691) (-328.245) [-325.868] (-324.646) * (-327.420) [-326.262] (-327.283) (-326.486) -- 0:00:34
423500 -- (-324.245) [-326.349] (-325.170) (-325.640) * [-325.256] (-324.311) (-326.592) (-329.099) -- 0:00:34
424000 -- (-329.033) (-325.088) (-331.489) [-330.198] * [-327.124] (-325.418) (-328.179) (-326.638) -- 0:00:33
424500 -- (-324.113) (-324.877) [-326.743] (-328.688) * (-330.269) [-325.999] (-327.998) (-325.288) -- 0:00:35
425000 -- (-325.149) (-325.177) [-327.554] (-326.505) * [-326.564] (-325.315) (-325.847) (-328.931) -- 0:00:35
Average standard deviation of split frequencies: 0.011066
425500 -- (-327.438) [-328.142] (-325.328) (-325.329) * (-332.816) (-327.901) [-324.102] (-327.094) -- 0:00:35
426000 -- (-324.613) (-326.633) [-326.211] (-325.735) * (-327.898) (-325.273) [-324.929] (-324.451) -- 0:00:35
426500 -- (-324.483) (-325.347) [-326.849] (-325.442) * (-326.328) [-324.552] (-325.217) (-325.034) -- 0:00:34
427000 -- [-326.371] (-325.515) (-325.733) (-325.349) * (-324.955) (-327.016) (-325.624) [-325.190] -- 0:00:34
427500 -- (-326.440) [-323.778] (-330.550) (-327.315) * (-323.618) [-326.784] (-324.617) (-325.372) -- 0:00:34
428000 -- (-324.359) (-327.001) (-325.340) [-325.380] * (-326.580) (-326.984) [-325.266] (-327.058) -- 0:00:34
428500 -- (-326.169) (-323.722) [-326.470] (-324.753) * (-325.358) (-328.091) (-325.102) [-326.637] -- 0:00:34
429000 -- (-325.714) (-324.835) (-325.828) [-328.041] * [-323.852] (-325.890) (-328.963) (-326.953) -- 0:00:34
429500 -- (-324.119) (-326.189) [-324.582] (-326.942) * [-324.782] (-327.857) (-325.434) (-328.027) -- 0:00:34
430000 -- [-324.747] (-324.513) (-327.906) (-326.324) * (-324.019) [-324.487] (-325.207) (-325.667) -- 0:00:34
Average standard deviation of split frequencies: 0.010467
430500 -- (-326.359) [-324.337] (-326.412) (-325.165) * (-323.839) [-325.533] (-323.599) (-324.649) -- 0:00:34
431000 -- (-330.419) (-327.242) [-327.702] (-326.036) * (-325.090) (-326.417) [-325.260] (-324.853) -- 0:00:34
431500 -- (-324.550) (-325.415) [-324.389] (-323.976) * [-326.869] (-324.747) (-328.214) (-327.935) -- 0:00:34
432000 -- (-323.488) (-324.430) [-324.213] (-325.105) * (-326.982) [-324.557] (-328.793) (-325.243) -- 0:00:34
432500 -- (-324.485) (-324.467) [-323.538] (-326.953) * (-325.830) (-324.401) (-324.479) [-325.104] -- 0:00:34
433000 -- (-327.399) [-324.841] (-327.247) (-325.690) * (-327.552) (-325.667) [-324.278] (-325.999) -- 0:00:34
433500 -- (-327.299) (-330.333) [-325.799] (-325.043) * (-324.833) [-324.335] (-326.187) (-324.142) -- 0:00:33
434000 -- (-326.907) (-325.063) (-324.448) [-323.722] * (-325.764) (-323.978) (-327.028) [-325.246] -- 0:00:33
434500 -- (-325.190) (-323.959) (-329.913) [-323.710] * (-324.078) [-324.862] (-326.275) (-326.092) -- 0:00:33
435000 -- (-328.993) (-327.702) (-324.654) [-323.746] * (-324.685) (-325.808) (-327.333) [-327.942] -- 0:00:33
Average standard deviation of split frequencies: 0.011082
435500 -- (-325.292) [-328.199] (-324.338) (-330.117) * [-324.481] (-328.970) (-326.704) (-325.685) -- 0:00:33
436000 -- (-326.191) [-326.719] (-326.247) (-326.616) * [-327.021] (-325.993) (-324.460) (-328.105) -- 0:00:33
436500 -- (-325.107) (-326.339) (-325.404) [-327.926] * (-326.645) [-331.001] (-328.185) (-331.968) -- 0:00:33
437000 -- (-325.038) (-324.992) [-324.863] (-328.014) * (-326.718) [-324.156] (-327.471) (-326.316) -- 0:00:33
437500 -- (-328.795) (-324.615) (-326.732) [-324.754] * (-324.377) [-327.067] (-324.866) (-331.398) -- 0:00:33
438000 -- (-325.158) [-324.273] (-323.590) (-324.839) * [-325.580] (-328.152) (-324.260) (-325.591) -- 0:00:33
438500 -- (-326.304) (-323.890) (-324.312) [-327.399] * (-326.884) (-328.572) (-323.555) [-324.525] -- 0:00:33
439000 -- (-328.665) [-324.281] (-326.183) (-330.327) * [-326.669] (-333.008) (-325.242) (-324.970) -- 0:00:33
439500 -- (-324.361) (-326.479) (-323.914) [-325.386] * (-325.861) (-330.609) (-325.935) [-324.289] -- 0:00:33
440000 -- (-325.418) (-326.218) [-324.434] (-326.115) * [-325.262] (-329.113) (-325.166) (-328.761) -- 0:00:33
Average standard deviation of split frequencies: 0.011567
440500 -- (-325.986) (-327.486) [-324.476] (-324.596) * (-325.160) (-327.821) [-325.675] (-325.921) -- 0:00:33
441000 -- (-326.686) (-325.590) (-324.746) [-324.913] * (-326.856) [-327.360] (-324.999) (-326.799) -- 0:00:32
441500 -- (-325.627) (-324.859) (-325.775) [-326.937] * (-325.222) [-329.652] (-324.524) (-328.092) -- 0:00:32
442000 -- (-327.216) (-324.381) [-324.058] (-329.704) * (-324.098) [-325.570] (-324.478) (-323.638) -- 0:00:34
442500 -- (-326.488) [-324.042] (-327.056) (-326.736) * (-326.614) (-330.330) (-324.533) [-325.876] -- 0:00:34
443000 -- (-324.031) (-326.511) [-325.272] (-329.666) * (-328.982) [-324.586] (-325.930) (-323.761) -- 0:00:33
443500 -- (-325.243) (-325.390) [-325.600] (-332.358) * [-324.841] (-326.086) (-328.596) (-328.601) -- 0:00:33
444000 -- [-326.140] (-325.355) (-324.524) (-325.689) * (-325.276) (-327.368) (-325.712) [-329.462] -- 0:00:33
444500 -- (-324.686) (-326.687) [-324.033] (-327.696) * (-326.767) (-325.726) (-325.565) [-324.213] -- 0:00:33
445000 -- (-323.848) [-325.253] (-325.790) (-327.598) * [-325.792] (-326.186) (-324.359) (-328.389) -- 0:00:33
Average standard deviation of split frequencies: 0.011693
445500 -- (-327.112) (-328.578) [-324.556] (-327.312) * (-327.600) (-329.559) (-327.322) [-324.671] -- 0:00:33
446000 -- (-324.929) (-324.638) [-324.165] (-325.452) * (-326.223) (-324.794) (-327.435) [-324.593] -- 0:00:33
446500 -- (-328.556) (-325.494) [-326.506] (-324.813) * [-326.592] (-328.276) (-330.154) (-327.787) -- 0:00:33
447000 -- (-325.679) [-325.978] (-326.037) (-327.703) * (-324.188) [-329.447] (-328.320) (-325.695) -- 0:00:33
447500 -- (-325.646) [-328.337] (-328.140) (-328.029) * [-326.682] (-326.968) (-324.397) (-328.410) -- 0:00:33
448000 -- (-324.596) [-327.161] (-324.834) (-331.858) * (-325.247) [-324.130] (-324.622) (-325.633) -- 0:00:33
448500 -- (-324.513) (-327.227) [-323.926] (-332.585) * (-326.232) (-325.592) (-326.333) [-328.324] -- 0:00:33
449000 -- (-327.233) (-325.779) (-326.215) [-327.093] * (-328.473) (-332.161) (-325.244) [-324.091] -- 0:00:33
449500 -- (-328.569) (-326.132) [-325.415] (-327.365) * (-325.523) [-327.591] (-325.621) (-324.822) -- 0:00:33
450000 -- (-328.206) (-325.802) (-324.844) [-329.759] * (-326.038) (-326.038) (-324.120) [-324.789] -- 0:00:33
Average standard deviation of split frequencies: 0.012029
450500 -- (-324.033) (-325.682) (-323.722) [-325.654] * (-325.455) [-324.379] (-326.074) (-327.339) -- 0:00:32
451000 -- (-324.579) (-331.206) [-329.315] (-325.015) * (-325.657) (-324.962) (-325.070) [-323.906] -- 0:00:32
451500 -- (-326.064) [-326.679] (-325.154) (-327.184) * [-324.527] (-324.951) (-325.420) (-324.481) -- 0:00:32
452000 -- (-325.098) (-324.976) [-325.669] (-324.640) * (-325.000) [-325.516] (-326.878) (-324.108) -- 0:00:32
452500 -- [-325.145] (-326.284) (-324.617) (-326.416) * (-324.018) (-327.968) [-326.522] (-325.059) -- 0:00:32
453000 -- (-325.002) (-327.933) (-325.989) [-324.932] * (-325.441) [-325.088] (-323.945) (-325.504) -- 0:00:32
453500 -- (-325.916) (-324.624) [-325.129] (-327.482) * [-324.380] (-325.866) (-325.241) (-327.763) -- 0:00:32
454000 -- (-325.583) [-324.662] (-323.739) (-326.057) * [-325.952] (-324.441) (-326.437) (-325.907) -- 0:00:32
454500 -- [-326.733] (-325.386) (-324.615) (-325.123) * (-328.880) [-325.332] (-326.389) (-326.497) -- 0:00:32
455000 -- (-325.376) (-324.588) [-326.851] (-325.487) * (-328.898) (-325.096) (-326.263) [-323.578] -- 0:00:32
Average standard deviation of split frequencies: 0.012405
455500 -- (-324.804) (-327.000) (-324.272) [-327.208] * (-328.464) (-327.899) (-329.295) [-325.249] -- 0:00:32
456000 -- [-324.279] (-326.334) (-324.384) (-327.593) * (-329.525) (-327.464) [-325.601] (-325.586) -- 0:00:32
456500 -- [-323.930] (-324.893) (-324.104) (-330.372) * (-329.889) (-324.537) (-323.731) [-327.583] -- 0:00:32
457000 -- (-325.829) (-328.177) (-324.344) [-323.949] * (-329.169) (-325.243) [-326.467] (-327.856) -- 0:00:32
457500 -- (-324.379) (-327.984) [-328.586] (-323.860) * (-324.532) (-327.401) (-330.908) [-329.749] -- 0:00:32
458000 -- (-324.812) (-324.097) (-326.114) [-324.806] * [-325.449] (-328.769) (-329.817) (-325.581) -- 0:00:33
458500 -- [-326.833] (-326.164) (-324.207) (-325.879) * [-325.358] (-327.592) (-328.052) (-324.388) -- 0:00:33
459000 -- (-323.496) [-325.194] (-325.598) (-327.255) * (-330.469) (-327.928) [-326.389] (-325.895) -- 0:00:33
459500 -- [-323.595] (-326.612) (-324.445) (-324.616) * [-325.631] (-325.408) (-325.882) (-327.661) -- 0:00:32
460000 -- (-327.386) [-325.357] (-327.616) (-324.276) * (-326.576) [-324.293] (-327.788) (-323.457) -- 0:00:32
Average standard deviation of split frequencies: 0.012216
460500 -- [-324.971] (-325.285) (-324.443) (-325.742) * [-324.313] (-330.059) (-330.093) (-324.848) -- 0:00:32
461000 -- (-326.818) [-325.771] (-324.431) (-329.049) * (-325.582) [-327.199] (-326.368) (-328.791) -- 0:00:32
461500 -- (-324.769) (-325.188) [-324.450] (-325.064) * (-328.253) (-325.815) (-323.871) [-324.412] -- 0:00:32
462000 -- (-329.360) (-323.716) (-324.807) [-324.167] * (-325.483) [-324.794] (-327.988) (-324.293) -- 0:00:32
462500 -- (-330.141) [-326.617] (-328.395) (-325.056) * (-324.533) (-325.447) (-332.151) [-325.820] -- 0:00:32
463000 -- (-325.324) (-325.920) (-327.573) [-325.057] * (-324.549) [-326.389] (-327.664) (-324.031) -- 0:00:32
463500 -- [-327.529] (-326.300) (-330.915) (-325.975) * [-324.724] (-326.915) (-323.445) (-323.660) -- 0:00:32
464000 -- (-325.507) (-326.340) (-326.877) [-325.658] * (-323.974) (-330.715) (-326.884) [-324.139] -- 0:00:32
464500 -- (-324.689) (-325.872) [-323.994] (-324.882) * [-323.959] (-328.835) (-327.659) (-324.697) -- 0:00:32
465000 -- (-323.677) (-327.508) [-323.874] (-325.838) * (-326.189) [-327.428] (-324.406) (-324.905) -- 0:00:32
Average standard deviation of split frequencies: 0.011633
465500 -- (-327.925) (-327.667) (-324.496) [-326.110] * (-324.726) (-326.261) [-326.371] (-325.337) -- 0:00:32
466000 -- [-327.384] (-325.522) (-325.201) (-326.651) * (-326.748) (-324.514) [-323.492] (-324.321) -- 0:00:32
466500 -- (-323.885) (-327.072) [-324.690] (-326.419) * (-324.961) (-324.132) [-326.385] (-327.062) -- 0:00:32
467000 -- (-324.075) (-327.373) (-325.347) [-326.579] * (-327.792) (-326.548) (-326.582) [-325.539] -- 0:00:31
467500 -- (-326.477) [-326.354] (-325.863) (-329.798) * (-325.667) (-328.730) (-323.801) [-327.660] -- 0:00:31
468000 -- (-325.561) (-328.174) (-327.841) [-330.729] * (-326.815) (-325.381) [-323.620] (-326.110) -- 0:00:31
468500 -- (-324.454) (-328.560) (-325.748) [-327.196] * [-324.719] (-325.517) (-323.553) (-325.287) -- 0:00:31
469000 -- (-324.640) (-323.480) (-327.302) [-324.916] * [-324.278] (-333.746) (-325.373) (-324.619) -- 0:00:31
469500 -- [-325.218] (-324.980) (-328.258) (-325.433) * (-324.673) (-326.011) (-325.398) [-325.095] -- 0:00:31
470000 -- (-324.345) [-325.314] (-328.901) (-325.298) * [-329.192] (-328.033) (-328.764) (-327.715) -- 0:00:31
Average standard deviation of split frequencies: 0.011831
470500 -- (-325.940) (-329.729) (-324.708) [-324.378] * (-324.704) (-324.483) (-326.645) [-324.571] -- 0:00:31
471000 -- (-325.011) (-323.995) [-324.925] (-327.898) * (-326.971) [-326.664] (-328.134) (-323.561) -- 0:00:31
471500 -- [-324.950] (-325.424) (-326.639) (-327.199) * (-329.673) [-325.154] (-327.846) (-326.817) -- 0:00:31
472000 -- (-324.975) (-324.700) (-328.666) [-324.666] * [-324.626] (-324.749) (-327.923) (-324.685) -- 0:00:31
472500 -- (-324.866) (-325.151) [-325.968] (-324.287) * (-324.093) (-326.527) (-326.677) [-324.410] -- 0:00:31
473000 -- (-324.407) (-329.997) [-324.589] (-327.944) * (-324.708) [-324.847] (-325.026) (-325.388) -- 0:00:31
473500 -- [-325.527] (-326.201) (-327.007) (-326.208) * (-326.625) (-324.708) [-326.988] (-323.982) -- 0:00:31
474000 -- [-324.558] (-325.161) (-326.645) (-326.339) * (-328.158) [-326.357] (-328.873) (-323.597) -- 0:00:31
474500 -- (-325.072) (-325.095) (-323.888) [-327.139] * (-327.048) [-324.857] (-327.120) (-323.960) -- 0:00:32
475000 -- (-325.847) [-326.490] (-327.690) (-325.463) * [-327.314] (-324.018) (-326.026) (-325.971) -- 0:00:32
Average standard deviation of split frequencies: 0.011575
475500 -- (-324.308) (-325.849) [-327.606] (-324.582) * (-325.602) [-326.655] (-327.200) (-326.885) -- 0:00:31
476000 -- [-324.616] (-325.866) (-328.539) (-325.688) * (-324.496) [-326.310] (-327.009) (-326.865) -- 0:00:31
476500 -- (-325.700) (-326.138) [-324.743] (-324.062) * (-327.213) [-325.919] (-327.270) (-325.034) -- 0:00:31
477000 -- [-323.837] (-329.889) (-327.907) (-328.226) * (-325.550) (-327.782) (-326.334) [-325.187] -- 0:00:31
477500 -- (-325.902) (-324.153) (-327.652) [-325.832] * (-326.669) (-329.573) (-326.522) [-323.961] -- 0:00:31
478000 -- (-327.038) [-324.975] (-323.727) (-324.747) * (-325.497) (-326.043) (-328.537) [-323.634] -- 0:00:31
478500 -- [-326.630] (-324.518) (-325.361) (-326.387) * (-327.075) (-326.576) [-326.646] (-325.154) -- 0:00:31
479000 -- (-326.691) [-326.732] (-324.306) (-325.989) * (-325.628) (-329.335) [-324.900] (-326.219) -- 0:00:31
479500 -- [-323.917] (-324.189) (-328.203) (-325.145) * (-325.573) (-331.992) (-325.765) [-325.832] -- 0:00:31
480000 -- (-326.849) (-323.712) (-324.567) [-323.846] * (-323.936) [-327.076] (-328.276) (-326.643) -- 0:00:31
Average standard deviation of split frequencies: 0.011830
480500 -- [-329.700] (-324.134) (-326.603) (-326.325) * (-325.854) (-326.034) (-328.312) [-326.517] -- 0:00:31
481000 -- (-325.544) (-326.886) (-326.773) [-324.591] * (-325.762) (-326.451) (-328.181) [-324.596] -- 0:00:31
481500 -- [-324.103] (-327.426) (-328.245) (-324.556) * (-326.122) [-325.955] (-324.873) (-328.800) -- 0:00:31
482000 -- (-326.270) [-325.228] (-326.157) (-324.244) * (-325.772) (-325.590) (-325.839) [-328.740] -- 0:00:31
482500 -- (-325.120) (-326.277) (-327.998) [-326.182] * [-324.339] (-325.829) (-324.166) (-326.986) -- 0:00:31
483000 -- [-327.708] (-325.360) (-324.747) (-323.715) * (-323.580) (-326.071) [-325.027] (-325.901) -- 0:00:31
483500 -- [-326.453] (-325.951) (-325.503) (-324.108) * [-325.502] (-326.314) (-326.277) (-328.635) -- 0:00:30
484000 -- (-332.271) (-327.371) (-328.066) [-324.044] * (-323.875) [-325.689] (-324.588) (-329.109) -- 0:00:30
484500 -- [-328.291] (-325.045) (-329.351) (-325.003) * (-323.906) [-327.025] (-325.920) (-325.761) -- 0:00:30
485000 -- (-328.317) (-325.520) [-324.271] (-324.688) * [-324.208] (-328.281) (-328.873) (-325.048) -- 0:00:30
Average standard deviation of split frequencies: 0.012125
485500 -- (-323.689) [-325.572] (-326.263) (-327.231) * [-327.291] (-326.336) (-325.115) (-325.845) -- 0:00:30
486000 -- (-324.642) [-324.972] (-326.428) (-325.185) * (-325.852) [-327.081] (-324.365) (-326.784) -- 0:00:30
486500 -- (-324.530) (-325.104) [-327.058] (-326.007) * (-325.792) (-325.484) [-324.831] (-325.286) -- 0:00:30
487000 -- [-324.077] (-326.084) (-328.712) (-326.836) * (-325.827) (-325.300) (-325.622) [-324.880] -- 0:00:30
487500 -- (-325.120) [-324.259] (-325.823) (-325.704) * (-324.071) (-324.042) (-326.684) [-323.923] -- 0:00:30
488000 -- (-326.434) (-324.501) [-326.843] (-324.654) * (-325.760) (-323.372) [-326.517] (-323.932) -- 0:00:30
488500 -- (-324.917) [-323.275] (-325.968) (-325.178) * (-323.393) [-331.807] (-324.239) (-324.103) -- 0:00:30
489000 -- (-329.933) [-325.392] (-325.711) (-325.980) * (-325.900) (-325.489) (-326.503) [-325.456] -- 0:00:30
489500 -- (-327.305) [-324.584] (-326.442) (-326.014) * (-324.570) [-325.672] (-325.834) (-325.508) -- 0:00:30
490000 -- (-326.783) [-325.112] (-324.656) (-323.785) * (-330.003) [-325.457] (-325.753) (-328.309) -- 0:00:30
Average standard deviation of split frequencies: 0.011529
490500 -- [-325.415] (-326.313) (-327.271) (-325.171) * [-325.117] (-324.470) (-325.163) (-328.149) -- 0:00:30
491000 -- (-325.544) (-325.019) [-324.699] (-325.846) * (-328.914) (-324.409) [-325.849] (-330.247) -- 0:00:31
491500 -- (-324.267) (-326.190) [-325.319] (-326.490) * (-329.421) [-325.311] (-324.696) (-325.073) -- 0:00:31
492000 -- [-325.402] (-324.086) (-328.541) (-327.850) * (-327.181) [-324.211] (-326.315) (-328.242) -- 0:00:30
492500 -- (-325.781) [-324.019] (-326.894) (-325.015) * (-329.202) (-324.119) (-325.989) [-324.996] -- 0:00:30
493000 -- (-326.946) [-324.705] (-326.989) (-326.427) * [-326.683] (-324.261) (-325.303) (-326.162) -- 0:00:30
493500 -- [-326.865] (-324.394) (-325.177) (-327.993) * (-329.918) [-323.653] (-324.078) (-324.638) -- 0:00:30
494000 -- [-323.916] (-324.878) (-326.838) (-325.535) * (-324.751) [-325.279] (-325.230) (-325.656) -- 0:00:30
494500 -- [-328.358] (-324.540) (-327.815) (-325.264) * [-323.957] (-324.096) (-323.675) (-329.665) -- 0:00:30
495000 -- (-325.439) (-324.937) [-325.607] (-324.972) * (-326.235) (-324.386) (-326.437) [-326.662] -- 0:00:30
Average standard deviation of split frequencies: 0.011583
495500 -- (-326.512) (-326.237) [-325.729] (-324.215) * [-324.176] (-323.645) (-324.688) (-327.612) -- 0:00:30
496000 -- (-329.936) (-323.802) [-328.877] (-324.603) * (-325.268) (-324.084) (-326.579) [-324.268] -- 0:00:30
496500 -- (-324.782) (-327.913) (-325.269) [-324.439] * (-323.846) (-327.967) (-324.268) [-324.994] -- 0:00:30
497000 -- (-327.027) (-332.004) (-323.977) [-326.317] * (-324.810) (-325.516) [-325.589] (-326.895) -- 0:00:30
497500 -- (-324.414) (-326.267) [-327.623] (-327.288) * [-325.287] (-324.116) (-326.120) (-326.221) -- 0:00:30
498000 -- (-327.562) [-325.078] (-326.715) (-327.169) * (-325.410) (-327.746) [-323.668] (-325.891) -- 0:00:30
498500 -- (-324.222) [-326.923] (-328.314) (-324.068) * (-325.173) (-327.054) [-326.324] (-326.859) -- 0:00:30
499000 -- (-325.531) [-325.810] (-330.031) (-324.665) * [-326.764] (-324.102) (-325.391) (-326.332) -- 0:00:30
499500 -- [-325.257] (-328.724) (-327.823) (-323.411) * (-327.027) (-323.624) (-328.513) [-326.861] -- 0:00:30
500000 -- (-327.539) (-325.725) [-327.619] (-325.635) * [-325.087] (-324.652) (-329.923) (-326.585) -- 0:00:30
Average standard deviation of split frequencies: 0.011828
500500 -- (-323.454) [-323.960] (-327.546) (-325.691) * (-323.758) [-324.447] (-330.970) (-325.922) -- 0:00:29
501000 -- (-325.135) [-328.725] (-328.271) (-328.322) * (-324.780) (-327.930) (-327.573) [-327.238] -- 0:00:29
501500 -- (-325.902) [-329.105] (-326.175) (-326.611) * (-327.519) (-326.610) (-325.451) [-324.576] -- 0:00:29
502000 -- (-323.867) (-328.528) [-326.089] (-327.221) * (-326.352) [-329.370] (-326.998) (-324.541) -- 0:00:29
502500 -- (-326.025) [-327.639] (-327.161) (-327.477) * (-324.659) (-326.592) (-323.918) [-327.649] -- 0:00:29
503000 -- [-325.451] (-326.326) (-328.712) (-330.665) * (-325.547) (-324.566) [-327.854] (-329.924) -- 0:00:29
503500 -- (-326.345) (-330.855) (-324.807) [-330.099] * (-330.944) (-324.804) (-325.237) [-325.804] -- 0:00:29
504000 -- [-327.764] (-324.864) (-324.425) (-326.640) * [-326.358] (-326.713) (-323.889) (-325.067) -- 0:00:29
504500 -- (-326.099) [-325.276] (-326.040) (-325.879) * (-327.965) [-324.856] (-325.323) (-328.412) -- 0:00:29
505000 -- (-326.165) (-323.925) (-325.281) [-325.551] * [-329.950] (-325.469) (-325.066) (-324.790) -- 0:00:29
Average standard deviation of split frequencies: 0.011820
505500 -- (-326.928) [-325.105] (-328.883) (-325.880) * [-323.783] (-323.910) (-324.508) (-328.373) -- 0:00:29
506000 -- (-325.636) (-326.348) (-325.294) [-325.688] * [-324.313] (-324.390) (-327.732) (-327.806) -- 0:00:29
506500 -- (-329.000) (-325.393) [-326.310] (-326.655) * (-330.604) (-329.200) [-324.382] (-327.693) -- 0:00:29
507000 -- (-328.997) (-325.275) (-327.202) [-325.452] * (-323.727) (-327.711) [-325.914] (-327.990) -- 0:00:29
507500 -- (-326.628) (-327.943) (-324.791) [-325.097] * (-325.818) (-326.166) (-324.630) [-331.091] -- 0:00:29
508000 -- (-327.752) [-324.356] (-324.413) (-325.081) * (-327.821) (-325.617) [-323.697] (-327.481) -- 0:00:29
508500 -- (-329.141) (-324.917) (-326.213) [-324.209] * [-325.494] (-326.372) (-326.784) (-325.317) -- 0:00:29
509000 -- (-329.108) (-323.834) [-325.536] (-323.829) * [-324.075] (-323.489) (-327.264) (-324.244) -- 0:00:29
509500 -- (-329.460) (-327.229) (-324.288) [-325.176] * [-324.600] (-325.578) (-323.863) (-325.034) -- 0:00:29
510000 -- (-325.145) (-326.528) (-325.411) [-325.272] * (-327.008) [-326.577] (-325.010) (-325.713) -- 0:00:29
Average standard deviation of split frequencies: 0.012058
510500 -- (-326.416) [-325.828] (-324.796) (-324.935) * (-326.847) (-325.102) [-326.703] (-326.806) -- 0:00:29
511000 -- [-325.595] (-325.236) (-326.876) (-328.216) * (-328.225) (-325.591) [-331.528] (-325.049) -- 0:00:29
511500 -- (-324.955) [-325.231] (-324.765) (-326.171) * (-325.747) [-325.698] (-325.027) (-325.697) -- 0:00:29
512000 -- (-324.301) (-326.546) (-324.204) [-326.614] * [-324.858] (-324.490) (-325.311) (-325.242) -- 0:00:29
512500 -- (-326.314) (-326.094) [-323.976] (-327.415) * (-324.578) (-326.672) (-324.391) [-325.739] -- 0:00:29
513000 -- [-325.353] (-325.024) (-323.593) (-326.189) * (-324.554) (-324.900) [-324.492] (-325.307) -- 0:00:29
513500 -- (-327.391) (-327.431) [-325.647] (-328.411) * (-323.897) (-325.626) (-324.219) [-325.192] -- 0:00:29
514000 -- (-329.685) (-329.087) (-324.036) [-326.116] * (-324.744) (-326.656) [-324.857] (-326.137) -- 0:00:29
514500 -- (-331.961) (-325.515) (-324.264) [-324.583] * [-327.318] (-325.975) (-325.429) (-326.569) -- 0:00:29
515000 -- [-329.442] (-326.576) (-324.088) (-325.527) * (-325.590) (-327.458) [-326.866] (-325.809) -- 0:00:29
Average standard deviation of split frequencies: 0.011819
515500 -- (-327.604) [-324.262] (-324.735) (-324.744) * (-325.911) (-329.640) [-323.648] (-326.422) -- 0:00:29
516000 -- (-326.077) (-324.228) (-325.007) [-324.199] * (-327.332) (-324.042) [-325.011] (-325.343) -- 0:00:29
516500 -- (-325.198) (-326.650) [-328.178] (-324.983) * (-326.416) (-325.001) [-326.958] (-328.171) -- 0:00:29
517000 -- (-326.740) (-330.512) (-328.808) [-324.566] * (-326.264) [-330.420] (-326.815) (-325.364) -- 0:00:28
517500 -- (-326.942) (-326.475) [-324.894] (-325.385) * (-324.263) (-326.464) [-326.956] (-325.460) -- 0:00:28
518000 -- [-323.573] (-324.322) (-324.152) (-325.020) * (-324.035) [-327.166] (-326.336) (-324.300) -- 0:00:28
518500 -- (-328.164) (-330.445) [-325.784] (-327.525) * (-325.556) (-324.187) (-326.022) [-325.143] -- 0:00:28
519000 -- (-325.227) [-327.099] (-323.836) (-326.451) * (-326.113) (-327.685) (-324.798) [-325.300] -- 0:00:28
519500 -- (-325.362) (-327.307) [-324.990] (-326.532) * (-324.994) [-324.337] (-324.693) (-324.173) -- 0:00:28
520000 -- (-331.264) (-329.170) (-324.511) [-325.720] * [-325.617] (-327.349) (-325.438) (-324.622) -- 0:00:28
Average standard deviation of split frequencies: 0.011261
520500 -- (-329.935) (-325.951) [-324.130] (-326.180) * (-327.158) [-324.971] (-326.997) (-326.672) -- 0:00:28
521000 -- (-326.955) [-325.162] (-324.207) (-323.879) * [-324.449] (-326.589) (-325.765) (-326.701) -- 0:00:28
521500 -- (-325.184) (-324.626) (-323.381) [-323.770] * (-324.284) [-330.603] (-325.755) (-325.359) -- 0:00:28
522000 -- (-325.237) (-326.287) [-325.394] (-324.805) * [-326.894] (-325.012) (-324.287) (-325.064) -- 0:00:28
522500 -- (-325.402) (-325.769) [-324.073] (-324.127) * (-324.680) (-326.160) (-325.161) [-324.742] -- 0:00:28
523000 -- (-325.703) (-324.415) (-326.659) [-323.761] * (-327.119) (-325.899) [-326.188] (-325.715) -- 0:00:28
523500 -- [-327.048] (-329.135) (-324.207) (-327.334) * [-326.108] (-323.743) (-325.695) (-325.590) -- 0:00:28
524000 -- (-324.702) (-333.045) [-327.176] (-326.621) * (-325.569) (-326.037) (-327.390) [-324.577] -- 0:00:28
524500 -- (-324.182) (-324.848) [-323.500] (-325.307) * (-328.241) [-326.611] (-325.164) (-327.250) -- 0:00:28
525000 -- (-324.240) (-324.161) (-325.333) [-324.991] * [-324.358] (-325.040) (-326.943) (-326.335) -- 0:00:28
Average standard deviation of split frequencies: 0.010698
525500 -- (-328.252) [-325.903] (-324.732) (-323.885) * (-327.568) [-324.730] (-330.196) (-328.157) -- 0:00:28
526000 -- [-328.853] (-325.508) (-325.892) (-323.947) * [-324.628] (-324.640) (-329.250) (-325.273) -- 0:00:28
526500 -- (-326.671) [-323.824] (-324.308) (-326.150) * [-324.705] (-327.098) (-326.242) (-323.376) -- 0:00:28
527000 -- (-324.143) (-326.539) [-324.386] (-325.392) * (-326.072) (-326.477) [-324.014] (-324.418) -- 0:00:28
527500 -- (-324.524) [-326.213] (-326.514) (-326.480) * (-326.105) (-324.335) (-324.548) [-325.996] -- 0:00:28
528000 -- [-325.316] (-325.467) (-326.240) (-324.958) * (-328.681) (-327.962) (-326.646) [-324.015] -- 0:00:28
528500 -- (-328.478) (-327.127) [-326.598] (-325.608) * (-325.020) [-325.063] (-323.568) (-327.456) -- 0:00:28
529000 -- [-328.057] (-328.340) (-326.345) (-325.917) * (-324.072) (-325.798) (-327.911) [-326.075] -- 0:00:28
529500 -- (-324.834) [-325.266] (-324.599) (-323.790) * (-325.409) (-323.416) (-328.650) [-325.083] -- 0:00:28
530000 -- [-326.584] (-327.391) (-324.789) (-327.693) * (-330.442) (-328.861) (-326.165) [-325.622] -- 0:00:28
Average standard deviation of split frequencies: 0.010549
530500 -- (-332.163) (-323.484) [-325.060] (-326.198) * (-325.816) (-325.436) [-324.864] (-326.330) -- 0:00:28
531000 -- (-333.396) [-324.622] (-325.897) (-325.722) * (-327.693) (-325.378) [-326.676] (-327.033) -- 0:00:28
531500 -- [-328.896] (-326.099) (-325.357) (-328.331) * [-326.828] (-325.832) (-325.890) (-325.772) -- 0:00:28
532000 -- (-324.337) (-324.899) (-330.450) [-323.874] * (-327.185) (-329.305) (-326.691) [-324.266] -- 0:00:28
532500 -- (-324.387) [-324.999] (-325.444) (-323.804) * (-323.729) [-325.750] (-327.351) (-324.588) -- 0:00:28
533000 -- (-327.197) (-325.106) [-325.733] (-326.221) * [-330.276] (-325.116) (-325.086) (-324.986) -- 0:00:28
533500 -- (-325.455) (-324.175) (-331.667) [-324.131] * [-323.818] (-326.838) (-329.661) (-324.732) -- 0:00:27
534000 -- (-327.174) (-323.471) [-329.615] (-326.412) * (-326.081) (-325.443) [-326.568] (-323.801) -- 0:00:27
534500 -- [-326.964] (-326.817) (-324.029) (-324.303) * (-323.735) (-325.256) [-325.469] (-326.640) -- 0:00:27
535000 -- (-325.079) (-326.144) (-324.754) [-325.048] * (-326.428) (-327.319) [-327.488] (-324.213) -- 0:00:27
Average standard deviation of split frequencies: 0.010719
535500 -- (-330.275) (-326.987) (-325.080) [-324.425] * (-324.429) (-328.506) [-325.366] (-328.992) -- 0:00:27
536000 -- (-326.660) [-325.197] (-324.100) (-326.123) * (-325.281) [-325.562] (-325.623) (-327.148) -- 0:00:27
536500 -- [-328.731] (-324.690) (-326.877) (-323.872) * (-330.652) (-332.204) [-325.371] (-327.490) -- 0:00:27
537000 -- (-324.469) (-324.296) (-324.273) [-324.866] * (-325.076) (-327.215) [-327.020] (-324.615) -- 0:00:27
537500 -- (-324.221) [-326.447] (-332.067) (-324.661) * (-326.512) (-326.044) [-327.459] (-324.205) -- 0:00:27
538000 -- (-324.795) [-326.590] (-327.120) (-326.026) * [-324.068] (-325.482) (-323.935) (-324.495) -- 0:00:27
538500 -- (-325.551) (-325.349) [-329.222] (-324.043) * (-325.037) (-329.295) (-325.975) [-326.058] -- 0:00:27
539000 -- (-325.551) (-327.127) [-335.256] (-323.767) * [-325.123] (-325.336) (-323.857) (-328.652) -- 0:00:27
539500 -- [-328.331] (-325.865) (-327.160) (-324.248) * (-328.048) [-325.685] (-326.027) (-327.525) -- 0:00:27
540000 -- (-325.277) [-325.287] (-331.488) (-329.828) * (-327.550) (-330.203) [-325.968] (-328.265) -- 0:00:27
Average standard deviation of split frequencies: 0.010408
540500 -- (-325.523) (-327.293) [-323.901] (-329.625) * [-325.859] (-325.994) (-325.985) (-326.944) -- 0:00:27
541000 -- (-327.910) (-325.420) (-324.617) [-329.920] * (-324.031) [-323.365] (-328.232) (-325.595) -- 0:00:27
541500 -- (-330.356) (-326.729) [-325.657] (-326.526) * (-325.104) (-323.840) [-324.242] (-331.041) -- 0:00:27
542000 -- (-328.044) (-327.863) (-325.817) [-328.085] * (-324.325) (-330.166) (-324.556) [-323.900] -- 0:00:27
542500 -- (-326.893) [-324.775] (-326.885) (-326.283) * (-326.509) [-326.309] (-326.600) (-323.878) -- 0:00:27
543000 -- [-324.177] (-324.529) (-327.099) (-323.734) * (-324.862) (-326.867) [-330.117] (-325.066) -- 0:00:27
543500 -- (-324.987) (-326.179) [-327.941] (-327.183) * [-327.797] (-325.236) (-327.555) (-328.254) -- 0:00:27
544000 -- [-328.148] (-323.820) (-325.608) (-326.538) * [-326.585] (-324.387) (-324.885) (-325.420) -- 0:00:27
544500 -- (-329.632) (-325.223) [-326.696] (-325.262) * (-326.573) (-327.176) (-331.182) [-323.597] -- 0:00:27
545000 -- (-324.650) (-326.490) (-324.600) [-323.877] * (-325.349) [-326.022] (-327.142) (-325.549) -- 0:00:27
Average standard deviation of split frequencies: 0.009929
545500 -- (-326.585) (-325.114) (-324.265) [-324.582] * (-325.868) (-327.225) (-327.575) [-325.913] -- 0:00:27
546000 -- (-324.974) (-328.158) [-324.342] (-324.537) * (-324.208) [-324.915] (-325.660) (-326.818) -- 0:00:27
546500 -- (-325.879) (-326.433) [-325.932] (-324.259) * (-325.049) [-325.246] (-325.262) (-323.647) -- 0:00:27
547000 -- (-328.162) (-324.688) (-327.400) [-328.904] * [-326.392] (-324.773) (-326.616) (-325.032) -- 0:00:27
547500 -- (-325.051) (-325.361) [-325.592] (-324.730) * (-328.246) (-324.298) [-327.227] (-325.518) -- 0:00:27
548000 -- (-323.662) [-325.016] (-328.691) (-327.230) * (-329.348) (-329.883) [-325.250] (-325.108) -- 0:00:27
548500 -- (-325.297) (-328.145) [-329.011] (-325.220) * (-328.105) (-330.689) [-329.171] (-326.777) -- 0:00:27
549000 -- (-325.345) (-326.451) [-326.905] (-326.760) * (-326.646) (-325.962) [-325.576] (-329.650) -- 0:00:27
549500 -- (-324.745) (-325.003) (-326.611) [-326.690] * (-328.442) (-324.857) [-327.529] (-327.595) -- 0:00:27
550000 -- (-326.719) (-329.324) (-326.113) [-324.199] * (-328.285) (-324.158) [-325.064] (-326.977) -- 0:00:27
Average standard deviation of split frequencies: 0.009577
550500 -- (-325.990) (-331.125) [-327.470] (-326.611) * (-327.211) [-325.579] (-325.028) (-324.399) -- 0:00:26
551000 -- (-330.860) (-328.619) (-328.773) [-323.866] * (-328.073) (-330.366) [-323.943] (-326.670) -- 0:00:26
551500 -- (-330.128) [-324.852] (-328.526) (-323.826) * (-324.642) (-329.417) (-325.593) [-324.453] -- 0:00:26
552000 -- (-328.208) [-331.411] (-326.087) (-325.951) * (-330.586) [-326.056] (-325.547) (-323.786) -- 0:00:26
552500 -- (-329.843) (-325.604) (-324.803) [-325.847] * (-328.129) [-324.496] (-323.702) (-325.213) -- 0:00:26
553000 -- [-325.681] (-325.671) (-324.285) (-328.053) * (-329.501) [-326.084] (-323.844) (-323.911) -- 0:00:26
553500 -- (-323.703) (-325.689) [-324.662] (-332.905) * (-326.439) [-324.233] (-323.850) (-323.563) -- 0:00:26
554000 -- [-326.968] (-326.114) (-325.037) (-328.528) * (-328.060) (-330.469) [-324.140] (-324.826) -- 0:00:26
554500 -- (-328.318) (-328.648) (-324.600) [-325.551] * (-329.340) [-325.878] (-325.580) (-324.219) -- 0:00:26
555000 -- (-327.070) (-326.867) [-324.152] (-328.217) * (-328.002) (-324.967) (-324.065) [-324.317] -- 0:00:26
Average standard deviation of split frequencies: 0.010280
555500 -- (-328.054) [-323.962] (-327.103) (-325.824) * (-329.356) [-323.797] (-323.965) (-324.149) -- 0:00:26
556000 -- [-324.257] (-325.174) (-327.563) (-324.467) * (-331.003) (-327.190) (-325.581) [-325.112] -- 0:00:26
556500 -- (-330.320) (-325.565) [-325.846] (-327.613) * [-324.098] (-326.630) (-324.345) (-327.008) -- 0:00:26
557000 -- (-334.562) [-324.639] (-334.431) (-330.110) * (-325.795) (-326.649) (-324.297) [-325.331] -- 0:00:26
557500 -- (-326.887) (-324.757) (-327.716) [-326.360] * (-326.734) (-326.220) (-325.870) [-326.197] -- 0:00:26
558000 -- (-326.234) (-326.296) [-324.193] (-325.929) * (-326.148) (-327.180) [-326.940] (-330.574) -- 0:00:26
558500 -- [-325.814] (-323.577) (-325.388) (-325.763) * (-326.583) (-327.762) (-327.940) [-325.405] -- 0:00:26
559000 -- (-327.112) [-325.565] (-327.573) (-325.955) * (-324.369) (-324.552) [-326.684] (-325.419) -- 0:00:26
559500 -- (-325.677) (-323.917) (-326.685) [-323.849] * (-327.238) (-324.340) [-324.371] (-329.313) -- 0:00:25
560000 -- [-323.440] (-324.898) (-326.649) (-325.451) * (-325.394) (-324.604) (-323.637) [-326.166] -- 0:00:26
Average standard deviation of split frequencies: 0.009984
560500 -- [-325.004] (-327.928) (-326.243) (-323.816) * (-325.569) (-326.460) [-324.443] (-326.903) -- 0:00:26
561000 -- (-324.909) (-324.504) [-327.056] (-331.864) * (-325.129) (-325.343) (-324.894) [-326.730] -- 0:00:26
561500 -- (-327.692) [-329.039] (-331.507) (-326.070) * [-325.405] (-326.387) (-327.742) (-325.911) -- 0:00:26
562000 -- (-328.915) [-324.695] (-325.607) (-327.131) * [-324.187] (-326.344) (-324.581) (-326.343) -- 0:00:26
562500 -- (-325.492) (-327.600) (-327.132) [-327.453] * (-328.017) (-324.372) (-325.486) [-324.966] -- 0:00:26
563000 -- (-326.581) [-325.033] (-324.160) (-329.490) * (-324.355) (-329.308) (-324.195) [-324.888] -- 0:00:26
563500 -- (-324.810) (-325.451) (-324.673) [-324.478] * (-325.601) [-325.774] (-328.526) (-324.932) -- 0:00:26
564000 -- [-326.034] (-326.634) (-333.767) (-324.570) * [-324.452] (-323.904) (-326.208) (-324.833) -- 0:00:26
564500 -- [-324.648] (-328.189) (-327.170) (-326.200) * [-324.566] (-325.877) (-325.233) (-326.178) -- 0:00:26
565000 -- [-323.474] (-329.702) (-325.071) (-326.023) * [-325.428] (-323.727) (-325.333) (-329.278) -- 0:00:26
Average standard deviation of split frequencies: 0.009838
565500 -- [-324.015] (-326.868) (-327.992) (-330.213) * (-325.208) (-324.765) (-327.753) [-326.372] -- 0:00:26
566000 -- (-324.205) (-327.926) [-324.739] (-327.255) * (-325.686) (-324.026) [-326.465] (-328.635) -- 0:00:26
566500 -- (-326.640) (-325.966) [-324.284] (-332.305) * (-326.096) (-323.599) (-327.393) [-325.543] -- 0:00:26
567000 -- (-324.970) [-325.405] (-327.724) (-324.730) * (-327.730) (-327.295) [-325.533] (-323.949) -- 0:00:25
567500 -- [-327.546] (-325.546) (-326.315) (-324.790) * (-326.277) [-323.875] (-324.875) (-325.624) -- 0:00:25
568000 -- (-326.588) (-325.288) (-325.955) [-324.786] * (-325.167) (-327.606) [-326.240] (-324.695) -- 0:00:25
568500 -- (-327.309) (-326.634) (-325.772) [-328.342] * (-327.368) [-329.435] (-324.639) (-323.943) -- 0:00:25
569000 -- [-324.293] (-325.198) (-323.905) (-325.265) * (-327.263) (-326.420) (-327.741) [-327.142] -- 0:00:25
569500 -- (-324.262) (-324.969) [-324.197] (-329.271) * (-324.767) [-325.657] (-323.761) (-325.224) -- 0:00:25
570000 -- (-327.448) (-329.775) (-325.144) [-328.857] * (-325.406) (-324.595) (-324.730) [-326.680] -- 0:00:25
Average standard deviation of split frequencies: 0.008701
570500 -- (-325.229) (-325.817) (-324.918) [-325.001] * [-326.199] (-326.125) (-325.133) (-328.227) -- 0:00:25
571000 -- (-328.304) [-323.965] (-327.089) (-323.792) * (-324.007) (-323.359) [-324.188] (-326.368) -- 0:00:25
571500 -- (-327.278) [-324.291] (-326.096) (-325.703) * (-324.112) (-326.243) [-325.260] (-326.854) -- 0:00:25
572000 -- [-325.087] (-325.807) (-328.699) (-324.820) * (-325.453) [-325.110] (-326.932) (-326.046) -- 0:00:25
572500 -- (-325.933) (-325.583) [-324.600] (-324.798) * (-328.021) (-329.879) (-325.057) [-331.965] -- 0:00:25
573000 -- [-326.285] (-325.595) (-324.291) (-324.584) * (-328.533) (-326.352) [-324.169] (-327.649) -- 0:00:25
573500 -- (-324.290) [-327.505] (-325.526) (-323.781) * (-329.916) (-326.149) [-328.319] (-328.922) -- 0:00:25
574000 -- (-324.790) (-324.069) [-327.444] (-324.572) * (-325.581) [-325.376] (-323.815) (-324.199) -- 0:00:25
574500 -- (-328.009) (-324.246) (-328.360) [-325.769] * (-325.649) (-323.999) (-323.963) [-324.362] -- 0:00:25
575000 -- (-324.983) (-325.588) (-325.345) [-324.245] * (-326.206) (-323.561) (-327.209) [-326.800] -- 0:00:25
Average standard deviation of split frequencies: 0.008511
575500 -- (-324.142) (-325.025) [-325.031] (-325.090) * (-324.385) (-326.284) (-327.392) [-324.593] -- 0:00:25
576000 -- [-327.586] (-323.992) (-328.719) (-328.564) * (-328.866) [-323.500] (-324.376) (-324.936) -- 0:00:25
576500 -- [-326.807] (-325.231) (-327.596) (-329.500) * (-329.345) (-325.725) (-324.546) [-325.577] -- 0:00:24
577000 -- (-327.966) (-326.118) [-325.524] (-325.783) * (-327.390) [-328.272] (-324.228) (-323.848) -- 0:00:25
577500 -- (-325.915) (-328.155) [-324.576] (-324.222) * (-326.192) (-324.856) [-325.426] (-326.810) -- 0:00:25
578000 -- (-325.628) [-326.170] (-324.934) (-327.404) * (-325.294) (-324.984) [-324.815] (-325.842) -- 0:00:25
578500 -- (-326.369) [-324.281] (-325.459) (-330.165) * (-326.299) (-326.732) (-324.946) [-324.910] -- 0:00:25
579000 -- (-325.419) (-329.129) [-324.298] (-325.529) * (-324.288) (-325.787) [-324.575] (-323.930) -- 0:00:25
579500 -- (-325.242) (-326.448) (-326.707) [-324.446] * (-327.226) (-324.624) (-324.428) [-323.989] -- 0:00:25
580000 -- [-323.943] (-326.708) (-328.114) (-324.440) * (-326.060) (-326.640) [-323.239] (-323.671) -- 0:00:25
Average standard deviation of split frequencies: 0.008551
580500 -- (-326.122) (-327.972) [-326.469] (-323.996) * [-325.173] (-324.913) (-323.944) (-324.453) -- 0:00:25
581000 -- (-324.269) [-323.784] (-325.777) (-325.617) * (-323.400) [-328.086] (-330.993) (-323.491) -- 0:00:25
581500 -- (-326.130) (-325.096) (-323.802) [-325.710] * [-323.893] (-325.008) (-326.642) (-327.090) -- 0:00:25
582000 -- (-327.023) (-330.720) (-326.326) [-325.656] * (-326.699) (-326.724) (-329.436) [-324.642] -- 0:00:25
582500 -- (-328.151) (-327.743) [-326.620] (-325.046) * (-326.014) (-327.073) [-327.062] (-325.276) -- 0:00:25
583000 -- (-324.940) [-327.814] (-325.340) (-327.057) * (-325.562) (-325.759) (-325.619) [-325.667] -- 0:00:25
583500 -- (-325.614) [-326.110] (-325.015) (-324.081) * (-330.152) (-326.010) [-324.450] (-325.044) -- 0:00:24
584000 -- (-324.639) (-325.532) (-327.812) [-328.029] * (-330.817) (-327.815) [-324.958] (-326.363) -- 0:00:24
584500 -- (-326.039) (-324.477) (-328.294) [-326.672] * (-324.082) [-325.308] (-328.017) (-326.177) -- 0:00:24
585000 -- (-326.454) (-324.169) (-326.414) [-326.295] * (-329.671) [-325.035] (-324.288) (-326.862) -- 0:00:24
Average standard deviation of split frequencies: 0.008742
585500 -- (-330.216) [-327.829] (-327.437) (-326.353) * (-325.733) (-323.984) (-325.262) [-325.939] -- 0:00:24
586000 -- [-324.800] (-323.894) (-326.192) (-327.009) * (-326.516) [-323.897] (-323.808) (-327.097) -- 0:00:24
586500 -- (-325.300) (-325.478) [-325.331] (-328.112) * [-326.877] (-325.710) (-328.724) (-326.806) -- 0:00:24
587000 -- (-325.071) (-323.429) [-325.092] (-325.700) * (-330.284) (-329.737) [-325.249] (-324.802) -- 0:00:24
587500 -- (-325.823) (-324.515) (-324.881) [-324.461] * (-331.599) (-325.952) [-324.744] (-325.603) -- 0:00:24
588000 -- (-326.779) (-326.598) [-323.698] (-324.816) * (-327.129) (-324.821) [-325.067] (-325.891) -- 0:00:24
588500 -- [-326.671] (-325.981) (-326.514) (-326.459) * (-323.790) (-324.947) (-325.994) [-324.640] -- 0:00:24
589000 -- (-330.829) (-325.721) [-325.933] (-327.732) * [-325.065] (-328.181) (-325.442) (-325.782) -- 0:00:24
589500 -- [-325.843] (-324.235) (-328.421) (-325.698) * (-325.501) [-330.368] (-325.647) (-327.372) -- 0:00:24
590000 -- (-323.717) [-325.710] (-329.993) (-323.863) * [-326.607] (-324.250) (-328.364) (-326.177) -- 0:00:24
Average standard deviation of split frequencies: 0.008141
590500 -- (-325.665) (-328.917) (-327.000) [-326.243] * (-329.912) (-331.407) (-327.627) [-325.317] -- 0:00:24
591000 -- (-324.865) (-328.442) [-327.103] (-324.447) * (-325.465) [-326.781] (-325.245) (-327.678) -- 0:00:24
591500 -- (-329.105) (-326.310) [-324.988] (-327.407) * (-325.086) (-324.649) (-323.565) [-324.016] -- 0:00:24
592000 -- (-323.385) (-330.429) [-330.653] (-331.840) * (-327.203) (-325.608) [-325.142] (-326.025) -- 0:00:24
592500 -- (-324.130) [-331.516] (-327.918) (-331.322) * (-330.143) (-326.014) [-324.676] (-327.596) -- 0:00:24
593000 -- (-327.021) (-326.785) (-326.661) [-327.117] * [-326.526] (-324.785) (-324.361) (-326.305) -- 0:00:24
593500 -- (-326.432) (-326.813) (-328.173) [-325.942] * (-324.418) (-328.922) [-323.706] (-326.286) -- 0:00:23
594000 -- [-328.723] (-326.442) (-326.987) (-324.591) * (-324.838) (-324.898) [-328.376] (-324.536) -- 0:00:24
594500 -- [-328.491] (-328.473) (-324.192) (-330.045) * (-326.162) (-326.596) (-326.103) [-326.058] -- 0:00:24
595000 -- (-327.298) (-329.048) [-325.707] (-328.929) * [-323.936] (-329.345) (-328.477) (-332.733) -- 0:00:24
Average standard deviation of split frequencies: 0.007751
595500 -- (-331.028) (-326.786) [-329.075] (-326.128) * (-326.315) (-329.032) [-325.562] (-331.126) -- 0:00:24
596000 -- [-327.066] (-324.606) (-325.797) (-325.006) * (-328.754) (-327.214) [-325.527] (-325.066) -- 0:00:24
596500 -- [-325.023] (-326.244) (-324.451) (-324.088) * (-329.419) [-327.419] (-325.519) (-325.797) -- 0:00:24
597000 -- (-325.993) (-326.120) [-324.502] (-323.477) * (-325.993) [-323.968] (-325.891) (-324.838) -- 0:00:24
597500 -- (-325.288) [-326.954] (-325.903) (-325.589) * [-325.017] (-324.473) (-327.304) (-324.288) -- 0:00:24
598000 -- [-327.749] (-327.461) (-324.729) (-325.019) * (-324.467) (-324.540) (-324.136) [-324.472] -- 0:00:24
598500 -- [-324.339] (-325.144) (-324.570) (-323.943) * [-324.036] (-325.428) (-330.175) (-324.764) -- 0:00:24
599000 -- [-327.853] (-324.039) (-326.464) (-325.777) * (-324.443) (-328.414) (-324.870) [-325.694] -- 0:00:24
599500 -- (-324.840) (-325.844) [-325.013] (-327.551) * (-324.083) [-326.066] (-323.999) (-325.816) -- 0:00:24
600000 -- (-328.701) [-327.428] (-327.346) (-324.977) * [-325.992] (-324.466) (-326.551) (-325.693) -- 0:00:24
Average standard deviation of split frequencies: 0.007743
600500 -- (-323.382) [-325.510] (-325.302) (-323.830) * [-324.628] (-325.047) (-326.821) (-327.465) -- 0:00:23
601000 -- [-326.363] (-325.365) (-327.648) (-325.479) * [-324.151] (-326.711) (-324.621) (-325.558) -- 0:00:23
601500 -- (-327.365) [-326.774] (-326.264) (-324.850) * (-326.008) (-329.266) (-327.540) [-330.014] -- 0:00:23
602000 -- (-325.798) (-324.333) (-324.224) [-324.281] * [-323.446] (-330.613) (-328.373) (-328.703) -- 0:00:23
602500 -- [-325.491] (-326.736) (-325.023) (-325.245) * (-325.842) (-334.723) (-328.343) [-326.546] -- 0:00:23
603000 -- [-328.585] (-326.812) (-324.125) (-324.443) * [-325.231] (-329.799) (-327.403) (-330.028) -- 0:00:23
603500 -- (-324.648) (-325.731) [-325.672] (-325.438) * (-327.043) (-325.263) (-324.888) [-327.974] -- 0:00:23
604000 -- [-323.566] (-327.472) (-326.245) (-325.699) * (-325.967) (-334.089) (-328.256) [-328.656] -- 0:00:23
604500 -- (-324.568) (-325.334) [-328.099] (-323.778) * (-331.049) (-325.961) (-326.467) [-331.183] -- 0:00:23
605000 -- (-324.329) (-325.768) (-325.883) [-324.993] * (-333.679) (-330.615) [-324.259] (-325.095) -- 0:00:23
Average standard deviation of split frequencies: 0.007779
605500 -- (-323.872) [-327.111] (-324.374) (-325.406) * (-327.021) (-329.900) (-325.764) [-324.445] -- 0:00:23
606000 -- (-327.600) (-325.129) (-327.663) [-326.749] * (-327.474) (-327.530) [-328.037] (-326.665) -- 0:00:23
606500 -- (-325.899) (-324.222) (-325.646) [-328.101] * (-329.103) [-324.768] (-328.222) (-324.490) -- 0:00:23
607000 -- [-325.348] (-326.972) (-327.745) (-326.606) * [-327.057] (-327.983) (-324.779) (-337.047) -- 0:00:23
607500 -- (-325.834) (-329.233) [-323.917] (-326.929) * (-326.547) [-324.287] (-324.114) (-325.000) -- 0:00:23
608000 -- (-330.751) (-327.273) (-324.655) [-325.104] * (-326.086) (-325.012) [-325.366] (-324.396) -- 0:00:23
608500 -- (-329.226) (-323.776) [-326.458] (-327.395) * (-327.124) (-326.050) (-328.187) [-323.694] -- 0:00:23
609000 -- (-328.022) (-324.004) (-324.903) [-328.910] * [-327.603] (-325.625) (-327.070) (-326.643) -- 0:00:23
609500 -- (-327.862) [-325.326] (-325.635) (-326.239) * [-326.203] (-324.063) (-325.206) (-324.846) -- 0:00:23
610000 -- [-326.984] (-329.984) (-327.312) (-326.996) * (-326.550) [-324.277] (-326.758) (-327.145) -- 0:00:23
Average standard deviation of split frequencies: 0.007977
610500 -- (-327.588) (-323.396) (-324.934) [-324.041] * (-325.577) [-327.574] (-324.515) (-327.435) -- 0:00:22
611000 -- (-331.503) [-324.634] (-326.793) (-327.402) * (-325.034) [-325.028] (-325.123) (-326.412) -- 0:00:23
611500 -- (-324.733) [-326.255] (-324.952) (-323.945) * (-324.551) (-326.021) (-328.414) [-328.774] -- 0:00:23
612000 -- (-327.618) (-324.007) [-326.082] (-326.001) * [-324.202] (-325.845) (-326.701) (-327.854) -- 0:00:23
612500 -- [-325.305] (-325.230) (-328.083) (-329.609) * (-327.201) [-328.248] (-325.544) (-325.353) -- 0:00:23
613000 -- (-324.262) (-327.260) [-326.089] (-329.291) * (-326.421) (-325.360) [-325.216] (-328.281) -- 0:00:23
613500 -- (-323.344) [-324.142] (-327.605) (-329.789) * (-324.757) [-327.052] (-324.171) (-327.344) -- 0:00:23
614000 -- (-328.670) (-326.656) [-324.760] (-325.768) * (-324.565) (-324.136) [-324.286] (-330.144) -- 0:00:23
614500 -- (-327.641) (-324.870) (-325.524) [-324.130] * (-327.615) [-325.387] (-323.692) (-323.828) -- 0:00:23
615000 -- (-325.226) [-325.037] (-325.377) (-331.848) * (-325.170) [-328.592] (-327.618) (-324.957) -- 0:00:23
Average standard deviation of split frequencies: 0.007704
615500 -- [-325.908] (-328.278) (-326.358) (-323.754) * (-324.905) (-328.221) (-328.122) [-325.639] -- 0:00:23
616000 -- [-324.868] (-326.618) (-324.737) (-324.212) * (-327.420) (-324.834) (-326.496) [-325.998] -- 0:00:23
616500 -- (-324.261) (-325.239) [-324.496] (-327.057) * [-325.336] (-326.276) (-324.567) (-327.456) -- 0:00:23
617000 -- [-324.150] (-324.262) (-325.534) (-324.937) * [-328.073] (-326.289) (-325.492) (-326.537) -- 0:00:22
617500 -- (-324.200) [-325.654] (-325.303) (-328.314) * [-326.878] (-325.564) (-325.254) (-328.097) -- 0:00:22
618000 -- [-323.936] (-324.339) (-328.788) (-323.879) * [-325.009] (-330.904) (-324.264) (-330.949) -- 0:00:22
618500 -- (-325.830) (-327.921) (-329.002) [-326.586] * (-325.928) [-323.712] (-327.366) (-330.956) -- 0:00:22
619000 -- (-326.549) (-324.395) [-324.271] (-323.925) * (-326.203) (-326.112) (-326.201) [-329.627] -- 0:00:22
619500 -- [-327.618] (-326.048) (-327.527) (-323.731) * (-325.949) [-327.217] (-323.693) (-325.778) -- 0:00:22
620000 -- (-328.240) (-328.120) [-324.265] (-323.777) * (-324.862) [-327.163] (-324.725) (-327.369) -- 0:00:22
Average standard deviation of split frequencies: 0.007089
620500 -- (-326.615) [-324.432] (-325.225) (-327.021) * [-327.213] (-323.571) (-327.585) (-327.868) -- 0:00:22
621000 -- (-325.227) [-324.718] (-326.538) (-325.740) * [-325.287] (-329.817) (-325.071) (-325.907) -- 0:00:22
621500 -- [-325.553] (-323.817) (-325.924) (-327.765) * (-325.204) [-323.835] (-323.751) (-323.747) -- 0:00:22
622000 -- [-324.791] (-324.848) (-324.406) (-325.800) * (-328.858) (-329.967) [-324.838] (-324.433) -- 0:00:22
622500 -- (-324.541) (-326.314) (-324.549) [-330.789] * (-330.029) (-326.147) [-325.931] (-328.147) -- 0:00:22
623000 -- (-325.452) (-325.059) [-325.155] (-327.911) * [-326.868] (-331.848) (-324.985) (-329.170) -- 0:00:22
623500 -- (-329.235) [-326.476] (-325.745) (-326.036) * (-323.702) (-327.999) (-324.817) [-326.049] -- 0:00:22
624000 -- (-324.582) (-327.930) [-323.938] (-323.867) * (-323.654) (-324.947) [-325.583] (-326.181) -- 0:00:22
624500 -- (-324.746) (-325.744) (-323.424) [-326.006] * (-324.340) (-326.932) (-323.719) [-324.230] -- 0:00:22
625000 -- (-325.507) [-326.831] (-323.713) (-323.927) * [-325.452] (-324.091) (-324.007) (-326.040) -- 0:00:22
Average standard deviation of split frequencies: 0.007380
625500 -- [-326.086] (-329.414) (-325.195) (-324.625) * (-324.270) [-325.412] (-324.099) (-329.978) -- 0:00:22
626000 -- (-325.514) (-325.924) [-324.646] (-324.044) * (-328.376) (-323.963) (-324.872) [-328.281] -- 0:00:22
626500 -- (-324.318) (-325.638) (-324.241) [-324.222] * [-324.027] (-325.188) (-323.816) (-323.941) -- 0:00:22
627000 -- [-325.447] (-327.144) (-324.567) (-326.035) * (-323.771) [-328.816] (-325.988) (-324.960) -- 0:00:22
627500 -- (-325.158) (-326.569) [-328.028] (-324.839) * (-324.263) [-324.543] (-323.914) (-323.727) -- 0:00:21
628000 -- (-324.371) [-324.945] (-327.079) (-325.137) * (-328.637) (-325.238) [-325.550] (-324.178) -- 0:00:22
628500 -- (-330.627) (-329.086) (-324.680) [-326.211] * (-326.937) (-324.396) (-324.225) [-324.620] -- 0:00:22
629000 -- (-324.175) (-324.792) (-330.409) [-325.319] * (-329.035) (-325.044) [-325.427] (-333.380) -- 0:00:22
629500 -- (-327.229) (-329.220) [-332.078] (-326.165) * (-330.702) [-324.526] (-325.909) (-326.943) -- 0:00:22
630000 -- (-327.719) (-325.607) (-325.539) [-330.440] * (-325.722) (-323.728) (-327.963) [-326.437] -- 0:00:22
Average standard deviation of split frequencies: 0.007275
630500 -- (-328.913) (-325.912) (-331.220) [-328.271] * (-327.222) (-325.016) (-324.338) [-324.875] -- 0:00:22
631000 -- (-328.756) [-331.671] (-325.685) (-325.503) * [-327.798] (-325.222) (-324.830) (-326.366) -- 0:00:22
631500 -- [-323.878] (-332.765) (-326.195) (-325.952) * [-324.889] (-323.905) (-324.306) (-329.107) -- 0:00:22
632000 -- (-326.356) [-326.246] (-326.047) (-325.557) * [-325.424] (-324.031) (-324.173) (-325.900) -- 0:00:22
632500 -- (-325.363) [-325.191] (-323.835) (-325.930) * (-325.648) (-324.116) [-323.911] (-325.415) -- 0:00:22
633000 -- (-324.677) (-325.103) [-324.706] (-323.705) * (-330.657) (-327.104) [-325.223] (-326.254) -- 0:00:22
633500 -- (-325.422) (-326.383) (-324.770) [-324.773] * [-324.217] (-325.641) (-324.007) (-324.105) -- 0:00:21
634000 -- (-327.147) (-327.398) (-327.934) [-324.626] * (-331.151) (-325.164) [-325.560] (-326.839) -- 0:00:21
634500 -- (-325.601) (-329.521) (-327.164) [-325.310] * (-324.969) (-325.116) [-325.875] (-327.787) -- 0:00:21
635000 -- (-330.955) (-325.959) [-326.719] (-325.548) * (-324.830) [-325.340] (-324.468) (-327.457) -- 0:00:21
Average standard deviation of split frequencies: 0.006918
635500 -- [-327.049] (-324.535) (-325.301) (-325.138) * (-334.240) (-323.981) (-324.541) [-326.039] -- 0:00:21
636000 -- (-324.604) (-325.354) (-327.055) [-324.816] * (-326.457) [-327.311] (-324.786) (-329.880) -- 0:00:21
636500 -- (-324.938) (-326.481) [-324.172] (-324.361) * (-327.126) (-326.206) (-325.038) [-325.830] -- 0:00:21
637000 -- [-327.103] (-330.517) (-324.845) (-324.576) * (-328.680) (-324.787) (-327.108) [-325.109] -- 0:00:21
637500 -- (-326.774) (-325.947) [-324.856] (-326.670) * [-326.072] (-324.525) (-327.229) (-324.817) -- 0:00:21
638000 -- (-330.208) (-324.769) (-324.416) [-324.466] * (-324.646) (-324.434) (-326.762) [-324.456] -- 0:00:21
638500 -- [-324.394] (-325.598) (-323.565) (-324.259) * (-328.349) (-327.200) [-325.802] (-326.898) -- 0:00:21
639000 -- [-324.769] (-325.415) (-324.925) (-325.563) * [-325.410] (-324.468) (-325.278) (-326.293) -- 0:00:21
639500 -- (-325.343) (-326.354) [-325.994] (-326.144) * (-327.579) (-325.348) [-324.794] (-324.292) -- 0:00:21
640000 -- [-323.986] (-325.713) (-325.762) (-324.164) * (-328.483) (-333.603) (-329.317) [-327.494] -- 0:00:21
Average standard deviation of split frequencies: 0.007358
640500 -- (-325.423) [-325.846] (-327.248) (-323.545) * [-327.047] (-332.366) (-325.849) (-327.218) -- 0:00:21
641000 -- (-327.716) [-326.446] (-325.317) (-327.220) * [-327.583] (-327.523) (-327.305) (-326.679) -- 0:00:21
641500 -- [-326.075] (-324.222) (-325.799) (-325.583) * [-325.156] (-329.061) (-328.387) (-324.060) -- 0:00:21
642000 -- (-327.371) [-324.174] (-325.176) (-326.349) * [-324.611] (-327.834) (-326.252) (-325.146) -- 0:00:21
642500 -- (-329.012) (-324.897) (-325.286) [-325.310] * (-325.186) (-325.296) [-325.389] (-323.929) -- 0:00:21
643000 -- (-326.165) (-323.902) [-326.814] (-324.217) * (-331.059) [-326.755] (-327.553) (-324.922) -- 0:00:21
643500 -- [-324.548] (-323.816) (-325.664) (-324.948) * (-326.934) (-324.995) (-325.668) [-326.231] -- 0:00:21
644000 -- (-324.399) [-330.515] (-326.915) (-326.574) * (-327.898) (-327.858) [-326.415] (-325.328) -- 0:00:21
644500 -- (-325.428) (-324.368) (-330.394) [-325.343] * (-324.820) (-326.352) [-324.710] (-326.615) -- 0:00:20
645000 -- (-328.283) (-325.704) (-324.443) [-324.273] * (-324.141) (-325.862) [-324.951] (-328.066) -- 0:00:20
Average standard deviation of split frequencies: 0.006470
645500 -- (-324.328) (-325.118) (-326.836) [-329.149] * [-326.705] (-325.319) (-327.726) (-326.779) -- 0:00:21
646000 -- (-324.907) [-327.459] (-326.600) (-326.182) * (-326.828) (-327.742) (-325.977) [-325.344] -- 0:00:21
646500 -- (-324.279) [-326.341] (-328.522) (-326.321) * (-326.193) [-324.453] (-325.807) (-326.801) -- 0:00:21
647000 -- (-324.884) (-325.146) (-326.241) [-323.785] * (-325.776) (-326.598) [-326.139] (-325.298) -- 0:00:21
647500 -- (-324.924) (-326.150) (-323.902) [-326.517] * [-329.710] (-326.440) (-325.187) (-323.472) -- 0:00:21
648000 -- (-324.466) (-323.562) (-324.803) [-327.063] * (-327.383) [-328.113] (-325.019) (-323.967) -- 0:00:21
648500 -- [-325.572] (-323.562) (-324.739) (-327.341) * [-327.795] (-326.437) (-324.049) (-325.449) -- 0:00:21
649000 -- (-329.668) (-324.227) (-325.410) [-324.877] * [-327.263] (-325.321) (-324.373) (-326.532) -- 0:00:21
649500 -- (-327.322) [-327.619] (-325.556) (-325.763) * (-325.905) (-324.639) (-327.176) [-327.402] -- 0:00:21
650000 -- (-324.380) (-327.313) (-329.004) [-323.313] * (-328.951) (-324.136) [-328.143] (-325.238) -- 0:00:21
Average standard deviation of split frequencies: 0.006472
650500 -- (-325.444) (-324.211) (-326.403) [-326.494] * (-329.167) (-324.904) (-325.243) [-326.209] -- 0:00:20
651000 -- (-324.523) (-329.088) (-326.146) [-325.145] * (-327.073) (-324.293) (-326.664) [-326.332] -- 0:00:20
651500 -- (-323.644) [-325.685] (-325.439) (-326.815) * [-323.930] (-325.874) (-324.937) (-326.849) -- 0:00:20
652000 -- (-323.707) (-327.589) (-328.396) [-323.569] * (-324.081) (-329.068) [-326.310] (-326.489) -- 0:00:20
652500 -- [-323.577] (-324.305) (-325.757) (-325.513) * (-325.592) (-329.325) [-326.523] (-325.518) -- 0:00:20
653000 -- (-325.980) [-326.197] (-326.077) (-325.979) * [-326.786] (-324.873) (-325.808) (-325.513) -- 0:00:20
653500 -- (-324.573) [-326.373] (-324.806) (-327.422) * (-325.635) (-325.730) (-324.619) [-324.974] -- 0:00:20
654000 -- (-324.413) (-325.241) [-324.111] (-325.320) * (-331.604) [-328.456] (-324.498) (-325.462) -- 0:00:20
654500 -- (-326.176) (-324.771) [-327.045] (-325.100) * (-329.666) (-328.669) [-325.196] (-325.665) -- 0:00:20
655000 -- (-324.842) (-325.654) [-325.716] (-324.888) * [-326.711] (-326.411) (-325.394) (-325.226) -- 0:00:20
Average standard deviation of split frequencies: 0.006420
655500 -- (-325.674) (-327.337) [-324.321] (-325.700) * (-324.397) [-326.650] (-326.373) (-326.145) -- 0:00:20
656000 -- (-324.515) (-324.950) [-325.912] (-326.726) * (-323.681) (-324.625) [-324.949] (-325.566) -- 0:00:20
656500 -- (-324.741) (-325.633) [-325.128] (-324.530) * [-324.943] (-325.393) (-329.001) (-325.416) -- 0:00:20
657000 -- (-325.014) [-324.183] (-324.611) (-325.811) * [-324.567] (-326.504) (-333.259) (-324.111) -- 0:00:20
657500 -- (-330.221) (-326.763) [-325.504] (-325.140) * (-323.666) (-326.726) [-325.375] (-329.609) -- 0:00:20
658000 -- (-324.712) (-326.456) [-329.030] (-329.396) * (-325.509) (-330.020) [-323.420] (-324.300) -- 0:00:20
658500 -- (-325.989) (-326.012) [-325.576] (-327.987) * (-326.062) (-326.006) (-326.320) [-323.949] -- 0:00:20
659000 -- [-326.121] (-323.660) (-324.927) (-325.561) * [-327.185] (-326.434) (-325.403) (-326.018) -- 0:00:20
659500 -- (-327.060) [-323.810] (-327.590) (-324.738) * (-329.708) (-325.764) (-327.138) [-325.225] -- 0:00:20
660000 -- (-325.133) (-325.441) (-324.796) [-325.567] * (-327.375) (-329.754) (-323.706) [-323.544] -- 0:00:20
Average standard deviation of split frequencies: 0.005756
660500 -- (-325.192) [-327.664] (-324.094) (-325.165) * (-326.385) (-331.910) (-327.916) [-326.155] -- 0:00:20
661000 -- [-324.645] (-324.671) (-325.915) (-327.775) * (-328.488) (-326.991) (-324.078) [-328.208] -- 0:00:20
661500 -- (-327.736) (-324.377) [-328.374] (-328.132) * (-326.699) (-327.748) [-324.181] (-325.607) -- 0:00:19
662000 -- [-334.584] (-324.726) (-326.790) (-325.026) * (-324.984) (-329.929) [-323.697] (-324.831) -- 0:00:19
662500 -- (-332.538) (-325.923) (-326.954) [-327.090] * [-326.872] (-326.804) (-324.685) (-324.372) -- 0:00:20
663000 -- (-328.678) (-325.746) (-325.494) [-325.645] * (-325.214) (-327.157) [-323.835] (-324.860) -- 0:00:20
663500 -- (-325.930) (-324.769) [-323.454] (-325.675) * (-325.345) [-330.124] (-326.019) (-326.319) -- 0:00:20
664000 -- [-325.814] (-327.414) (-324.785) (-324.922) * (-325.014) (-327.166) [-324.511] (-326.092) -- 0:00:20
664500 -- (-327.227) (-324.783) (-325.785) [-328.985] * (-328.473) (-325.654) (-325.568) [-324.631] -- 0:00:20
665000 -- [-326.600] (-325.022) (-328.339) (-327.246) * [-325.083] (-324.910) (-324.448) (-325.103) -- 0:00:20
Average standard deviation of split frequencies: 0.005568
665500 -- (-326.059) [-324.417] (-328.877) (-326.653) * [-326.257] (-324.967) (-325.834) (-328.070) -- 0:00:20
666000 -- (-326.832) [-324.785] (-327.847) (-325.206) * [-324.808] (-323.882) (-330.801) (-325.266) -- 0:00:20
666500 -- [-324.737] (-325.219) (-323.637) (-325.099) * (-325.584) [-324.220] (-325.232) (-324.674) -- 0:00:20
667000 -- (-324.633) [-324.541] (-323.976) (-325.395) * (-327.653) [-326.151] (-323.797) (-324.351) -- 0:00:19
667500 -- (-329.943) [-325.548] (-323.875) (-327.100) * [-323.525] (-326.999) (-324.334) (-325.086) -- 0:00:19
668000 -- (-326.952) (-323.712) [-323.897] (-328.933) * (-324.861) (-323.941) (-326.981) [-326.282] -- 0:00:19
668500 -- (-325.557) (-324.451) [-326.312] (-331.308) * (-325.248) [-323.961] (-324.615) (-325.664) -- 0:00:19
669000 -- [-324.715] (-326.294) (-325.993) (-323.994) * (-325.309) (-328.092) (-324.096) [-323.814] -- 0:00:19
669500 -- (-325.301) (-325.482) (-325.104) [-324.386] * (-325.148) [-325.228] (-324.785) (-326.109) -- 0:00:19
670000 -- (-325.548) (-323.824) [-325.313] (-324.769) * (-330.735) (-324.515) [-323.929] (-328.246) -- 0:00:19
Average standard deviation of split frequencies: 0.005857
670500 -- (-332.341) [-323.798] (-327.630) (-325.185) * (-328.800) [-325.939] (-326.106) (-324.701) -- 0:00:19
671000 -- [-324.886] (-323.845) (-324.539) (-325.603) * [-325.090] (-326.404) (-324.886) (-323.855) -- 0:00:19
671500 -- (-326.545) (-325.488) [-323.793] (-328.713) * [-325.839] (-329.226) (-326.371) (-325.249) -- 0:00:19
672000 -- (-325.466) (-324.759) [-324.886] (-325.688) * [-325.112] (-327.184) (-325.560) (-324.748) -- 0:00:19
672500 -- (-327.500) (-329.821) [-324.382] (-325.774) * (-328.499) (-326.191) (-325.034) [-325.779] -- 0:00:19
673000 -- (-333.173) (-329.073) [-326.603] (-325.903) * (-324.212) (-325.644) (-326.846) [-325.311] -- 0:00:19
673500 -- (-334.486) [-326.564] (-325.227) (-325.323) * (-324.960) [-328.032] (-329.895) (-329.036) -- 0:00:19
674000 -- (-331.927) [-325.580] (-324.190) (-325.032) * (-325.830) (-326.887) [-329.140] (-327.623) -- 0:00:19
674500 -- (-327.170) (-325.387) [-326.457] (-324.566) * (-325.986) (-328.496) [-324.424] (-331.679) -- 0:00:19
675000 -- (-326.678) [-326.612] (-325.449) (-330.292) * (-323.666) (-324.972) [-324.898] (-330.417) -- 0:00:19
Average standard deviation of split frequencies: 0.005765
675500 -- [-327.269] (-324.427) (-323.831) (-325.557) * (-325.555) [-326.185] (-325.068) (-325.624) -- 0:00:19
676000 -- (-330.771) [-326.435] (-324.600) (-329.527) * (-325.073) (-326.284) [-325.550] (-326.095) -- 0:00:19
676500 -- (-324.556) [-324.871] (-324.790) (-327.402) * (-326.718) [-327.093] (-326.451) (-324.555) -- 0:00:19
677000 -- (-324.660) (-324.136) (-327.003) [-326.160] * [-328.981] (-331.197) (-325.552) (-324.412) -- 0:00:19
677500 -- [-327.591] (-324.647) (-329.831) (-326.720) * (-326.464) (-331.353) (-326.816) [-324.826] -- 0:00:19
678000 -- (-323.721) (-326.891) (-324.115) [-323.927] * [-324.369] (-334.978) (-325.329) (-325.607) -- 0:00:18
678500 -- (-323.736) (-326.683) (-328.771) [-323.311] * (-323.815) [-325.352] (-324.549) (-325.330) -- 0:00:18
679000 -- (-325.892) (-323.929) (-326.427) [-325.175] * (-324.120) (-328.984) (-325.552) [-327.164] -- 0:00:18
679500 -- (-325.219) (-326.090) (-334.426) [-324.498] * (-324.587) (-327.039) (-325.405) [-324.871] -- 0:00:19
680000 -- (-325.659) (-330.454) (-327.114) [-324.338] * (-326.734) (-325.795) (-327.590) [-324.628] -- 0:00:19
Average standard deviation of split frequencies: 0.005633
680500 -- [-325.728] (-323.892) (-325.735) (-325.371) * (-327.570) [-325.116] (-324.785) (-324.580) -- 0:00:19
681000 -- (-326.187) (-323.643) (-327.090) [-323.505] * (-326.148) (-326.083) (-325.315) [-325.687] -- 0:00:19
681500 -- [-323.512] (-323.522) (-325.057) (-326.068) * (-326.938) (-326.759) [-326.452] (-325.283) -- 0:00:19
682000 -- (-324.651) [-327.257] (-325.968) (-327.135) * [-325.243] (-328.802) (-323.605) (-328.214) -- 0:00:19
682500 -- (-323.616) [-326.274] (-325.036) (-325.705) * (-326.903) [-324.858] (-326.935) (-328.681) -- 0:00:19
683000 -- (-323.621) [-326.073] (-326.969) (-330.605) * (-326.517) (-324.586) [-324.313] (-326.627) -- 0:00:19
683500 -- [-325.676] (-329.111) (-327.564) (-327.534) * [-324.927] (-327.587) (-324.659) (-326.950) -- 0:00:18
684000 -- (-326.499) [-324.885] (-326.113) (-324.013) * (-327.164) [-326.532] (-326.607) (-325.169) -- 0:00:18
684500 -- (-330.401) (-324.570) [-323.630] (-327.178) * (-333.371) (-324.213) [-324.710] (-325.451) -- 0:00:18
685000 -- [-325.280] (-326.228) (-325.323) (-324.638) * (-327.130) [-323.223] (-327.232) (-325.564) -- 0:00:18
Average standard deviation of split frequencies: 0.005864
685500 -- (-324.659) [-324.210] (-326.869) (-324.978) * (-324.681) (-323.896) [-325.790] (-326.852) -- 0:00:18
686000 -- [-325.162] (-325.612) (-324.105) (-324.410) * (-323.828) (-324.823) (-327.430) [-324.242] -- 0:00:18
686500 -- (-324.613) [-326.963] (-327.120) (-328.526) * (-324.665) (-324.656) [-325.067] (-324.031) -- 0:00:18
687000 -- (-324.224) [-324.205] (-332.733) (-325.471) * [-325.034] (-325.628) (-325.814) (-326.703) -- 0:00:18
687500 -- (-327.290) [-323.757] (-324.954) (-326.491) * (-327.325) (-325.852) [-329.873] (-326.794) -- 0:00:18
688000 -- (-326.577) [-328.201] (-323.864) (-328.466) * [-324.071] (-326.102) (-327.381) (-326.681) -- 0:00:18
688500 -- (-326.531) (-326.772) (-323.576) [-326.703] * [-327.257] (-324.559) (-328.108) (-327.185) -- 0:00:18
689000 -- [-324.513] (-325.614) (-324.209) (-326.431) * (-336.151) [-325.629] (-325.406) (-326.076) -- 0:00:18
689500 -- (-324.473) (-324.607) (-324.972) [-324.408] * (-325.293) (-325.116) (-325.250) [-327.118] -- 0:00:18
690000 -- (-323.371) (-324.097) [-325.368] (-332.988) * (-326.023) (-327.902) (-325.525) [-325.329] -- 0:00:18
Average standard deviation of split frequencies: 0.005779
690500 -- (-325.112) (-325.424) [-325.164] (-330.386) * (-332.310) (-326.170) (-325.770) [-329.605] -- 0:00:18
691000 -- (-325.803) (-324.025) [-329.837] (-327.683) * [-329.324] (-325.374) (-325.963) (-326.397) -- 0:00:18
691500 -- (-326.307) [-326.687] (-328.067) (-326.804) * (-328.182) (-327.019) (-326.083) [-326.450] -- 0:00:18
692000 -- (-328.929) (-329.142) (-326.679) [-325.051] * (-324.881) (-326.142) [-324.518] (-326.714) -- 0:00:18
692500 -- (-331.818) (-329.045) [-327.683] (-326.424) * (-323.851) (-325.339) [-325.988] (-324.041) -- 0:00:18
693000 -- (-327.348) (-327.016) [-327.250] (-325.706) * (-325.146) [-324.200] (-325.457) (-325.525) -- 0:00:18
693500 -- [-326.941] (-329.963) (-330.087) (-325.147) * (-324.798) (-325.352) [-324.274] (-325.922) -- 0:00:18
694000 -- [-325.645] (-325.914) (-325.486) (-326.859) * (-324.121) [-325.486] (-324.911) (-330.880) -- 0:00:18
694500 -- (-325.661) (-325.871) (-326.252) [-325.217] * [-324.418] (-325.120) (-324.913) (-325.411) -- 0:00:18
695000 -- (-324.554) [-323.814] (-324.516) (-325.342) * (-324.875) [-326.476] (-324.875) (-326.407) -- 0:00:17
Average standard deviation of split frequencies: 0.006322
695500 -- (-327.227) (-324.508) (-324.825) [-324.765] * [-324.833] (-324.927) (-324.575) (-324.224) -- 0:00:17
696000 -- (-327.438) (-323.738) (-323.988) [-324.808] * (-329.600) (-325.367) [-325.223] (-326.182) -- 0:00:17
696500 -- (-328.954) (-323.305) [-324.549] (-323.796) * (-326.511) (-325.139) (-324.658) [-324.746] -- 0:00:17
697000 -- (-326.346) (-324.208) (-324.840) [-326.548] * [-324.367] (-324.329) (-325.263) (-323.733) -- 0:00:18
697500 -- (-326.868) [-324.739] (-327.042) (-324.728) * (-324.509) (-329.580) [-324.107] (-324.499) -- 0:00:18
698000 -- (-326.710) [-323.814] (-325.953) (-323.879) * [-325.084] (-333.289) (-324.866) (-325.841) -- 0:00:18
698500 -- [-325.507] (-325.066) (-326.744) (-324.919) * [-324.505] (-324.894) (-327.793) (-325.700) -- 0:00:18
699000 -- [-326.360] (-324.276) (-326.870) (-326.503) * (-326.162) (-324.035) [-325.254] (-327.012) -- 0:00:18
699500 -- (-325.383) (-324.563) [-326.947] (-327.957) * (-326.669) (-325.020) [-326.434] (-324.438) -- 0:00:18
700000 -- (-325.634) (-324.787) [-323.570] (-326.334) * (-326.184) (-327.746) (-327.606) [-327.556] -- 0:00:18
Average standard deviation of split frequencies: 0.005921
700500 -- [-326.361] (-324.497) (-325.385) (-326.466) * (-326.211) (-323.644) (-325.433) [-324.684] -- 0:00:17
701000 -- (-330.599) (-324.895) (-325.272) [-326.064] * (-325.453) (-324.771) (-325.986) [-324.405] -- 0:00:17
701500 -- (-324.749) (-324.491) (-328.426) [-327.246] * [-325.915] (-323.775) (-325.673) (-330.258) -- 0:00:17
702000 -- (-324.654) (-326.945) (-328.099) [-324.283] * (-327.541) (-325.173) [-323.466] (-330.616) -- 0:00:17
702500 -- (-325.167) (-329.535) [-323.897] (-324.675) * (-326.752) (-324.429) [-326.800] (-328.268) -- 0:00:17
703000 -- (-323.249) (-327.987) [-324.686] (-324.991) * (-329.218) [-330.880] (-328.452) (-325.488) -- 0:00:17
703500 -- [-325.478] (-327.707) (-325.655) (-332.143) * [-327.841] (-334.450) (-326.923) (-324.815) -- 0:00:17
704000 -- (-326.683) [-325.326] (-328.518) (-325.452) * [-325.877] (-330.460) (-323.742) (-326.019) -- 0:00:17
704500 -- [-325.906] (-328.942) (-329.758) (-324.891) * (-324.941) [-325.719] (-325.128) (-326.527) -- 0:00:17
705000 -- [-326.685] (-323.665) (-324.396) (-324.076) * [-326.210] (-326.455) (-326.847) (-325.228) -- 0:00:17
Average standard deviation of split frequencies: 0.005742
705500 -- (-325.507) [-325.492] (-325.872) (-327.257) * (-325.398) [-326.659] (-323.912) (-323.664) -- 0:00:17
706000 -- (-324.973) (-325.189) (-324.293) [-324.419] * (-328.656) (-326.519) (-323.859) [-324.708] -- 0:00:17
706500 -- (-325.057) (-325.958) (-324.446) [-324.938] * (-327.078) [-326.979] (-328.497) (-325.605) -- 0:00:17
707000 -- [-328.303] (-329.730) (-324.688) (-324.585) * (-331.783) (-327.045) [-325.172] (-326.579) -- 0:00:17
707500 -- (-325.084) (-332.303) (-324.407) [-326.252] * (-329.511) (-323.871) (-329.173) [-324.781] -- 0:00:17
708000 -- [-328.430] (-325.568) (-325.434) (-325.313) * (-324.932) (-324.604) (-324.974) [-328.433] -- 0:00:17
708500 -- (-328.269) [-326.789] (-325.970) (-324.793) * [-324.366] (-325.334) (-327.022) (-325.092) -- 0:00:17
709000 -- (-325.073) (-324.501) (-330.427) [-324.567] * (-328.156) (-328.239) (-325.411) [-325.338] -- 0:00:17
709500 -- (-323.725) (-325.054) [-325.193] (-330.478) * [-324.479] (-326.239) (-328.112) (-328.675) -- 0:00:17
710000 -- (-325.762) (-324.796) [-326.883] (-328.405) * (-325.167) (-328.684) [-324.875] (-328.685) -- 0:00:17
Average standard deviation of split frequencies: 0.005837
710500 -- (-325.002) [-327.188] (-326.055) (-325.184) * (-323.454) (-324.036) [-326.413] (-326.721) -- 0:00:17
711000 -- (-330.792) (-325.099) (-326.621) [-330.002] * (-326.374) [-323.674] (-324.132) (-325.769) -- 0:00:17
711500 -- (-325.678) [-328.349] (-324.319) (-325.480) * [-325.373] (-328.504) (-324.744) (-325.479) -- 0:00:17
712000 -- (-327.165) (-325.904) [-325.617] (-327.084) * (-324.346) (-326.495) [-324.050] (-329.482) -- 0:00:16
712500 -- (-328.727) (-327.225) (-326.258) [-324.310] * (-325.221) (-333.583) [-324.694] (-327.618) -- 0:00:16
713000 -- [-324.822] (-325.329) (-326.176) (-327.810) * (-325.210) [-325.019] (-324.304) (-326.849) -- 0:00:16
713500 -- [-325.522] (-326.018) (-324.011) (-325.446) * [-323.776] (-325.138) (-330.227) (-331.920) -- 0:00:17
714000 -- (-324.215) (-325.868) (-325.399) [-325.654] * (-324.809) (-327.083) (-324.701) [-325.008] -- 0:00:17
714500 -- (-323.784) [-327.235] (-325.528) (-324.781) * (-326.484) (-324.370) [-324.533] (-325.345) -- 0:00:17
715000 -- (-326.522) (-324.610) (-324.002) [-324.228] * (-326.651) (-327.409) (-329.602) [-326.483] -- 0:00:17
Average standard deviation of split frequencies: 0.005969
715500 -- (-325.112) (-325.308) [-326.545] (-324.863) * [-326.677] (-333.289) (-330.165) (-326.447) -- 0:00:17
716000 -- [-326.831] (-327.211) (-326.725) (-325.602) * (-327.910) (-325.091) (-324.104) [-325.461] -- 0:00:17
716500 -- (-323.857) [-324.892] (-324.935) (-326.739) * [-325.362] (-328.498) (-324.897) (-326.906) -- 0:00:17
717000 -- (-325.778) [-325.507] (-324.330) (-327.970) * (-325.114) [-324.873] (-324.935) (-329.972) -- 0:00:16
717500 -- (-325.055) [-329.800] (-326.419) (-329.266) * (-327.165) (-324.894) [-325.302] (-325.120) -- 0:00:16
718000 -- [-324.620] (-325.582) (-326.834) (-330.784) * (-327.675) (-327.134) (-324.838) [-328.201] -- 0:00:16
718500 -- (-325.577) (-326.550) [-325.126] (-328.680) * (-325.327) (-325.450) [-330.735] (-326.024) -- 0:00:16
719000 -- (-324.907) (-329.425) [-324.854] (-328.158) * (-326.497) [-325.290] (-326.598) (-324.620) -- 0:00:16
719500 -- [-325.902] (-325.641) (-327.415) (-326.292) * (-325.972) (-326.498) (-324.198) [-325.308] -- 0:00:16
720000 -- [-324.631] (-326.336) (-324.455) (-328.923) * (-324.735) [-327.799] (-324.039) (-324.105) -- 0:00:16
Average standard deviation of split frequencies: 0.005843
720500 -- [-324.789] (-325.430) (-324.552) (-326.775) * (-326.360) (-323.491) (-325.977) [-326.222] -- 0:00:16
721000 -- (-324.002) [-324.679] (-324.147) (-334.137) * (-326.549) (-324.315) (-326.753) [-325.882] -- 0:00:16
721500 -- (-326.089) (-324.288) [-325.109] (-326.511) * (-325.889) (-325.757) [-325.863] (-328.367) -- 0:00:16
722000 -- (-326.898) (-324.306) (-324.423) [-327.440] * [-325.520] (-323.472) (-324.452) (-324.415) -- 0:00:16
722500 -- (-327.105) (-323.982) (-326.087) [-325.911] * (-328.111) [-326.103] (-324.004) (-328.227) -- 0:00:16
723000 -- (-325.455) (-327.293) (-328.229) [-325.892] * (-328.503) (-324.915) (-326.786) [-323.734] -- 0:00:16
723500 -- (-325.861) [-324.401] (-327.909) (-329.911) * (-326.495) (-325.155) [-328.547] (-323.256) -- 0:00:16
724000 -- (-326.290) [-324.341] (-324.586) (-329.748) * [-326.172] (-325.804) (-333.977) (-323.814) -- 0:00:16
724500 -- (-326.945) (-327.358) [-328.182] (-326.928) * (-327.415) (-324.148) [-324.038] (-324.227) -- 0:00:16
725000 -- (-329.878) (-328.785) (-326.119) [-327.620] * [-327.675] (-324.394) (-324.556) (-326.590) -- 0:00:16
Average standard deviation of split frequencies: 0.006104
725500 -- (-327.894) (-324.995) [-324.521] (-324.780) * (-327.067) [-324.308] (-324.428) (-324.403) -- 0:00:16
726000 -- (-327.441) (-324.270) (-325.902) [-324.317] * (-333.807) [-324.912] (-324.072) (-324.730) -- 0:00:16
726500 -- (-325.215) (-324.183) (-324.940) [-329.364] * [-327.110] (-328.537) (-323.764) (-327.151) -- 0:00:16
727000 -- (-331.946) (-325.332) (-324.809) [-325.607] * (-323.773) [-327.602] (-323.420) (-325.834) -- 0:00:16
727500 -- (-325.589) [-325.183] (-323.683) (-328.732) * (-325.016) (-325.272) (-323.849) [-324.988] -- 0:00:16
728000 -- (-325.668) [-324.808] (-327.061) (-327.446) * [-328.163] (-324.567) (-324.371) (-325.007) -- 0:00:16
728500 -- (-325.226) (-328.611) [-326.109] (-325.239) * (-326.530) (-323.542) (-325.415) [-325.811] -- 0:00:16
729000 -- [-326.715] (-325.387) (-326.394) (-328.933) * (-326.492) (-328.612) [-325.305] (-324.799) -- 0:00:15
729500 -- (-325.573) (-324.464) (-325.215) [-323.904] * (-325.878) (-328.339) [-323.972] (-324.209) -- 0:00:15
730000 -- (-326.107) (-328.637) (-323.492) [-326.588] * (-330.509) (-334.429) [-325.138] (-324.581) -- 0:00:15
Average standard deviation of split frequencies: 0.006280
730500 -- (-326.240) (-327.709) [-325.360] (-326.352) * (-328.269) (-328.204) [-324.709] (-323.645) -- 0:00:16
731000 -- (-327.870) (-326.802) [-324.704] (-327.448) * (-329.882) (-327.025) [-326.537] (-326.986) -- 0:00:16
731500 -- [-327.526] (-324.512) (-325.416) (-325.329) * (-324.494) (-326.570) (-326.352) [-325.049] -- 0:00:16
732000 -- (-332.142) (-324.827) [-324.747] (-325.910) * (-326.951) [-326.017] (-330.585) (-327.944) -- 0:00:16
732500 -- [-323.404] (-328.135) (-327.931) (-326.813) * (-325.615) [-326.268] (-325.339) (-324.260) -- 0:00:16
733000 -- (-324.301) [-326.839] (-327.679) (-324.629) * (-325.791) (-325.039) (-325.797) [-323.781] -- 0:00:16
733500 -- (-327.785) [-324.539] (-326.786) (-326.792) * (-325.856) (-328.732) (-325.973) [-323.895] -- 0:00:15
734000 -- [-324.167] (-326.657) (-326.758) (-324.464) * (-325.682) [-325.706] (-329.133) (-324.326) -- 0:00:15
734500 -- (-326.826) [-327.028] (-323.742) (-330.306) * (-326.911) [-325.346] (-326.794) (-324.422) -- 0:00:15
735000 -- (-327.071) [-325.238] (-325.575) (-326.403) * (-326.076) (-324.653) [-325.575] (-326.946) -- 0:00:15
Average standard deviation of split frequencies: 0.006533
735500 -- (-327.651) (-326.200) (-325.009) [-326.891] * [-324.976] (-326.983) (-325.705) (-324.947) -- 0:00:15
736000 -- [-326.696] (-324.627) (-324.812) (-325.351) * (-324.673) (-325.997) [-325.507] (-323.928) -- 0:00:15
736500 -- [-331.035] (-325.625) (-327.831) (-330.252) * (-324.230) [-326.366] (-328.906) (-323.663) -- 0:00:15
737000 -- (-327.642) (-327.088) [-324.190] (-325.758) * (-324.921) (-323.983) (-330.419) [-323.617] -- 0:00:15
737500 -- (-325.729) [-325.829] (-327.704) (-325.056) * (-328.511) (-324.070) (-325.845) [-328.655] -- 0:00:15
738000 -- (-326.690) (-325.046) [-324.765] (-324.222) * [-325.583] (-323.983) (-325.978) (-325.940) -- 0:00:15
738500 -- (-325.452) (-325.289) [-324.254] (-325.380) * [-325.304] (-325.393) (-326.359) (-325.413) -- 0:00:15
739000 -- (-327.605) (-325.641) (-325.408) [-329.096] * (-325.069) (-324.216) (-325.286) [-326.316] -- 0:00:15
739500 -- (-325.019) [-328.251] (-326.436) (-327.726) * (-326.379) (-323.526) [-324.974] (-324.882) -- 0:00:15
740000 -- (-325.018) (-327.687) [-326.342] (-325.586) * (-327.658) (-324.315) (-324.453) [-323.901] -- 0:00:15
Average standard deviation of split frequencies: 0.006237
740500 -- (-324.161) [-325.536] (-326.525) (-325.367) * [-327.512] (-324.674) (-324.539) (-326.070) -- 0:00:15
741000 -- (-329.746) (-330.675) [-325.398] (-325.050) * (-325.519) (-325.849) [-324.896] (-327.734) -- 0:00:15
741500 -- (-324.501) (-327.633) [-325.512] (-324.553) * [-328.071] (-324.234) (-326.564) (-326.669) -- 0:00:15
742000 -- (-325.022) (-325.288) (-326.118) [-323.677] * (-323.390) (-325.201) (-324.655) [-329.115] -- 0:00:15
742500 -- (-327.806) (-326.511) [-326.215] (-326.331) * (-329.513) (-326.852) [-324.863] (-327.570) -- 0:00:15
743000 -- (-329.882) [-325.961] (-324.380) (-328.382) * (-324.811) (-325.930) [-326.093] (-326.876) -- 0:00:15
743500 -- (-326.753) (-326.578) (-331.124) [-325.217] * (-324.819) [-327.711] (-328.053) (-327.782) -- 0:00:15
744000 -- (-325.783) (-327.571) [-324.664] (-326.531) * (-324.210) (-328.376) [-325.745] (-331.679) -- 0:00:15
744500 -- (-324.400) [-326.525] (-323.992) (-324.239) * (-323.908) (-326.729) (-324.612) [-324.234] -- 0:00:15
745000 -- [-324.596] (-324.581) (-324.810) (-327.262) * (-324.158) (-327.072) (-328.514) [-326.010] -- 0:00:15
Average standard deviation of split frequencies: 0.006193
745500 -- (-324.989) (-325.156) [-327.020] (-328.589) * (-325.582) (-329.354) (-324.891) [-324.480] -- 0:00:15
746000 -- (-329.449) [-326.428] (-324.736) (-324.401) * (-326.210) (-325.736) (-328.341) [-325.534] -- 0:00:14
746500 -- [-324.365] (-324.171) (-326.535) (-329.978) * (-328.036) (-327.063) (-326.479) [-326.372] -- 0:00:14
747000 -- (-325.108) (-327.914) [-324.448] (-328.321) * (-331.010) [-329.996] (-326.338) (-323.495) -- 0:00:14
747500 -- [-323.377] (-325.864) (-323.723) (-325.747) * (-326.083) [-325.897] (-323.998) (-325.111) -- 0:00:15
748000 -- (-333.795) [-329.672] (-323.773) (-324.330) * [-325.607] (-326.425) (-325.188) (-323.737) -- 0:00:15
748500 -- (-326.318) [-327.256] (-326.929) (-325.308) * (-324.545) (-325.026) [-324.798] (-323.633) -- 0:00:15
749000 -- (-324.985) (-325.024) (-326.701) [-324.541] * [-325.349] (-325.129) (-324.689) (-323.934) -- 0:00:15
749500 -- (-325.104) (-325.935) [-325.379] (-329.782) * (-325.335) (-323.928) (-324.993) [-326.711] -- 0:00:15
750000 -- (-325.752) (-329.661) [-325.013] (-326.200) * (-326.407) (-323.625) [-326.069] (-328.061) -- 0:00:15
Average standard deviation of split frequencies: 0.006154
750500 -- (-329.978) [-325.940] (-326.538) (-327.107) * (-329.151) (-327.111) (-326.255) [-327.651] -- 0:00:14
751000 -- (-325.569) (-325.224) [-327.314] (-326.353) * (-327.023) (-325.043) [-325.400] (-325.551) -- 0:00:14
751500 -- [-326.053] (-326.950) (-325.086) (-326.614) * (-326.264) [-325.279] (-325.990) (-326.371) -- 0:00:14
752000 -- (-323.901) (-327.704) [-324.893] (-327.675) * [-325.127] (-326.413) (-325.768) (-324.459) -- 0:00:14
752500 -- [-326.459] (-326.140) (-325.592) (-328.012) * [-325.325] (-327.642) (-325.387) (-324.341) -- 0:00:14
753000 -- (-324.338) (-326.034) (-324.872) [-327.719] * (-326.022) (-329.716) [-325.032] (-324.680) -- 0:00:14
753500 -- (-326.496) (-326.032) [-326.696] (-327.781) * (-325.455) (-328.032) [-324.098] (-325.678) -- 0:00:14
754000 -- [-325.215] (-325.656) (-324.941) (-325.526) * (-330.621) (-325.153) [-323.297] (-326.210) -- 0:00:14
754500 -- (-326.044) [-326.596] (-325.184) (-326.723) * (-325.088) (-323.957) [-326.558] (-326.528) -- 0:00:14
755000 -- (-326.475) (-326.754) [-325.009] (-325.471) * (-324.900) [-326.107] (-325.147) (-324.281) -- 0:00:14
Average standard deviation of split frequencies: 0.006069
755500 -- (-325.137) (-325.438) [-325.147] (-325.812) * [-324.546] (-325.003) (-324.783) (-323.733) -- 0:00:14
756000 -- (-325.150) (-327.688) [-327.023] (-326.934) * (-323.796) [-325.697] (-326.640) (-324.053) -- 0:00:14
756500 -- (-324.090) (-325.247) (-326.162) [-328.121] * (-324.761) (-325.741) [-323.449] (-324.349) -- 0:00:14
757000 -- [-326.183] (-325.465) (-327.728) (-323.943) * (-324.917) [-325.267] (-323.428) (-324.676) -- 0:00:14
757500 -- (-325.084) [-326.796] (-325.924) (-325.899) * [-323.771] (-325.106) (-327.049) (-324.486) -- 0:00:14
758000 -- (-324.118) [-323.573] (-328.728) (-325.123) * (-327.852) (-323.757) [-329.457] (-324.629) -- 0:00:14
758500 -- (-324.133) [-325.832] (-327.829) (-326.380) * (-333.193) (-326.005) (-324.676) [-326.700] -- 0:00:14
759000 -- (-324.663) [-328.117] (-326.848) (-326.167) * (-334.504) [-324.897] (-324.274) (-327.970) -- 0:00:14
759500 -- (-329.126) [-325.809] (-325.088) (-327.430) * (-323.934) (-324.236) (-323.951) [-326.496] -- 0:00:14
760000 -- [-327.960] (-327.330) (-327.169) (-325.630) * (-329.354) (-325.356) [-325.508] (-326.647) -- 0:00:14
Average standard deviation of split frequencies: 0.006280
760500 -- (-325.310) [-327.328] (-324.827) (-324.142) * [-325.673] (-324.332) (-323.921) (-327.467) -- 0:00:14
761000 -- (-327.643) (-327.095) (-324.393) [-325.287] * (-323.825) (-324.685) (-325.018) [-326.490] -- 0:00:14
761500 -- (-323.850) (-324.668) [-328.533] (-324.463) * [-325.544] (-324.694) (-326.874) (-327.913) -- 0:00:14
762000 -- (-325.241) (-323.651) [-324.072] (-326.375) * (-325.627) [-325.485] (-324.123) (-325.794) -- 0:00:14
762500 -- [-327.702] (-324.806) (-323.983) (-327.713) * (-325.741) (-324.798) [-324.077] (-331.396) -- 0:00:14
763000 -- (-327.840) (-324.066) [-324.235] (-325.449) * [-324.522] (-328.800) (-324.570) (-326.554) -- 0:00:13
763500 -- (-328.328) (-323.590) (-325.595) [-326.221] * (-327.664) [-327.042] (-324.328) (-324.316) -- 0:00:14
764000 -- [-324.340] (-326.764) (-327.934) (-331.769) * (-327.379) [-327.634] (-327.211) (-324.733) -- 0:00:14
764500 -- (-331.385) [-323.990] (-324.915) (-329.882) * [-325.611] (-327.485) (-326.274) (-329.138) -- 0:00:14
765000 -- [-324.733] (-323.998) (-325.508) (-325.829) * (-324.495) (-326.774) [-324.294] (-327.546) -- 0:00:14
Average standard deviation of split frequencies: 0.006359
765500 -- (-323.652) [-325.325] (-327.027) (-325.208) * (-324.539) (-326.503) [-327.229] (-330.000) -- 0:00:14
766000 -- (-324.582) (-324.174) (-324.403) [-327.532] * [-325.100] (-325.700) (-325.314) (-327.290) -- 0:00:14
766500 -- (-325.131) [-325.102] (-324.104) (-324.919) * (-324.676) (-324.329) (-324.314) [-324.171] -- 0:00:14
767000 -- [-326.999] (-328.976) (-325.709) (-324.550) * [-325.649] (-327.331) (-326.163) (-329.124) -- 0:00:13
767500 -- [-326.866] (-332.377) (-326.248) (-325.128) * (-324.904) [-325.160] (-324.694) (-326.458) -- 0:00:13
768000 -- (-324.313) [-324.367] (-324.429) (-324.877) * (-326.051) (-325.414) [-326.680] (-326.975) -- 0:00:13
768500 -- [-326.698] (-325.389) (-324.025) (-326.273) * (-326.990) (-326.743) [-327.821] (-324.892) -- 0:00:13
769000 -- (-326.601) (-328.540) (-324.680) [-325.431] * (-328.069) (-330.660) (-326.719) [-324.992] -- 0:00:13
769500 -- [-328.172] (-326.585) (-324.760) (-326.655) * (-325.438) (-324.751) (-329.031) [-325.820] -- 0:00:13
770000 -- (-327.601) (-325.595) [-327.872] (-325.455) * (-324.127) [-326.722] (-327.510) (-328.735) -- 0:00:13
Average standard deviation of split frequencies: 0.006443
770500 -- (-323.848) (-324.778) (-329.888) [-327.921] * (-328.577) (-326.260) [-328.456] (-326.038) -- 0:00:13
771000 -- [-324.534] (-325.421) (-325.584) (-326.162) * [-327.141] (-326.229) (-324.817) (-324.974) -- 0:00:13
771500 -- (-325.914) (-325.742) [-326.533] (-329.879) * (-328.674) (-327.490) [-327.422] (-328.371) -- 0:00:13
772000 -- (-325.477) (-325.549) (-325.970) [-323.646] * (-326.753) [-327.930] (-325.005) (-324.909) -- 0:00:13
772500 -- (-325.050) [-325.439] (-326.061) (-323.989) * [-328.424] (-328.160) (-325.139) (-329.878) -- 0:00:13
773000 -- (-324.550) (-330.975) (-325.313) [-325.777] * (-325.962) (-325.561) [-324.233] (-325.332) -- 0:00:13
773500 -- (-325.382) [-327.276] (-324.951) (-329.794) * (-328.890) [-324.749] (-328.966) (-324.869) -- 0:00:13
774000 -- (-330.457) (-324.034) (-324.531) [-325.420] * (-328.696) [-324.190] (-330.390) (-324.466) -- 0:00:13
774500 -- (-325.959) [-325.807] (-323.720) (-323.878) * (-325.254) (-326.821) (-324.399) [-324.485] -- 0:00:13
775000 -- (-330.650) [-323.916] (-327.114) (-327.868) * (-325.861) (-328.746) (-326.177) [-324.161] -- 0:00:13
Average standard deviation of split frequencies: 0.006561
775500 -- (-334.765) [-326.840] (-324.882) (-326.445) * (-325.805) (-329.738) [-325.609] (-328.077) -- 0:00:13
776000 -- (-324.164) [-324.417] (-325.626) (-325.412) * [-325.029] (-324.363) (-325.927) (-326.523) -- 0:00:13
776500 -- (-325.327) (-324.891) [-324.717] (-323.806) * (-324.287) (-326.117) [-325.265] (-324.921) -- 0:00:13
777000 -- [-325.662] (-325.107) (-326.112) (-327.194) * (-327.008) (-327.719) (-325.035) [-324.373] -- 0:00:13
777500 -- (-325.687) (-327.215) [-325.760] (-324.996) * [-325.645] (-325.447) (-323.513) (-325.205) -- 0:00:13
778000 -- [-325.062] (-325.729) (-328.871) (-328.443) * (-324.859) [-328.869] (-326.327) (-324.766) -- 0:00:13
778500 -- (-323.736) (-323.981) (-327.053) [-326.488] * (-328.070) [-329.177] (-325.462) (-325.173) -- 0:00:13
779000 -- (-324.812) (-325.510) [-325.742] (-324.908) * (-327.549) (-328.199) [-327.037] (-327.559) -- 0:00:13
779500 -- (-326.434) [-324.701] (-326.216) (-325.834) * (-326.290) (-323.599) (-327.570) [-328.760] -- 0:00:13
780000 -- (-324.186) [-323.819] (-327.360) (-325.303) * (-327.578) (-324.656) [-325.639] (-325.047) -- 0:00:12
Average standard deviation of split frequencies: 0.006320
780500 -- (-325.575) [-329.099] (-326.858) (-333.759) * (-326.828) (-324.607) [-325.787] (-326.539) -- 0:00:12
781000 -- (-326.808) (-327.037) (-327.035) [-325.059] * (-325.908) (-327.743) [-324.201] (-327.823) -- 0:00:13
781500 -- (-327.478) (-324.035) [-325.335] (-324.326) * (-324.044) [-324.410] (-331.395) (-325.570) -- 0:00:13
782000 -- [-324.883] (-325.381) (-336.952) (-325.835) * (-332.398) (-323.583) [-327.008] (-323.630) -- 0:00:13
782500 -- (-325.157) (-325.111) [-329.100] (-326.369) * (-325.186) (-327.192) [-324.650] (-323.641) -- 0:00:13
783000 -- (-325.424) [-326.423] (-328.461) (-327.089) * (-328.383) [-323.523] (-332.517) (-324.479) -- 0:00:13
783500 -- [-325.886] (-325.100) (-325.923) (-323.979) * (-329.382) [-325.151] (-325.053) (-326.183) -- 0:00:12
784000 -- (-328.120) [-325.677] (-328.648) (-328.215) * [-328.565] (-328.034) (-326.213) (-326.220) -- 0:00:12
784500 -- (-327.659) (-326.454) [-326.885] (-325.432) * (-325.776) (-327.457) [-326.469] (-327.559) -- 0:00:12
785000 -- (-323.693) (-327.560) [-326.831] (-326.263) * [-324.963] (-325.842) (-323.655) (-326.286) -- 0:00:12
Average standard deviation of split frequencies: 0.006397
785500 -- (-325.988) (-325.354) (-326.877) [-324.896] * (-323.543) (-329.602) (-324.326) [-331.845] -- 0:00:12
786000 -- (-324.939) (-326.064) [-326.170] (-327.464) * (-323.944) (-325.221) [-324.255] (-325.271) -- 0:00:12
786500 -- (-325.501) (-324.723) (-323.976) [-329.221] * (-329.914) (-330.452) [-323.973] (-326.512) -- 0:00:12
787000 -- (-324.438) (-326.019) (-324.056) [-325.512] * (-326.598) (-327.449) [-323.969] (-327.789) -- 0:00:12
787500 -- [-324.500] (-325.026) (-324.044) (-325.432) * [-328.369] (-324.748) (-324.652) (-327.187) -- 0:00:12
788000 -- [-324.116] (-324.465) (-329.421) (-324.753) * (-327.448) (-328.103) (-325.112) [-323.971] -- 0:00:12
788500 -- [-326.674] (-325.880) (-326.624) (-327.550) * (-324.271) [-327.962] (-328.175) (-324.940) -- 0:00:12
789000 -- [-324.214] (-324.381) (-327.116) (-325.183) * (-326.441) (-324.877) [-323.637] (-326.061) -- 0:00:12
789500 -- (-328.983) [-326.477] (-325.388) (-324.634) * (-328.474) (-328.674) [-324.539] (-324.868) -- 0:00:12
790000 -- [-323.879] (-324.542) (-325.221) (-330.189) * (-326.226) (-326.216) [-324.262] (-326.297) -- 0:00:12
Average standard deviation of split frequencies: 0.006558
790500 -- (-324.870) [-324.043] (-325.566) (-324.662) * (-324.312) (-326.992) (-324.588) [-324.683] -- 0:00:12
791000 -- (-325.739) [-327.682] (-326.759) (-326.331) * (-324.722) [-325.097] (-328.296) (-324.079) -- 0:00:12
791500 -- (-324.310) [-328.095] (-325.719) (-325.790) * (-325.590) [-325.030] (-324.195) (-324.185) -- 0:00:12
792000 -- (-326.734) (-324.923) [-326.786] (-328.780) * (-324.724) (-325.785) [-325.949] (-324.899) -- 0:00:12
792500 -- (-328.854) (-324.236) (-327.568) [-323.228] * (-324.081) [-323.831] (-324.552) (-324.996) -- 0:00:12
793000 -- [-325.903] (-325.110) (-325.983) (-323.879) * (-325.712) (-324.113) [-323.916] (-324.758) -- 0:00:12
793500 -- (-324.458) [-326.056] (-325.313) (-325.502) * (-329.848) (-326.846) [-325.525] (-327.888) -- 0:00:12
794000 -- (-325.957) [-325.020] (-327.128) (-324.162) * (-328.273) [-323.734] (-329.507) (-324.181) -- 0:00:12
794500 -- (-326.400) (-326.062) (-325.517) [-324.570] * (-325.324) (-324.874) (-328.056) [-324.784] -- 0:00:12
795000 -- (-325.204) (-326.035) (-325.667) [-324.722] * (-325.038) [-325.143] (-325.514) (-323.788) -- 0:00:12
Average standard deviation of split frequencies: 0.006277
795500 -- (-324.452) (-330.312) (-325.579) [-324.394] * [-326.469] (-331.334) (-326.695) (-324.263) -- 0:00:12
796000 -- (-325.511) [-324.148] (-330.400) (-324.649) * (-325.968) [-328.031] (-328.276) (-324.645) -- 0:00:12
796500 -- (-327.072) (-325.316) [-324.988] (-325.512) * (-326.029) [-327.482] (-326.537) (-324.339) -- 0:00:12
797000 -- [-327.519] (-325.794) (-324.140) (-326.407) * (-331.772) (-325.859) (-326.348) [-325.718] -- 0:00:11
797500 -- (-330.578) (-331.667) [-323.851] (-325.738) * (-329.841) (-331.386) (-327.419) [-325.326] -- 0:00:11
798000 -- (-328.934) (-329.403) [-325.717] (-325.832) * (-327.708) [-324.339] (-324.976) (-328.392) -- 0:00:12
798500 -- [-325.993] (-325.130) (-327.550) (-326.283) * (-328.458) (-325.313) (-329.652) [-325.761] -- 0:00:12
799000 -- (-325.610) [-324.554] (-326.761) (-323.636) * (-323.775) (-323.455) [-326.409] (-327.027) -- 0:00:12
799500 -- [-327.253] (-327.811) (-324.976) (-323.998) * (-323.924) [-325.193] (-329.887) (-329.271) -- 0:00:12
800000 -- (-326.389) [-328.487] (-327.342) (-324.912) * (-325.953) (-324.764) [-324.118] (-325.231) -- 0:00:12
Average standard deviation of split frequencies: 0.006359
800500 -- (-330.980) (-327.527) [-325.017] (-327.313) * (-327.252) [-324.197] (-325.784) (-325.083) -- 0:00:11
801000 -- (-325.051) (-325.159) (-324.667) [-324.261] * [-328.174] (-325.774) (-330.115) (-324.438) -- 0:00:11
801500 -- (-323.676) [-326.156] (-324.562) (-327.522) * (-326.241) (-326.033) [-325.953] (-327.508) -- 0:00:11
802000 -- (-324.968) (-324.765) (-329.852) [-325.372] * (-324.025) (-324.669) [-324.872] (-324.565) -- 0:00:11
802500 -- [-325.045] (-327.944) (-325.307) (-323.950) * (-325.515) (-328.584) [-324.469] (-325.942) -- 0:00:11
803000 -- (-329.687) (-326.006) (-325.930) [-323.581] * (-324.029) (-329.470) [-324.095] (-325.683) -- 0:00:11
803500 -- (-324.486) (-325.199) [-326.588] (-329.373) * (-324.176) (-328.145) (-328.668) [-328.342] -- 0:00:11
804000 -- [-326.826] (-326.123) (-324.887) (-326.205) * (-327.801) [-324.677] (-328.297) (-328.350) -- 0:00:11
804500 -- (-328.608) (-328.414) [-327.137] (-325.043) * (-325.714) [-323.849] (-328.942) (-325.600) -- 0:00:11
805000 -- (-330.844) (-326.264) (-326.941) [-324.405] * (-324.069) [-324.479] (-326.773) (-323.704) -- 0:00:11
Average standard deviation of split frequencies: 0.006122
805500 -- [-324.980] (-325.862) (-324.393) (-323.876) * (-324.792) [-324.513] (-330.953) (-325.285) -- 0:00:11
806000 -- (-324.392) (-327.981) (-327.663) [-326.792] * (-330.912) (-324.460) [-325.807] (-324.135) -- 0:00:11
806500 -- (-323.922) [-330.797] (-328.433) (-324.750) * [-327.779] (-326.230) (-326.333) (-326.351) -- 0:00:11
807000 -- (-326.061) [-326.718] (-325.108) (-326.358) * [-326.305] (-324.414) (-326.064) (-324.444) -- 0:00:11
807500 -- (-327.886) (-326.816) (-326.188) [-328.202] * [-326.280] (-324.300) (-325.666) (-324.911) -- 0:00:11
808000 -- [-325.331] (-324.988) (-326.288) (-325.962) * (-324.157) [-324.077] (-328.284) (-324.912) -- 0:00:11
808500 -- (-325.737) (-326.319) [-328.663] (-324.846) * [-323.863] (-323.776) (-326.790) (-328.262) -- 0:00:11
809000 -- (-325.063) [-324.439] (-326.069) (-324.637) * (-326.305) (-324.262) (-330.054) [-323.282] -- 0:00:11
809500 -- (-325.456) (-327.083) [-325.200] (-324.978) * (-326.649) (-324.216) (-327.721) [-327.563] -- 0:00:11
810000 -- (-325.849) (-328.511) (-323.791) [-323.773] * (-330.010) (-325.114) [-327.792] (-326.469) -- 0:00:11
Average standard deviation of split frequencies: 0.006203
810500 -- [-326.638] (-325.849) (-324.222) (-326.293) * (-323.719) (-324.768) (-335.009) [-324.199] -- 0:00:11
811000 -- (-326.978) [-325.630] (-325.196) (-328.320) * [-323.284] (-323.824) (-327.800) (-323.746) -- 0:00:11
811500 -- (-325.803) (-324.518) (-326.680) [-327.171] * (-327.914) (-325.492) (-327.338) [-325.191] -- 0:00:11
812000 -- (-327.950) (-327.797) (-324.956) [-325.160] * (-325.774) (-324.083) (-327.327) [-325.929] -- 0:00:11
812500 -- (-327.068) (-324.770) (-327.025) [-325.312] * [-324.209] (-324.278) (-324.521) (-323.981) -- 0:00:11
813000 -- (-326.396) (-327.440) (-329.704) [-326.162] * [-330.869] (-324.430) (-323.888) (-324.540) -- 0:00:11
813500 -- [-324.265] (-326.016) (-325.976) (-324.042) * [-324.479] (-325.372) (-325.850) (-328.427) -- 0:00:11
814000 -- (-326.154) (-324.688) (-327.584) [-323.664] * (-324.539) [-324.762] (-326.135) (-328.980) -- 0:00:10
814500 -- (-326.157) [-324.642] (-328.349) (-324.936) * (-330.857) [-324.533] (-329.708) (-332.199) -- 0:00:10
815000 -- [-324.396] (-323.523) (-325.513) (-324.554) * (-330.503) (-327.273) [-325.333] (-331.363) -- 0:00:11
Average standard deviation of split frequencies: 0.006860
815500 -- (-327.010) (-323.456) [-325.725] (-323.919) * (-326.555) [-324.711] (-332.106) (-327.565) -- 0:00:11
816000 -- (-325.869) (-327.823) (-324.138) [-323.757] * (-325.612) [-324.856] (-324.530) (-325.612) -- 0:00:11
816500 -- (-325.146) [-328.216] (-327.784) (-324.606) * (-331.295) [-330.037] (-325.003) (-324.674) -- 0:00:11
817000 -- (-325.122) (-326.683) (-325.931) [-324.488] * (-324.442) (-331.753) (-325.582) [-324.562] -- 0:00:10
817500 -- (-327.632) [-324.651] (-326.610) (-324.525) * (-326.844) (-326.658) (-324.848) [-323.500] -- 0:00:10
818000 -- [-326.794] (-328.362) (-324.140) (-324.303) * (-325.265) (-326.724) (-323.865) [-327.515] -- 0:00:10
818500 -- (-328.065) (-329.071) (-325.333) [-324.184] * (-325.215) (-326.593) [-326.755] (-324.640) -- 0:00:10
819000 -- [-324.497] (-326.096) (-326.322) (-325.985) * [-326.303] (-323.929) (-328.262) (-324.692) -- 0:00:10
819500 -- (-325.255) (-324.203) [-324.688] (-326.534) * (-329.180) [-324.317] (-326.058) (-324.884) -- 0:00:10
820000 -- (-325.937) [-325.734] (-325.020) (-325.014) * (-328.711) (-325.624) (-326.623) [-325.036] -- 0:00:10
Average standard deviation of split frequencies: 0.006319
820500 -- [-326.384] (-326.286) (-327.769) (-326.182) * (-328.611) (-328.578) (-324.979) [-324.490] -- 0:00:10
821000 -- (-329.217) (-328.349) [-326.419] (-330.582) * (-325.832) (-328.568) [-325.525] (-327.704) -- 0:00:10
821500 -- (-324.568) (-323.845) (-325.862) [-325.226] * (-325.656) (-328.033) [-326.345] (-327.154) -- 0:00:10
822000 -- (-327.502) (-324.812) [-324.851] (-325.972) * (-327.977) [-323.588] (-324.668) (-326.437) -- 0:00:10
822500 -- (-325.788) [-328.731] (-325.262) (-327.160) * [-326.823] (-325.209) (-327.223) (-325.316) -- 0:00:10
823000 -- (-333.670) (-325.175) (-328.322) [-324.735] * (-326.911) [-324.079] (-326.257) (-331.981) -- 0:00:10
823500 -- (-327.739) (-324.652) (-324.763) [-323.720] * (-324.510) [-325.814] (-326.076) (-325.502) -- 0:00:10
824000 -- [-328.511] (-324.062) (-325.797) (-324.140) * (-324.446) (-324.595) (-324.910) [-325.635] -- 0:00:10
824500 -- (-326.775) (-326.148) [-325.541] (-327.238) * [-324.690] (-325.001) (-326.231) (-329.317) -- 0:00:10
825000 -- [-323.872] (-330.640) (-325.736) (-325.577) * [-323.895] (-326.199) (-326.973) (-326.675) -- 0:00:10
Average standard deviation of split frequencies: 0.006126
825500 -- (-323.862) (-333.758) [-324.654] (-329.127) * (-327.791) (-325.605) [-323.493] (-325.691) -- 0:00:10
826000 -- (-325.410) [-324.455] (-326.646) (-327.918) * [-324.609] (-327.020) (-327.455) (-324.413) -- 0:00:10
826500 -- (-324.792) (-327.442) (-329.029) [-328.242] * (-327.942) [-324.227] (-326.850) (-325.918) -- 0:00:10
827000 -- [-324.542] (-327.965) (-325.061) (-325.791) * (-326.432) [-325.838] (-326.349) (-328.083) -- 0:00:10
827500 -- (-325.522) (-325.935) (-324.976) [-326.965] * (-325.126) [-326.081] (-325.078) (-324.795) -- 0:00:10
828000 -- (-324.813) [-324.652] (-324.306) (-324.966) * [-325.831] (-325.053) (-325.050) (-326.386) -- 0:00:10
828500 -- (-324.422) (-324.710) [-325.240] (-324.149) * (-323.395) (-323.650) [-324.224] (-326.110) -- 0:00:10
829000 -- [-324.957] (-325.068) (-325.111) (-324.660) * (-327.133) (-324.222) (-328.229) [-325.779] -- 0:00:10
829500 -- (-324.929) (-326.916) [-326.809] (-326.776) * (-323.939) (-323.791) (-326.673) [-325.527] -- 0:00:10
830000 -- (-326.104) [-325.462] (-327.436) (-326.049) * (-329.136) (-325.675) [-324.168] (-323.702) -- 0:00:10
Average standard deviation of split frequencies: 0.005978
830500 -- (-325.148) [-323.618] (-326.056) (-325.497) * [-324.581] (-325.723) (-328.876) (-324.628) -- 0:00:10
831000 -- (-324.872) [-325.903] (-326.679) (-325.555) * [-325.780] (-328.731) (-329.582) (-327.519) -- 0:00:09
831500 -- (-325.388) [-326.747] (-326.856) (-326.208) * (-327.404) (-328.439) (-330.863) [-323.580] -- 0:00:09
832000 -- [-325.257] (-325.654) (-324.614) (-325.379) * (-323.829) (-325.219) (-326.437) [-326.473] -- 0:00:10
832500 -- (-326.425) [-324.066] (-326.745) (-326.540) * (-329.645) [-325.887] (-327.055) (-329.190) -- 0:00:10
833000 -- (-324.022) [-324.585] (-324.458) (-325.717) * (-327.083) (-324.269) (-325.879) [-324.589] -- 0:00:10
833500 -- (-325.000) (-328.407) (-325.684) [-323.991] * (-326.268) [-326.606] (-328.873) (-324.553) -- 0:00:09
834000 -- (-327.042) (-325.522) [-325.698] (-326.285) * (-326.722) [-325.159] (-324.996) (-327.638) -- 0:00:09
834500 -- [-324.919] (-327.195) (-328.579) (-325.670) * [-326.148] (-325.400) (-324.290) (-325.444) -- 0:00:09
835000 -- [-326.539] (-325.146) (-325.085) (-324.557) * (-324.392) [-325.371] (-326.885) (-326.962) -- 0:00:09
Average standard deviation of split frequencies: 0.005789
835500 -- (-325.205) [-328.021] (-324.563) (-325.153) * [-325.225] (-323.991) (-327.044) (-324.554) -- 0:00:09
836000 -- (-327.607) [-324.314] (-326.060) (-327.976) * (-327.509) (-323.912) [-326.196] (-325.147) -- 0:00:09
836500 -- [-326.226] (-327.839) (-326.386) (-326.366) * (-327.329) [-325.511] (-325.829) (-325.337) -- 0:00:09
837000 -- [-325.436] (-325.777) (-326.435) (-325.249) * [-325.211] (-324.802) (-326.793) (-326.194) -- 0:00:09
837500 -- (-326.056) (-324.365) [-324.203] (-327.877) * (-328.281) (-326.802) (-330.432) [-327.026] -- 0:00:09
838000 -- (-323.787) (-324.511) [-324.472] (-325.110) * (-326.479) [-324.339] (-328.758) (-327.626) -- 0:00:09
838500 -- (-329.286) [-328.266] (-324.981) (-329.482) * (-328.053) [-323.954] (-323.969) (-325.731) -- 0:00:09
839000 -- (-325.281) [-324.902] (-327.868) (-328.387) * (-326.194) [-325.121] (-326.274) (-326.031) -- 0:00:09
839500 -- (-333.177) (-327.583) [-324.441] (-324.430) * (-325.993) (-325.328) (-327.530) [-323.565] -- 0:00:09
840000 -- (-331.506) (-327.536) [-325.884] (-325.502) * (-325.903) (-326.051) (-326.103) [-323.833] -- 0:00:09
Average standard deviation of split frequencies: 0.005383
840500 -- (-333.117) (-325.535) [-325.318] (-326.025) * (-325.013) (-325.769) [-327.575] (-324.472) -- 0:00:09
841000 -- (-325.685) [-324.602] (-329.147) (-326.191) * (-324.424) (-324.172) [-327.544] (-324.621) -- 0:00:09
841500 -- (-324.917) [-325.251] (-329.586) (-325.336) * (-324.834) (-324.258) [-330.965] (-326.935) -- 0:00:09
842000 -- (-325.125) [-326.138] (-328.947) (-326.600) * (-324.806) [-324.894] (-327.497) (-325.673) -- 0:00:09
842500 -- [-327.338] (-328.142) (-330.364) (-325.275) * [-324.122] (-324.571) (-325.247) (-324.190) -- 0:00:09
843000 -- (-323.721) (-325.787) (-324.631) [-325.361] * (-324.444) (-324.056) [-324.382] (-326.524) -- 0:00:09
843500 -- (-323.735) [-323.880] (-325.447) (-327.806) * [-323.854] (-325.869) (-334.689) (-327.382) -- 0:00:09
844000 -- (-324.474) [-327.488] (-325.698) (-326.115) * (-325.486) (-324.505) [-330.356] (-325.088) -- 0:00:09
844500 -- (-324.059) (-329.056) [-325.333] (-326.024) * (-325.959) [-325.027] (-332.008) (-324.551) -- 0:00:09
845000 -- (-325.250) (-323.804) (-326.526) [-324.953] * [-324.854] (-325.591) (-327.011) (-323.973) -- 0:00:09
Average standard deviation of split frequencies: 0.005990
845500 -- (-326.790) [-324.137] (-327.162) (-325.598) * [-325.828] (-326.073) (-324.107) (-325.009) -- 0:00:09
846000 -- [-324.436] (-324.888) (-326.598) (-324.566) * (-324.606) [-325.303] (-324.890) (-324.188) -- 0:00:09
846500 -- (-324.315) (-325.320) (-326.295) [-324.590] * [-324.582] (-324.480) (-324.773) (-325.222) -- 0:00:09
847000 -- (-326.501) (-324.475) (-323.953) [-324.097] * (-323.530) (-324.117) (-328.102) [-324.364] -- 0:00:09
847500 -- (-326.288) [-327.798] (-326.767) (-324.471) * (-324.965) (-324.405) (-325.190) [-324.738] -- 0:00:08
848000 -- [-329.047] (-325.434) (-327.316) (-326.852) * [-323.881] (-324.880) (-327.854) (-325.270) -- 0:00:08
848500 -- [-325.145] (-326.086) (-324.219) (-325.934) * [-324.545] (-325.093) (-329.262) (-324.982) -- 0:00:09
849000 -- [-324.363] (-326.558) (-328.262) (-324.535) * [-326.462] (-327.280) (-325.857) (-325.290) -- 0:00:09
849500 -- (-324.892) (-327.689) [-328.175] (-328.562) * (-323.983) [-326.566] (-327.662) (-330.507) -- 0:00:09
850000 -- (-328.612) [-323.879] (-330.156) (-325.282) * (-324.528) (-324.786) (-326.267) [-329.108] -- 0:00:09
Average standard deviation of split frequencies: 0.006200
850500 -- (-323.843) (-325.379) (-325.765) [-327.470] * (-326.382) (-328.284) [-323.543] (-330.511) -- 0:00:08
851000 -- (-325.786) (-326.578) [-326.425] (-327.834) * [-325.733] (-325.446) (-329.200) (-327.751) -- 0:00:08
851500 -- (-325.658) [-323.904] (-326.223) (-324.678) * (-325.860) [-324.353] (-325.577) (-333.857) -- 0:00:08
852000 -- (-325.825) [-324.540] (-324.430) (-324.704) * (-325.493) [-325.127] (-326.072) (-332.573) -- 0:00:08
852500 -- (-324.178) (-329.460) [-325.835] (-325.599) * (-326.174) [-325.383] (-325.471) (-328.469) -- 0:00:08
853000 -- (-327.819) (-326.099) [-325.264] (-324.110) * [-325.374] (-325.128) (-325.549) (-326.097) -- 0:00:08
853500 -- (-325.399) [-326.043] (-325.113) (-326.884) * [-324.240] (-328.603) (-324.787) (-328.478) -- 0:00:08
854000 -- (-325.942) [-324.219] (-327.046) (-325.529) * (-324.881) (-324.209) [-326.162] (-327.134) -- 0:00:08
854500 -- [-326.425] (-324.735) (-325.883) (-327.773) * [-324.976] (-325.690) (-325.918) (-325.742) -- 0:00:08
855000 -- (-323.974) [-324.144] (-325.193) (-324.231) * (-327.843) (-325.749) (-325.434) [-329.200] -- 0:00:08
Average standard deviation of split frequencies: 0.005948
855500 -- (-327.603) (-324.482) [-324.028] (-325.690) * [-328.100] (-326.385) (-324.696) (-326.450) -- 0:00:08
856000 -- (-324.804) (-326.487) (-325.470) [-327.045] * (-323.857) [-326.358] (-328.408) (-324.139) -- 0:00:08
856500 -- (-326.670) [-325.380] (-328.627) (-330.968) * (-326.707) [-328.734] (-326.428) (-323.992) -- 0:00:08
857000 -- (-324.335) (-327.579) [-324.439] (-324.772) * (-331.664) (-325.449) [-325.863] (-324.909) -- 0:00:08
857500 -- (-328.207) (-326.979) [-323.669] (-324.953) * (-326.065) [-323.929] (-324.698) (-324.328) -- 0:00:08
858000 -- (-326.307) (-325.835) [-324.196] (-326.613) * [-323.565] (-325.391) (-325.863) (-328.303) -- 0:00:08
858500 -- (-329.085) [-324.500] (-327.396) (-324.664) * (-323.893) (-325.123) [-325.950] (-325.904) -- 0:00:08
859000 -- [-326.278] (-326.130) (-327.200) (-327.469) * [-323.892] (-328.257) (-326.717) (-325.876) -- 0:00:08
859500 -- (-325.509) [-324.878] (-333.094) (-325.212) * (-323.597) (-327.540) (-324.458) [-325.280] -- 0:00:08
860000 -- (-327.806) (-325.346) (-328.672) [-325.206] * (-323.723) (-325.265) (-325.419) [-323.688] -- 0:00:08
Average standard deviation of split frequencies: 0.005769
860500 -- (-326.630) (-325.191) [-325.798] (-328.454) * (-324.667) (-324.338) (-333.225) [-324.802] -- 0:00:08
861000 -- (-329.301) [-327.150] (-327.188) (-330.594) * (-323.519) (-328.971) [-333.113] (-325.796) -- 0:00:08
861500 -- (-328.652) [-323.818] (-328.728) (-328.441) * (-324.614) (-324.939) [-328.380] (-328.415) -- 0:00:08
862000 -- (-323.981) (-325.563) (-323.915) [-323.504] * (-325.666) (-326.817) [-326.915] (-333.111) -- 0:00:08
862500 -- (-326.125) (-325.446) [-324.573] (-325.167) * (-328.387) (-325.926) [-328.747] (-328.402) -- 0:00:08
863000 -- (-323.959) [-324.022] (-326.341) (-327.173) * (-325.071) (-327.959) (-324.607) [-326.865] -- 0:00:08
863500 -- (-325.529) [-323.992] (-324.025) (-325.590) * [-325.892] (-328.207) (-324.741) (-324.947) -- 0:00:08
864000 -- (-325.335) [-323.376] (-324.238) (-324.442) * (-323.909) (-331.826) [-324.368] (-324.479) -- 0:00:08
864500 -- (-324.925) (-326.998) [-324.145] (-325.576) * (-324.872) [-329.814] (-325.051) (-325.941) -- 0:00:07
865000 -- (-325.873) [-324.515] (-325.351) (-324.355) * [-324.803] (-327.678) (-325.864) (-325.425) -- 0:00:07
Average standard deviation of split frequencies: 0.005734
865500 -- (-325.049) (-326.122) [-324.430] (-327.283) * (-325.415) (-329.253) [-326.553] (-324.965) -- 0:00:07
866000 -- [-325.109] (-326.678) (-333.340) (-330.587) * [-325.247] (-328.391) (-325.897) (-325.691) -- 0:00:08
866500 -- [-324.574] (-331.770) (-328.705) (-326.218) * (-325.437) (-329.497) [-330.286] (-325.926) -- 0:00:08
867000 -- (-325.309) (-327.881) [-324.334] (-325.369) * [-323.668] (-327.375) (-332.139) (-325.118) -- 0:00:07
867500 -- [-325.247] (-328.192) (-326.201) (-326.157) * [-325.135] (-326.289) (-324.174) (-324.728) -- 0:00:07
868000 -- [-324.460] (-324.845) (-324.251) (-326.226) * (-326.611) (-325.930) (-327.611) [-328.704] -- 0:00:07
868500 -- (-327.141) (-325.471) [-326.403] (-325.716) * (-325.292) (-325.189) (-331.133) [-324.351] -- 0:00:07
869000 -- [-324.227] (-324.565) (-325.945) (-331.210) * (-328.165) (-324.448) [-327.645] (-326.376) -- 0:00:07
869500 -- (-325.026) (-325.231) [-324.584] (-331.690) * (-327.253) [-324.065] (-326.020) (-326.276) -- 0:00:07
870000 -- [-325.387] (-325.030) (-325.409) (-324.208) * (-326.116) [-327.312] (-323.627) (-327.880) -- 0:00:07
Average standard deviation of split frequencies: 0.005811
870500 -- [-325.573] (-325.500) (-326.267) (-326.060) * (-326.700) (-328.259) (-324.821) [-326.343] -- 0:00:07
871000 -- (-330.078) [-324.731] (-327.952) (-327.213) * (-323.748) (-324.379) (-325.027) [-324.813] -- 0:00:07
871500 -- (-327.114) (-325.675) (-332.559) [-325.405] * (-326.139) (-326.028) [-323.610] (-324.259) -- 0:00:07
872000 -- (-326.282) (-325.154) [-329.457] (-324.914) * (-330.073) (-325.167) (-327.354) [-325.862] -- 0:00:07
872500 -- [-324.804] (-324.328) (-328.247) (-327.716) * (-330.327) (-325.374) [-326.839] (-324.871) -- 0:00:07
873000 -- (-325.569) (-323.799) (-327.844) [-324.350] * (-325.621) [-325.344] (-324.999) (-323.595) -- 0:00:07
873500 -- [-324.039] (-326.243) (-323.675) (-327.058) * (-328.347) [-325.896] (-325.448) (-326.378) -- 0:00:07
874000 -- (-325.518) (-323.661) [-323.899] (-323.287) * (-327.144) (-325.512) (-325.967) [-325.715] -- 0:00:07
874500 -- (-326.984) [-324.794] (-325.071) (-323.397) * (-325.792) (-325.875) [-324.101] (-331.705) -- 0:00:07
875000 -- (-326.873) [-327.867] (-327.985) (-324.174) * (-324.513) (-326.582) [-324.118] (-324.720) -- 0:00:07
Average standard deviation of split frequencies: 0.005525
875500 -- (-326.442) (-324.459) (-324.780) [-325.332] * [-328.064] (-325.619) (-324.380) (-324.615) -- 0:00:07
876000 -- (-325.750) (-323.554) (-325.660) [-327.312] * (-328.492) (-326.655) [-325.958] (-327.348) -- 0:00:07
876500 -- (-329.643) [-325.066] (-325.368) (-329.881) * (-326.103) (-325.610) (-323.819) [-327.936] -- 0:00:07
877000 -- [-323.526] (-327.219) (-324.467) (-330.695) * (-324.406) (-326.874) [-324.418] (-326.510) -- 0:00:07
877500 -- (-324.426) [-327.686] (-324.119) (-325.566) * [-325.170] (-328.430) (-324.349) (-323.835) -- 0:00:07
878000 -- (-325.796) [-325.578] (-330.519) (-324.447) * (-327.426) (-326.572) (-327.339) [-324.107] -- 0:00:07
878500 -- (-326.771) (-327.208) (-328.019) [-324.072] * (-326.506) (-328.143) (-327.463) [-323.883] -- 0:00:07
879000 -- (-328.867) (-324.280) [-323.916] (-323.938) * (-325.601) (-324.755) (-323.684) [-324.005] -- 0:00:07
879500 -- (-324.007) [-330.284] (-327.292) (-323.775) * (-325.619) (-324.675) (-323.808) [-323.857] -- 0:00:07
880000 -- (-324.024) (-326.878) (-328.473) [-324.087] * [-323.875] (-325.737) (-325.543) (-329.750) -- 0:00:07
Average standard deviation of split frequencies: 0.005210
880500 -- [-323.924] (-324.373) (-326.990) (-323.915) * (-328.916) [-325.276] (-327.144) (-325.494) -- 0:00:07
881000 -- [-323.469] (-326.579) (-323.633) (-327.880) * (-325.126) (-325.384) (-324.290) [-324.765] -- 0:00:07
881500 -- [-326.132] (-324.797) (-326.968) (-325.649) * (-328.459) (-324.427) (-323.817) [-324.583] -- 0:00:06
882000 -- [-327.773] (-326.200) (-324.278) (-329.536) * (-325.704) (-323.829) [-325.859] (-324.847) -- 0:00:06
882500 -- [-324.077] (-324.140) (-328.605) (-326.603) * (-324.464) (-325.033) [-325.334] (-326.893) -- 0:00:06
883000 -- (-323.830) [-324.531] (-327.025) (-323.712) * (-325.680) [-325.574] (-323.565) (-328.089) -- 0:00:07
883500 -- (-323.627) [-326.639] (-325.797) (-323.844) * (-325.127) (-326.047) (-325.911) [-324.854] -- 0:00:06
884000 -- (-325.875) [-325.630] (-326.405) (-330.534) * (-326.534) [-330.466] (-328.529) (-326.952) -- 0:00:06
884500 -- [-324.788] (-326.756) (-326.258) (-328.293) * (-326.711) (-323.838) (-326.457) [-325.493] -- 0:00:06
885000 -- (-324.028) (-326.371) [-325.151] (-329.046) * (-327.902) (-327.359) (-323.897) [-326.496] -- 0:00:06
Average standard deviation of split frequencies: 0.004930
885500 -- (-325.421) [-325.653] (-330.005) (-327.430) * (-324.769) [-325.279] (-327.006) (-325.986) -- 0:00:06
886000 -- [-325.317] (-325.044) (-326.180) (-324.951) * [-326.266] (-325.413) (-327.404) (-326.133) -- 0:00:06
886500 -- [-324.001] (-324.112) (-328.548) (-328.391) * [-323.497] (-326.595) (-325.493) (-327.127) -- 0:00:06
887000 -- (-325.162) (-324.799) [-327.029] (-324.188) * (-324.339) (-326.643) [-324.403] (-328.944) -- 0:00:06
887500 -- (-327.667) [-325.404] (-328.989) (-324.319) * (-324.331) (-326.910) (-324.000) [-328.406] -- 0:00:06
888000 -- (-327.292) [-325.278] (-324.176) (-329.200) * [-323.369] (-325.381) (-324.875) (-328.239) -- 0:00:06
888500 -- [-326.793] (-327.063) (-326.994) (-325.131) * [-325.758] (-328.847) (-326.455) (-331.626) -- 0:00:06
889000 -- (-324.977) (-329.005) (-328.017) [-326.608] * [-323.925] (-324.656) (-324.929) (-326.247) -- 0:00:06
889500 -- [-325.040] (-325.124) (-331.093) (-328.503) * (-327.156) (-328.362) [-325.191] (-324.963) -- 0:00:06
890000 -- (-325.259) [-324.630] (-324.713) (-325.838) * (-325.227) (-327.893) (-325.612) [-328.472] -- 0:00:06
Average standard deviation of split frequencies: 0.005046
890500 -- (-326.475) [-325.263] (-324.350) (-324.060) * (-325.489) (-325.530) [-327.626] (-324.905) -- 0:00:06
891000 -- [-328.742] (-325.848) (-326.810) (-327.346) * [-324.540] (-328.803) (-327.715) (-326.333) -- 0:00:06
891500 -- (-330.851) [-325.298] (-327.431) (-325.532) * [-323.528] (-325.367) (-326.098) (-326.406) -- 0:00:06
892000 -- (-327.621) (-325.047) (-329.393) [-325.243] * (-331.993) (-324.035) (-326.941) [-328.738] -- 0:00:06
892500 -- [-326.814] (-325.439) (-326.252) (-325.646) * (-328.413) (-324.403) (-323.871) [-325.448] -- 0:00:06
893000 -- (-327.931) (-329.478) (-329.507) [-325.852] * [-325.268] (-324.293) (-326.302) (-325.442) -- 0:00:06
893500 -- (-327.486) (-330.073) (-324.416) [-326.910] * (-327.741) (-324.178) [-324.822] (-325.372) -- 0:00:06
894000 -- (-330.057) (-324.240) [-324.405] (-326.046) * (-329.050) (-325.669) [-324.649] (-328.559) -- 0:00:06
894500 -- (-326.686) [-326.921] (-324.773) (-326.217) * (-323.712) (-325.671) [-324.134] (-326.229) -- 0:00:06
895000 -- (-329.794) [-327.563] (-325.861) (-324.865) * (-324.575) (-324.818) (-326.794) [-327.760] -- 0:00:06
Average standard deviation of split frequencies: 0.005086
895500 -- [-326.793] (-326.880) (-326.161) (-331.498) * (-326.464) [-324.672] (-327.580) (-326.234) -- 0:00:06
896000 -- (-326.844) (-324.467) (-326.550) [-329.362] * (-325.481) (-324.879) [-328.112] (-325.021) -- 0:00:06
896500 -- (-325.885) [-327.263] (-324.243) (-327.700) * (-325.328) [-327.287] (-328.032) (-324.632) -- 0:00:06
897000 -- [-325.226] (-324.633) (-325.158) (-325.173) * (-325.475) [-327.356] (-324.027) (-323.939) -- 0:00:06
897500 -- (-327.482) (-325.737) [-326.384] (-326.664) * (-324.222) (-325.636) [-326.618] (-327.327) -- 0:00:06
898000 -- [-326.257] (-327.814) (-324.928) (-327.639) * (-323.907) (-329.412) [-324.845] (-325.798) -- 0:00:06
898500 -- [-329.350] (-324.532) (-327.956) (-327.569) * (-325.117) (-325.449) (-329.355) [-326.171] -- 0:00:05
899000 -- (-329.726) (-325.915) [-327.113] (-325.723) * (-326.942) (-326.231) [-325.743] (-327.604) -- 0:00:05
899500 -- (-325.880) (-324.877) [-326.463] (-324.722) * (-325.637) (-326.936) [-325.285] (-326.395) -- 0:00:05
900000 -- (-325.276) (-323.992) (-326.587) [-324.507] * (-326.737) (-325.084) [-324.405] (-326.348) -- 0:00:06
Average standard deviation of split frequencies: 0.004850
900500 -- (-325.098) [-326.823] (-324.383) (-327.531) * [-328.254] (-325.492) (-324.940) (-324.486) -- 0:00:05
901000 -- (-324.740) (-325.486) [-326.233] (-329.314) * (-324.668) (-328.197) [-327.077] (-323.878) -- 0:00:05
901500 -- (-325.736) (-323.803) [-324.445] (-325.807) * (-327.944) (-328.421) [-325.241] (-326.086) -- 0:00:05
902000 -- (-331.312) (-324.721) (-325.701) [-326.084] * (-326.721) [-326.198] (-325.651) (-328.710) -- 0:00:05
902500 -- (-326.856) (-332.029) (-327.507) [-325.135] * (-329.212) (-324.988) (-325.180) [-327.777] -- 0:00:05
903000 -- (-324.182) (-324.204) (-326.180) [-324.896] * [-326.291] (-323.733) (-323.730) (-324.708) -- 0:00:05
903500 -- (-324.182) [-323.863] (-325.720) (-325.512) * (-323.689) (-327.897) [-325.274] (-329.004) -- 0:00:05
904000 -- [-324.244] (-326.475) (-326.998) (-326.573) * (-323.751) (-326.259) (-325.038) [-324.563] -- 0:00:05
904500 -- (-328.001) [-325.899] (-324.245) (-327.148) * (-325.818) [-326.476] (-326.492) (-325.549) -- 0:00:05
905000 -- (-324.983) [-324.166] (-324.085) (-325.400) * (-323.605) (-326.867) (-324.911) [-324.489] -- 0:00:05
Average standard deviation of split frequencies: 0.005333
905500 -- (-326.706) (-325.765) (-326.595) [-325.595] * (-324.274) (-326.882) (-324.458) [-324.329] -- 0:00:05
906000 -- (-326.963) (-325.052) [-326.595] (-324.575) * [-325.697] (-324.250) (-327.937) (-323.846) -- 0:00:05
906500 -- [-325.411] (-326.032) (-325.861) (-327.019) * [-323.940] (-325.670) (-326.168) (-326.520) -- 0:00:05
907000 -- [-327.642] (-326.123) (-326.392) (-323.873) * (-323.566) [-324.829] (-327.019) (-324.225) -- 0:00:05
907500 -- (-327.924) (-325.297) (-325.048) [-324.194] * [-325.715] (-324.591) (-325.026) (-325.093) -- 0:00:05
908000 -- (-325.658) (-323.991) (-324.206) [-325.630] * (-326.156) (-323.841) (-326.754) [-325.309] -- 0:00:05
908500 -- [-326.832] (-327.730) (-326.339) (-326.156) * (-334.001) (-323.592) (-329.196) [-324.649] -- 0:00:05
909000 -- (-325.624) (-330.434) (-325.366) [-329.544] * [-326.352] (-324.523) (-330.282) (-326.344) -- 0:00:05
909500 -- (-326.209) (-326.833) (-325.130) [-325.585] * (-324.866) [-326.284] (-327.951) (-326.178) -- 0:00:05
910000 -- (-325.336) (-326.865) (-325.417) [-328.261] * [-327.959] (-326.736) (-330.150) (-325.901) -- 0:00:05
Average standard deviation of split frequencies: 0.005241
910500 -- (-325.507) (-325.444) [-327.943] (-326.246) * [-325.120] (-325.819) (-326.473) (-325.272) -- 0:00:05
911000 -- (-325.151) (-324.409) [-325.094] (-325.714) * [-324.394] (-325.595) (-324.993) (-324.170) -- 0:00:05
911500 -- (-324.931) [-324.375] (-327.734) (-325.209) * (-329.541) (-326.752) (-324.738) [-324.326] -- 0:00:05
912000 -- [-328.014] (-328.299) (-325.317) (-328.394) * (-326.029) [-330.834] (-324.957) (-325.603) -- 0:00:05
912500 -- (-325.389) (-326.919) (-324.101) [-325.104] * (-326.607) (-326.204) (-325.048) [-325.979] -- 0:00:05
913000 -- [-323.607] (-329.593) (-324.843) (-325.523) * [-325.860] (-331.397) (-324.876) (-324.059) -- 0:00:05
913500 -- (-323.744) [-327.289] (-325.167) (-324.386) * (-325.963) [-325.818] (-326.413) (-329.518) -- 0:00:05
914000 -- (-328.259) (-326.479) (-325.627) [-324.361] * (-326.448) (-327.832) (-326.975) [-324.999] -- 0:00:05
914500 -- (-325.240) [-326.884] (-323.525) (-324.995) * [-326.416] (-326.753) (-324.321) (-324.759) -- 0:00:05
915000 -- (-325.392) [-325.862] (-328.349) (-325.076) * [-326.984] (-326.059) (-323.882) (-323.729) -- 0:00:05
Average standard deviation of split frequencies: 0.005009
915500 -- (-325.033) [-324.620] (-330.576) (-325.177) * (-326.646) (-324.271) (-325.408) [-323.724] -- 0:00:04
916000 -- (-325.284) [-324.233] (-328.462) (-325.758) * (-324.852) (-325.121) (-326.016) [-325.251] -- 0:00:04
916500 -- [-328.037] (-325.415) (-325.714) (-324.540) * (-326.758) (-324.001) (-324.851) [-326.495] -- 0:00:04
917000 -- (-325.870) [-326.068] (-326.846) (-329.019) * [-327.811] (-324.286) (-325.107) (-324.352) -- 0:00:04
917500 -- [-326.472] (-324.906) (-326.134) (-327.702) * (-325.102) (-325.848) [-323.655] (-323.513) -- 0:00:04
918000 -- (-325.636) [-327.057] (-325.854) (-324.940) * (-328.011) (-326.741) [-326.764] (-324.654) -- 0:00:04
918500 -- (-326.894) (-326.329) (-326.634) [-325.532] * (-325.257) (-326.739) [-326.585] (-327.322) -- 0:00:04
919000 -- (-324.770) [-324.598] (-325.799) (-325.945) * (-326.082) (-327.508) (-326.743) [-326.252] -- 0:00:04
919500 -- [-323.848] (-326.331) (-326.999) (-329.383) * (-324.622) [-326.511] (-325.301) (-325.296) -- 0:00:04
920000 -- (-324.771) [-326.949] (-336.634) (-325.843) * (-324.394) [-330.263] (-325.083) (-327.778) -- 0:00:04
Average standard deviation of split frequencies: 0.005598
920500 -- (-327.134) [-325.306] (-324.484) (-323.863) * [-324.365] (-325.039) (-323.709) (-327.338) -- 0:00:04
921000 -- (-325.102) (-324.353) (-329.930) [-324.486] * (-326.918) (-325.949) (-323.530) [-324.670] -- 0:00:04
921500 -- [-331.687] (-325.243) (-324.721) (-327.228) * (-327.443) (-325.031) [-324.594] (-324.816) -- 0:00:04
922000 -- (-325.021) (-328.557) (-328.904) [-324.258] * (-328.318) (-325.203) (-329.156) [-324.585] -- 0:00:04
922500 -- (-329.699) (-324.102) [-329.036] (-326.024) * (-324.785) (-325.379) [-326.293] (-327.244) -- 0:00:04
923000 -- (-330.813) [-325.582] (-323.789) (-325.489) * (-324.504) (-324.283) [-326.143] (-326.723) -- 0:00:04
923500 -- [-327.685] (-327.049) (-334.339) (-326.342) * (-324.168) (-323.982) [-325.829] (-331.238) -- 0:00:04
924000 -- (-325.166) [-328.943] (-326.687) (-327.645) * (-323.800) (-324.503) (-326.157) [-324.590] -- 0:00:04
924500 -- (-324.463) (-328.335) (-325.716) [-324.671] * (-328.410) [-328.029] (-326.699) (-324.548) -- 0:00:04
925000 -- (-323.958) (-325.988) (-324.052) [-324.676] * (-328.682) [-324.146] (-325.197) (-323.935) -- 0:00:04
Average standard deviation of split frequencies: 0.006077
925500 -- (-327.173) (-324.896) (-323.592) [-324.311] * (-323.582) (-323.428) (-325.485) [-327.154] -- 0:00:04
926000 -- (-323.624) [-325.832] (-326.467) (-329.850) * (-323.595) [-323.819] (-325.811) (-325.659) -- 0:00:04
926500 -- (-325.899) (-326.909) [-325.659] (-324.700) * (-327.790) [-326.580] (-326.074) (-327.933) -- 0:00:04
927000 -- [-324.446] (-325.063) (-324.714) (-326.168) * (-324.081) [-324.335] (-323.979) (-330.728) -- 0:00:04
927500 -- (-324.675) (-326.299) [-326.579] (-324.431) * (-324.905) (-323.739) [-323.468] (-328.569) -- 0:00:04
928000 -- [-324.374] (-324.034) (-326.318) (-327.086) * (-326.630) (-323.743) [-329.343] (-326.091) -- 0:00:04
928500 -- (-325.995) [-324.732] (-325.921) (-325.895) * (-327.701) [-323.805] (-335.431) (-326.058) -- 0:00:04
929000 -- (-325.473) (-327.262) [-328.381] (-327.270) * [-326.915] (-323.507) (-326.452) (-327.920) -- 0:00:04
929500 -- (-325.346) (-326.774) (-325.040) [-324.862] * (-326.972) [-325.102] (-324.661) (-324.691) -- 0:00:04
930000 -- (-324.975) (-329.439) [-326.532] (-325.987) * [-325.831] (-325.658) (-325.479) (-324.306) -- 0:00:04
Average standard deviation of split frequencies: 0.006237
930500 -- (-330.678) (-326.174) (-329.757) [-325.441] * (-327.550) (-328.738) (-326.071) [-324.838] -- 0:00:04
931000 -- (-328.916) [-323.811] (-327.374) (-328.284) * (-324.519) [-326.065] (-324.429) (-324.649) -- 0:00:04
931500 -- (-328.825) (-325.083) (-333.247) [-326.921] * (-326.124) (-324.526) [-325.493] (-329.119) -- 0:00:04
932000 -- [-327.399] (-325.609) (-326.506) (-327.859) * (-326.721) [-324.435] (-323.272) (-326.269) -- 0:00:04
932500 -- (-327.118) (-324.919) [-324.364] (-324.897) * (-327.333) (-326.445) [-323.523] (-327.995) -- 0:00:03
933000 -- [-327.317] (-324.308) (-324.074) (-328.294) * (-325.417) [-325.747] (-324.717) (-327.012) -- 0:00:03
933500 -- [-324.757] (-329.690) (-325.161) (-327.357) * (-325.321) (-328.276) [-326.291] (-324.142) -- 0:00:03
934000 -- (-324.934) (-327.423) [-324.805] (-327.779) * (-324.412) [-326.924] (-326.866) (-327.912) -- 0:00:03
934500 -- (-324.899) (-325.765) [-324.656] (-330.005) * [-324.632] (-327.750) (-325.552) (-330.569) -- 0:00:03
935000 -- (-324.620) (-324.677) [-326.506] (-326.541) * (-327.637) (-332.847) (-326.117) [-328.820] -- 0:00:03
Average standard deviation of split frequencies: 0.006295
935500 -- [-327.711] (-329.655) (-328.084) (-326.445) * (-325.851) (-325.721) [-323.927] (-326.127) -- 0:00:03
936000 -- (-324.715) (-326.181) [-326.910] (-329.192) * (-325.647) (-327.780) (-324.268) [-326.056] -- 0:00:03
936500 -- [-327.587] (-323.791) (-331.327) (-325.734) * (-323.843) [-326.155] (-329.771) (-325.139) -- 0:00:03
937000 -- (-324.261) [-327.110] (-325.297) (-327.382) * (-323.725) (-326.543) [-325.869] (-325.339) -- 0:00:03
937500 -- (-324.172) (-325.307) [-326.958] (-324.854) * (-326.164) [-324.326] (-326.668) (-326.072) -- 0:00:03
938000 -- [-324.182] (-324.801) (-327.351) (-328.493) * (-324.357) [-327.635] (-327.831) (-328.328) -- 0:00:03
938500 -- (-324.548) [-326.749] (-326.301) (-323.976) * (-323.964) [-324.804] (-326.256) (-330.538) -- 0:00:03
939000 -- [-328.111] (-324.281) (-328.268) (-324.595) * [-325.653] (-324.503) (-325.188) (-325.345) -- 0:00:03
939500 -- [-326.775] (-327.381) (-328.606) (-325.079) * (-328.673) [-325.355] (-323.943) (-324.779) -- 0:00:03
940000 -- (-324.344) [-325.087] (-325.879) (-324.891) * (-331.098) [-323.702] (-324.020) (-328.409) -- 0:00:03
Average standard deviation of split frequencies: 0.005646
940500 -- [-324.310] (-324.372) (-324.255) (-323.892) * (-327.204) [-323.540] (-334.517) (-324.772) -- 0:00:03
941000 -- (-323.790) (-325.220) (-324.984) [-324.274] * (-328.171) [-325.917] (-330.067) (-325.168) -- 0:00:03
941500 -- [-324.882] (-325.804) (-325.777) (-324.599) * (-326.899) [-326.960] (-327.439) (-324.186) -- 0:00:03
942000 -- [-325.441] (-325.605) (-324.403) (-325.238) * (-326.793) (-324.358) [-324.214] (-324.361) -- 0:00:03
942500 -- (-326.164) [-325.006] (-324.150) (-324.128) * (-325.902) [-323.976] (-325.192) (-325.025) -- 0:00:03
943000 -- [-324.659] (-327.607) (-324.039) (-326.622) * [-327.741] (-324.151) (-328.243) (-325.244) -- 0:00:03
943500 -- (-331.240) (-330.024) (-325.619) [-324.527] * (-327.528) [-326.586] (-324.108) (-326.693) -- 0:00:03
944000 -- (-325.394) (-324.649) [-325.383] (-327.516) * (-325.948) (-326.896) [-323.934] (-325.889) -- 0:00:03
944500 -- (-327.066) (-324.232) (-325.774) [-323.987] * (-326.237) (-325.860) (-325.103) [-329.412] -- 0:00:03
945000 -- (-325.980) [-325.219] (-325.424) (-327.553) * [-326.621] (-326.724) (-327.998) (-327.704) -- 0:00:03
Average standard deviation of split frequencies: 0.005714
945500 -- (-325.017) (-329.243) (-324.917) [-323.787] * [-324.813] (-326.564) (-327.102) (-326.163) -- 0:00:03
946000 -- [-323.754] (-332.974) (-326.830) (-326.593) * [-324.068] (-324.433) (-328.145) (-326.215) -- 0:00:03
946500 -- (-327.607) (-327.955) [-326.613] (-326.244) * (-323.483) (-332.353) [-324.592] (-324.156) -- 0:00:03
947000 -- [-324.935] (-326.744) (-325.465) (-325.997) * (-323.903) (-324.770) (-327.820) [-325.788] -- 0:00:03
947500 -- (-326.400) (-324.689) [-328.988] (-326.640) * (-329.195) [-325.368] (-327.656) (-325.329) -- 0:00:03
948000 -- (-326.474) [-326.586] (-325.088) (-332.200) * [-326.167] (-326.569) (-325.712) (-325.986) -- 0:00:03
948500 -- (-325.746) (-326.923) [-325.498] (-332.273) * (-324.557) (-326.557) [-326.638] (-324.389) -- 0:00:03
949000 -- (-325.189) [-326.229] (-328.294) (-326.005) * (-325.560) [-324.149] (-326.152) (-327.606) -- 0:00:03
949500 -- (-323.842) (-324.636) (-324.716) [-326.344] * (-325.407) [-326.210] (-329.904) (-327.142) -- 0:00:02
950000 -- (-323.722) (-326.337) [-324.719] (-323.935) * (-326.118) (-327.179) (-327.414) [-325.425] -- 0:00:02
Average standard deviation of split frequencies: 0.005752
950500 -- [-324.340] (-327.853) (-329.604) (-323.446) * (-325.192) [-326.476] (-326.988) (-325.902) -- 0:00:02
951000 -- (-324.091) [-327.409] (-326.847) (-324.651) * [-323.595] (-324.402) (-324.662) (-324.349) -- 0:00:02
951500 -- (-327.041) [-325.383] (-326.738) (-324.523) * (-324.577) (-324.804) (-329.775) [-324.616] -- 0:00:02
952000 -- (-326.743) (-324.622) (-330.285) [-324.386] * (-325.561) [-324.245] (-329.332) (-325.556) -- 0:00:02
952500 -- (-330.347) [-323.730] (-324.501) (-324.482) * [-324.443] (-323.637) (-327.945) (-324.733) -- 0:00:02
953000 -- (-325.392) (-328.539) (-326.119) [-326.641] * (-325.712) (-326.240) (-324.482) [-326.258] -- 0:00:02
953500 -- (-330.215) (-324.306) [-326.781] (-324.648) * (-325.235) [-323.901] (-330.694) (-324.223) -- 0:00:02
954000 -- (-325.758) (-326.003) (-329.103) [-323.841] * (-326.297) (-325.157) (-325.077) [-324.141] -- 0:00:02
954500 -- (-327.724) [-326.144] (-332.242) (-325.221) * (-324.504) (-326.647) (-330.826) [-323.534] -- 0:00:02
955000 -- [-326.113] (-331.119) (-327.034) (-324.331) * (-324.594) (-324.009) (-325.603) [-325.309] -- 0:00:02
Average standard deviation of split frequencies: 0.005654
955500 -- (-326.143) [-326.344] (-331.534) (-325.631) * (-325.854) [-324.049] (-327.677) (-324.051) -- 0:00:02
956000 -- (-324.778) [-327.751] (-324.880) (-326.779) * (-324.654) (-324.497) (-326.420) [-324.967] -- 0:00:02
956500 -- (-324.578) [-324.991] (-326.503) (-325.355) * (-326.142) [-328.253] (-326.583) (-325.264) -- 0:00:02
957000 -- [-325.259] (-328.470) (-325.517) (-324.610) * (-324.522) (-326.252) [-326.182] (-327.726) -- 0:00:02
957500 -- (-324.211) [-323.508] (-324.090) (-325.506) * (-326.801) [-325.925] (-328.156) (-328.559) -- 0:00:02
958000 -- [-324.651] (-325.209) (-326.589) (-324.135) * (-323.503) [-325.802] (-325.769) (-327.061) -- 0:00:02
958500 -- (-326.573) [-324.613] (-329.704) (-325.805) * [-323.864] (-328.709) (-323.816) (-328.963) -- 0:00:02
959000 -- (-335.646) [-324.571] (-325.975) (-324.608) * [-326.787] (-327.369) (-324.848) (-329.497) -- 0:00:02
959500 -- (-329.399) (-324.777) [-325.455] (-325.685) * (-324.440) (-324.264) (-324.265) [-328.366] -- 0:00:02
960000 -- (-325.132) [-324.132] (-325.616) (-324.584) * (-325.574) (-326.759) [-326.923] (-329.096) -- 0:00:02
Average standard deviation of split frequencies: 0.005529
960500 -- [-326.095] (-328.599) (-323.541) (-330.752) * (-328.008) [-326.615] (-325.007) (-330.789) -- 0:00:02
961000 -- (-325.644) (-326.973) [-324.010] (-328.632) * [-325.311] (-327.352) (-323.876) (-329.063) -- 0:00:02
961500 -- [-323.637] (-329.066) (-327.776) (-326.310) * (-324.173) (-325.422) [-323.783] (-325.743) -- 0:00:02
962000 -- (-323.575) (-325.642) (-327.172) [-327.453] * (-326.040) (-325.044) (-326.364) [-330.869] -- 0:00:02
962500 -- (-326.340) (-325.644) [-325.641] (-328.756) * (-323.231) (-325.777) (-325.883) [-329.237] -- 0:00:02
963000 -- [-328.410] (-326.731) (-324.172) (-333.018) * (-326.074) [-329.793] (-324.075) (-328.693) -- 0:00:02
963500 -- (-323.564) [-325.399] (-325.201) (-326.869) * (-326.755) [-328.422] (-324.258) (-324.872) -- 0:00:02
964000 -- (-324.771) [-331.566] (-323.476) (-325.410) * [-330.329] (-325.418) (-327.709) (-325.790) -- 0:00:02
964500 -- [-324.188] (-329.024) (-324.541) (-324.483) * [-326.010] (-326.511) (-324.776) (-328.223) -- 0:00:02
965000 -- (-324.035) (-329.607) [-324.195] (-327.502) * [-326.377] (-325.354) (-327.766) (-328.381) -- 0:00:02
Average standard deviation of split frequencies: 0.005466
965500 -- (-324.999) [-325.304] (-325.321) (-328.202) * (-323.647) [-323.778] (-327.581) (-327.992) -- 0:00:02
966000 -- (-325.417) [-328.536] (-324.201) (-330.985) * (-325.586) [-326.440] (-328.611) (-323.403) -- 0:00:02
966500 -- [-328.437] (-325.495) (-324.630) (-327.661) * [-323.553] (-325.293) (-325.083) (-323.706) -- 0:00:01
967000 -- (-325.853) (-328.115) (-327.499) [-328.643] * (-327.357) [-324.946] (-326.155) (-323.713) -- 0:00:01
967500 -- [-323.950] (-325.303) (-326.356) (-329.613) * (-328.797) (-328.663) [-324.405] (-326.608) -- 0:00:01
968000 -- (-324.070) (-324.721) (-325.497) [-326.858] * (-327.731) [-328.994] (-324.771) (-325.798) -- 0:00:01
968500 -- (-324.243) (-326.560) [-324.412] (-328.394) * (-327.202) [-324.461] (-326.068) (-327.038) -- 0:00:01
969000 -- (-330.371) (-324.867) (-323.577) [-323.992] * [-326.394] (-328.680) (-324.909) (-323.513) -- 0:00:01
969500 -- (-328.395) (-326.881) (-326.064) [-324.263] * (-323.428) [-326.305] (-325.855) (-327.901) -- 0:00:01
970000 -- (-327.134) (-324.245) (-326.035) [-324.009] * (-324.937) (-324.914) [-324.281] (-327.359) -- 0:00:01
Average standard deviation of split frequencies: 0.005439
970500 -- [-326.925] (-327.190) (-327.196) (-323.687) * (-327.930) [-323.936] (-323.606) (-327.300) -- 0:00:01
971000 -- (-328.436) (-325.643) (-325.497) [-325.700] * [-325.883] (-325.409) (-327.296) (-325.658) -- 0:00:01
971500 -- (-323.679) (-323.901) [-324.161] (-327.556) * (-326.007) [-324.534] (-323.459) (-327.013) -- 0:00:01
972000 -- (-325.494) (-324.228) (-324.156) [-324.931] * (-330.628) [-324.441] (-326.107) (-325.831) -- 0:00:01
972500 -- (-325.609) [-323.925] (-325.152) (-324.967) * (-326.468) (-323.834) (-325.311) [-327.243] -- 0:00:01
973000 -- (-325.131) (-324.709) [-323.715] (-329.383) * (-328.614) [-326.070] (-325.240) (-329.356) -- 0:00:01
973500 -- [-325.413] (-328.801) (-324.421) (-324.832) * (-325.083) [-329.339] (-328.276) (-325.849) -- 0:00:01
974000 -- (-325.351) [-326.941] (-325.469) (-325.750) * [-325.710] (-330.806) (-324.496) (-324.829) -- 0:00:01
974500 -- [-326.859] (-325.926) (-325.289) (-325.104) * (-325.181) (-326.336) [-326.264] (-326.814) -- 0:00:01
975000 -- (-324.065) [-327.584] (-324.623) (-326.015) * [-325.236] (-327.548) (-327.862) (-325.727) -- 0:00:01
Average standard deviation of split frequencies: 0.005571
975500 -- (-324.858) [-325.856] (-325.889) (-324.732) * [-325.970] (-326.421) (-326.105) (-325.530) -- 0:00:01
976000 -- (-331.845) [-326.251] (-329.077) (-324.497) * [-325.469] (-323.672) (-324.110) (-329.393) -- 0:00:01
976500 -- [-325.237] (-325.075) (-329.354) (-327.342) * [-325.776] (-324.058) (-323.765) (-323.679) -- 0:00:01
977000 -- (-324.733) [-324.657] (-325.332) (-330.332) * (-327.897) [-327.960] (-326.133) (-325.386) -- 0:00:01
977500 -- (-324.925) (-325.117) (-324.149) [-325.430] * (-328.505) (-329.525) (-326.925) [-325.243] -- 0:00:01
978000 -- (-326.212) (-325.011) [-324.809] (-324.703) * (-331.628) [-329.178] (-325.006) (-324.859) -- 0:00:01
978500 -- (-327.756) (-323.791) (-326.361) [-325.704] * (-327.510) (-328.331) (-326.399) [-329.488] -- 0:00:01
979000 -- (-327.147) (-323.957) [-326.908] (-327.647) * (-324.826) (-325.994) [-325.487] (-327.822) -- 0:00:01
979500 -- (-327.744) [-326.448] (-324.701) (-328.490) * (-326.765) (-324.952) (-325.695) [-326.101] -- 0:00:01
980000 -- [-325.003] (-325.101) (-327.430) (-327.283) * (-327.315) (-326.037) [-323.773] (-324.456) -- 0:00:01
Average standard deviation of split frequencies: 0.005672
980500 -- [-325.845] (-325.170) (-325.913) (-327.193) * (-325.352) (-326.873) (-324.510) [-324.691] -- 0:00:01
981000 -- (-323.787) (-325.585) [-328.242] (-324.821) * (-327.800) [-326.166] (-324.811) (-324.511) -- 0:00:01
981500 -- [-324.727] (-324.765) (-331.207) (-325.292) * (-333.177) (-323.978) (-325.543) [-323.784] -- 0:00:01
982000 -- (-326.276) [-323.832] (-325.902) (-324.141) * (-330.404) [-325.600] (-327.022) (-324.593) -- 0:00:01
982500 -- (-326.639) [-324.369] (-327.753) (-323.964) * (-324.616) [-326.686] (-330.992) (-326.194) -- 0:00:01
983000 -- (-325.143) (-324.165) (-324.552) [-327.104] * (-329.529) [-326.466] (-332.951) (-325.917) -- 0:00:01
983500 -- [-325.925] (-324.600) (-325.307) (-325.160) * (-326.420) [-325.464] (-330.652) (-327.389) -- 0:00:00
984000 -- (-328.821) (-327.392) (-325.264) [-326.580] * [-325.277] (-323.892) (-324.685) (-324.798) -- 0:00:00
984500 -- (-329.673) (-328.797) [-323.592] (-332.485) * (-326.160) [-324.173] (-325.140) (-323.807) -- 0:00:00
985000 -- (-326.204) (-327.883) (-327.481) [-328.623] * (-325.775) (-327.836) (-324.593) [-328.071] -- 0:00:00
Average standard deviation of split frequencies: 0.006120
985500 -- (-326.081) (-324.929) [-324.829] (-327.558) * (-326.571) (-327.253) (-327.953) [-326.100] -- 0:00:00
986000 -- (-323.922) [-326.318] (-328.416) (-325.372) * [-325.301] (-326.330) (-324.671) (-324.601) -- 0:00:00
986500 -- [-323.405] (-325.363) (-330.393) (-324.948) * [-325.277] (-324.499) (-325.329) (-325.823) -- 0:00:00
987000 -- (-323.414) [-324.827] (-326.123) (-330.948) * (-325.976) (-325.141) [-325.106] (-325.191) -- 0:00:00
987500 -- (-325.389) (-324.519) (-325.422) [-325.130] * [-324.277] (-327.479) (-326.404) (-325.394) -- 0:00:00
988000 -- (-323.340) [-329.194] (-327.781) (-325.081) * [-326.068] (-324.945) (-325.286) (-326.764) -- 0:00:00
988500 -- (-325.123) [-326.958] (-323.457) (-323.967) * (-325.937) [-327.570] (-325.280) (-331.738) -- 0:00:00
989000 -- (-326.595) [-330.180] (-324.358) (-324.419) * (-325.656) [-325.571] (-325.464) (-324.867) -- 0:00:00
989500 -- (-325.728) (-324.211) (-324.362) [-324.420] * (-327.364) (-324.621) (-329.058) [-324.849] -- 0:00:00
990000 -- (-325.338) (-325.827) [-324.698] (-326.115) * (-329.311) (-324.943) (-328.827) [-325.685] -- 0:00:00
Average standard deviation of split frequencies: 0.006249
990500 -- (-325.171) (-325.905) (-327.430) [-326.981] * (-326.577) [-324.655] (-326.126) (-325.682) -- 0:00:00
991000 -- (-326.173) (-324.972) [-323.996] (-325.579) * (-323.975) [-326.779] (-325.255) (-327.095) -- 0:00:00
991500 -- [-326.653] (-324.054) (-327.001) (-324.282) * (-325.656) (-324.115) (-324.524) [-327.633] -- 0:00:00
992000 -- (-326.800) (-326.741) [-324.089] (-327.319) * (-330.869) [-328.021] (-325.217) (-328.529) -- 0:00:00
992500 -- (-328.558) [-324.675] (-328.812) (-327.315) * (-325.572) (-326.823) [-324.005] (-326.138) -- 0:00:00
993000 -- (-326.197) (-328.959) (-328.821) [-326.083] * (-324.849) (-323.852) (-326.299) [-324.678] -- 0:00:00
993500 -- (-327.274) [-325.533] (-328.020) (-326.824) * (-324.533) (-326.124) [-326.238] (-324.298) -- 0:00:00
994000 -- (-325.143) (-324.303) (-327.519) [-325.400] * (-325.494) (-324.300) [-323.829] (-324.392) -- 0:00:00
994500 -- (-327.919) [-325.770] (-328.414) (-325.473) * [-325.214] (-326.272) (-325.980) (-327.244) -- 0:00:00
995000 -- (-325.049) [-331.095] (-324.947) (-329.927) * (-325.726) [-327.515] (-326.057) (-325.375) -- 0:00:00
Average standard deviation of split frequencies: 0.005806
995500 -- (-325.347) (-325.799) (-325.919) [-330.025] * (-325.514) (-325.200) (-328.351) [-326.106] -- 0:00:00
996000 -- (-327.520) (-330.841) [-324.722] (-325.118) * (-324.681) (-325.469) [-324.767] (-326.431) -- 0:00:00
996500 -- (-326.572) [-324.751] (-324.661) (-327.723) * (-326.395) (-325.474) [-326.458] (-325.635) -- 0:00:00
997000 -- (-330.544) (-327.430) [-327.596] (-324.350) * (-326.418) (-325.523) (-327.204) [-324.523] -- 0:00:00
997500 -- [-327.521] (-326.911) (-324.506) (-325.916) * (-324.980) (-324.952) [-323.703] (-324.819) -- 0:00:00
998000 -- [-325.483] (-325.173) (-324.292) (-323.698) * (-324.535) (-325.809) [-324.756] (-326.342) -- 0:00:00
998500 -- (-325.014) (-325.598) (-325.200) [-327.965] * (-326.215) (-323.467) [-327.216] (-327.898) -- 0:00:00
999000 -- (-325.484) [-326.993] (-330.936) (-324.299) * (-325.060) [-323.832] (-324.752) (-324.205) -- 0:00:00
999500 -- [-325.328] (-327.057) (-324.867) (-327.465) * (-323.741) (-325.313) (-326.169) [-323.964] -- 0:00:00
1000000 -- [-324.968] (-326.652) (-326.879) (-327.700) * (-326.480) [-325.102] (-328.235) (-325.025) -- 0:00:00
Average standard deviation of split frequencies: 0.005370
Analysis completed in 59 seconds
Analysis used 58.24 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -323.19
Likelihood of best state for "cold" chain of run 2 was -323.19
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
74.6 % ( 70 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
44.5 % ( 32 %) Dirichlet(Pi{all})
40.6 % ( 16 %) Slider(Pi{all})
78.8 % ( 52 %) Multiplier(Alpha{1,2})
77.4 % ( 47 %) Multiplier(Alpha{3})
26.7 % ( 28 %) Slider(Pinvar{all})
98.6 % ( 98 %) ExtSPR(Tau{all},V{all})
70.2 % ( 66 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.5 % ( 87 %) ParsSPR(Tau{all},V{all})
28.2 % ( 28 %) Multiplier(V{all})
97.5 % ( 98 %) Nodeslider(V{all})
30.8 % ( 27 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
75.3 % ( 75 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
44.2 % ( 33 %) Dirichlet(Pi{all})
41.7 % ( 25 %) Slider(Pi{all})
79.4 % ( 58 %) Multiplier(Alpha{1,2})
77.2 % ( 45 %) Multiplier(Alpha{3})
26.4 % ( 18 %) Slider(Pinvar{all})
98.6 % (100 %) ExtSPR(Tau{all},V{all})
70.1 % ( 72 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.5 % ( 94 %) ParsSPR(Tau{all},V{all})
28.2 % ( 27 %) Multiplier(V{all})
97.4 % (100 %) Nodeslider(V{all})
30.4 % ( 18 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.81 0.64 0.50
2 | 166933 0.82 0.67
3 | 165846 166356 0.84
4 | 167016 166531 167318
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.81 0.64 0.50
2 | 166596 0.82 0.67
3 | 167232 166895 0.84
4 | 166943 166333 166001
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p and /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p
Writing summary statistics to file /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -324.82
| 1 |
| |
|1 1 1 2 2 1 |
| 1 1 1 2 1 11 2 2 1 |
| * 2 122 2 * 11 |
|2 221 2 2 * 2 11 2 2 2 2 2 2 * 1 2*2 2|
| * 2 2 1 111 1 2 1 1 |
| 1 21 22 2 1 *2211 * 1 1 |
| 2 1 212 2 1 ** 2 2 2 |
| 1 1 1 2 1 *2 1 2 1 22 1 |
| 2 2 2 1 2 |
| 1 1 1|
| |
| 1 |
| 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -326.85
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -324.94 -328.80
2 -324.95 -327.78
--------------------------------------
TOTAL -324.95 -328.42
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.887209 0.090465 0.352460 1.476372 0.849804 993.38 1247.19 1.000
r(A<->C){all} 0.173552 0.020928 0.000263 0.468217 0.137900 194.48 215.61 1.002
r(A<->G){all} 0.166515 0.018581 0.000108 0.433975 0.132206 164.67 216.61 1.007
r(A<->T){all} 0.166941 0.019281 0.000037 0.436188 0.130960 198.86 253.96 1.002
r(C<->G){all} 0.164789 0.019328 0.000024 0.451642 0.129558 184.44 273.50 1.001
r(C<->T){all} 0.170980 0.020244 0.000097 0.459726 0.135404 123.01 176.20 1.005
r(G<->T){all} 0.157224 0.018738 0.000079 0.440051 0.119406 153.41 183.16 1.002
pi(A){all} 0.168067 0.000576 0.124834 0.218742 0.166817 971.99 1108.09 1.000
pi(C){all} 0.250533 0.000727 0.199461 0.304236 0.250254 1258.91 1299.89 1.000
pi(G){all} 0.360351 0.000955 0.297933 0.419834 0.359864 1228.98 1274.09 1.000
pi(T){all} 0.221049 0.000728 0.171992 0.277887 0.220423 1098.75 1185.64 1.001
alpha{1,2} 0.406566 0.217145 0.000227 1.351545 0.238813 1069.03 1207.71 1.000
alpha{3} 0.450518 0.234719 0.000104 1.437480 0.283600 1157.19 1169.23 1.001
pinvar{all} 0.992967 0.000073 0.977878 0.999999 0.995671 1205.83 1276.10 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a paramiter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
5 -- C5
6 -- C6
Key to taxon bipartitions (saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.parts"):
ID -- Partition
------------
1 -- .*****
2 -- .*....
3 -- ..*...
4 -- ...*..
5 -- ....*.
6 -- .....*
7 -- .*...*
8 -- .***.*
9 -- ..**..
10 -- .*.***
11 -- ..****
12 -- ...*.*
13 -- .*.*..
14 -- ....**
15 -- .**.**
16 -- ...**.
17 -- .****.
18 -- ..*.*.
19 -- .*..*.
20 -- .**...
21 -- ..*..*
------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
7 467 0.155563 0.002355 0.153897 0.157229 2
8 445 0.148235 0.008009 0.142572 0.153897 2
9 445 0.148235 0.005182 0.144570 0.151899 2
10 444 0.147901 0.000000 0.147901 0.147901 2
11 439 0.146236 0.013662 0.136576 0.155896 2
12 430 0.143238 0.009422 0.136576 0.149900 2
13 429 0.142905 0.003298 0.140573 0.145237 2
14 425 0.141572 0.000471 0.141239 0.141905 2
15 423 0.140906 0.002355 0.139241 0.142572 2
16 422 0.140573 0.000942 0.139907 0.141239 2
17 420 0.139907 0.009422 0.133245 0.146569 2
18 419 0.139574 0.004240 0.136576 0.142572 2
19 419 0.139574 0.000471 0.139241 0.139907 2
20 419 0.139574 0.008009 0.133911 0.145237 2
21 411 0.136909 0.012719 0.127915 0.145903 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.097985 0.009684 0.000014 0.292463 0.067419 1.001 2
length{all}[2] 0.098939 0.009843 0.000043 0.292510 0.068841 1.000 2
length{all}[3] 0.099617 0.010117 0.000073 0.296929 0.068001 1.000 2
length{all}[4] 0.102318 0.011147 0.000020 0.308501 0.069862 1.000 2
length{all}[5] 0.097891 0.009465 0.000006 0.295670 0.068611 1.000 2
length{all}[6] 0.098393 0.009423 0.000086 0.297362 0.069076 1.000 2
length{all}[7] 0.100311 0.009885 0.000140 0.316666 0.070926 0.998 2
length{all}[8] 0.092906 0.008873 0.000038 0.298888 0.062866 0.998 2
length{all}[9] 0.098482 0.009240 0.000484 0.270037 0.070011 1.003 2
length{all}[10] 0.093147 0.008693 0.000284 0.285213 0.063976 1.002 2
length{all}[11] 0.092970 0.008668 0.000030 0.274608 0.062138 0.998 2
length{all}[12] 0.091579 0.008366 0.000430 0.258518 0.064614 1.002 2
length{all}[13] 0.095857 0.008268 0.000717 0.266973 0.071116 1.003 2
length{all}[14] 0.087889 0.007690 0.000463 0.257698 0.059881 0.998 2
length{all}[15] 0.091572 0.008306 0.000218 0.267988 0.067551 1.007 2
length{all}[16] 0.104623 0.010383 0.000656 0.324569 0.072180 0.999 2
length{all}[17] 0.101823 0.008495 0.000087 0.271819 0.076640 1.010 2
length{all}[18] 0.097421 0.009687 0.000283 0.303259 0.061317 0.999 2
length{all}[19] 0.100078 0.010503 0.000858 0.297099 0.068697 1.000 2
length{all}[20] 0.100336 0.010821 0.000748 0.307045 0.061039 0.998 2
length{all}[21] 0.100331 0.008825 0.000305 0.297662 0.071303 1.004 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.005370
Maximum standard deviation of split frequencies = 0.013662
Average PSRF for parameter values ( excluding NA and >10.0 ) = 1.001
Maximum PSRF for parameter values = 1.010
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|------------------------------------------------------------------------ C5 (5)
|
\------------------------------------------------------------------------ C6 (6)
Phylogram (based on average branch lengths):
/--------------------------------------------------------------------- C1 (1)
|
|----------------------------------------------------------------------- C2 (2)
|
|---------------------------------------------------------------------- C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|----------------------------------------------------------------------- C5 (5)
|
\----------------------------------------------------------------------- C6 (6)
|---------| 0.010 expected changes per site
Calculating tree probabilities...
Credible sets of trees (105 trees sampled):
50 % credible set contains 45 trees
90 % credible set contains 91 trees
95 % credible set contains 98 trees
99 % credible set contains 104 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
MrBayes output code: 0
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 0 1 2 7 8
seq file is not paml/phylip format. Trying nexus format.ns = 6 ls = 240
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Sequences read..
Counting site patterns.. 0:00
Compressing, 34 patterns at 80 / 80 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 34 patterns at 80 / 80 sites (100.0%), 0:00
Counting codons..
120 bytes for distance
33184 bytes for conP
2992 bytes for fhK
5000000 bytes for space
Model 0: one-ratio
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.082956 0.042268 0.031518 0.064221 0.076097 0.068991 0.300000 1.300000
ntime & nrate & np: 6 2 8
Bounds (np=8):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000100
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 999.000000
np = 8
lnL0 = -321.933356
Iterating by ming2
Initial: fx= 321.933356
x= 0.08296 0.04227 0.03152 0.06422 0.07610 0.06899 0.30000 1.30000
1 h-m-p 0.0000 0.0004 192.0958 +++ 307.152252 m 0.0004 14 | 1/8
2 h-m-p 0.0039 0.0338 18.1054 ------------.. | 1/8
3 h-m-p 0.0000 0.0001 176.3979 ++ 302.900304 m 0.0001 46 | 2/8
4 h-m-p 0.0015 0.0766 14.0523 -----------.. | 2/8
5 h-m-p 0.0000 0.0003 157.9411 +++ 295.894281 m 0.0003 78 | 3/8
6 h-m-p 0.0034 0.2444 11.2221 ------------.. | 3/8
7 h-m-p 0.0000 0.0001 137.3846 ++ 294.743388 m 0.0001 110 | 4/8
8 h-m-p 0.0160 8.0000 8.6777 -------------.. | 4/8
9 h-m-p 0.0000 0.0001 112.2066 ++ 293.597477 m 0.0001 143 | 5/8
10 h-m-p 0.0160 8.0000 5.9769 -------------.. | 5/8
11 h-m-p 0.0000 0.0001 79.4096 ++ 293.042599 m 0.0001 176 | 6/8
12 h-m-p 0.1985 8.0000 0.0000 +++ 293.042599 m 8.0000 188 | 6/8
13 h-m-p 0.6753 8.0000 0.0000 ++ 293.042599 m 8.0000 201 | 6/8
14 h-m-p 0.0021 1.0303 0.2986 -----C 293.042599 0 0.0000 219 | 6/8
15 h-m-p 0.0160 8.0000 0.0000 -------------.. | 6/8
16 h-m-p 0.0160 8.0000 0.0000 +++++ 293.042599 m 8.0000 259 | 6/8
17 h-m-p 0.0160 8.0000 0.8766 +++++ 293.042571 m 8.0000 275 | 6/8
18 h-m-p 1.6000 8.0000 1.1463 ++ 293.042561 m 8.0000 288 | 6/8
19 h-m-p 1.2432 8.0000 7.3763 ++ 293.042550 m 8.0000 299 | 6/8
20 h-m-p 1.6000 8.0000 4.7016 ++ 293.042549 m 8.0000 310 | 6/8
21 h-m-p 0.2579 6.3838 145.8638 +++ 293.042546 m 6.3838 322 | 6/8
22 h-m-p 1.6000 8.0000 22.1874 --------Y 293.042546 0 0.0000 341 | 6/8
23 h-m-p 1.2476 8.0000 0.0001 ---------------C 293.042546 0 0.0000 367
Out..
lnL = -293.042546
368 lfun, 368 eigenQcodon, 2208 P(t)
Time used: 0:01
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.044879 0.073863 0.060830 0.019168 0.043532 0.040399 307.686009 0.577810 0.444669
ntime & nrate & np: 6 2 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 0.054393
np = 9
lnL0 = -315.151697
Iterating by ming2
Initial: fx= 315.151697
x= 0.04488 0.07386 0.06083 0.01917 0.04353 0.04040 307.68601 0.57781 0.44467
1 h-m-p 0.0000 0.0002 187.7795 +++ 306.412020 m 0.0002 15 | 1/9
2 h-m-p 0.0017 0.0179 25.3717 ++ 302.393852 m 0.0179 27 | 2/9
3 h-m-p 0.0024 0.0122 3.7298 ++ 298.294302 m 0.0122 39 | 3/9
4 h-m-p 0.0002 0.0010 34.5082 ++ 296.651978 m 0.0010 51 | 4/9
5 h-m-p 0.0001 0.0003 25.3113 ++ 295.743782 m 0.0003 63 | 5/9
6 h-m-p 0.0000 0.0001 12.4626 ++ 295.711083 m 0.0001 75 | 6/9
7 h-m-p 0.0002 0.0807 6.1201 ----------.. | 6/9
8 h-m-p 0.0000 0.0004 77.7406 +++ 293.042625 m 0.0004 108 | 7/9
9 h-m-p 1.6000 8.0000 0.0000 ++ 293.042625 m 8.0000 120 | 6/9
10 h-m-p 0.0160 8.0000 0.0014 +++++ 293.042624 m 8.0000 137 | 6/9
11 h-m-p 0.0275 1.2829 0.4020 +++ 293.042599 m 1.2829 153 | 7/9
12 h-m-p 1.6000 8.0000 0.0000 Y 293.042599 0 2.9310 168 | 7/9
13 h-m-p 1.6000 8.0000 0.0000 C 293.042599 0 1.6000 182 | 7/9
14 h-m-p 1.0089 8.0000 0.0000 -Y 293.042599 0 0.1156 197
Out..
lnL = -293.042599
198 lfun, 594 eigenQcodon, 2376 P(t)
Time used: 0:02
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.098927 0.085900 0.060122 0.061106 0.032751 0.102467 307.678470 0.859977 0.373507 0.399094 1044.920824
ntime & nrate & np: 6 3 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 0.000347
np = 11
lnL0 = -306.887510
Iterating by ming2
Initial: fx= 306.887510
x= 0.09893 0.08590 0.06012 0.06111 0.03275 0.10247 307.67847 0.85998 0.37351 0.39909 951.42857
1 h-m-p 0.0000 0.0026 27.5439 +++++ 304.191017 m 0.0026 19 | 1/11
2 h-m-p 0.0068 0.1081 9.2912 ++ 296.675519 m 0.1081 33 | 2/11
3 h-m-p 0.0000 0.0000 58977.3717 ++ 296.527896 m 0.0000 47 | 3/11
4 h-m-p 0.0000 0.0000 5408.1811 ++ 296.008936 m 0.0000 61 | 4/11
5 h-m-p 0.0005 0.0023 274.7445 ++ 293.372590 m 0.0023 75 | 5/11
6 h-m-p 0.0003 0.0013 180.1144 ++ 293.042547 m 0.0013 89 | 6/11
7 h-m-p 1.6000 8.0000 0.0000 ++ 293.042547 m 8.0000 103 | 6/11
8 h-m-p 0.0374 8.0000 0.0027 ++++ 293.042547 m 8.0000 124 | 6/11
9 h-m-p 0.0161 8.0000 1.3338 +++++ 293.042546 m 8.0000 146 | 6/11
10 h-m-p 1.6000 8.0000 0.4536 ++ 293.042546 m 8.0000 160 | 6/11
11 h-m-p 1.6000 8.0000 0.0640 ++ 293.042546 m 8.0000 179 | 6/11
12 h-m-p 1.6000 8.0000 0.1393 ----C 293.042546 0 0.0016 202 | 6/11
13 h-m-p 1.6000 8.0000 0.0001 --------Y 293.042546 0 0.0000 229 | 6/11
14 h-m-p 0.3479 8.0000 0.0000 ---Y 293.042546 0 0.0014 251
Out..
lnL = -293.042546
252 lfun, 1008 eigenQcodon, 4536 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -293.040696 S = -293.040691 -0.000002
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 34 patterns 0:03
did 20 / 34 patterns 0:03
did 30 / 34 patterns 0:03
did 34 / 34 patterns 0:03
Time used: 0:03
Model 7: beta
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.054831 0.051543 0.059100 0.102557 0.103688 0.050891 307.677986 1.010398 1.390771
ntime & nrate & np: 6 1 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 0.068387
np = 9
lnL0 = -325.677480
Iterating by ming2
Initial: fx= 325.677480
x= 0.05483 0.05154 0.05910 0.10256 0.10369 0.05089 307.67799 1.01040 1.39077
1 h-m-p 0.0000 0.0007 181.6855 ++++ 302.664886 m 0.0007 16 | 1/9
2 h-m-p 0.0226 0.2381 4.9538 -------------.. | 1/9
3 h-m-p 0.0000 0.0000 175.8348 ++ 302.402858 m 0.0000 51 | 2/9
4 h-m-p 0.0014 0.6785 2.6839 -----------.. | 2/9
5 h-m-p 0.0000 0.0000 156.6878 ++ 301.350560 m 0.0000 84 | 3/9
6 h-m-p 0.0025 0.8707 2.2695 ------------.. | 3/9
7 h-m-p 0.0000 0.0001 135.2780 ++ 300.329505 m 0.0001 118 | 4/9
8 h-m-p 0.0034 1.2408 1.7998 ------------.. | 4/9
9 h-m-p 0.0000 0.0006 109.6269 +++ 293.141492 m 0.0006 153 | 5/9
10 h-m-p 0.0289 1.4944 1.5705 --------------.. | 5/9
11 h-m-p 0.0000 0.0000 80.7584 ++ 293.042630 m 0.0000 189 | 6/9
12 h-m-p 0.1429 8.0000 0.0000 Y 293.042630 0 0.1429 201 | 6/9
13 h-m-p 0.4965 8.0000 0.0000 N 293.042630 0 0.4965 216
Out..
lnL = -293.042630
217 lfun, 2387 eigenQcodon, 13020 P(t)
Time used: 0:06
Model 8: beta&w>1
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.028500 0.078038 0.051761 0.076338 0.103125 0.027815 307.677986 0.900000 0.929273 1.181492 998.999871
ntime & nrate & np: 6 2 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 0.000716
np = 11
lnL0 = -300.454254
Iterating by ming2
Initial: fx= 300.454254
x= 0.02850 0.07804 0.05176 0.07634 0.10312 0.02782 307.67799 0.90000 0.92927 1.18149 951.42857
1 h-m-p 0.0000 0.0017 59.6404 +++YCYYCCCC 295.918866 7 0.0014 31 | 0/11
2 h-m-p 0.0008 0.0039 12.0441 ++ 295.343542 m 0.0039 45 | 1/11
3 h-m-p 0.0007 0.0035 15.2031 ++ 294.848515 m 0.0035 59 | 2/11
4 h-m-p 0.0011 0.0056 4.2265 ++ 294.644255 m 0.0056 73 | 3/11
5 h-m-p 0.0070 0.0348 1.3174 ++ 294.463181 m 0.0348 87 | 4/11
6 h-m-p 0.0008 0.0040 8.5195 ++ 294.043614 m 0.0040 101 | 5/11
7 h-m-p 0.2113 8.0000 0.0941 ---------------.. | 5/11
8 h-m-p 0.0000 0.0008 27.2827 +++YYYCCCC 293.693928 6 0.0006 160 | 5/11
9 h-m-p 0.0004 0.0018 15.9772 ++ 293.042561 m 0.0018 174 | 6/11
10 h-m-p 1.6000 8.0000 0.0001 --------Y 293.042561 0 0.0000 196
Out..
lnL = -293.042561
197 lfun, 2364 eigenQcodon, 13002 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -293.042353 S = -293.040982 -0.000600
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 34 patterns 0:10
did 20 / 34 patterns 0:10
did 30 / 34 patterns 0:10
did 34 / 34 patterns 0:10
Time used: 0:10
CodeML output code: -1
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=80
NC_011896_1_WP_010908436_1_1715_MLBR_RS08115 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
NC_002677_1_NP_302115_1_987_ML1617 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
**************************************************
NC_011896_1_WP_010908436_1_1715_MLBR_RS08115 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
NC_002677_1_NP_302115_1_987_ML1617 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090 RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
******************************
>NC_011896_1_WP_010908436_1_1715_MLBR_RS08115 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG >NC_002677_1_NP_302115_1_987_ML1617 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG >NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG >NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG >NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG >NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090 ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>NC_011896_1_WP_010908436_1_1715_MLBR_RS08115 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG RGGRTATALRKLVAGIGGRGIRVDVVDTDQ >NC_002677_1_NP_302115_1_987_ML1617 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG RGGRTATALRKLVAGIGGRGIRVDVVDTDQ >NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG RGGRTATALRKLVAGIGGRGIRVDVVDTDQ >NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG RGGRTATALRKLVAGIGGRGIRVDVVDTDQ >NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG RGGRTATALRKLVAGIGGRGIRVDVVDTDQ >NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090 MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
#NEXUS
[ID: 5415670298]
begin taxa;
dimensions ntax=6;
taxlabels
NC_011896_1_WP_010908436_1_1715_MLBR_RS08115
NC_002677_1_NP_302115_1_987_ML1617
NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850
NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445
NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875
NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090
;
end;
begin trees;
translate
1 NC_011896_1_WP_010908436_1_1715_MLBR_RS08115,
2 NC_002677_1_NP_302115_1_987_ML1617,
3 NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850,
4 NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445,
5 NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875,
6 NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:0.06741905,2:0.06884082,3:0.06800137,4:0.06986179,5:0.06861086,6:0.06907618);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:0.06741905,2:0.06884082,3:0.06800137,4:0.06986179,5:0.06861086,6:0.06907618);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -324.94 -328.80
2 -324.95 -327.78
--------------------------------------
TOTAL -324.95 -328.42
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.887209 0.090465 0.352460 1.476372 0.849804 993.38 1247.19 1.000
r(A<->C){all} 0.173552 0.020928 0.000263 0.468217 0.137900 194.48 215.61 1.002
r(A<->G){all} 0.166515 0.018581 0.000108 0.433975 0.132206 164.67 216.61 1.007
r(A<->T){all} 0.166941 0.019281 0.000037 0.436188 0.130960 198.86 253.96 1.002
r(C<->G){all} 0.164789 0.019328 0.000024 0.451642 0.129558 184.44 273.50 1.001
r(C<->T){all} 0.170980 0.020244 0.000097 0.459726 0.135404 123.01 176.20 1.005
r(G<->T){all} 0.157224 0.018738 0.000079 0.440051 0.119406 153.41 183.16 1.002
pi(A){all} 0.168067 0.000576 0.124834 0.218742 0.166817 971.99 1108.09 1.000
pi(C){all} 0.250533 0.000727 0.199461 0.304236 0.250254 1258.91 1299.89 1.000
pi(G){all} 0.360351 0.000955 0.297933 0.419834 0.359864 1228.98 1274.09 1.000
pi(T){all} 0.221049 0.000728 0.171992 0.277887 0.220423 1098.75 1185.64 1.001
alpha{1,2} 0.406566 0.217145 0.000227 1.351545 0.238813 1069.03 1207.71 1.000
alpha{3} 0.450518 0.234719 0.000104 1.437480 0.283600 1157.19 1169.23 1.001
pinvar{all} 0.992967 0.000073 0.977878 0.999999 0.995671 1205.83 1276.10 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
CODONML (in paml version 4.9h, March 2018) /data/7res/ML1617/batch/allfiles/codeml/input.fasta.fasta.pnxs
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 6 ls = 80
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 0 0 0 0 0 0 | Ser TCT 0 0 0 0 0 0 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 0 0 0 0 0 0 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 0 0 0 0 0 0 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 2 2 2 2 2 2 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 0 0 0 0 0 0 | Pro CCT 0 0 0 0 0 0 | His CAT 3 3 3 3 3 3 | Arg CGT 3 3 3 3 3 3
CTC 0 0 0 0 0 0 | CCC 1 1 1 1 1 1 | CAC 0 0 0 0 0 0 | CGC 5 5 5 5 5 5
CTA 0 0 0 0 0 0 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 2 2 2 2 2 2 | CCG 1 1 1 1 1 1 | CAG 1 1 1 1 1 1 | CGG 2 2 2 2 2 2
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 1 1 1 1 1 1 | Thr ACT 2 2 2 2 2 2 | Asn AAT 1 1 1 1 1 1 | Ser AGT 2 2 2 2 2 2
ATC 4 4 4 4 4 4 | ACC 2 2 2 2 2 2 | AAC 0 0 0 0 0 0 | AGC 0 0 0 0 0 0
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 0 0 0 0 0 0 | Arg AGA 0 0 0 0 0 0
Met ATG 1 1 1 1 1 1 | ACG 1 1 1 1 1 1 | AAG 2 2 2 2 2 2 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 2 2 2 2 2 2 | Ala GCT 1 1 1 1 1 1 | Asp GAT 4 4 4 4 4 4 | Gly GGT 4 4 4 4 4 4
GTC 10 10 10 10 10 10 | GCC 1 1 1 1 1 1 | GAC 6 6 6 6 6 6 | GGC 2 2 2 2 2 2
GTA 1 1 1 1 1 1 | GCA 1 1 1 1 1 1 | Glu GAA 1 1 1 1 1 1 | GGA 2 2 2 2 2 2
GTG 5 5 5 5 5 5 | GCG 1 1 1 1 1 1 | GAG 1 1 1 1 1 1 | GGG 2 2 2 2 2 2
--------------------------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: NC_011896_1_WP_010908436_1_1715_MLBR_RS08115
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
#2: NC_002677_1_NP_302115_1_987_ML1617
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
#3: NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
#4: NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
#5: NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
#6: NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 0 | Ser S TCT 0 | Tyr Y TAT 0 | Cys C TGT 0
TTC 0 | TCC 0 | TAC 0 | TGC 0
Leu L TTA 0 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 12 | TCG 0 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 0 | Pro P CCT 0 | His H CAT 18 | Arg R CGT 18
CTC 0 | CCC 6 | CAC 0 | CGC 30
CTA 0 | CCA 0 | Gln Q CAA 0 | CGA 0
CTG 12 | CCG 6 | CAG 6 | CGG 12
------------------------------------------------------------------------------
Ile I ATT 6 | Thr T ACT 12 | Asn N AAT 6 | Ser S AGT 12
ATC 24 | ACC 12 | AAC 0 | AGC 0
ATA 0 | ACA 0 | Lys K AAA 0 | Arg R AGA 0
Met M ATG 6 | ACG 6 | AAG 12 | AGG 0
------------------------------------------------------------------------------
Val V GTT 12 | Ala A GCT 6 | Asp D GAT 24 | Gly G GGT 24
GTC 60 | GCC 6 | GAC 36 | GGC 12
GTA 6 | GCA 6 | Glu E GAA 6 | GGA 12
GTG 30 | GCG 6 | GAG 6 | GGG 12
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.02500 C:0.22500 A:0.20000 G:0.55000
position 2: T:0.35000 C:0.13750 A:0.23750 G:0.27500
position 3: T:0.28750 C:0.38750 A:0.06250 G:0.26250
Average T:0.22083 C:0.25000 A:0.16667 G:0.36250
Model 0: one-ratio
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 8): -293.042546 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 307.686009 998.999871
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908436_1_1715_MLBR_RS08115: 0.000004, NC_002677_1_NP_302115_1_987_ML1617: 0.000004, NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850: 0.000004, NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445: 0.000004, NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875: 0.000004, NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 307.68601
omega (dN/dS) = 998.99987
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 151.2 88.8 998.9999 0.0000 0.0000 0.0 0.0
7..2 0.000 151.2 88.8 998.9999 0.0000 0.0000 0.0 0.0
7..3 0.000 151.2 88.8 998.9999 0.0000 0.0000 0.0 0.0
7..4 0.000 151.2 88.8 998.9999 0.0000 0.0000 0.0 0.0
7..5 0.000 151.2 88.8 998.9999 0.0000 0.0000 0.0 0.0
7..6 0.000 151.2 88.8 998.9999 0.0000 0.0000 0.0 0.0
tree length for dN: 0.0000
tree length for dS: 0.0000
Time used: 0:01
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -293.042599 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 307.678470 0.000010 0.118777
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908436_1_1715_MLBR_RS08115: 0.000004, NC_002677_1_NP_302115_1_987_ML1617: 0.000004, NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850: 0.000004, NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445: 0.000004, NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875: 0.000004, NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 307.67847
MLEs of dN/dS (w) for site classes (K=2)
p: 0.00001 0.99999
w: 0.11878 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 151.2 88.8 1.0000 0.0000 0.0000 0.0 0.0
7..2 0.000 151.2 88.8 1.0000 0.0000 0.0000 0.0 0.0
7..3 0.000 151.2 88.8 1.0000 0.0000 0.0000 0.0 0.0
7..4 0.000 151.2 88.8 1.0000 0.0000 0.0000 0.0 0.0
7..5 0.000 151.2 88.8 1.0000 0.0000 0.0000 0.0 0.0
7..6 0.000 151.2 88.8 1.0000 0.0000 0.0000 0.0 0.0
Time used: 0:02
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -293.042546 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 307.677986 0.000015 0.001104 0.530121 951.428892
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908436_1_1715_MLBR_RS08115: 0.000004, NC_002677_1_NP_302115_1_987_ML1617: 0.000004, NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850: 0.000004, NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445: 0.000004, NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875: 0.000004, NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 307.67799
MLEs of dN/dS (w) for site classes (K=3)
p: 0.00001 0.00110 0.99888
w: 0.53012 1.00000 951.42889
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 151.2 88.8 950.3659 0.0000 0.0000 0.0 0.0
7..2 0.000 151.2 88.8 950.3659 0.0000 0.0000 0.0 0.0
7..3 0.000 151.2 88.8 950.3659 0.0000 0.0000 0.0 0.0
7..4 0.000 151.2 88.8 950.3659 0.0000 0.0000 0.0 0.0
7..5 0.000 151.2 88.8 950.3659 0.0000 0.0000 0.0 0.0
7..6 0.000 151.2 88.8 950.3659 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908436_1_1715_MLBR_RS08115)
Pr(w>1) post mean +- SE for w
1 M 0.999** 950.366
2 S 0.999** 950.366
3 T 0.999** 950.366
4 V 0.999** 950.366
5 V 0.999** 950.366
6 V 0.999** 950.366
7 D 0.999** 950.366
8 A 0.999** 950.366
9 V 0.999** 950.366
10 E 0.999** 950.366
11 H 0.999** 950.366
12 V 0.999** 950.366
13 V 0.999** 950.366
14 R 0.999** 950.366
15 G 0.999** 950.366
16 I 0.999** 950.366
17 V 0.999** 950.366
18 D 0.999** 950.366
19 N 0.999** 950.366
20 P 0.999** 950.366
21 D 0.999** 950.366
22 D 0.999** 950.366
23 V 0.999** 950.366
24 R 0.999** 950.366
25 V 0.999** 950.366
26 D 0.999** 950.366
27 L 0.999** 950.366
28 V 0.999** 950.366
29 I 0.999** 950.366
30 S 0.999** 950.366
31 R 0.999** 950.366
32 R 0.999** 950.366
33 G 0.999** 950.366
34 R 0.999** 950.366
35 T 0.999** 950.366
36 V 0.999** 950.366
37 E 0.999** 950.366
38 V 0.999** 950.366
39 H 0.999** 950.366
40 V 0.999** 950.366
41 H 0.999** 950.366
42 P 0.999** 950.366
43 D 0.999** 950.366
44 D 0.999** 950.366
45 L 0.999** 950.366
46 G 0.999** 950.366
47 K 0.999** 950.366
48 V 0.999** 950.366
49 I 0.999** 950.366
50 G 0.999** 950.366
51 R 0.999** 950.366
52 G 0.999** 950.366
53 G 0.999** 950.366
54 R 0.999** 950.366
55 T 0.999** 950.366
56 A 0.999** 950.366
57 T 0.999** 950.366
58 A 0.999** 950.366
59 L 0.999** 950.366
60 R 0.999** 950.366
61 K 0.999** 950.366
62 L 0.999** 950.366
63 V 0.999** 950.366
64 A 0.999** 950.366
65 G 0.999** 950.366
66 I 0.999** 950.366
67 G 0.999** 950.366
68 G 0.999** 950.366
69 R 0.999** 950.366
70 G 0.999** 950.366
71 I 0.999** 950.366
72 R 0.999** 950.366
73 V 0.999** 950.366
74 D 0.999** 950.366
75 V 0.999** 950.366
76 V 0.999** 950.366
77 D 0.999** 950.366
78 T 0.999** 950.366
79 D 0.999** 950.366
80 Q 0.999** 950.366
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908436_1_1715_MLBR_RS08115)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
w2: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.010
0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
sum of density on p0-p1 = 1.000000
Time used: 0:03
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -293.042630 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 307.677986 1.010262 1.390638
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908436_1_1715_MLBR_RS08115: 0.000004, NC_002677_1_NP_302115_1_987_ML1617: 0.000004, NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850: 0.000004, NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445: 0.000004, NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875: 0.000004, NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 307.67799
Parameters in M7 (beta):
p = 1.01026 q = 1.39064
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.03738 0.11260 0.18981 0.26966 0.35282 0.44016 0.53302 0.63361 0.74640 0.88499
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 151.2 88.8 0.4200 0.0000 0.0000 0.0 0.0
7..2 0.000 151.2 88.8 0.4200 0.0000 0.0000 0.0 0.0
7..3 0.000 151.2 88.8 0.4200 0.0000 0.0000 0.0 0.0
7..4 0.000 151.2 88.8 0.4200 0.0000 0.0000 0.0 0.0
7..5 0.000 151.2 88.8 0.4200 0.0000 0.0000 0.0 0.0
7..6 0.000 151.2 88.8 0.4200 0.0000 0.0000 0.0 0.0
Time used: 0:06
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -293.042561 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 307.677988 0.996519 0.919447 1.189198 951.428613
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010908436_1_1715_MLBR_RS08115: 0.000004, NC_002677_1_NP_302115_1_987_ML1617: 0.000004, NZ_LVXE01000006_1_WP_010908436_1_2338_A3216_RS03850: 0.000004, NZ_LYPH01000002_1_WP_010908436_1_308_A8144_RS01445: 0.000004, NZ_CP029543_1_WP_010908436_1_1745_DIJ64_RS08875: 0.000004, NZ_AP014567_1_WP_010908436_1_1788_JK2ML_RS09090: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 307.67799
Parameters in M8 (beta&w>1):
p0 = 0.99652 p = 0.91945 q = 1.18920
(p1 = 0.00348) w = 951.42861
MLEs of dN/dS (w) for site classes (K=11)
p: 0.09965 0.09965 0.09965 0.09965 0.09965 0.09965 0.09965 0.09965 0.09965 0.09965 0.00348
w: 0.03229 0.10748 0.18900 0.27525 0.36586 0.46098 0.56114 0.66749 0.78246 0.91317 951.42861
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 151.2 88.8 3.7458 0.0000 0.0000 0.0 0.0
7..2 0.000 151.2 88.8 3.7458 0.0000 0.0000 0.0 0.0
7..3 0.000 151.2 88.8 3.7458 0.0000 0.0000 0.0 0.0
7..4 0.000 151.2 88.8 3.7458 0.0000 0.0000 0.0 0.0
7..5 0.000 151.2 88.8 3.7458 0.0000 0.0000 0.0 0.0
7..6 0.000 151.2 88.8 3.7458 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908436_1_1715_MLBR_RS08115)
Pr(w>1) post mean +- SE for w
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010908436_1_1715_MLBR_RS08115)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
p : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
q : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
ws: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Time used: 0:10
Model 1: NearlyNeutral -293.042599 Model 2: PositiveSelection -293.042546 Model 0: one-ratio -293.042546 Model 7: beta -293.04263 Model 8: beta&w>1 -293.042561 Model 0 vs 1 1.059999999597494E-4 Model 2 vs 1 1.059999999597494E-4 Model 8 vs 7 1.37999999992644E-4
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
