--- EXPERIMENT NOTES




 --- EXPERIMENT PROPERTIES

#Fri Jan 24 09:06:30 GMT 2020
codeml.models=0 1 2 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=MUSCLE
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/7res/ML1617/input.fasta
input.names=
mrbayes.params=
codeml.params=



 --- PSRF SUMMARY

      Estimated marginal likelihoods for runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)

(Values are saved to the file /data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)

Run   Arithmetic mean   Harmonic mean
--------------------------------------
1       -324.94          -328.80
2       -324.95          -327.78
--------------------------------------
TOTAL     -324.95          -328.42
--------------------------------------


Model parameter summaries over the runs sampled in files
"/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".

95% HPD Interval
--------------------
Parameter         Mean      Variance     Lower       Upper       Median    min ESS*  avg ESS    PSRF+
------------------------------------------------------------------------------------------------------
TL{all}         0.887209    0.090465    0.352460    1.476372    0.849804    993.38   1247.19    1.000
r(A<->C){all}   0.173552    0.020928    0.000263    0.468217    0.137900    194.48    215.61    1.002
r(A<->G){all}   0.166515    0.018581    0.000108    0.433975    0.132206    164.67    216.61    1.007
r(A<->T){all}   0.166941    0.019281    0.000037    0.436188    0.130960    198.86    253.96    1.002
r(C<->G){all}   0.164789    0.019328    0.000024    0.451642    0.129558    184.44    273.50    1.001
r(C<->T){all}   0.170980    0.020244    0.000097    0.459726    0.135404    123.01    176.20    1.005
r(G<->T){all}   0.157224    0.018738    0.000079    0.440051    0.119406    153.41    183.16    1.002
pi(A){all}      0.168067    0.000576    0.124834    0.218742    0.166817    971.99   1108.09    1.000
pi(C){all}      0.250533    0.000727    0.199461    0.304236    0.250254   1258.91   1299.89    1.000
pi(G){all}      0.360351    0.000955    0.297933    0.419834    0.359864   1228.98   1274.09    1.000
pi(T){all}      0.221049    0.000728    0.171992    0.277887    0.220423   1098.75   1185.64    1.001
alpha{1,2}      0.406566    0.217145    0.000227    1.351545    0.238813   1069.03   1207.71    1.000
alpha{3}        0.450518    0.234719    0.000104    1.437480    0.283600   1157.19   1169.23    1.001
pinvar{all}     0.992967    0.000073    0.977878    0.999999    0.995671   1205.83   1276.10    1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.


Setting sumt conformat to Simple



 --- CODEML SUMMARY

Model 1: NearlyNeutral	-293.042599
Model 2: PositiveSelection	-293.042546
Model 0: one-ratio	-293.042546
Model 7: beta	-293.04263
Model 8: beta&w>1	-293.042561


Model 0 vs 1	1.059999999597494E-4

Model 2 vs 1	1.059999999597494E-4

Model 8 vs 7	1.37999999992644E-4
>C1
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C2
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C3
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C4
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C5
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C6
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=80 

C1              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C2              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C3              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C4              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C5              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C6              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
                **************************************************

C1              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C2              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C3              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C4              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C5              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C6              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
                ******************************




PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log      	S	[0] 
-genepred_score	S	[0] 	nsd
-run_name      	S	[0] 
-mem_mode      	S	[0] 	mem
-extend        	D	[1] 	1 
-extend_mode   	S	[0] 	very_fast_triplet
-max_n_pair    	D	[0] 	10 
-seq_name_for_quadruplet	S	[0] 	all
-compact       	S	[0] 	default
-clean         	S	[0] 	no
-do_self       	FL	[0] 	0
-do_normalise  	D	[0] 	1000 
-template_file 	S	[0] 
-setenv        	S	[0] 	0
-template_mode 	S	[0] 
-flip          	D	[0] 	0 
-remove_template_file	D	[0] 	0 
-profile_template_file	S	[0] 
-in            	S	[0] 
-seq           	S	[0] 
-aln           	S	[0] 
-method_limits 	S	[0] 
-method        	S	[0] 
-lib           	S	[0] 
-profile       	S	[0] 
-profile1      	S	[0] 
-profile2      	S	[0] 
-pdb           	S	[0] 
-relax_lib     	D	[0] 	1 
-filter_lib    	D	[0] 	0 
-shrink_lib    	D	[0] 	0 
-out_lib       	W_F	[0] 	no
-out_lib_mode  	S	[0] 	primary
-lib_only      	D	[0] 	0 
-outseqweight  	W_F	[0] 	no
-dpa           	FL	[0] 	0
-seq_source    	S	[0] 	ANY
-cosmetic_penalty	D	[0] 	0 
-gapopen       	D	[0] 	0 
-gapext        	D	[0] 	0 
-fgapopen      	D	[0] 	0 
-fgapext       	D	[0] 	0 
-nomatch       	D	[0] 	0 
-newtree       	W_F	[0] 	default
-tree          	W_F	[0] 	NO
-usetree       	R_F	[0] 
-tree_mode     	S	[0] 	nj
-distance_matrix_mode	S	[0] 	ktup
-distance_matrix_sim_mode	S	[0] 	idmat_sim1
-quicktree     	FL	[0] 	0
-outfile       	W_F	[0] 	default
-maximise      	FL	[1] 	1
-output        	S	[1] 	score_ascii	html	score_ascii
-len           	D	[0] 	0 
-infile        	R_F	[1] 	input.prot.fasta.muscle_rs_0_0.fasta.aln
-matrix        	S	[0] 	default
-tg_mode       	D	[0] 	1 
-profile_mode  	S	[0] 	cw_profile_profile
-profile_comparison	S	[0] 	profile
-dp_mode       	S	[0] 	linked_pair_wise
-ktuple        	D	[0] 	1 
-ndiag         	D	[0] 	0 
-diag_threshold	D	[0] 	0 
-diag_mode     	D	[0] 	0 
-sim_matrix    	S	[0] 	vasiliky
-transform     	S	[0] 
-extend_seq    	FL	[0] 	0
-outorder      	S	[0] 	input
-inorder       	S	[0] 	aligned
-seqnos        	S	[0] 	off
-case          	S	[0] 	keep
-cpu           	D	[0] 	0 
-maxnseq       	D	[0] 	1000 
-maxlen        	D	[0] 	-1 
-sample_dp     	D	[0] 	0 
-weight        	S	[0] 	default
-seq_weight    	S	[0] 	no
-align         	FL	[1] 	1
-mocca         	FL	[0] 	0
-domain        	FL	[0] 	0
-start         	D	[0] 	0 
-len           	D	[0] 	0 
-scale         	D	[0] 	0 
-mocca_interactive	FL	[0] 	0
-method_evaluate_mode	S	[0] 	default
-evaluate_mode 	S	[1] 	t_coffee_fast
-get_type      	FL	[0] 	0
-clean_aln     	D	[0] 	0 
-clean_threshold	D	[1] 	1 
-clean_iteration	D	[1] 	1 
-clean_evaluate_mode	S	[0] 	t_coffee_fast
-extend_matrix 	FL	[0] 	0
-prot_min_sim  	D	[40] 	40 
-prot_max_sim  	D	[90] 	90 
-prot_min_cov  	D	[40] 	40 
-pdb_type      	S	[0] 	d
-pdb_min_sim   	D	[35] 	35 
-pdb_max_sim   	D	[100] 	100 
-pdb_min_cov   	D	[50] 	50 
-pdb_blast_server	W_F	[0] 	EBI
-blast         	W_F	[0] 
-blast_server  	W_F	[0] 	EBI
-pdb_db        	W_F	[0] 	pdb
-protein_db    	W_F	[0] 	uniprot
-method_log    	W_F	[0] 	no
-struc_to_use  	S	[0] 
-cache         	W_F	[0] 	use
-align_pdb_param_file	W_F	[0] 	no
-align_pdb_hasch_mode	W_F	[0] 	hasch_ca_trace_bubble
-external_aligner	S	[0] 	NO
-msa_mode      	S	[0] 	tree
-master        	S	[0] 	no
-blast_nseq    	D	[0] 	0 
-lalign_n_top  	D	[0] 	10 
-iterate       	D	[1] 	0 
-trim          	D	[0] 	0 
-split         	D	[0] 	0 
-trimfile      	S	[0] 	default
-split         	D	[0] 	0 
-split_nseq_thres	D	[0] 	0 
-split_score_thres	D	[0] 	0 
-check_pdb_status	D	[0] 	0 
-clean_seq_name	D	[0] 	0 
-seq_to_keep   	S	[0] 
-dpa_master_aln	S	[0] 
-dpa_maxnseq   	D	[0] 	0 
-dpa_min_score1	D	[0] 
-dpa_min_score2	D	[0] 
-dpa_keep_tmpfile	FL	[0] 	0
-dpa_debug     	D	[0] 	0 
-multi_core    	S	[0] 	templates_jobs_relax_msa_evaluate
-n_core        	D	[0] 	0 
-max_n_proc    	D	[0] 	0 
-lib_list      	S	[0] 
-prune_lib_mode	S	[0] 	5
-tip           	S	[0] 	none
-rna_lib       	S	[0] 
-no_warning    	D	[0] 	0 
-run_local_script	D	[0] 	0 
-plugins       	S	[0] 	default
-proxy         	S	[0] 	unset
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   80 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   80 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2400]

Library Relaxation: Multi_proc [96]
 
Relaxation Summary: [2400]--->[2400]



UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1


OUTPUT RESULTS
	#### File Type= MSA             Format= score_ascii     Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
	#### File Type= MSA             Format= html            Name= input.prot.fasta.muscle_rs_0_0.fasta.html
	#### File Type= MSA             Format= score_ascii     Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii

# Command Line: t_coffee -infile input.prot.fasta.muscle_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast  [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.448 Mb, Max= 30.601 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/

FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment

C1              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C2              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C3              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C4              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C5              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
C6              MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
                **************************************************

C1              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C2              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C3              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C4              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C5              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
C6              RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
                ******************************




FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.muscle_rs_0_0.fasta.aln I:93 S:100 BS:94
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES 
BOT	    0    1	 100.00 C1	 C2	 100.00
TOP	    1    0	 100.00 C2	 C1	 100.00
BOT	    0    2	 100.00 C1	 C3	 100.00
TOP	    2    0	 100.00 C3	 C1	 100.00
BOT	    0    3	 100.00 C1	 C4	 100.00
TOP	    3    0	 100.00 C4	 C1	 100.00
BOT	    0    4	 100.00 C1	 C5	 100.00
TOP	    4    0	 100.00 C5	 C1	 100.00
BOT	    0    5	 100.00 C1	 C6	 100.00
TOP	    5    0	 100.00 C6	 C1	 100.00
BOT	    1    2	 100.00 C2	 C3	 100.00
TOP	    2    1	 100.00 C3	 C2	 100.00
BOT	    1    3	 100.00 C2	 C4	 100.00
TOP	    3    1	 100.00 C4	 C2	 100.00
BOT	    1    4	 100.00 C2	 C5	 100.00
TOP	    4    1	 100.00 C5	 C2	 100.00
BOT	    1    5	 100.00 C2	 C6	 100.00
TOP	    5    1	 100.00 C6	 C2	 100.00
BOT	    2    3	 100.00 C3	 C4	 100.00
TOP	    3    2	 100.00 C4	 C3	 100.00
BOT	    2    4	 100.00 C3	 C5	 100.00
TOP	    4    2	 100.00 C5	 C3	 100.00
BOT	    2    5	 100.00 C3	 C6	 100.00
TOP	    5    2	 100.00 C6	 C3	 100.00
BOT	    3    4	 100.00 C4	 C5	 100.00
TOP	    4    3	 100.00 C5	 C4	 100.00
BOT	    3    5	 100.00 C4	 C6	 100.00
TOP	    5    3	 100.00 C6	 C4	 100.00
BOT	    4    5	 100.00 C5	 C6	 100.00
TOP	    5    4	 100.00 C6	 C5	 100.00
AVG	 0	 C1	  *	 100.00
AVG	 1	 C2	  *	 100.00
AVG	 2	 C3	  *	 100.00
AVG	 3	 C4	  *	 100.00
AVG	 4	 C5	  *	 100.00
AVG	 5	 C6	  *	 100.00
TOT	 TOT	  *	 100.00
CLUSTAL W (1.83) multiple sequence alignment

C1              ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C2              ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C3              ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C4              ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C5              ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
C6              ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
                **************************************************

C1              CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C2              CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C3              CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C4              CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C5              CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
C6              CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
                **************************************************

C1              GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C2              GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C3              GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C4              GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C5              GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
C6              GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
                **************************************************

C1              CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C2              CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C3              CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C4              CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C5              CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
C6              CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
                **************************************************

C1              TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C2              TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C3              TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C4              TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C5              TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
C6              TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
                ****************************************



>C1
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C2
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C3
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C4
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C5
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C6
ATGAGTACGGTCGTCGTTGACGCTGTCGAGCATGTGGTCCGCGGGATTGT
CGATAATCCGGACGATGTCCGGGTGGACCTGGTCATCAGTCGGCGTGGGC
GCACTGTCGAAGTGCATGTTCATCCCGACGATCTGGGTAAGGTGATCGGT
CGTGGAGGACGTACTGCAACCGCGTTGCGCAAGTTGGTCGCCGGCATCGG
TGGCCGCGGTATCCGCGTCGATGTGGTAGACACCGACCAG
>C1
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C2
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C3
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C4
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C5
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ
>C6
MSTVVVDAVEHVVRGIVDNPDDVRVDLVISRRGRTVEVHVHPDDLGKVIG
RGGRTATALRKLVAGIGGRGIRVDVVDTDQ


                            MrBayes v3.2.2 x64

                      (Bayesian Analysis of Phylogeny)

              Distributed under the GNU General Public License


               Type "help" or "help <command>" for information
                     on the commands that are available.

                   Type "about" for authorship and general
                       information about the program.



   Executing file "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
   UNIX line termination
   Longest line length = 63
   Parsing file
   Expecting NEXUS formatted file
   Reading data block
      Allocated taxon set
      Allocated matrix
      Defining new matrix with 6 taxa and 240 characters
      Missing data coded as ?
      Data matrix is interleaved
      Data is Dna
      Gaps coded as -
      Matching characters coded as .
      Taxon 1 -> C1
      Taxon 2 -> C2
      Taxon 3 -> C3
      Taxon 4 -> C4
      Taxon 5 -> C5
      Taxon 6 -> C6
      Successfully read matrix
      Setting default partition (does not divide up characters)
      Setting model defaults
      Seed (for generating default start values) = 1579856719
      Setting output file names to "/data/7res/ML1617/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
   Exiting data block
   Reading mrbayes block
      Setting autoclose to yes
      Setting nowarnings to yes
      Defining charset called first_pos
      Defining charset called second_pos
      Defining charset called third_pos
      Defining partition called by_codon
      Setting by_codon as the partition, dividing characters into 3 parts.
      Setting model defaults
      Seed (for generating default start values) = 1714890374
      Setting Nst to 6 for partition 1
      Setting Nst to 6 for partition 2
      Setting Nst to 6 for partition 3
      Setting Rates to Invgamma for partition 1
      Setting Rates to Invgamma for partition 2
      Setting Rates to Invgamma for partition 3
      Successfully set likelihood model parameters to all
         applicable data partitions 
      Unlinking
      Setting number of generations to 1000000
      Running Markov chain
      MCMC stamp = 5415670298
      Seed = 1911374757
      Swapseed = 1579856719
      Model settings:

         Settings for partition 1 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

         Settings for partition 2 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

         Settings for partition 3 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

      Active parameters: 

                          Partition(s)
         Parameters       1  2  3
         ------------------------
         Revmat           1  1  1
         Statefreq        2  2  2
         Shape            3  3  4
         Pinvar           5  5  5
         Ratemultiplier   6  6  6
         Topology         7  7  7
         Brlens           8  8  8
         ------------------------

         Parameters can be linked or unlinked across partitions using 'link' and 'unlink'

         1 --  Parameter  = Revmat{all}
               Type       = Rates of reversible rate matrix
               Prior      = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
               Partitions = All

         2 --  Parameter  = Pi{all}
               Type       = Stationary state frequencies
               Prior      = Dirichlet
               Partitions = All

         3 --  Parameter  = Alpha{1,2}
               Type       = Shape of scaled gamma distribution of site rates
               Prior      = Exponential(2.00)
               Partitions = 1 and 2

         4 --  Parameter  = Alpha{3}
               Type       = Shape of scaled gamma distribution of site rates
               Prior      = Exponential(2.00)
               Partition  = 3

         5 --  Parameter  = Pinvar{all}
               Type       = Proportion of invariable sites
               Prior      = Uniform(0.00,1.00)
               Partitions = All

         6 --  Parameter  = Ratemultiplier{all}
               Type       = Partition-specific rate multiplier
               Prior      = Fixed(1.0)
               Partitions = All

         7 --  Parameter  = Tau{all}
               Type       = Topology
               Prior      = All topologies equally probable a priori
               Partitions = All
               Subparam.  = V{all}

         8 --  Parameter  = V{all}
               Type       = Branch lengths
               Prior      = Unconstrained:Exponential(10.0)
               Partitions = All



      The MCMC sampler will use the following moves:
         With prob.  Chain will use move
            1.06 %   Dirichlet(Revmat{all})
            1.06 %   Slider(Revmat{all})
            1.06 %   Dirichlet(Pi{all})
            1.06 %   Slider(Pi{all})
            2.13 %   Multiplier(Alpha{1,2})
            2.13 %   Multiplier(Alpha{3})
            2.13 %   Slider(Pinvar{all})
           10.64 %   ExtSPR(Tau{all},V{all})
           10.64 %   ExtTBR(Tau{all},V{all})
           10.64 %   NNI(Tau{all},V{all})
           10.64 %   ParsSPR(Tau{all},V{all})
           31.91 %   Multiplier(V{all})
           10.64 %   Nodeslider(V{all})
            4.26 %   TLMultiplier(V{all})

      Division 1 has 4 unique site patterns
      Division 2 has 4 unique site patterns
      Division 3 has 4 unique site patterns
      Initializing conditional likelihoods
      Using standard SSE likelihood calculator for division 1 (single-precision)
      Using standard SSE likelihood calculator for division 2 (single-precision)
      Using standard SSE likelihood calculator for division 3 (single-precision)
      Initializing invariable-site conditional likelihoods

      Initial log likelihoods and log prior probs for run 1:
         Chain 1 -- -537.131472 -- -24.965149
         Chain 2 -- -537.131472 -- -24.965149
         Chain 3 -- -537.131503 -- -24.965149
         Chain 4 -- -537.131472 -- -24.965149

      Initial log likelihoods and log prior probs for run 2:
         Chain 1 -- -537.131503 -- -24.965149
         Chain 2 -- -537.131472 -- -24.965149
         Chain 3 -- -537.131472 -- -24.965149
         Chain 4 -- -537.131503 -- -24.965149


      Using a relative burnin of 25.0 % for diagnostics

      Chain results (1000000 generations requested):

          0 -- [-537.131] (-537.131) (-537.132) (-537.131) * [-537.132] (-537.131) (-537.131) (-537.132) 
        500 -- (-332.801) (-338.416) (-336.007) [-330.153] * (-338.761) [-330.993] (-335.489) (-336.193) -- 0:00:00
       1000 -- [-332.864] (-335.891) (-329.749) (-338.590) * [-332.381] (-335.352) (-341.105) (-340.445) -- 0:00:00
       1500 -- (-332.626) (-343.357) [-336.913] (-332.871) * (-331.884) (-336.157) (-337.953) [-333.400] -- 0:00:00
       2000 -- (-336.802) [-331.533] (-336.163) (-335.836) * (-338.949) (-339.863) (-330.210) [-329.842] -- 0:00:00
       2500 -- (-328.379) (-339.539) [-328.083] (-337.005) * (-332.603) [-339.670] (-334.958) (-336.839) -- 0:00:00
       3000 -- [-332.759] (-331.746) (-331.094) (-329.235) * (-331.528) (-337.300) (-335.951) [-332.108] -- 0:00:00
       3500 -- (-332.944) (-338.789) (-333.518) [-333.953] * (-335.112) [-333.734] (-336.946) (-338.605) -- 0:00:00
       4000 -- (-334.692) [-334.218] (-332.730) (-336.220) * (-330.109) (-329.861) [-334.701] (-336.564) -- 0:00:00
       4500 -- (-337.888) (-339.866) (-343.465) [-330.711] * (-332.051) [-335.475] (-333.418) (-336.302) -- 0:00:00
       5000 -- (-333.008) (-335.084) (-327.382) [-329.644] * [-335.904] (-335.270) (-346.291) (-333.699) -- 0:00:00

      Average standard deviation of split frequencies: 0.097274

       5500 -- [-335.356] (-332.759) (-324.073) (-337.164) * [-337.758] (-337.241) (-344.831) (-335.599) -- 0:00:00
       6000 -- [-334.623] (-333.217) (-325.573) (-334.945) * (-334.919) (-336.698) (-326.380) [-328.158] -- 0:00:00
       6500 -- (-331.380) [-332.229] (-324.054) (-329.449) * (-334.000) [-332.616] (-325.472) (-339.168) -- 0:00:00
       7000 -- [-336.112] (-338.550) (-328.994) (-343.095) * [-332.208] (-333.656) (-325.358) (-341.569) -- 0:00:00
       7500 -- (-331.571) [-332.908] (-324.208) (-334.517) * (-340.277) (-333.331) [-325.859] (-338.304) -- 0:00:00
       8000 -- (-337.452) (-334.391) (-325.059) [-330.217] * (-338.403) [-335.918] (-326.864) (-336.670) -- 0:00:00
       8500 -- (-333.622) [-334.407] (-327.276) (-337.596) * (-333.329) (-342.533) [-327.130] (-340.788) -- 0:00:00
       9000 -- (-333.648) (-333.449) (-323.844) [-330.100] * (-334.202) [-334.890] (-324.059) (-339.661) -- 0:01:50
       9500 -- (-336.464) (-341.297) [-326.449] (-338.574) * (-345.709) (-337.790) [-325.076] (-341.658) -- 0:01:44
      10000 -- (-334.533) (-337.703) [-323.607] (-336.350) * (-334.207) (-341.278) [-325.555] (-333.943) -- 0:01:39

      Average standard deviation of split frequencies: 0.095017

      10500 -- (-344.677) (-334.268) (-324.284) [-342.470] * (-337.810) (-347.233) (-324.672) [-340.187] -- 0:01:34
      11000 -- (-338.917) [-339.300] (-325.729) (-335.633) * (-335.261) (-346.034) [-325.972] (-337.228) -- 0:01:29
      11500 -- (-325.446) [-333.434] (-330.043) (-336.052) * [-334.538] (-338.076) (-326.054) (-330.895) -- 0:01:25
      12000 -- (-325.217) [-337.846] (-325.655) (-333.862) * [-334.085] (-347.564) (-324.551) (-345.110) -- 0:01:22
      12500 -- (-324.917) (-341.786) [-324.246] (-330.216) * (-333.197) (-350.617) [-328.917] (-334.315) -- 0:01:19
      13000 -- (-324.318) (-341.761) (-323.884) [-329.685] * (-328.702) (-348.085) (-329.323) [-327.801] -- 0:01:15
      13500 -- (-324.405) (-329.248) (-324.293) [-325.539] * (-334.527) (-345.688) (-326.631) [-324.005] -- 0:01:13
      14000 -- (-324.238) (-331.688) [-325.752] (-324.055) * [-331.533] (-345.799) (-326.025) (-327.055) -- 0:01:10
      14500 -- (-326.625) [-324.943] (-324.013) (-332.683) * (-333.780) (-336.216) [-326.622] (-327.175) -- 0:01:07
      15000 -- (-326.112) (-325.380) [-324.740] (-327.674) * (-332.633) (-327.649) (-324.585) [-327.841] -- 0:01:05

      Average standard deviation of split frequencies: 0.080204

      15500 -- [-325.238] (-325.521) (-324.879) (-325.937) * [-336.459] (-329.502) (-327.186) (-325.456) -- 0:01:03
      16000 -- [-326.808] (-324.636) (-326.269) (-324.575) * [-331.472] (-327.139) (-325.040) (-325.011) -- 0:01:01
      16500 -- (-325.463) [-326.397] (-328.548) (-324.012) * (-353.176) (-324.829) (-324.520) [-326.001] -- 0:00:59
      17000 -- (-324.136) [-326.386] (-324.045) (-323.960) * (-338.876) (-326.554) (-323.742) [-326.026] -- 0:00:57
      17500 -- (-324.442) [-327.863] (-326.520) (-324.830) * (-339.805) (-326.433) (-324.888) [-324.357] -- 0:00:56
      18000 -- (-326.309) [-324.426] (-325.957) (-327.965) * (-334.133) (-324.608) [-325.708] (-324.637) -- 0:00:54
      18500 -- [-326.446] (-323.923) (-327.362) (-324.582) * (-334.444) [-324.124] (-326.657) (-324.777) -- 0:00:53
      19000 -- (-326.454) (-332.380) (-326.638) [-326.071] * (-332.877) (-326.324) [-324.184] (-323.964) -- 0:00:51
      19500 -- [-324.170] (-328.901) (-326.426) (-325.190) * (-334.069) (-325.829) [-325.061] (-325.341) -- 0:00:50
      20000 -- [-324.286] (-323.901) (-324.623) (-329.126) * [-333.156] (-327.289) (-326.468) (-325.520) -- 0:00:49

      Average standard deviation of split frequencies: 0.048303

      20500 -- [-326.099] (-324.311) (-326.036) (-326.511) * (-334.897) [-324.553] (-324.871) (-326.671) -- 0:00:47
      21000 -- (-323.951) (-325.220) [-326.006] (-323.768) * (-341.411) [-324.384] (-324.738) (-330.977) -- 0:00:46
      21500 -- (-329.251) [-327.231] (-326.323) (-324.158) * [-331.754] (-323.910) (-326.325) (-329.143) -- 0:00:45
      22000 -- [-327.308] (-324.537) (-330.893) (-323.508) * (-344.643) (-324.200) [-327.693] (-330.228) -- 0:00:44
      22500 -- (-329.269) (-324.169) [-328.201] (-324.339) * (-340.853) (-323.881) [-327.226] (-328.328) -- 0:00:43
      23000 -- (-326.949) [-324.007] (-327.221) (-325.688) * (-335.848) [-324.227] (-324.948) (-329.149) -- 0:00:42
      23500 -- (-325.164) (-325.116) [-325.813] (-330.489) * [-336.977] (-323.676) (-327.429) (-324.233) -- 0:00:41
      24000 -- [-326.148] (-326.052) (-326.601) (-328.639) * [-333.154] (-324.635) (-325.043) (-325.570) -- 0:00:40
      24500 -- [-323.629] (-325.443) (-324.401) (-328.133) * (-357.096) [-326.421] (-326.299) (-324.372) -- 0:00:39
      25000 -- (-324.937) [-323.759] (-329.416) (-325.587) * (-347.074) (-328.952) (-324.826) [-326.462] -- 0:00:39

      Average standard deviation of split frequencies: 0.044145

      25500 -- (-325.595) (-325.154) [-326.442] (-327.519) * (-333.232) [-326.810] (-326.259) (-325.994) -- 0:00:38
      26000 -- (-325.476) [-325.361] (-324.233) (-329.011) * (-323.805) [-323.976] (-323.863) (-325.846) -- 0:01:14
      26500 -- (-324.863) (-329.417) (-325.945) [-324.492] * [-324.786] (-326.019) (-325.665) (-326.878) -- 0:01:13
      27000 -- (-324.035) (-326.983) [-323.678] (-324.731) * (-323.834) (-328.635) [-325.202] (-324.039) -- 0:01:12
      27500 -- (-325.803) (-327.744) (-325.123) [-327.328] * [-324.513] (-331.056) (-325.614) (-326.797) -- 0:01:10
      28000 -- (-323.848) (-326.528) (-324.767) [-326.573] * [-324.601] (-327.725) (-326.754) (-325.023) -- 0:01:09
      28500 -- (-324.403) (-325.022) [-324.849] (-326.590) * [-324.105] (-325.556) (-328.327) (-323.895) -- 0:01:08
      29000 -- (-324.971) (-324.669) (-325.387) [-325.511] * (-326.247) (-325.214) [-325.871] (-324.933) -- 0:01:06
      29500 -- (-325.226) (-323.682) [-324.389] (-324.053) * (-324.748) (-326.317) (-328.360) [-326.100] -- 0:01:05
      30000 -- (-324.966) (-325.586) [-324.881] (-332.959) * (-324.874) (-326.773) (-327.745) [-324.562] -- 0:01:04

      Average standard deviation of split frequencies: 0.046814

      30500 -- (-324.803) [-325.350] (-325.217) (-326.537) * (-325.685) (-325.338) [-327.781] (-327.080) -- 0:01:03
      31000 -- (-329.653) (-326.535) [-323.613] (-326.775) * (-324.883) [-326.497] (-327.223) (-328.826) -- 0:01:02
      31500 -- (-328.135) (-325.869) [-325.087] (-327.390) * (-324.473) (-327.249) [-326.575] (-326.287) -- 0:01:01
      32000 -- (-327.688) (-324.864) (-328.666) [-326.711] * [-325.754] (-325.639) (-324.051) (-326.924) -- 0:01:00
      32500 -- (-324.516) (-325.012) [-324.857] (-327.198) * (-328.483) [-327.013] (-329.006) (-327.490) -- 0:00:59
      33000 -- (-327.491) (-326.998) (-325.178) [-327.292] * (-326.400) (-325.191) (-325.340) [-324.089] -- 0:00:58
      33500 -- [-324.002] (-325.652) (-323.793) (-328.165) * [-329.343] (-323.786) (-324.851) (-324.896) -- 0:00:57
      34000 -- (-323.945) (-325.653) (-325.641) [-325.439] * (-326.682) (-324.081) [-323.912] (-326.404) -- 0:00:56
      34500 -- (-324.350) (-323.583) (-325.529) [-329.192] * (-325.205) (-324.125) [-325.034] (-324.042) -- 0:00:55
      35000 -- (-325.266) [-325.993] (-326.070) (-325.098) * (-325.923) (-324.443) (-325.907) [-324.260] -- 0:00:55

      Average standard deviation of split frequencies: 0.052378

      35500 -- [-324.846] (-329.204) (-325.359) (-324.976) * (-324.921) (-326.153) [-325.120] (-325.021) -- 0:00:54
      36000 -- (-326.301) (-323.723) [-327.101] (-325.275) * [-328.635] (-324.326) (-329.471) (-327.145) -- 0:00:53
      36500 -- [-324.469] (-325.628) (-326.567) (-325.862) * [-325.043] (-327.209) (-325.520) (-326.523) -- 0:00:52
      37000 -- (-329.580) [-323.797] (-325.327) (-327.126) * (-324.563) [-325.022] (-325.035) (-328.529) -- 0:00:52
      37500 -- (-327.916) (-324.381) (-325.983) [-324.817] * (-323.983) (-328.104) (-324.562) [-326.518] -- 0:00:51
      38000 -- [-326.728] (-325.215) (-325.880) (-326.003) * [-324.458] (-324.069) (-324.552) (-327.296) -- 0:00:50
      38500 -- [-324.182] (-326.733) (-325.769) (-325.426) * (-325.875) (-325.073) (-326.584) [-324.914] -- 0:00:49
      39000 -- [-324.952] (-325.753) (-326.815) (-324.932) * (-324.681) [-324.767] (-325.514) (-326.619) -- 0:00:49
      39500 -- [-324.302] (-330.081) (-326.708) (-325.867) * [-326.438] (-325.393) (-326.107) (-325.744) -- 0:00:48
      40000 -- (-326.767) (-324.952) (-326.368) [-326.347] * (-329.348) (-323.810) [-329.084] (-325.492) -- 0:00:48

      Average standard deviation of split frequencies: 0.053902

      40500 -- (-327.096) (-325.160) (-325.635) [-326.380] * (-325.701) (-325.922) (-328.306) [-325.122] -- 0:00:47
      41000 -- (-328.233) (-327.375) [-324.715] (-327.805) * (-326.008) (-327.551) [-325.808] (-327.418) -- 0:00:46
      41500 -- (-326.093) [-325.599] (-325.091) (-325.856) * (-326.475) (-325.551) (-323.686) [-326.023] -- 0:00:46
      42000 -- [-325.905] (-324.055) (-327.936) (-327.070) * (-328.136) [-326.331] (-327.126) (-327.494) -- 0:00:45
      42500 -- (-323.601) [-325.502] (-325.728) (-325.707) * (-328.165) (-325.864) [-324.921] (-326.171) -- 0:00:45
      43000 -- [-325.013] (-326.173) (-324.877) (-324.404) * [-326.427] (-323.993) (-325.341) (-325.362) -- 0:01:06
      43500 -- (-325.688) [-325.440] (-325.229) (-324.383) * [-325.104] (-324.058) (-325.322) (-323.771) -- 0:01:05
      44000 -- (-324.063) (-328.073) [-327.370] (-326.872) * (-328.619) (-326.352) (-330.161) [-326.074] -- 0:01:05
      44500 -- (-325.926) (-326.036) (-325.339) [-325.564] * [-332.849] (-326.763) (-324.408) (-332.183) -- 0:01:04
      45000 -- [-331.094] (-323.903) (-325.176) (-324.944) * (-324.221) [-327.207] (-324.802) (-330.060) -- 0:01:03

      Average standard deviation of split frequencies: 0.043787

      45500 -- (-324.810) (-324.149) (-323.627) [-324.785] * [-326.666] (-327.360) (-324.284) (-324.457) -- 0:01:02
      46000 -- [-328.692] (-324.599) (-325.510) (-333.662) * (-324.907) (-327.795) [-327.093] (-327.310) -- 0:01:02
      46500 -- [-326.692] (-325.937) (-326.418) (-325.440) * [-326.089] (-324.485) (-326.714) (-326.124) -- 0:01:01
      47000 -- (-325.562) (-328.521) [-328.188] (-326.782) * [-328.767] (-327.045) (-326.555) (-324.741) -- 0:01:00
      47500 -- [-325.040] (-330.066) (-324.206) (-324.991) * (-324.113) (-324.465) (-326.983) [-324.947] -- 0:01:00
      48000 -- (-324.092) (-324.082) [-325.854] (-324.432) * (-327.358) [-324.582] (-326.615) (-324.988) -- 0:00:59
      48500 -- (-323.723) (-327.810) (-328.218) [-323.862] * (-324.212) (-329.840) (-330.119) [-325.990] -- 0:00:58
      49000 -- [-325.091] (-325.199) (-327.046) (-328.292) * (-324.987) (-327.269) [-328.542] (-326.975) -- 0:00:58
      49500 -- (-324.818) [-325.135] (-325.359) (-326.322) * (-326.184) [-324.050] (-324.557) (-324.768) -- 0:00:57
      50000 -- [-325.673] (-325.766) (-325.115) (-325.388) * (-324.501) [-325.349] (-326.976) (-326.977) -- 0:00:57

      Average standard deviation of split frequencies: 0.041204

      50500 -- (-328.252) (-326.172) [-326.296] (-328.900) * [-325.314] (-329.880) (-324.554) (-330.920) -- 0:00:56
      51000 -- [-328.334] (-327.862) (-326.936) (-323.559) * (-324.091) [-328.979] (-324.114) (-330.032) -- 0:00:55
      51500 -- [-325.455] (-325.930) (-325.458) (-324.686) * [-325.013] (-328.672) (-324.327) (-328.274) -- 0:00:55
      52000 -- (-324.848) (-325.670) (-328.925) [-325.147] * (-327.335) (-326.592) [-323.875] (-331.011) -- 0:00:54
      52500 -- (-325.575) (-325.699) (-326.872) [-323.579] * (-325.899) [-327.386] (-324.553) (-323.915) -- 0:00:54
      53000 -- (-325.868) [-329.146] (-327.279) (-323.557) * (-327.459) (-327.774) [-326.697] (-325.537) -- 0:00:53
      53500 -- (-329.843) (-327.714) [-324.945] (-324.797) * (-326.527) (-325.531) (-327.151) [-325.249] -- 0:00:53
      54000 -- [-327.629] (-323.752) (-325.164) (-324.293) * (-325.693) (-326.908) [-325.220] (-325.225) -- 0:00:52
      54500 -- [-329.416] (-328.466) (-325.093) (-324.704) * (-326.902) (-329.230) [-323.856] (-323.688) -- 0:00:52
      55000 -- [-327.186] (-327.435) (-327.597) (-327.388) * (-328.642) [-325.561] (-326.266) (-324.676) -- 0:00:51

      Average standard deviation of split frequencies: 0.036618

      55500 -- (-327.102) (-328.905) [-325.545] (-326.155) * (-326.077) (-324.231) [-327.394] (-329.070) -- 0:00:51
      56000 -- (-324.231) [-325.334] (-325.609) (-325.965) * (-329.836) [-323.473] (-327.965) (-328.285) -- 0:00:50
      56500 -- (-326.186) [-326.960] (-327.160) (-324.765) * (-324.452) (-324.442) (-329.064) [-326.993] -- 0:00:50
      57000 -- (-327.729) (-330.608) [-324.058] (-324.186) * (-325.856) (-323.858) (-329.437) [-324.526] -- 0:00:49
      57500 -- (-326.268) (-325.885) (-323.686) [-325.077] * (-323.530) [-326.561] (-326.642) (-323.774) -- 0:00:49
      58000 -- [-324.259] (-325.608) (-329.595) (-327.328) * (-323.711) (-326.205) [-323.881] (-324.904) -- 0:00:48
      58500 -- [-323.504] (-324.180) (-325.557) (-329.856) * (-326.739) (-329.085) (-325.296) [-325.824] -- 0:00:48
      59000 -- (-324.062) (-324.808) [-324.413] (-323.628) * [-325.800] (-328.155) (-329.626) (-330.637) -- 0:00:47
      59500 -- (-325.439) (-323.782) [-324.528] (-324.573) * (-324.108) (-327.670) (-324.869) [-327.680] -- 0:00:47
      60000 -- (-324.178) (-325.616) [-325.765] (-329.574) * (-325.056) (-324.375) [-325.785] (-324.892) -- 0:01:02

      Average standard deviation of split frequencies: 0.044987

      60500 -- (-325.691) (-330.871) [-324.109] (-330.100) * [-324.493] (-329.176) (-326.542) (-324.967) -- 0:01:02
      61000 -- (-326.265) (-325.183) [-324.186] (-327.537) * [-324.593] (-325.167) (-324.503) (-324.678) -- 0:01:01
      61500 -- (-324.120) (-325.151) [-325.703] (-331.724) * [-324.353] (-325.434) (-324.483) (-332.812) -- 0:01:01
      62000 -- [-325.736] (-327.863) (-325.992) (-328.378) * [-326.369] (-325.202) (-328.269) (-328.381) -- 0:01:00
      62500 -- (-325.549) (-334.136) (-330.602) [-332.100] * (-324.623) (-325.388) (-325.647) [-325.563] -- 0:01:00
      63000 -- (-325.064) (-331.425) [-327.128] (-331.734) * (-324.127) (-325.038) (-324.598) [-329.379] -- 0:00:59
      63500 -- (-328.988) (-332.879) (-327.627) [-325.846] * (-325.313) (-326.466) [-327.228] (-328.446) -- 0:00:58
      64000 -- (-328.798) (-327.556) [-323.788] (-325.536) * [-324.796] (-327.504) (-323.809) (-325.403) -- 0:00:58
      64500 -- (-327.573) (-324.326) [-323.794] (-325.440) * [-323.981] (-327.859) (-324.417) (-324.855) -- 0:00:58
      65000 -- (-326.221) (-324.280) (-324.224) [-324.145] * (-324.096) (-325.084) [-324.975] (-324.595) -- 0:00:57

      Average standard deviation of split frequencies: 0.036037

      65500 -- [-325.396] (-324.181) (-326.866) (-327.053) * (-324.235) (-332.945) (-330.205) [-326.173] -- 0:00:57
      66000 -- (-328.795) (-327.067) [-326.504] (-326.365) * (-326.156) [-333.619] (-331.402) (-326.661) -- 0:00:56
      66500 -- (-324.640) (-326.622) (-328.367) [-324.399] * (-324.148) [-326.813] (-323.679) (-327.252) -- 0:00:56
      67000 -- (-328.567) (-326.274) (-323.571) [-324.541] * [-323.481] (-324.086) (-324.589) (-325.420) -- 0:00:55
      67500 -- (-328.293) [-325.360] (-323.792) (-324.869) * [-324.601] (-327.515) (-323.995) (-323.817) -- 0:00:55
      68000 -- (-325.037) (-325.201) (-327.276) [-324.712] * (-329.402) (-326.659) [-324.291] (-328.746) -- 0:00:54
      68500 -- (-328.123) (-324.712) (-329.024) [-325.483] * (-326.516) (-328.120) [-326.525] (-325.868) -- 0:00:54
      69000 -- (-324.225) (-325.849) [-325.691] (-327.198) * (-328.785) (-324.410) [-325.094] (-326.220) -- 0:00:53
      69500 -- (-323.395) (-326.848) (-328.017) [-325.693] * (-327.509) (-325.231) [-324.840] (-328.136) -- 0:00:53
      70000 -- (-328.276) (-323.357) [-326.336] (-326.481) * (-327.887) (-327.290) [-324.342] (-325.419) -- 0:00:53

      Average standard deviation of split frequencies: 0.034307

      70500 -- (-326.953) (-324.380) (-327.550) [-327.075] * (-324.284) [-324.543] (-323.856) (-325.134) -- 0:00:52
      71000 -- (-325.096) (-324.289) [-325.023] (-331.293) * (-325.217) [-324.767] (-331.053) (-325.826) -- 0:00:52
      71500 -- (-325.837) (-324.481) [-326.165] (-323.703) * (-327.370) (-324.624) [-328.059] (-326.604) -- 0:00:51
      72000 -- [-325.789] (-325.027) (-328.914) (-326.623) * (-325.619) (-323.529) (-324.768) [-324.510] -- 0:00:51
      72500 -- [-324.887] (-324.011) (-331.313) (-325.662) * [-325.483] (-323.929) (-323.704) (-324.465) -- 0:00:51
      73000 -- [-328.054] (-325.325) (-327.434) (-325.128) * [-324.399] (-325.599) (-323.582) (-324.545) -- 0:00:50
      73500 -- (-326.922) (-323.669) [-327.335] (-324.838) * (-324.955) (-324.949) (-326.415) [-323.307] -- 0:00:50
      74000 -- (-326.892) (-326.171) [-326.864] (-323.926) * (-324.308) [-324.299] (-327.954) (-324.872) -- 0:00:50
      74500 -- (-325.779) (-328.911) (-326.189) [-324.616] * (-325.217) (-326.412) [-326.619] (-325.515) -- 0:00:49
      75000 -- (-326.834) [-329.157] (-324.321) (-327.182) * (-326.644) (-327.983) [-324.322] (-328.901) -- 0:00:49

      Average standard deviation of split frequencies: 0.034115

      75500 -- (-325.889) (-324.165) [-325.976] (-324.363) * (-327.202) (-327.662) (-324.193) [-326.125] -- 0:00:48
      76000 -- (-326.505) (-326.051) [-327.475] (-329.527) * (-327.399) (-327.701) [-327.151] (-326.322) -- 0:00:48
      76500 -- (-325.634) (-325.210) (-325.020) [-325.108] * (-324.588) (-324.368) (-326.848) [-327.052] -- 0:00:48
      77000 -- (-326.240) [-325.282] (-325.564) (-330.256) * (-325.197) (-325.613) (-326.038) [-324.620] -- 0:00:59
      77500 -- (-325.011) [-323.332] (-325.919) (-324.486) * (-324.171) (-325.702) [-325.057] (-325.303) -- 0:00:59
      78000 -- (-328.199) (-325.250) (-326.281) [-324.062] * (-324.889) (-325.538) (-325.618) [-324.928] -- 0:00:59
      78500 -- (-327.499) [-327.701] (-329.110) (-327.391) * (-330.126) (-324.952) (-326.586) [-325.355] -- 0:00:58
      79000 -- (-325.058) (-325.645) (-330.292) [-327.839] * (-325.512) (-325.839) [-326.021] (-326.383) -- 0:00:58
      79500 -- [-324.180] (-324.904) (-329.512) (-324.567) * (-323.983) (-325.983) (-324.792) [-326.517] -- 0:00:57
      80000 -- (-326.631) [-323.861] (-324.535) (-325.386) * (-326.166) (-325.138) (-326.076) [-325.811] -- 0:00:57

      Average standard deviation of split frequencies: 0.033218

      80500 -- (-324.863) [-326.370] (-324.144) (-324.485) * (-326.858) (-331.370) (-328.551) [-326.171] -- 0:00:57
      81000 -- (-325.799) (-324.044) (-331.634) [-327.035] * (-324.116) (-326.302) (-329.409) [-324.536] -- 0:00:56
      81500 -- (-326.555) (-324.049) (-333.135) [-325.933] * (-324.038) (-327.479) (-327.891) [-326.305] -- 0:00:56
      82000 -- (-327.826) (-324.273) [-330.938] (-325.298) * [-325.077] (-323.967) (-324.020) (-325.847) -- 0:00:55
      82500 -- (-327.033) [-324.548] (-329.394) (-326.898) * (-327.917) [-325.164] (-327.553) (-324.752) -- 0:00:55
      83000 -- (-326.686) (-326.687) (-326.983) [-326.275] * (-324.831) [-327.117] (-329.996) (-329.667) -- 0:00:55
      83500 -- [-326.048] (-327.014) (-326.782) (-328.390) * (-325.170) [-326.044] (-325.556) (-331.173) -- 0:00:54
      84000 -- (-326.363) [-324.051] (-323.939) (-328.443) * (-324.810) [-330.449] (-326.093) (-327.088) -- 0:00:54
      84500 -- [-326.346] (-323.454) (-323.811) (-325.228) * [-325.870] (-332.841) (-324.021) (-324.114) -- 0:00:54
      85000 -- (-331.676) (-324.669) (-326.682) [-325.901] * [-323.522] (-324.669) (-324.473) (-325.620) -- 0:00:53

      Average standard deviation of split frequencies: 0.031062

      85500 -- (-328.053) (-324.723) (-324.396) [-324.820] * (-329.835) (-325.011) [-326.113] (-323.446) -- 0:00:53
      86000 -- (-325.578) (-326.770) [-327.230] (-324.099) * (-326.652) [-329.948] (-325.650) (-324.725) -- 0:00:53
      86500 -- (-325.111) (-330.535) (-325.663) [-325.836] * [-327.066] (-325.560) (-326.770) (-324.022) -- 0:00:52
      87000 -- (-327.701) (-327.422) (-326.207) [-324.962] * (-325.564) (-324.308) [-324.843] (-324.410) -- 0:00:52
      87500 -- [-326.103] (-325.003) (-329.134) (-326.595) * (-326.640) (-326.002) (-324.446) [-325.433] -- 0:00:52
      88000 -- (-324.755) (-330.127) [-326.695] (-326.028) * [-325.433] (-324.436) (-324.385) (-324.258) -- 0:00:51
      88500 -- (-325.946) [-327.224] (-325.352) (-326.816) * (-325.879) (-324.835) (-325.686) [-325.829] -- 0:00:51
      89000 -- (-326.385) (-327.609) [-323.916] (-328.492) * (-326.126) [-324.945] (-328.007) (-325.489) -- 0:00:51
      89500 -- [-324.301] (-326.993) (-326.954) (-324.361) * (-325.071) [-325.309] (-325.401) (-328.709) -- 0:00:50
      90000 -- (-323.998) [-326.259] (-324.070) (-328.294) * [-324.062] (-324.613) (-324.190) (-325.326) -- 0:00:50

      Average standard deviation of split frequencies: 0.031196

      90500 -- [-325.370] (-326.669) (-325.537) (-333.117) * (-323.800) (-326.539) (-326.056) [-325.343] -- 0:00:50
      91000 -- (-327.215) (-324.941) (-324.034) [-325.539] * (-325.845) (-328.115) [-325.214] (-325.934) -- 0:00:49
      91500 -- (-326.914) (-328.299) (-325.402) [-323.674] * [-326.209] (-328.027) (-325.935) (-325.899) -- 0:00:49
      92000 -- (-325.710) (-326.133) (-328.188) [-323.797] * [-324.814] (-325.434) (-328.683) (-327.016) -- 0:00:49
      92500 -- (-327.217) [-328.092] (-325.296) (-324.770) * [-328.435] (-327.529) (-326.131) (-324.768) -- 0:00:49
      93000 -- (-324.789) (-327.333) [-326.764] (-324.685) * (-330.230) (-326.892) [-328.506] (-323.964) -- 0:00:48
      93500 -- (-326.980) (-324.830) (-326.859) [-325.210] * (-328.859) (-328.265) [-325.907] (-323.525) -- 0:00:48
      94000 -- [-325.913] (-324.795) (-325.712) (-325.072) * (-326.011) (-326.158) [-328.699] (-329.624) -- 0:00:48
      94500 -- (-326.395) [-325.074] (-325.480) (-323.788) * (-325.292) (-326.935) (-326.172) [-326.753] -- 0:00:57
      95000 -- (-327.161) [-324.944] (-328.142) (-325.028) * (-326.207) (-327.235) (-328.005) [-326.514] -- 0:00:57

      Average standard deviation of split frequencies: 0.030497

      95500 -- (-324.802) (-326.391) [-324.285] (-324.889) * (-324.877) [-330.938] (-327.267) (-327.722) -- 0:00:56
      96000 -- (-323.770) [-324.337] (-324.423) (-324.202) * (-324.523) (-324.519) (-325.479) [-325.452] -- 0:00:56
      96500 -- (-324.252) [-326.924] (-325.596) (-323.368) * (-324.648) (-326.379) [-326.538] (-324.799) -- 0:00:56
      97000 -- (-323.905) [-327.636] (-323.937) (-324.061) * [-329.704] (-326.459) (-324.200) (-330.000) -- 0:00:55
      97500 -- [-324.901] (-325.100) (-325.189) (-325.571) * (-325.548) (-325.671) [-324.778] (-324.095) -- 0:00:55
      98000 -- (-325.672) (-324.170) (-324.620) [-326.112] * [-327.103] (-323.554) (-325.569) (-324.675) -- 0:00:55
      98500 -- (-324.648) [-327.785] (-324.133) (-327.648) * [-329.904] (-323.680) (-328.034) (-327.073) -- 0:00:54
      99000 -- (-325.058) (-325.457) (-325.109) [-325.999] * (-330.118) (-326.402) (-325.900) [-325.469] -- 0:00:54
      99500 -- [-325.807] (-328.043) (-325.803) (-328.413) * (-329.932) [-325.775] (-326.810) (-323.909) -- 0:00:54
      100000 -- [-324.813] (-334.512) (-323.688) (-330.772) * (-329.708) (-332.777) (-328.860) [-330.706] -- 0:00:54

      Average standard deviation of split frequencies: 0.028617

      100500 -- (-324.382) [-325.243] (-324.982) (-325.369) * (-326.622) (-324.619) [-326.498] (-325.237) -- 0:00:53
      101000 -- (-326.265) [-326.297] (-327.278) (-324.972) * [-327.729] (-327.024) (-327.708) (-325.213) -- 0:00:53
      101500 -- [-324.474] (-324.704) (-323.974) (-325.728) * [-327.120] (-324.779) (-324.390) (-325.660) -- 0:00:53
      102000 -- [-324.956] (-328.496) (-327.695) (-325.845) * [-324.347] (-323.967) (-327.815) (-325.587) -- 0:00:52
      102500 -- (-325.098) [-326.034] (-329.781) (-326.986) * [-328.200] (-326.313) (-327.825) (-323.570) -- 0:00:52
      103000 -- (-328.955) [-326.809] (-329.152) (-326.751) * (-325.289) [-324.679] (-324.954) (-327.818) -- 0:00:52
      103500 -- [-323.990] (-325.038) (-324.444) (-327.895) * (-324.677) (-325.149) [-325.956] (-328.852) -- 0:00:51
      104000 -- [-325.686] (-328.156) (-324.163) (-327.403) * (-325.836) (-324.273) [-325.582] (-324.086) -- 0:00:51
      104500 -- (-325.113) (-327.981) [-325.923] (-326.310) * (-324.333) [-324.488] (-330.796) (-324.467) -- 0:00:51
      105000 -- (-325.275) (-326.836) [-325.590] (-324.292) * (-326.077) (-324.623) (-327.739) [-332.271] -- 0:00:51

      Average standard deviation of split frequencies: 0.030896

      105500 -- (-326.247) (-328.917) (-328.118) [-323.400] * (-324.422) (-325.223) (-329.634) [-324.034] -- 0:00:50
      106000 -- (-328.379) (-326.601) [-325.208] (-324.435) * (-324.619) (-328.712) (-326.810) [-323.689] -- 0:00:50
      106500 -- [-325.267] (-325.176) (-325.725) (-324.817) * (-327.893) (-329.132) [-324.215] (-324.490) -- 0:00:50
      107000 -- (-324.670) (-329.899) (-327.798) [-323.903] * (-325.947) [-324.681] (-326.503) (-325.924) -- 0:00:50
      107500 -- (-323.833) (-325.075) [-326.909] (-324.723) * (-323.737) (-327.554) (-328.277) [-326.783] -- 0:00:49
      108000 -- (-324.787) (-325.959) (-328.202) [-325.433] * (-327.569) (-324.469) [-325.202] (-327.053) -- 0:00:49
      108500 -- [-328.576] (-327.564) (-326.180) (-327.258) * (-325.913) (-324.846) [-324.568] (-327.577) -- 0:00:49
      109000 -- [-325.357] (-325.008) (-325.085) (-328.070) * [-326.412] (-324.260) (-324.844) (-327.452) -- 0:00:49
      109500 -- (-327.892) [-327.593] (-324.376) (-324.352) * (-323.636) (-325.840) [-323.413] (-324.816) -- 0:00:48
      110000 -- (-327.509) (-326.879) [-324.917] (-324.082) * (-326.932) [-326.218] (-324.855) (-323.754) -- 0:00:48

      Average standard deviation of split frequencies: 0.028398

      110500 -- (-324.941) (-325.220) [-324.473] (-328.183) * (-324.380) (-326.077) [-323.882] (-325.838) -- 0:00:48
      111000 -- (-324.859) (-324.860) [-325.687] (-325.304) * (-325.587) [-326.552] (-323.696) (-327.771) -- 0:00:48
      111500 -- [-324.462] (-323.505) (-323.540) (-324.903) * (-325.223) (-327.739) (-328.628) [-324.035] -- 0:00:55
      112000 -- (-324.827) (-324.829) (-327.379) [-326.988] * (-327.419) [-325.371] (-324.614) (-327.338) -- 0:00:55
      112500 -- [-325.930] (-324.845) (-323.858) (-324.921) * [-324.410] (-323.642) (-326.170) (-324.247) -- 0:00:55
      113000 -- (-333.709) (-325.702) [-324.440] (-326.226) * (-325.998) [-325.875] (-325.634) (-325.286) -- 0:00:54
      113500 -- (-328.668) [-323.683] (-324.926) (-325.773) * (-326.478) (-324.893) [-327.580] (-326.240) -- 0:00:54
      114000 -- (-323.609) [-325.727] (-324.423) (-325.487) * (-331.977) (-326.668) [-323.960] (-329.236) -- 0:00:54
      114500 -- (-323.521) (-326.572) [-325.629] (-326.072) * (-335.063) [-325.133] (-326.923) (-326.493) -- 0:00:54
      115000 -- (-323.543) (-329.783) [-324.281] (-326.581) * (-326.213) [-324.001] (-333.021) (-326.427) -- 0:00:53

      Average standard deviation of split frequencies: 0.025512

      115500 -- (-323.878) (-328.342) [-323.453] (-326.939) * (-324.195) [-325.809] (-325.805) (-327.478) -- 0:00:53
      116000 -- (-323.789) (-325.791) [-326.524] (-324.792) * [-324.640] (-327.950) (-326.766) (-324.952) -- 0:00:53
      116500 -- [-324.061] (-324.475) (-325.082) (-323.633) * (-327.640) (-325.595) (-324.096) [-325.458] -- 0:00:53
      117000 -- (-324.020) (-325.520) (-323.433) [-324.843] * [-330.241] (-326.290) (-324.153) (-326.475) -- 0:00:52
      117500 -- (-323.682) (-326.341) (-324.390) [-325.967] * (-324.470) (-326.596) (-327.364) [-324.148] -- 0:00:52
      118000 -- (-326.360) (-325.776) (-328.233) [-325.310] * (-328.145) (-325.985) (-324.275) [-324.312] -- 0:00:52
      118500 -- [-324.069] (-326.508) (-326.833) (-327.556) * [-324.531] (-327.352) (-324.253) (-324.012) -- 0:00:52
      119000 -- [-325.284] (-326.655) (-326.432) (-326.760) * (-325.475) (-325.971) [-324.034] (-324.298) -- 0:00:51
      119500 -- (-327.101) (-328.870) [-328.581] (-324.648) * (-326.661) (-326.348) [-329.327] (-325.754) -- 0:00:51
      120000 -- (-325.757) (-325.728) (-326.242) [-324.647] * (-325.062) [-324.378] (-327.957) (-325.048) -- 0:00:51

      Average standard deviation of split frequencies: 0.021831

      120500 -- (-323.719) (-325.008) [-326.560] (-324.105) * (-324.536) (-323.797) (-328.633) [-325.389] -- 0:00:51
      121000 -- (-331.470) (-326.315) (-325.889) [-324.777] * (-327.361) (-323.332) (-325.195) [-328.548] -- 0:00:50
      121500 -- (-328.407) (-324.805) [-325.183] (-324.732) * [-323.582] (-324.260) (-332.508) (-324.670) -- 0:00:50
      122000 -- [-325.145] (-326.164) (-329.895) (-325.479) * (-325.486) (-326.096) [-325.323] (-326.265) -- 0:00:50
      122500 -- [-327.852] (-325.034) (-326.068) (-325.332) * (-327.800) (-324.994) [-326.820] (-326.190) -- 0:00:50
      123000 -- (-325.425) [-324.674] (-328.913) (-325.277) * [-327.348] (-328.241) (-326.491) (-326.285) -- 0:00:49
      123500 -- (-324.894) (-326.660) (-326.338) [-325.096] * (-327.422) [-325.242] (-328.387) (-330.564) -- 0:00:49
      124000 -- [-325.511] (-325.090) (-325.979) (-323.975) * (-324.563) (-324.489) (-324.268) [-323.447] -- 0:00:49
      124500 -- [-326.013] (-326.550) (-325.708) (-325.497) * [-327.371] (-325.961) (-326.474) (-328.016) -- 0:00:49
      125000 -- (-327.512) [-329.028] (-327.030) (-327.314) * (-324.904) [-324.678] (-326.341) (-324.077) -- 0:00:49

      Average standard deviation of split frequencies: 0.019954

      125500 -- [-326.302] (-323.647) (-326.722) (-327.683) * (-324.896) [-323.933] (-324.214) (-323.778) -- 0:00:48
      126000 -- (-324.440) (-325.046) (-326.687) [-323.983] * (-326.764) [-325.400] (-328.066) (-326.764) -- 0:00:48
      126500 -- (-324.932) [-330.110] (-325.692) (-324.059) * (-327.352) [-323.402] (-329.479) (-323.803) -- 0:00:48
      127000 -- (-325.195) (-325.460) (-324.017) [-324.110] * (-326.260) (-323.499) (-325.152) [-324.479] -- 0:00:48
      127500 -- [-326.449] (-328.478) (-324.530) (-325.136) * [-330.997] (-324.180) (-324.850) (-326.389) -- 0:00:47
      128000 -- (-325.295) (-325.006) (-327.002) [-323.292] * (-329.561) (-324.406) (-326.564) [-323.851] -- 0:00:47
      128500 -- (-323.695) (-325.237) (-326.985) [-326.283] * (-327.639) (-324.736) (-323.953) [-323.401] -- 0:00:47
      129000 -- [-324.098] (-323.937) (-326.130) (-324.606) * (-324.773) [-324.812] (-324.026) (-324.567) -- 0:00:54
      129500 -- [-323.562] (-326.002) (-330.173) (-326.449) * (-326.553) (-324.634) (-324.425) [-325.097] -- 0:00:53
      130000 -- [-323.776] (-326.679) (-324.778) (-323.866) * (-331.774) [-325.693] (-329.690) (-328.602) -- 0:00:53

      Average standard deviation of split frequencies: 0.019041

      130500 -- (-325.497) [-327.579] (-327.776) (-323.727) * [-324.805] (-325.495) (-334.920) (-325.792) -- 0:00:53
      131000 -- [-325.211] (-326.643) (-331.635) (-326.603) * (-326.019) [-324.445] (-327.503) (-327.849) -- 0:00:53
      131500 -- [-325.624] (-326.640) (-326.109) (-325.386) * (-326.991) (-327.386) [-325.093] (-324.101) -- 0:00:52
      132000 -- (-324.784) (-327.566) (-324.833) [-324.285] * (-324.771) (-324.829) (-326.677) [-324.555] -- 0:00:52
      132500 -- (-325.484) [-325.092] (-325.010) (-325.217) * (-330.126) (-324.966) (-332.394) [-325.604] -- 0:00:52
      133000 -- (-324.681) (-324.476) [-327.321] (-327.092) * (-329.279) [-325.691] (-328.179) (-324.158) -- 0:00:52
      133500 -- (-325.255) (-332.776) [-325.347] (-326.220) * (-325.553) [-324.577] (-326.875) (-325.946) -- 0:00:51
      134000 -- [-325.953] (-327.366) (-326.589) (-326.209) * (-325.913) (-324.908) (-325.538) [-325.530] -- 0:00:51
      134500 -- (-323.513) (-325.321) [-327.402] (-325.516) * (-326.537) [-325.806] (-326.703) (-326.020) -- 0:00:51
      135000 -- (-324.551) [-323.715] (-329.907) (-324.220) * (-324.261) (-326.654) [-326.678] (-327.740) -- 0:00:51

      Average standard deviation of split frequencies: 0.022338

      135500 -- (-326.461) [-324.893] (-329.976) (-326.793) * [-324.645] (-324.514) (-325.272) (-326.076) -- 0:00:51
      136000 -- (-324.105) [-325.088] (-328.894) (-325.787) * (-323.839) (-326.474) [-324.734] (-325.563) -- 0:00:50
      136500 -- (-324.575) (-327.608) [-326.208] (-324.701) * (-330.055) [-326.699] (-330.165) (-326.782) -- 0:00:50
      137000 -- (-326.100) (-323.929) (-325.423) [-325.770] * (-327.820) (-324.735) [-325.751] (-326.411) -- 0:00:50
      137500 -- (-327.372) (-330.320) [-324.487] (-326.626) * [-324.264] (-326.660) (-324.743) (-326.445) -- 0:00:50
      138000 -- [-327.371] (-326.061) (-325.368) (-325.267) * (-323.653) (-324.619) [-330.017] (-326.343) -- 0:00:49
      138500 -- (-326.935) (-326.039) [-325.706] (-325.165) * (-325.172) [-323.763] (-327.638) (-332.039) -- 0:00:49
      139000 -- (-323.423) [-326.187] (-325.943) (-325.008) * (-323.486) (-325.045) [-324.221] (-328.697) -- 0:00:49
      139500 -- (-325.406) [-324.344] (-325.410) (-324.171) * [-325.246] (-325.307) (-326.311) (-324.062) -- 0:00:49
      140000 -- (-325.285) (-325.060) [-327.094] (-328.000) * (-324.831) [-325.366] (-325.421) (-324.858) -- 0:00:49

      Average standard deviation of split frequencies: 0.020989

      140500 -- [-325.176] (-325.898) (-327.803) (-326.062) * (-325.630) [-324.910] (-326.020) (-327.181) -- 0:00:48
      141000 -- (-324.353) (-324.654) [-324.448] (-328.069) * [-326.324] (-327.801) (-324.306) (-326.127) -- 0:00:48
      141500 -- [-325.681] (-326.322) (-325.271) (-330.562) * (-328.434) [-326.804] (-323.840) (-334.418) -- 0:00:48
      142000 -- (-325.289) (-325.262) (-325.808) [-326.748] * [-324.228] (-324.180) (-323.964) (-326.784) -- 0:00:48
      142500 -- [-326.238] (-325.954) (-325.140) (-324.130) * (-325.346) (-324.300) (-325.949) [-326.451] -- 0:00:48
      143000 -- (-326.043) [-323.245] (-325.762) (-326.674) * (-325.035) (-328.533) (-326.781) [-324.347] -- 0:00:47
      143500 -- (-325.955) [-325.621] (-326.082) (-327.901) * (-327.872) (-329.185) [-324.669] (-326.135) -- 0:00:47
      144000 -- (-323.682) (-331.145) [-325.291] (-327.165) * (-328.147) (-325.160) (-328.991) [-327.892] -- 0:00:47
      144500 -- (-324.751) (-342.105) [-325.434] (-325.427) * (-328.563) (-326.615) (-324.002) [-325.506] -- 0:00:47
      145000 -- (-325.843) (-324.868) [-325.483] (-326.928) * (-328.828) [-325.516] (-324.441) (-328.304) -- 0:00:47

      Average standard deviation of split frequencies: 0.021794

      145500 -- (-324.321) (-324.456) (-323.425) [-325.855] * [-325.728] (-325.069) (-323.699) (-326.116) -- 0:00:46
      146000 -- (-328.400) (-324.623) [-327.240] (-326.079) * (-324.633) (-325.853) [-328.391] (-326.632) -- 0:00:46
      146500 -- (-325.244) (-324.481) (-326.498) [-325.415] * [-324.982] (-330.367) (-327.756) (-326.958) -- 0:00:52
      147000 -- (-326.491) (-325.436) [-324.281] (-331.191) * (-323.801) (-330.471) [-325.213] (-325.873) -- 0:00:52
      147500 -- (-327.583) (-327.053) (-324.841) [-325.387] * [-323.439] (-328.667) (-326.547) (-324.379) -- 0:00:52
      148000 -- (-325.111) (-323.406) (-324.201) [-327.889] * (-327.543) (-324.804) [-325.548] (-324.483) -- 0:00:51
      148500 -- (-324.065) [-325.978] (-324.250) (-331.085) * (-324.223) (-324.725) (-325.415) [-324.878] -- 0:00:51
      149000 -- (-324.418) (-324.163) (-324.387) [-324.275] * (-326.149) [-325.848] (-325.373) (-324.271) -- 0:00:51
      149500 -- (-327.425) (-324.937) (-325.480) [-326.121] * (-325.848) (-329.755) (-330.160) [-324.433] -- 0:00:51
      150000 -- (-328.964) (-328.284) [-324.190] (-325.197) * (-325.533) (-328.823) (-329.332) [-323.676] -- 0:00:51

      Average standard deviation of split frequencies: 0.022371

      150500 -- (-328.556) (-327.340) [-325.352] (-325.579) * (-327.516) (-324.600) (-328.339) [-324.030] -- 0:00:50
      151000 -- (-327.316) (-330.312) [-325.761] (-326.045) * (-324.640) [-324.315] (-326.509) (-325.538) -- 0:00:50
      151500 -- (-324.090) [-324.596] (-326.386) (-325.234) * [-325.614] (-325.533) (-325.729) (-324.059) -- 0:00:50
      152000 -- (-324.356) (-325.115) [-323.848] (-328.040) * (-323.713) (-324.282) (-325.587) [-325.095] -- 0:00:50
      152500 -- [-325.748] (-327.306) (-325.036) (-324.593) * (-325.210) (-324.898) (-323.857) [-326.476] -- 0:00:50
      153000 -- (-337.486) (-324.858) [-326.823] (-326.329) * (-325.843) (-328.178) (-324.064) [-325.087] -- 0:00:49
      153500 -- (-330.314) (-326.991) (-326.101) [-325.657] * (-328.775) (-326.451) (-324.887) [-328.079] -- 0:00:49
      154000 -- (-328.617) (-326.688) [-325.656] (-326.308) * (-327.502) (-327.492) (-325.433) [-324.709] -- 0:00:49
      154500 -- [-326.930] (-326.230) (-323.477) (-325.174) * (-325.575) (-325.543) (-328.104) [-327.568] -- 0:00:49
      155000 -- (-325.858) (-324.109) [-325.495] (-326.215) * (-326.165) (-323.871) (-326.303) [-324.079] -- 0:00:49

      Average standard deviation of split frequencies: 0.022266

      155500 -- (-326.610) (-324.223) (-326.016) [-326.788] * (-325.077) [-323.611] (-325.821) (-324.913) -- 0:00:48
      156000 -- (-326.168) (-325.560) (-326.307) [-325.978] * (-326.003) (-324.976) [-326.384] (-324.253) -- 0:00:48
      156500 -- [-329.778] (-325.166) (-323.918) (-324.627) * [-326.345] (-325.805) (-325.956) (-323.627) -- 0:00:48
      157000 -- (-325.380) (-325.902) (-326.198) [-326.186] * [-324.660] (-330.658) (-326.239) (-328.670) -- 0:00:48
      157500 -- (-326.180) [-324.886] (-324.394) (-327.903) * (-325.134) (-326.069) [-328.665] (-323.722) -- 0:00:48
      158000 -- [-327.147] (-324.332) (-324.738) (-323.778) * (-324.063) (-327.900) [-327.004] (-327.912) -- 0:00:47
      158500 -- (-324.197) [-326.329] (-324.137) (-326.167) * [-324.325] (-329.146) (-324.995) (-325.059) -- 0:00:47
      159000 -- (-324.215) [-325.141] (-328.646) (-324.960) * (-325.680) (-326.129) (-326.164) [-325.732] -- 0:00:47
      159500 -- (-324.241) (-325.328) [-327.821] (-326.831) * [-326.153] (-326.305) (-325.598) (-324.420) -- 0:00:47
      160000 -- [-326.304] (-326.019) (-327.087) (-325.912) * (-328.918) (-327.509) (-325.071) [-326.188] -- 0:00:47

      Average standard deviation of split frequencies: 0.020538

      160500 -- (-327.190) [-325.162] (-324.753) (-323.574) * [-325.459] (-327.269) (-327.018) (-327.223) -- 0:00:47
      161000 -- (-324.925) (-329.469) (-323.475) [-324.931] * (-324.642) (-326.696) (-325.047) [-325.722] -- 0:00:46
      161500 -- (-325.892) (-328.319) [-326.672] (-326.654) * [-325.638] (-324.649) (-329.604) (-326.658) -- 0:00:46
      162000 -- [-324.243] (-325.042) (-326.149) (-325.303) * [-325.683] (-326.224) (-326.710) (-325.750) -- 0:00:46
      162500 -- (-324.001) [-326.169] (-326.400) (-329.140) * (-323.822) (-325.949) [-325.549] (-327.587) -- 0:00:46
      163000 -- (-324.829) [-327.021] (-324.325) (-325.659) * (-323.622) (-326.176) [-324.554] (-326.002) -- 0:00:46
      163500 -- (-327.598) [-328.895] (-325.175) (-328.983) * (-326.370) (-326.786) [-326.173] (-327.642) -- 0:00:51
      164000 -- [-326.043] (-325.787) (-323.632) (-327.310) * (-326.101) [-328.101] (-323.398) (-325.059) -- 0:00:50
      164500 -- (-326.318) (-327.767) (-326.936) [-324.564] * (-329.214) [-324.010] (-324.322) (-329.604) -- 0:00:50
      165000 -- [-327.645] (-326.706) (-324.750) (-324.648) * (-327.909) (-324.159) (-323.419) [-331.099] -- 0:00:50

      Average standard deviation of split frequencies: 0.020730

      165500 -- (-324.817) (-326.276) [-323.793] (-329.106) * (-328.107) (-324.921) [-323.750] (-324.899) -- 0:00:50
      166000 -- [-327.036] (-327.327) (-326.455) (-326.452) * (-329.926) (-328.405) (-325.784) [-324.029] -- 0:00:50
      166500 -- (-328.550) [-324.881] (-327.088) (-326.109) * [-327.495] (-325.567) (-324.185) (-325.874) -- 0:00:50
      167000 -- [-324.631] (-325.663) (-328.340) (-324.372) * (-325.382) (-323.869) [-324.440] (-324.841) -- 0:00:49
      167500 -- (-327.431) (-327.186) (-327.553) [-325.461] * (-326.913) [-325.128] (-327.374) (-324.032) -- 0:00:49
      168000 -- (-324.804) (-329.504) (-332.476) [-325.163] * (-325.333) (-325.864) [-324.753] (-324.364) -- 0:00:49
      168500 -- (-324.842) (-329.721) [-329.878] (-326.238) * (-328.046) (-324.409) [-326.352] (-325.585) -- 0:00:49
      169000 -- (-324.143) (-330.750) (-327.577) [-323.522] * (-326.441) (-330.844) [-325.072] (-328.015) -- 0:00:49
      169500 -- (-325.592) (-331.074) (-324.442) [-327.038] * (-325.420) (-327.858) (-324.974) [-328.002] -- 0:00:48
      170000 -- (-327.542) (-323.733) (-326.298) [-324.842] * [-323.448] (-325.182) (-324.631) (-324.073) -- 0:00:48

      Average standard deviation of split frequencies: 0.020302

      170500 -- (-325.487) (-324.664) (-325.411) [-324.081] * (-324.670) (-324.455) [-324.591] (-325.340) -- 0:00:48
      171000 -- (-329.079) (-324.755) (-324.487) [-324.338] * (-323.879) (-325.186) [-326.195] (-326.079) -- 0:00:48
      171500 -- (-325.698) (-323.996) [-325.257] (-323.564) * (-324.996) (-326.486) (-324.348) [-327.009] -- 0:00:48
      172000 -- [-327.304] (-324.848) (-323.996) (-325.818) * [-326.506] (-329.125) (-326.025) (-327.293) -- 0:00:48
      172500 -- (-325.861) (-327.704) [-325.667] (-323.807) * [-324.420] (-326.795) (-327.017) (-326.029) -- 0:00:47
      173000 -- (-326.945) [-324.846] (-324.630) (-324.396) * (-326.680) (-324.241) [-324.438] (-326.898) -- 0:00:47
      173500 -- (-325.908) (-326.298) [-325.939] (-328.368) * (-324.655) (-324.277) (-326.113) [-324.968] -- 0:00:47
      174000 -- (-324.526) [-325.496] (-324.602) (-323.528) * (-326.438) (-325.356) [-326.156] (-324.652) -- 0:00:47
      174500 -- (-325.712) [-326.250] (-324.871) (-328.635) * (-327.859) (-325.273) (-324.775) [-325.064] -- 0:00:47
      175000 -- (-329.723) (-327.634) [-325.420] (-325.886) * (-324.481) [-324.582] (-325.881) (-324.370) -- 0:00:47

      Average standard deviation of split frequencies: 0.019877

      175500 -- (-326.533) (-324.126) (-324.135) [-326.416] * (-324.480) (-325.336) (-325.474) [-325.788] -- 0:00:46
      176000 -- [-326.166] (-326.079) (-324.529) (-326.029) * (-324.249) (-324.293) [-325.081] (-324.681) -- 0:00:46
      176500 -- (-327.701) [-324.929] (-327.393) (-329.612) * (-323.983) [-324.111] (-325.831) (-324.825) -- 0:00:46
      177000 -- (-324.860) (-325.078) [-326.491] (-327.933) * [-324.963] (-325.229) (-325.244) (-324.754) -- 0:00:46
      177500 -- [-328.243] (-324.198) (-323.889) (-324.664) * (-325.880) (-324.263) (-328.810) [-323.918] -- 0:00:46
      178000 -- (-327.292) (-324.253) [-324.692] (-325.037) * (-326.020) (-325.663) [-326.136] (-326.510) -- 0:00:46
      178500 -- (-327.956) [-325.441] (-324.955) (-327.447) * (-327.539) [-324.924] (-326.020) (-324.372) -- 0:00:46
      179000 -- (-328.206) (-326.999) (-325.744) [-325.099] * (-325.245) (-327.263) [-325.882] (-325.790) -- 0:00:45
      179500 -- (-325.631) (-325.683) [-326.724] (-328.197) * (-323.949) (-325.295) (-325.049) [-324.307] -- 0:00:45
      180000 -- (-326.382) (-323.555) [-325.381] (-328.774) * (-324.892) (-330.476) (-327.205) [-325.358] -- 0:00:45

      Average standard deviation of split frequencies: 0.019714

      180500 -- [-325.292] (-325.480) (-327.828) (-329.314) * [-324.532] (-324.247) (-325.713) (-324.055) -- 0:00:49
      181000 -- (-325.310) (-327.876) [-326.469] (-328.636) * (-326.268) [-325.334] (-327.202) (-326.417) -- 0:00:49
      181500 -- [-328.142] (-325.041) (-325.398) (-324.315) * (-324.505) (-324.818) (-325.407) [-326.192] -- 0:00:49
      182000 -- [-331.069] (-327.911) (-325.084) (-323.733) * (-326.824) (-324.893) [-325.413] (-325.675) -- 0:00:49
      182500 -- (-327.811) [-326.163] (-326.545) (-331.536) * (-326.499) (-327.450) (-326.852) [-327.786] -- 0:00:49
      183000 -- [-324.961] (-325.926) (-326.848) (-328.195) * (-328.179) (-325.327) [-328.461] (-326.377) -- 0:00:49
      183500 -- (-326.221) [-325.492] (-324.309) (-325.043) * (-325.111) [-323.504] (-327.475) (-328.954) -- 0:00:48
      184000 -- (-326.138) (-325.679) (-324.313) [-325.867] * (-326.630) (-323.785) [-323.795] (-330.379) -- 0:00:48
      184500 -- [-327.546] (-325.443) (-325.708) (-326.598) * [-327.311] (-324.769) (-324.715) (-325.539) -- 0:00:48
      185000 -- (-325.451) (-325.952) [-323.896] (-325.792) * (-327.565) [-325.237] (-325.918) (-328.594) -- 0:00:48

      Average standard deviation of split frequencies: 0.019642

      185500 -- (-324.944) [-326.382] (-323.807) (-325.836) * (-327.496) (-324.372) [-328.188] (-325.293) -- 0:00:48
      186000 -- (-325.098) (-327.340) (-331.407) [-325.642] * (-325.957) (-325.733) [-324.353] (-323.868) -- 0:00:48
      186500 -- (-326.050) (-327.362) (-326.012) [-324.999] * (-324.803) [-327.684] (-326.202) (-326.350) -- 0:00:47
      187000 -- (-324.927) (-324.720) (-329.386) [-324.964] * [-324.824] (-325.609) (-327.948) (-324.333) -- 0:00:47
      187500 -- (-325.326) (-325.366) [-325.106] (-324.630) * (-325.301) [-324.992] (-324.977) (-327.166) -- 0:00:47
      188000 -- (-327.153) [-325.343] (-328.183) (-330.541) * [-325.377] (-328.619) (-326.057) (-325.692) -- 0:00:47
      188500 -- (-326.416) [-326.702] (-324.523) (-331.970) * [-324.559] (-325.708) (-327.437) (-324.797) -- 0:00:47
      189000 -- (-327.312) (-327.784) (-324.479) [-325.183] * (-329.137) (-326.694) (-323.655) [-326.532] -- 0:00:47
      189500 -- (-324.334) (-324.361) (-326.920) [-323.887] * (-330.253) (-325.661) (-326.110) [-323.703] -- 0:00:47
      190000 -- [-324.032] (-328.899) (-323.501) (-327.969) * (-325.969) [-326.214] (-330.709) (-324.979) -- 0:00:46

      Average standard deviation of split frequencies: 0.018720

      190500 -- (-327.102) [-324.569] (-327.506) (-332.270) * (-325.775) (-329.846) [-326.713] (-328.247) -- 0:00:46
      191000 -- (-324.488) (-324.025) [-326.717] (-324.998) * [-324.629] (-326.335) (-327.163) (-325.877) -- 0:00:46
      191500 -- [-325.156] (-325.656) (-326.394) (-327.235) * (-329.109) (-325.887) [-324.700] (-328.494) -- 0:00:46
      192000 -- (-325.290) (-326.623) [-330.574] (-325.857) * [-326.896] (-323.505) (-325.551) (-326.476) -- 0:00:46
      192500 -- (-325.828) (-330.337) (-324.851) [-324.408] * [-324.115] (-327.659) (-329.351) (-325.789) -- 0:00:46
      193000 -- (-323.616) (-325.555) [-323.491] (-326.384) * (-324.456) (-323.866) [-324.646] (-327.950) -- 0:00:45
      193500 -- (-326.866) [-324.008] (-326.933) (-323.515) * (-324.531) (-324.402) [-325.047] (-325.012) -- 0:00:45
      194000 -- (-330.487) [-323.803] (-325.182) (-330.724) * (-325.736) (-324.116) [-324.648] (-324.042) -- 0:00:45
      194500 -- (-326.965) [-323.889] (-324.560) (-324.991) * (-327.440) (-325.342) [-324.187] (-326.182) -- 0:00:45
      195000 -- (-331.776) (-325.131) [-325.411] (-325.220) * (-326.924) (-323.605) (-327.142) [-326.058] -- 0:00:45

      Average standard deviation of split frequencies: 0.017678

      195500 -- (-323.955) (-326.007) [-326.449] (-325.130) * (-327.482) (-324.607) (-327.661) [-328.097] -- 0:00:45
      196000 -- (-324.846) (-325.860) (-323.961) [-324.520] * (-327.557) (-326.943) (-331.099) [-325.211] -- 0:00:45
      196500 -- (-325.519) (-324.631) (-326.216) [-325.338] * (-324.951) (-325.975) (-324.400) [-324.286] -- 0:00:44
      197000 -- [-324.358] (-327.949) (-330.330) (-325.110) * (-325.712) [-326.010] (-325.494) (-324.060) -- 0:00:44
      197500 -- (-325.963) (-325.307) [-326.396] (-324.630) * (-330.202) (-324.486) (-325.214) [-324.303] -- 0:00:48
      198000 -- (-324.972) (-324.893) (-325.445) [-326.058] * (-329.794) (-326.313) [-325.840] (-324.393) -- 0:00:48
      198500 -- (-326.684) [-325.163] (-326.754) (-325.420) * (-324.898) (-323.754) (-326.455) [-325.288] -- 0:00:48
      199000 -- (-326.636) (-331.565) (-328.361) [-327.350] * (-325.251) (-324.458) (-327.341) [-325.835] -- 0:00:48
      199500 -- (-324.615) (-335.408) [-326.466] (-324.987) * (-326.724) (-323.920) (-324.409) [-324.803] -- 0:00:48
      200000 -- (-325.314) [-325.368] (-327.246) (-327.016) * (-327.134) (-324.164) [-326.239] (-324.193) -- 0:00:48

      Average standard deviation of split frequencies: 0.016939

      200500 -- (-323.780) (-324.018) (-325.491) [-327.769] * (-324.132) [-325.117] (-325.746) (-323.725) -- 0:00:47
      201000 -- (-326.145) (-324.196) (-324.290) [-324.541] * (-323.482) [-328.349] (-324.459) (-329.875) -- 0:00:47
      201500 -- (-325.337) [-324.475] (-325.472) (-327.649) * (-325.265) [-326.767] (-326.638) (-323.590) -- 0:00:47
      202000 -- (-324.329) (-327.246) [-324.445] (-325.096) * [-327.802] (-325.850) (-325.066) (-326.909) -- 0:00:47
      202500 -- (-326.131) [-327.368] (-324.837) (-324.986) * (-326.010) (-325.738) (-329.558) [-324.294] -- 0:00:47
      203000 -- (-325.523) (-324.373) [-326.111] (-327.202) * (-326.087) [-325.764] (-327.273) (-325.353) -- 0:00:47
      203500 -- (-325.907) (-334.641) [-326.472] (-324.972) * (-323.849) [-328.511] (-328.839) (-326.524) -- 0:00:46
      204000 -- (-326.541) (-325.037) (-325.083) [-325.647] * (-329.546) (-331.926) [-323.531] (-325.898) -- 0:00:46
      204500 -- (-327.719) (-328.483) [-324.723] (-324.712) * [-326.977] (-325.117) (-323.722) (-324.889) -- 0:00:46
      205000 -- [-323.809] (-327.335) (-328.129) (-324.384) * [-324.871] (-325.870) (-324.641) (-325.651) -- 0:00:46

      Average standard deviation of split frequencies: 0.015176

      205500 -- (-326.581) (-328.872) (-331.562) [-323.688] * (-324.893) (-326.664) (-325.317) [-328.404] -- 0:00:46
      206000 -- (-325.931) (-327.070) [-325.955] (-324.608) * (-326.140) (-325.283) [-325.183] (-327.390) -- 0:00:46
      206500 -- (-328.338) (-325.580) [-324.889] (-326.397) * (-325.721) [-326.747] (-326.324) (-325.248) -- 0:00:46
      207000 -- (-331.633) [-327.952] (-326.588) (-326.854) * (-328.687) [-326.281] (-329.703) (-325.648) -- 0:00:45
      207500 -- (-326.038) (-327.111) (-325.502) [-324.443] * (-325.579) (-330.199) (-324.888) [-327.671] -- 0:00:45
      208000 -- (-327.210) [-325.010] (-324.200) (-327.366) * [-325.166] (-325.110) (-323.997) (-323.975) -- 0:00:45
      208500 -- [-324.790] (-325.591) (-327.093) (-324.612) * (-325.862) [-324.792] (-326.814) (-326.237) -- 0:00:45
      209000 -- [-325.918] (-324.360) (-324.865) (-323.804) * (-325.749) [-326.368] (-326.398) (-330.039) -- 0:00:45
      209500 -- (-324.235) (-324.522) [-325.044] (-324.900) * (-324.685) (-327.721) [-325.672] (-326.256) -- 0:00:45
      210000 -- [-324.255] (-325.955) (-328.135) (-325.053) * (-324.798) [-325.623] (-328.123) (-327.026) -- 0:00:45

      Average standard deviation of split frequencies: 0.016161

      210500 -- (-325.445) [-325.413] (-325.729) (-329.626) * (-328.885) [-324.995] (-324.323) (-328.448) -- 0:00:45
      211000 -- (-325.979) (-324.122) (-324.503) [-324.251] * [-326.270] (-328.811) (-325.007) (-327.764) -- 0:00:44
      211500 -- [-325.727] (-325.012) (-326.250) (-323.692) * (-326.145) (-326.673) [-325.109] (-326.770) -- 0:00:44
      212000 -- (-325.714) [-323.574] (-324.288) (-324.585) * (-324.470) (-327.424) (-324.514) [-325.259] -- 0:00:44
      212500 -- (-329.310) (-327.156) (-326.138) [-328.113] * (-326.772) (-326.784) [-325.113] (-325.786) -- 0:00:44
      213000 -- (-331.400) (-325.523) (-325.500) [-326.326] * [-326.267] (-328.685) (-325.466) (-325.096) -- 0:00:44
      213500 -- (-325.628) (-325.811) (-328.937) [-323.665] * (-328.510) (-324.148) (-325.637) [-324.710] -- 0:00:44
      214000 -- (-325.087) (-326.148) (-324.552) [-324.752] * (-327.523) (-323.993) [-326.321] (-327.610) -- 0:00:44
      214500 -- (-324.524) [-330.695] (-327.606) (-324.973) * (-324.464) (-326.144) (-326.054) [-326.242] -- 0:00:43
      215000 -- (-325.693) [-329.715] (-328.488) (-324.375) * (-328.417) (-330.130) (-326.194) [-325.106] -- 0:00:47

      Average standard deviation of split frequencies: 0.016611

      215500 -- (-325.512) [-326.966] (-326.674) (-323.997) * (-329.106) (-328.419) (-327.245) [-325.277] -- 0:00:47
      216000 -- (-328.248) [-329.251] (-324.833) (-324.189) * (-327.013) [-328.370] (-326.781) (-325.985) -- 0:00:47
      216500 -- (-323.976) [-324.617] (-324.725) (-325.194) * (-330.171) [-325.829] (-324.836) (-329.234) -- 0:00:47
      217000 -- (-326.016) [-324.948] (-328.771) (-325.043) * (-324.941) (-329.972) (-323.345) [-329.824] -- 0:00:46
      217500 -- [-324.828] (-324.133) (-325.374) (-325.474) * (-323.449) (-326.691) (-324.628) [-329.650] -- 0:00:46
      218000 -- (-327.701) (-325.188) (-326.527) [-325.347] * (-324.956) (-329.305) [-324.958] (-323.572) -- 0:00:46
      218500 -- (-323.872) (-325.211) (-324.949) [-329.128] * [-329.811] (-324.312) (-331.400) (-326.943) -- 0:00:46
      219000 -- [-323.877] (-325.801) (-324.691) (-326.733) * (-329.189) (-325.333) (-328.239) [-324.406] -- 0:00:46
      219500 -- [-324.560] (-327.475) (-325.192) (-326.438) * [-326.353] (-323.770) (-329.485) (-327.931) -- 0:00:46
      220000 -- (-324.865) (-329.456) (-325.565) [-331.614] * (-324.202) (-326.144) (-329.203) [-325.681] -- 0:00:46

      Average standard deviation of split frequencies: 0.017090

      220500 -- (-327.211) (-323.958) [-326.390] (-329.267) * (-326.460) (-326.471) (-333.248) [-326.172] -- 0:00:45
      221000 -- [-326.378] (-326.574) (-324.297) (-324.801) * (-326.474) [-324.295] (-326.306) (-327.080) -- 0:00:45
      221500 -- [-327.581] (-326.985) (-325.700) (-330.389) * (-324.821) (-325.369) [-325.271] (-328.605) -- 0:00:45
      222000 -- (-325.529) [-324.174] (-325.848) (-324.730) * (-328.328) [-326.424] (-327.627) (-331.821) -- 0:00:45
      222500 -- (-325.036) (-324.353) [-327.110] (-324.562) * (-325.863) (-326.034) [-323.325] (-326.789) -- 0:00:45
      223000 -- [-325.314] (-324.372) (-326.490) (-323.696) * [-326.858] (-324.653) (-328.984) (-327.328) -- 0:00:45
      223500 -- (-324.675) (-325.997) (-326.829) [-324.494] * (-327.844) (-323.621) [-325.739] (-325.870) -- 0:00:45
      224000 -- [-325.045] (-323.981) (-326.001) (-323.958) * [-328.656] (-327.201) (-327.388) (-323.710) -- 0:00:45
      224500 -- (-325.224) (-325.673) (-326.007) [-325.656] * (-328.246) [-324.473] (-327.096) (-324.842) -- 0:00:44
      225000 -- (-326.310) (-325.433) (-327.515) [-325.014] * (-330.725) [-325.959] (-324.129) (-326.170) -- 0:00:44

      Average standard deviation of split frequencies: 0.016571

      225500 -- (-328.543) [-326.135] (-327.624) (-326.115) * [-324.115] (-325.748) (-326.166) (-324.070) -- 0:00:44
      226000 -- [-325.895] (-325.652) (-323.743) (-327.719) * [-325.435] (-324.584) (-326.949) (-327.942) -- 0:00:44
      226500 -- (-328.401) [-325.084] (-324.310) (-332.747) * (-330.050) (-324.889) [-325.204] (-326.325) -- 0:00:44
      227000 -- (-325.426) (-326.950) (-324.625) [-329.384] * (-325.107) (-330.023) [-324.830] (-324.657) -- 0:00:44
      227500 -- (-325.954) (-326.259) [-325.875] (-324.713) * (-326.022) (-327.444) (-327.628) [-324.329] -- 0:00:44
      228000 -- (-325.177) (-326.502) [-325.123] (-326.329) * (-324.979) (-324.462) [-323.837] (-326.434) -- 0:00:44
      228500 -- (-325.695) (-324.706) [-325.434] (-325.805) * (-327.036) (-326.386) (-325.907) [-326.000] -- 0:00:47
      229000 -- (-324.471) (-326.217) [-324.713] (-324.800) * (-324.397) (-323.978) [-325.072] (-326.446) -- 0:00:47
      229500 -- (-325.675) [-324.374] (-327.603) (-324.093) * (-324.227) [-326.434] (-324.002) (-323.778) -- 0:00:47
      230000 -- (-327.746) [-324.494] (-326.492) (-324.432) * (-325.268) [-328.931] (-329.905) (-324.471) -- 0:00:46

      Average standard deviation of split frequencies: 0.017371

      230500 -- [-328.363] (-323.930) (-327.650) (-325.888) * (-325.807) [-326.480] (-324.882) (-326.237) -- 0:00:46
      231000 -- (-325.360) (-324.512) [-326.006] (-326.232) * (-329.295) (-327.432) [-325.559] (-326.022) -- 0:00:46
      231500 -- (-326.385) [-325.982] (-323.873) (-326.357) * [-325.761] (-325.537) (-325.559) (-326.575) -- 0:00:46
      232000 -- (-324.819) (-325.601) (-325.327) [-325.821] * (-329.006) (-326.431) [-325.913] (-327.494) -- 0:00:46
      232500 -- (-329.881) [-323.613] (-329.765) (-327.724) * (-325.248) [-327.376] (-324.198) (-324.728) -- 0:00:46
      233000 -- (-328.283) (-326.002) (-326.839) [-327.678] * (-328.463) (-326.188) (-325.350) [-324.303] -- 0:00:46
      233500 -- [-324.490] (-325.529) (-326.077) (-326.414) * (-327.811) [-326.827] (-323.808) (-323.791) -- 0:00:45
      234000 -- (-324.966) (-323.850) (-324.502) [-327.458] * [-324.326] (-325.786) (-324.659) (-325.012) -- 0:00:45
      234500 -- (-327.202) [-327.755] (-323.418) (-327.470) * (-330.910) (-325.982) [-326.635] (-331.865) -- 0:00:45
      235000 -- [-324.169] (-324.284) (-324.071) (-326.446) * (-330.072) [-325.961] (-326.421) (-328.572) -- 0:00:45

      Average standard deviation of split frequencies: 0.016757

      235500 -- (-325.713) (-326.605) [-324.419] (-332.295) * (-327.572) (-325.584) (-327.459) [-324.845] -- 0:00:45
      236000 -- (-327.290) (-327.152) (-325.336) [-331.498] * (-328.856) (-325.615) (-326.351) [-323.882] -- 0:00:45
      236500 -- [-324.674] (-327.784) (-326.109) (-325.224) * (-323.731) (-326.295) (-326.113) [-323.782] -- 0:00:45
      237000 -- (-323.824) [-324.569] (-325.268) (-327.800) * (-324.252) [-324.852] (-326.203) (-326.072) -- 0:00:45
      237500 -- (-326.962) (-327.249) (-325.628) [-325.715] * (-327.120) (-326.644) [-329.285] (-324.441) -- 0:00:44
      238000 -- (-324.875) (-324.171) (-328.019) [-325.447] * (-327.020) [-327.434] (-324.328) (-324.777) -- 0:00:44
      238500 -- (-326.252) (-326.072) [-325.298] (-324.684) * (-325.784) (-326.422) [-324.596] (-325.291) -- 0:00:44
      239000 -- (-327.238) (-324.575) [-327.344] (-328.071) * (-325.546) (-325.895) (-325.905) [-325.291] -- 0:00:44
      239500 -- (-324.095) [-324.939] (-327.809) (-326.019) * (-325.793) (-327.632) [-325.877] (-325.492) -- 0:00:44
      240000 -- [-324.336] (-329.274) (-326.696) (-325.141) * [-325.010] (-327.307) (-324.813) (-325.216) -- 0:00:44

      Average standard deviation of split frequencies: 0.015888

      240500 -- [-323.471] (-325.519) (-325.710) (-325.711) * [-326.330] (-325.493) (-325.326) (-325.261) -- 0:00:44
      241000 -- [-324.795] (-325.863) (-323.941) (-324.422) * (-324.007) [-324.274] (-326.785) (-324.405) -- 0:00:44
      241500 -- (-327.312) [-323.962] (-325.606) (-324.487) * (-326.506) (-324.712) [-327.240] (-324.642) -- 0:00:43
      242000 -- (-327.943) (-323.746) (-324.696) [-325.745] * (-327.873) [-326.916] (-324.892) (-325.460) -- 0:00:43
      242500 -- (-325.779) (-324.204) (-326.548) [-325.121] * (-324.469) (-332.556) (-326.253) [-326.693] -- 0:00:43
      243000 -- [-324.723] (-323.970) (-326.274) (-323.933) * [-324.813] (-326.410) (-323.997) (-326.542) -- 0:00:46
      243500 -- [-324.138] (-323.703) (-326.579) (-324.100) * (-323.492) (-326.282) (-324.586) [-326.000] -- 0:00:46
      244000 -- (-324.570) (-325.029) [-327.179] (-326.071) * (-325.347) (-324.220) (-325.941) [-324.792] -- 0:00:46
      244500 -- (-325.272) (-324.333) (-326.402) [-327.449] * (-324.112) (-325.373) [-325.106] (-326.256) -- 0:00:46
      245000 -- [-325.203] (-323.941) (-327.229) (-327.906) * (-328.356) (-325.888) [-328.981] (-329.487) -- 0:00:46

      Average standard deviation of split frequencies: 0.016238

      245500 -- (-324.026) (-326.778) [-324.964] (-330.592) * (-328.929) (-328.035) (-325.309) [-326.755] -- 0:00:46
      246000 -- (-325.715) (-328.570) (-324.684) [-327.049] * (-330.633) (-323.833) [-333.307] (-326.243) -- 0:00:45
      246500 -- (-324.458) [-324.379] (-326.027) (-326.302) * (-332.664) [-325.750] (-329.986) (-326.329) -- 0:00:45
      247000 -- (-327.251) [-325.178] (-327.224) (-325.674) * (-326.822) [-327.211] (-324.904) (-324.603) -- 0:00:45
      247500 -- (-327.506) (-324.107) [-323.614] (-325.357) * (-324.403) (-326.618) (-325.880) [-323.736] -- 0:00:45
      248000 -- (-326.081) [-324.569] (-323.800) (-324.935) * (-326.633) (-325.371) (-324.511) [-324.292] -- 0:00:45
      248500 -- (-325.794) (-325.726) [-324.272] (-324.750) * [-329.703] (-328.228) (-326.656) (-327.678) -- 0:00:45
      249000 -- (-325.685) (-324.864) (-324.654) [-325.763] * (-328.131) (-325.338) [-326.668] (-324.289) -- 0:00:45
      249500 -- [-326.526] (-323.513) (-324.657) (-327.138) * (-328.398) [-325.587] (-331.093) (-324.934) -- 0:00:45
      250000 -- (-325.542) [-328.157] (-324.488) (-327.635) * (-325.687) (-326.589) [-323.833] (-323.926) -- 0:00:45

      Average standard deviation of split frequencies: 0.016151

      250500 -- (-327.043) [-328.296] (-327.978) (-325.174) * (-327.509) [-324.894] (-325.154) (-328.980) -- 0:00:44
      251000 -- (-327.581) (-327.351) (-323.762) [-324.691] * (-325.540) (-325.425) [-324.937] (-323.863) -- 0:00:44
      251500 -- (-329.652) (-325.461) [-324.137] (-331.171) * (-326.049) (-325.067) [-324.223] (-327.727) -- 0:00:44
      252000 -- (-328.509) (-328.668) [-324.526] (-329.341) * (-323.897) (-323.807) (-324.051) [-323.678] -- 0:00:44
      252500 -- (-329.091) (-326.766) [-324.446] (-325.110) * (-324.040) (-330.163) [-323.693] (-323.662) -- 0:00:44
      253000 -- (-325.189) [-325.652] (-325.503) (-324.427) * (-325.902) (-330.927) (-323.975) [-324.479] -- 0:00:44
      253500 -- [-326.398] (-325.864) (-325.273) (-328.788) * (-324.659) [-327.750] (-325.104) (-323.887) -- 0:00:44
      254000 -- (-326.156) (-325.475) (-328.472) [-325.790] * (-325.393) (-327.547) (-324.384) [-324.717] -- 0:00:44
      254500 -- [-324.086] (-323.758) (-325.963) (-328.921) * (-329.621) [-326.668] (-324.925) (-326.778) -- 0:00:43
      255000 -- (-325.470) [-323.624] (-324.641) (-328.051) * (-324.540) (-323.548) [-325.115] (-326.025) -- 0:00:43

      Average standard deviation of split frequencies: 0.015422

      255500 -- [-324.080] (-326.529) (-328.015) (-324.602) * (-323.929) [-325.113] (-324.224) (-327.358) -- 0:00:43
      256000 -- (-324.568) (-324.458) (-326.073) [-323.667] * (-325.999) (-327.174) [-326.338] (-325.260) -- 0:00:43
      256500 -- (-324.993) [-324.143] (-325.605) (-325.307) * (-326.043) (-325.498) [-325.661] (-324.834) -- 0:00:43
      257000 -- [-324.808] (-324.994) (-323.802) (-323.938) * (-328.828) [-325.385] (-328.097) (-325.812) -- 0:00:43
      257500 -- (-326.030) [-324.656] (-325.220) (-327.304) * [-325.291] (-325.165) (-329.464) (-327.227) -- 0:00:43
      258000 -- [-326.843] (-325.627) (-326.073) (-329.536) * (-326.050) [-323.346] (-325.936) (-325.893) -- 0:00:43
      258500 -- (-324.704) (-326.433) [-326.040] (-324.469) * (-323.823) [-325.028] (-324.749) (-326.730) -- 0:00:43
      259000 -- (-324.234) [-324.380] (-324.695) (-325.010) * (-325.730) (-326.335) (-325.181) [-326.481] -- 0:00:42
      259500 -- (-325.586) [-327.570] (-326.273) (-327.301) * (-325.026) (-328.290) [-325.773] (-324.985) -- 0:00:45
      260000 -- (-325.337) [-325.104] (-325.743) (-324.919) * (-327.775) [-326.199] (-327.464) (-324.989) -- 0:00:45

      Average standard deviation of split frequencies: 0.014807

      260500 -- (-329.290) (-326.860) [-325.169] (-324.058) * (-326.118) (-325.415) [-327.301] (-324.869) -- 0:00:45
      261000 -- (-327.276) (-327.021) (-323.481) [-324.297] * (-326.772) [-327.837] (-327.108) (-326.515) -- 0:00:45
      261500 -- (-324.044) [-323.665] (-324.062) (-325.819) * (-327.699) [-324.782] (-326.563) (-327.700) -- 0:00:45
      262000 -- [-325.107] (-325.685) (-324.246) (-324.803) * [-328.904] (-327.692) (-327.629) (-327.911) -- 0:00:45
      262500 -- (-323.791) (-325.643) [-325.192] (-324.703) * (-328.309) (-330.526) [-324.172] (-327.391) -- 0:00:44
      263000 -- (-325.642) [-325.713] (-324.056) (-324.969) * (-328.361) (-324.413) [-325.098] (-324.276) -- 0:00:44
      263500 -- [-325.221] (-326.791) (-323.430) (-325.046) * (-327.045) (-325.175) (-327.074) [-326.153] -- 0:00:44
      264000 -- [-323.873] (-324.089) (-324.814) (-324.556) * (-324.538) (-324.570) (-325.334) [-325.986] -- 0:00:44
      264500 -- (-325.570) [-326.924] (-324.025) (-324.204) * (-329.521) (-325.523) [-329.004] (-325.751) -- 0:00:44
      265000 -- [-325.522] (-325.842) (-325.576) (-326.619) * (-324.867) (-326.086) [-324.134] (-324.684) -- 0:00:44

      Average standard deviation of split frequencies: 0.015741

      265500 -- [-330.538] (-324.368) (-325.662) (-324.016) * (-323.906) [-326.342] (-327.859) (-327.560) -- 0:00:44
      266000 -- (-325.606) (-323.557) [-323.726] (-325.731) * (-327.072) (-325.223) [-326.763] (-326.827) -- 0:00:44
      266500 -- (-323.879) [-324.142] (-327.507) (-325.356) * (-325.725) (-325.492) (-324.333) [-323.794] -- 0:00:44
      267000 -- (-326.143) (-325.259) (-325.659) [-324.989] * (-331.628) (-326.900) [-325.549] (-325.481) -- 0:00:43
      267500 -- (-325.127) (-328.716) (-324.221) [-325.632] * (-326.076) (-324.458) (-326.648) [-327.596] -- 0:00:43
      268000 -- (-323.360) (-323.513) [-324.889] (-325.216) * (-325.121) (-324.754) (-325.177) [-327.381] -- 0:00:43
      268500 -- (-323.238) [-324.355] (-327.082) (-326.219) * (-326.225) (-324.739) [-327.694] (-325.218) -- 0:00:43
      269000 -- (-327.474) (-325.145) [-324.972] (-324.199) * (-324.264) (-324.682) (-325.945) [-326.134] -- 0:00:43
      269500 -- (-326.402) (-325.942) [-327.944] (-326.052) * (-324.335) (-326.077) [-325.720] (-324.820) -- 0:00:43
      270000 -- (-325.446) [-323.729] (-326.838) (-323.724) * (-326.219) (-325.573) [-323.415] (-323.969) -- 0:00:43

      Average standard deviation of split frequencies: 0.017029

      270500 -- (-324.892) (-324.053) [-326.071] (-324.672) * (-327.662) (-327.647) [-325.463] (-323.696) -- 0:00:43
      271000 -- [-328.952] (-325.919) (-326.767) (-325.684) * [-325.235] (-327.288) (-324.494) (-325.408) -- 0:00:43
      271500 -- (-326.376) [-326.016] (-325.738) (-330.704) * (-324.616) (-324.326) [-324.414] (-331.939) -- 0:00:42
      272000 -- [-324.768] (-325.219) (-330.166) (-324.265) * (-327.214) (-324.991) [-326.689] (-329.415) -- 0:00:42
      272500 -- [-329.201] (-326.989) (-325.594) (-325.218) * [-326.653] (-326.191) (-328.039) (-326.120) -- 0:00:42
      273000 -- (-325.644) (-327.854) (-325.387) [-326.293] * (-327.300) [-325.197] (-324.503) (-325.319) -- 0:00:42
      273500 -- (-327.187) (-329.988) [-324.027] (-324.251) * (-323.836) (-325.556) (-325.294) [-325.268] -- 0:00:42
      274000 -- (-325.304) (-326.779) [-323.891] (-325.108) * (-324.078) (-331.612) (-324.103) [-324.175] -- 0:00:42
      274500 -- (-328.120) [-324.729] (-324.865) (-328.224) * [-323.745] (-325.909) (-324.141) (-325.241) -- 0:00:42
      275000 -- (-330.624) (-326.668) (-325.153) [-329.088] * [-324.426] (-328.920) (-326.300) (-328.138) -- 0:00:42

      Average standard deviation of split frequencies: 0.018085

      275500 -- [-323.707] (-326.698) (-325.439) (-324.932) * [-323.425] (-325.021) (-328.087) (-324.402) -- 0:00:44
      276000 -- (-328.271) (-326.004) (-327.551) [-325.390] * (-324.259) (-324.450) (-328.765) [-325.212] -- 0:00:44
      276500 -- (-329.852) (-325.762) (-327.368) [-324.602] * (-325.374) (-324.580) (-326.635) [-324.853] -- 0:00:44
      277000 -- [-327.002] (-324.164) (-326.402) (-327.138) * [-325.764] (-325.913) (-325.625) (-326.559) -- 0:00:44
      277500 -- (-326.256) (-324.912) (-326.244) [-323.955] * (-325.410) (-328.941) (-327.651) [-327.717] -- 0:00:44
      278000 -- (-325.388) (-328.906) (-325.407) [-327.025] * (-324.290) [-326.629] (-324.741) (-324.362) -- 0:00:44
      278500 -- [-326.049] (-326.203) (-326.211) (-327.623) * (-323.785) (-324.653) (-324.496) [-325.532] -- 0:00:44
      279000 -- (-324.506) (-324.295) [-330.560] (-328.267) * (-324.797) (-325.545) (-327.152) [-324.061] -- 0:00:43
      279500 -- [-324.116] (-326.394) (-325.996) (-323.989) * [-326.181] (-323.580) (-324.284) (-325.245) -- 0:00:43
      280000 -- (-326.906) (-325.495) (-325.549) [-330.612] * (-325.400) (-326.513) [-325.058] (-325.128) -- 0:00:43

      Average standard deviation of split frequencies: 0.019365

      280500 -- (-326.965) (-329.656) (-323.641) [-328.066] * (-324.701) [-325.084] (-327.228) (-326.694) -- 0:00:43
      281000 -- [-324.349] (-324.252) (-324.997) (-327.522) * (-324.342) [-325.832] (-325.667) (-328.303) -- 0:00:43
      281500 -- (-324.788) [-326.117] (-326.478) (-324.031) * (-327.736) (-326.087) (-324.676) [-328.024] -- 0:00:43
      282000 -- [-324.413] (-325.355) (-324.144) (-326.683) * [-326.723] (-325.112) (-324.050) (-331.947) -- 0:00:43
      282500 -- (-324.100) (-326.440) (-327.432) [-323.621] * (-326.108) (-325.216) [-324.808] (-327.106) -- 0:00:43
      283000 -- (-324.110) (-323.840) [-326.576] (-326.441) * [-323.999] (-331.209) (-326.567) (-328.221) -- 0:00:43
      283500 -- [-325.107] (-326.426) (-324.566) (-328.248) * (-325.527) (-324.765) [-326.585] (-328.152) -- 0:00:42
      284000 -- (-325.864) (-327.239) [-327.034] (-327.602) * [-324.642] (-324.962) (-328.340) (-324.404) -- 0:00:42
      284500 -- (-326.348) (-325.770) [-327.493] (-329.592) * (-324.404) (-324.279) (-326.315) [-324.178] -- 0:00:42
      285000 -- (-327.018) (-329.318) [-328.004] (-326.688) * [-327.682] (-328.261) (-327.809) (-325.414) -- 0:00:42

      Average standard deviation of split frequencies: 0.019101

      285500 -- (-326.348) (-329.407) (-325.760) [-324.752] * [-329.753] (-325.983) (-324.864) (-324.710) -- 0:00:42
      286000 -- (-325.371) (-324.385) [-326.553] (-323.980) * (-330.487) (-325.481) (-325.482) [-324.896] -- 0:00:42
      286500 -- (-329.214) [-323.772] (-328.100) (-324.253) * (-325.960) [-324.407] (-331.679) (-324.955) -- 0:00:42
      287000 -- [-325.431] (-324.163) (-328.149) (-325.038) * [-325.119] (-325.170) (-329.061) (-324.453) -- 0:00:42
      287500 -- (-326.361) (-323.482) (-325.825) [-326.254] * [-325.128] (-325.509) (-327.263) (-324.111) -- 0:00:42
      288000 -- (-325.321) (-324.191) (-324.246) [-325.805] * (-327.078) [-324.422] (-324.100) (-325.812) -- 0:00:42
      288500 -- [-324.542] (-326.964) (-323.504) (-324.483) * (-325.688) [-325.414] (-327.461) (-328.997) -- 0:00:41
      289000 -- (-326.893) [-324.045] (-323.893) (-326.282) * (-324.756) [-324.534] (-332.682) (-324.671) -- 0:00:41
      289500 -- (-323.803) (-323.535) (-324.397) [-325.133] * (-328.178) (-324.433) (-325.250) [-325.027] -- 0:00:41
      290000 -- (-330.741) (-324.230) [-324.230] (-329.217) * (-326.674) (-324.802) (-325.342) [-324.153] -- 0:00:41

      Average standard deviation of split frequencies: 0.018448

      290500 -- (-324.746) (-323.460) [-325.308] (-325.826) * (-328.890) (-327.411) [-323.803] (-326.849) -- 0:00:41
      291000 -- [-325.479] (-323.839) (-326.525) (-325.008) * (-328.862) (-328.234) [-325.384] (-328.848) -- 0:00:43
      291500 -- (-324.780) (-324.225) [-324.906] (-327.039) * (-328.783) (-326.225) [-328.543] (-325.749) -- 0:00:43
      292000 -- (-325.173) (-325.351) [-324.932] (-325.872) * [-325.662] (-328.323) (-328.835) (-327.513) -- 0:00:43
      292500 -- (-327.745) (-323.920) [-332.391] (-327.006) * (-329.030) (-329.487) (-324.996) [-326.727] -- 0:00:43
      293000 -- (-327.838) (-327.921) (-327.065) [-326.108] * [-327.537] (-325.869) (-324.370) (-331.405) -- 0:00:43
      293500 -- (-326.795) [-326.155] (-326.013) (-326.023) * (-325.795) [-326.743] (-325.340) (-326.776) -- 0:00:43
      294000 -- [-325.054] (-324.664) (-324.296) (-330.065) * (-328.026) (-325.992) [-325.655] (-328.665) -- 0:00:43
      294500 -- [-324.458] (-324.474) (-328.716) (-323.919) * (-328.944) (-323.828) [-325.003] (-325.982) -- 0:00:43
      295000 -- (-324.913) (-331.786) [-327.033] (-327.248) * (-326.118) (-324.478) [-327.541] (-325.052) -- 0:00:43

      Average standard deviation of split frequencies: 0.017319

      295500 -- [-327.791] (-326.289) (-330.603) (-328.085) * (-324.131) [-325.304] (-323.993) (-324.833) -- 0:00:42
      296000 -- (-324.115) (-324.848) (-326.708) [-325.320] * [-325.171] (-325.227) (-332.128) (-324.181) -- 0:00:42
      296500 -- (-324.695) (-324.610) [-327.371] (-327.993) * [-325.271] (-326.701) (-330.026) (-326.405) -- 0:00:42
      297000 -- (-330.428) (-328.113) [-324.694] (-329.436) * (-325.920) (-324.822) [-326.346] (-329.512) -- 0:00:42
      297500 -- (-325.069) (-328.136) (-325.008) [-325.746] * (-323.520) (-325.560) [-325.145] (-323.953) -- 0:00:42
      298000 -- (-325.876) (-325.712) [-328.244] (-324.398) * (-323.897) [-325.535] (-327.823) (-326.147) -- 0:00:42
      298500 -- [-324.631] (-324.913) (-327.254) (-324.656) * (-325.628) (-324.574) [-326.029] (-326.487) -- 0:00:42
      299000 -- [-323.489] (-323.624) (-330.492) (-326.666) * (-324.959) (-325.421) (-327.657) [-325.645] -- 0:00:42
      299500 -- (-324.939) [-325.662] (-327.358) (-325.525) * [-325.040] (-327.550) (-327.699) (-324.051) -- 0:00:42
      300000 -- (-323.806) [-323.844] (-327.822) (-329.607) * (-324.276) (-326.932) (-325.185) [-328.669] -- 0:00:42

      Average standard deviation of split frequencies: 0.018814

      300500 -- (-327.050) [-323.451] (-328.240) (-330.373) * (-325.606) (-326.373) (-324.996) [-324.033] -- 0:00:41
      301000 -- (-325.455) [-326.473] (-327.632) (-325.505) * (-327.810) (-326.951) [-325.178] (-325.631) -- 0:00:41
      301500 -- (-325.070) [-325.897] (-323.865) (-325.119) * (-328.556) (-323.624) [-325.298] (-327.499) -- 0:00:41
      302000 -- (-324.892) [-325.909] (-323.423) (-327.497) * [-327.710] (-324.536) (-327.490) (-326.513) -- 0:00:41
      302500 -- (-326.033) (-325.565) (-323.639) [-324.425] * (-329.599) (-326.188) [-325.687] (-324.837) -- 0:00:41
      303000 -- [-327.319] (-324.355) (-329.260) (-325.116) * (-324.559) (-325.007) [-326.741] (-323.324) -- 0:00:41
      303500 -- (-326.279) (-328.981) [-326.444] (-326.392) * (-324.998) [-324.671] (-325.440) (-327.087) -- 0:00:41
      304000 -- (-325.388) (-329.691) [-326.264] (-324.879) * (-326.491) [-326.471] (-324.112) (-326.207) -- 0:00:41
      304500 -- [-325.251] (-325.291) (-325.974) (-325.539) * (-326.161) [-324.007] (-324.270) (-328.300) -- 0:00:41
      305000 -- (-324.580) (-327.018) (-325.078) [-324.624] * (-327.463) [-324.654] (-325.219) (-326.599) -- 0:00:41

      Average standard deviation of split frequencies: 0.018124

      305500 -- (-325.764) [-326.752] (-325.444) (-325.022) * (-326.854) [-326.602] (-323.894) (-325.180) -- 0:00:40
      306000 -- [-324.245] (-327.656) (-325.331) (-324.033) * [-326.227] (-325.276) (-327.553) (-323.664) -- 0:00:40
      306500 -- (-324.180) [-325.762] (-327.712) (-324.740) * (-325.661) [-326.653] (-325.511) (-325.305) -- 0:00:40
      307000 -- [-325.179] (-326.817) (-330.070) (-324.836) * (-328.926) [-326.137] (-326.517) (-326.850) -- 0:00:40
      307500 -- (-325.447) [-326.467] (-327.604) (-325.119) * (-324.754) [-324.203] (-328.076) (-326.103) -- 0:00:40
      308000 -- [-324.998] (-326.097) (-324.827) (-326.520) * (-326.915) (-331.164) [-325.953] (-324.450) -- 0:00:42
      308500 -- (-324.785) (-324.563) (-328.935) [-325.545] * [-327.678] (-326.161) (-327.116) (-328.593) -- 0:00:42
      309000 -- (-331.654) [-328.140] (-329.091) (-328.140) * [-327.178] (-327.008) (-330.791) (-328.214) -- 0:00:42
      309500 -- [-324.797] (-325.640) (-325.517) (-325.559) * (-326.215) (-324.941) [-324.802] (-326.458) -- 0:00:42
      310000 -- (-326.150) [-325.634] (-326.830) (-325.768) * (-326.809) (-331.131) [-324.956] (-325.023) -- 0:00:42

      Average standard deviation of split frequencies: 0.016959

      310500 -- (-325.480) (-326.380) (-330.295) [-324.109] * (-327.988) (-324.725) [-325.447] (-327.971) -- 0:00:42
      311000 -- (-326.144) (-325.615) [-326.166] (-324.166) * [-324.560] (-326.376) (-324.361) (-329.774) -- 0:00:42
      311500 -- (-329.708) [-324.353] (-326.280) (-326.462) * [-324.508] (-328.736) (-325.067) (-324.450) -- 0:00:41
      312000 -- (-326.553) (-325.767) [-326.954] (-326.560) * [-324.526] (-325.507) (-325.936) (-324.368) -- 0:00:41
      312500 -- (-328.091) (-328.890) [-326.362] (-326.700) * (-327.700) (-325.005) (-327.049) [-324.980] -- 0:00:41
      313000 -- [-326.437] (-326.861) (-325.588) (-327.204) * (-327.035) (-327.242) [-325.387] (-323.891) -- 0:00:41
      313500 -- [-324.377] (-328.233) (-323.732) (-328.820) * [-324.926] (-326.490) (-325.963) (-324.105) -- 0:00:41
      314000 -- (-324.339) [-325.149] (-327.465) (-326.453) * (-323.801) (-326.404) [-326.152] (-325.132) -- 0:00:41
      314500 -- (-325.091) [-326.207] (-326.170) (-323.877) * [-325.320] (-326.670) (-326.374) (-326.226) -- 0:00:41
      315000 -- [-327.320] (-326.379) (-324.596) (-326.323) * (-328.216) (-327.550) (-323.857) [-329.069] -- 0:00:41

      Average standard deviation of split frequencies: 0.016969

      315500 -- (-326.397) (-325.842) (-325.055) [-325.493] * [-324.084] (-325.118) (-324.632) (-323.782) -- 0:00:41
      316000 -- [-327.552] (-323.971) (-329.317) (-324.684) * (-329.144) (-326.893) [-326.799] (-326.040) -- 0:00:41
      316500 -- (-323.890) [-324.196] (-323.693) (-325.687) * [-325.079] (-330.934) (-324.593) (-324.889) -- 0:00:41
      317000 -- (-327.034) (-328.194) [-324.065] (-323.802) * (-325.769) [-325.910] (-324.584) (-324.042) -- 0:00:40
      317500 -- (-323.788) (-325.617) (-328.103) [-324.129] * [-325.403] (-326.717) (-327.721) (-327.525) -- 0:00:40
      318000 -- (-328.808) [-325.150] (-329.119) (-323.906) * [-323.998] (-327.291) (-325.774) (-327.231) -- 0:00:40
      318500 -- (-324.402) [-324.440] (-325.175) (-327.701) * (-325.193) [-327.302] (-329.190) (-329.854) -- 0:00:40
      319000 -- (-324.261) [-324.566] (-327.683) (-326.278) * (-326.043) [-323.798] (-324.853) (-328.538) -- 0:00:40
      319500 -- [-324.174] (-328.308) (-324.281) (-325.707) * (-325.954) (-324.522) [-326.477] (-327.803) -- 0:00:40
      320000 -- (-324.241) [-325.076] (-327.136) (-323.467) * [-324.144] (-326.041) (-331.941) (-324.945) -- 0:00:40

      Average standard deviation of split frequencies: 0.015711

      320500 -- (-326.114) [-324.428] (-326.983) (-327.119) * [-325.108] (-324.709) (-328.151) (-325.170) -- 0:00:40
      321000 -- (-328.040) (-325.392) (-325.072) [-325.328] * [-326.911] (-325.055) (-324.610) (-324.822) -- 0:00:40
      321500 -- (-325.334) (-326.831) (-329.257) [-325.284] * (-326.874) (-326.448) [-324.840] (-329.996) -- 0:00:40
      322000 -- (-325.166) (-326.048) [-325.061] (-326.367) * (-326.873) (-326.722) (-329.204) [-327.311] -- 0:00:40
      322500 -- (-327.822) (-329.459) [-324.637] (-326.284) * (-329.614) (-325.874) [-323.731] (-325.582) -- 0:00:39
      323000 -- [-324.860] (-325.810) (-326.092) (-325.181) * (-324.018) [-329.848] (-326.095) (-324.590) -- 0:00:39
      323500 -- (-326.127) (-327.688) [-323.810] (-326.302) * [-327.078] (-325.069) (-324.093) (-328.371) -- 0:00:39
      324000 -- (-325.502) (-324.590) (-326.767) [-326.323] * (-326.851) (-325.053) (-327.639) [-326.451] -- 0:00:39
      324500 -- (-325.947) [-324.122] (-328.072) (-327.869) * (-325.149) (-323.783) [-326.582] (-326.032) -- 0:00:41
      325000 -- (-328.171) [-324.704] (-326.429) (-327.495) * (-326.587) (-324.812) (-325.789) [-327.389] -- 0:00:41

      Average standard deviation of split frequencies: 0.015183

      325500 -- (-326.686) (-324.937) (-326.401) [-325.547] * [-325.972] (-325.840) (-325.043) (-332.859) -- 0:00:41
      326000 -- (-326.870) (-325.332) (-328.094) [-325.184] * (-325.007) (-326.475) (-325.750) [-325.381] -- 0:00:41
      326500 -- (-325.447) (-323.850) (-328.350) [-324.706] * (-325.228) (-328.900) (-324.405) [-326.102] -- 0:00:41
      327000 -- (-327.448) (-324.280) [-323.745] (-328.230) * (-326.876) [-326.136] (-327.095) (-326.509) -- 0:00:41
      327500 -- (-327.142) (-327.030) (-324.185) [-329.857] * (-324.438) (-325.656) (-324.887) [-325.767] -- 0:00:41
      328000 -- (-324.491) [-324.413] (-326.354) (-329.583) * [-324.982] (-324.856) (-324.428) (-325.282) -- 0:00:40
      328500 -- (-325.790) (-326.412) (-323.791) [-324.629] * (-337.176) (-324.848) [-326.481] (-327.438) -- 0:00:40
      329000 -- (-324.771) (-325.683) [-325.090] (-324.419) * (-325.878) (-325.557) (-324.640) [-326.499] -- 0:00:40
      329500 -- (-325.207) (-329.823) [-326.416] (-327.241) * (-324.065) (-326.687) (-325.686) [-325.798] -- 0:00:40
      330000 -- [-324.967] (-328.197) (-330.079) (-326.416) * (-327.216) (-327.017) (-325.317) [-326.155] -- 0:00:40

      Average standard deviation of split frequencies: 0.015147

      330500 -- (-327.083) [-325.766] (-330.263) (-326.608) * (-329.272) (-326.419) (-326.858) [-326.977] -- 0:00:40
      331000 -- (-327.645) (-324.766) (-329.243) [-324.846] * (-325.944) [-325.885] (-329.298) (-324.738) -- 0:00:40
      331500 -- (-328.000) (-324.216) (-325.237) [-325.536] * [-325.124] (-326.284) (-330.800) (-325.450) -- 0:00:40
      332000 -- (-326.047) (-325.985) (-325.960) [-327.310] * (-332.886) (-325.498) (-324.722) [-326.458] -- 0:00:40
      332500 -- (-325.111) [-325.733] (-324.887) (-325.257) * (-326.615) (-328.189) [-327.317] (-325.789) -- 0:00:40
      333000 -- (-325.176) (-324.633) [-325.389] (-326.757) * (-324.535) [-325.257] (-328.590) (-324.595) -- 0:00:40
      333500 -- (-324.972) (-323.843) [-325.364] (-326.764) * [-325.650] (-323.992) (-327.712) (-324.662) -- 0:00:39
      334000 -- [-328.026] (-325.279) (-324.185) (-327.397) * (-325.262) (-327.928) (-326.924) [-323.672] -- 0:00:39
      334500 -- (-325.713) (-326.950) (-324.416) [-325.694] * (-323.831) (-324.407) (-324.879) [-325.930] -- 0:00:39
      335000 -- [-324.450] (-323.237) (-323.639) (-325.485) * (-325.736) (-325.734) [-324.876] (-323.676) -- 0:00:39

      Average standard deviation of split frequencies: 0.015521

      335500 -- (-328.089) (-324.457) (-325.343) [-328.081] * (-324.140) (-325.717) (-325.680) [-325.064] -- 0:00:39
      336000 -- (-328.140) [-324.487] (-324.085) (-324.921) * (-325.719) (-325.513) (-324.314) [-324.589] -- 0:00:39
      336500 -- (-327.252) (-323.943) [-326.282] (-328.459) * (-326.344) [-324.129] (-324.401) (-327.841) -- 0:00:39
      337000 -- (-329.940) (-326.345) (-325.365) [-328.605] * (-327.002) (-323.404) [-324.906] (-326.420) -- 0:00:39
      337500 -- (-326.555) (-325.506) [-323.535] (-326.924) * (-330.137) [-323.697] (-329.170) (-328.672) -- 0:00:39
      338000 -- (-324.936) (-325.274) [-324.411] (-324.305) * (-330.251) [-325.669] (-325.179) (-338.768) -- 0:00:39
      338500 -- [-325.381] (-323.918) (-324.866) (-327.320) * (-331.287) (-326.995) [-326.083] (-323.349) -- 0:00:39
      339000 -- (-325.329) [-324.837] (-323.970) (-324.495) * (-323.986) (-325.783) [-325.792] (-329.746) -- 0:00:38
      339500 -- [-325.902] (-325.749) (-324.356) (-324.768) * (-324.978) (-327.154) [-326.500] (-326.561) -- 0:00:38
      340000 -- [-323.659] (-324.894) (-324.332) (-325.730) * (-324.379) (-327.785) (-323.800) [-325.715] -- 0:00:38

      Average standard deviation of split frequencies: 0.017124

      340500 -- (-324.708) (-326.208) (-324.131) [-324.532] * (-326.401) (-325.302) (-324.736) [-324.241] -- 0:00:38
      341000 -- [-325.048] (-326.630) (-326.687) (-327.538) * (-325.693) (-330.247) [-324.795] (-327.758) -- 0:00:40
      341500 -- (-328.239) (-325.301) (-325.806) [-325.293] * [-325.251] (-325.169) (-326.814) (-323.702) -- 0:00:40
      342000 -- [-325.740] (-326.355) (-326.672) (-324.613) * [-323.746] (-325.972) (-326.972) (-326.850) -- 0:00:40
      342500 -- (-324.596) (-324.071) [-325.501] (-323.774) * (-325.567) (-324.747) [-325.896] (-326.370) -- 0:00:40
      343000 -- [-329.205] (-324.691) (-324.524) (-325.183) * (-325.570) [-323.884] (-326.268) (-325.710) -- 0:00:40
      343500 -- (-326.460) (-326.344) [-323.875] (-324.430) * [-324.904] (-326.167) (-324.782) (-327.700) -- 0:00:40
      344000 -- (-324.508) (-325.441) [-324.871] (-323.768) * (-325.548) [-325.808] (-323.990) (-324.585) -- 0:00:40
      344500 -- [-324.049] (-327.358) (-324.235) (-323.815) * (-325.422) [-326.109] (-325.052) (-327.123) -- 0:00:39
      345000 -- (-324.977) (-327.357) (-324.249) [-325.366] * (-323.852) (-328.437) (-330.230) [-325.897] -- 0:00:39

      Average standard deviation of split frequencies: 0.016670

      345500 -- (-325.750) [-324.746] (-325.846) (-328.370) * (-325.197) [-326.566] (-327.591) (-325.766) -- 0:00:39
      346000 -- (-325.441) (-326.775) [-326.774] (-326.157) * (-328.550) [-324.508] (-324.562) (-324.419) -- 0:00:39
      346500 -- [-326.855] (-325.677) (-330.617) (-324.424) * (-325.639) (-325.602) (-327.104) [-325.650] -- 0:00:39
      347000 -- (-326.182) (-324.270) [-326.940] (-326.596) * (-324.380) (-325.961) (-327.481) [-326.164] -- 0:00:39
      347500 -- (-324.745) (-326.452) [-325.436] (-326.232) * (-325.721) (-323.763) [-325.832] (-324.338) -- 0:00:39
      348000 -- (-324.531) (-328.161) (-327.404) [-326.528] * (-324.623) (-328.511) (-326.910) [-325.258] -- 0:00:39
      348500 -- (-327.619) (-325.111) (-324.112) [-326.771] * (-325.222) (-329.079) (-327.235) [-326.062] -- 0:00:39
      349000 -- [-325.419] (-329.124) (-327.956) (-331.651) * [-325.790] (-325.968) (-326.217) (-324.634) -- 0:00:39
      349500 -- (-324.933) (-325.667) (-326.649) [-326.298] * (-323.483) (-324.617) [-325.581] (-325.271) -- 0:00:39
      350000 -- (-326.593) (-326.921) (-329.598) [-324.111] * [-327.260] (-325.611) (-327.955) (-324.277) -- 0:00:39

      Average standard deviation of split frequencies: 0.016685

      350500 -- (-326.211) (-329.644) (-326.764) [-324.377] * [-329.381] (-326.060) (-326.418) (-324.054) -- 0:00:38
      351000 -- (-324.578) [-323.860] (-325.627) (-327.286) * (-324.485) (-326.390) [-325.172] (-324.398) -- 0:00:38
      351500 -- (-326.690) [-323.892] (-326.433) (-325.970) * (-323.674) [-325.571] (-326.638) (-326.058) -- 0:00:38
      352000 -- [-325.620] (-324.118) (-325.786) (-329.706) * (-325.683) [-324.438] (-326.182) (-325.154) -- 0:00:38
      352500 -- [-326.471] (-323.409) (-325.098) (-325.439) * (-329.953) (-325.985) [-325.414] (-324.715) -- 0:00:38
      353000 -- (-325.634) (-324.218) (-328.728) [-324.367] * (-330.881) (-324.443) (-327.680) [-324.889] -- 0:00:38
      353500 -- (-325.897) [-325.730] (-328.906) (-326.938) * (-328.382) [-324.777] (-326.370) (-327.285) -- 0:00:38
      354000 -- (-323.998) [-325.954] (-326.372) (-331.025) * (-324.811) [-325.818] (-330.621) (-325.803) -- 0:00:38
      354500 -- (-324.777) (-329.505) (-324.325) [-331.732] * [-324.341] (-326.571) (-328.904) (-326.573) -- 0:00:38
      355000 -- (-325.044) [-325.489] (-324.564) (-327.975) * (-326.131) (-329.824) (-325.129) [-325.599] -- 0:00:38

      Average standard deviation of split frequencies: 0.016635

      355500 -- (-324.926) [-325.533] (-327.689) (-326.281) * (-327.018) (-326.759) (-325.072) [-326.892] -- 0:00:38
      356000 -- (-325.215) (-325.503) (-328.258) [-323.784] * [-329.673] (-324.359) (-326.626) (-326.472) -- 0:00:37
      356500 -- (-325.432) [-324.836] (-323.287) (-325.332) * (-327.966) (-327.114) (-328.291) [-323.966] -- 0:00:39
      357000 -- (-325.850) (-323.904) (-325.998) [-324.630] * (-324.319) (-324.525) [-327.187] (-326.463) -- 0:00:39
      357500 -- [-325.228] (-325.960) (-325.363) (-327.752) * (-325.394) (-324.369) (-329.652) [-325.857] -- 0:00:39
      358000 -- [-327.034] (-327.194) (-326.994) (-327.400) * (-327.710) [-326.867] (-327.400) (-324.011) -- 0:00:39
      358500 -- [-325.277] (-326.128) (-325.512) (-330.177) * (-323.571) [-324.794] (-324.203) (-325.640) -- 0:00:39
      359000 -- (-325.383) (-324.996) (-327.479) [-324.518] * (-325.707) [-324.669] (-326.116) (-323.991) -- 0:00:39
      359500 -- (-328.526) (-326.473) [-325.476] (-323.923) * (-324.491) (-326.677) (-325.997) [-325.349] -- 0:00:39
      360000 -- (-329.989) (-325.797) (-325.748) [-325.167] * [-325.201] (-331.876) (-323.838) (-327.726) -- 0:00:39

      Average standard deviation of split frequencies: 0.015521

      360500 -- (-329.272) (-323.382) (-329.826) [-324.774] * [-326.115] (-327.992) (-324.403) (-325.755) -- 0:00:39
      361000 -- (-328.369) [-324.331] (-327.840) (-324.901) * (-324.064) [-328.125] (-326.940) (-326.853) -- 0:00:38
      361500 -- (-324.627) [-326.014] (-324.917) (-324.591) * (-324.151) [-328.592] (-323.567) (-325.580) -- 0:00:38
      362000 -- (-327.844) (-331.049) (-325.017) [-325.765] * (-323.407) [-324.687] (-324.957) (-323.726) -- 0:00:38
      362500 -- (-327.170) (-331.598) [-327.205] (-328.926) * (-325.956) (-324.031) [-326.135] (-331.547) -- 0:00:38
      363000 -- [-324.257] (-329.692) (-326.995) (-327.589) * [-328.131] (-328.054) (-330.756) (-329.769) -- 0:00:38
      363500 -- (-324.251) (-327.667) [-324.768] (-324.587) * (-323.892) (-326.568) (-324.306) [-330.031] -- 0:00:38
      364000 -- (-326.550) [-327.707] (-325.762) (-324.151) * (-327.178) [-325.045] (-326.023) (-325.711) -- 0:00:38
      364500 -- [-326.185] (-328.978) (-324.823) (-324.590) * (-326.793) (-329.311) [-325.335] (-324.464) -- 0:00:38
      365000 -- [-325.306] (-325.821) (-323.898) (-326.066) * (-329.060) (-328.977) [-327.304] (-328.590) -- 0:00:38

      Average standard deviation of split frequencies: 0.015134

      365500 -- (-324.829) (-325.416) [-324.946] (-324.758) * [-326.847] (-325.813) (-326.738) (-328.953) -- 0:00:38
      366000 -- (-323.689) (-328.292) [-326.524] (-325.017) * (-326.191) [-325.685] (-326.019) (-329.215) -- 0:00:38
      366500 -- [-326.533] (-325.287) (-325.694) (-326.972) * (-325.492) [-325.332] (-326.573) (-330.397) -- 0:00:38
      367000 -- (-326.140) [-324.805] (-325.584) (-326.895) * [-326.708] (-324.947) (-327.084) (-329.670) -- 0:00:37
      367500 -- (-324.605) (-331.661) [-329.784] (-324.611) * [-331.682] (-328.066) (-326.288) (-327.234) -- 0:00:37
      368000 -- [-324.086] (-327.653) (-324.591) (-326.723) * (-329.700) (-325.948) (-325.253) [-324.900] -- 0:00:37
      368500 -- (-328.289) (-327.683) (-326.752) [-326.101] * (-326.312) [-326.034] (-326.177) (-328.683) -- 0:00:37
      369000 -- (-329.276) (-326.194) (-327.361) [-324.883] * (-325.027) (-326.564) [-325.429] (-326.664) -- 0:00:37
      369500 -- (-330.693) (-327.044) (-325.618) [-327.538] * (-324.458) (-328.439) (-327.451) [-327.361] -- 0:00:37
      370000 -- (-326.694) (-324.910) [-325.163] (-327.651) * (-330.152) (-328.685) (-325.551) [-327.329] -- 0:00:37

      Average standard deviation of split frequencies: 0.015579

      370500 -- [-330.688] (-324.486) (-325.632) (-326.937) * (-331.673) [-327.742] (-325.060) (-330.672) -- 0:00:37
      371000 -- (-326.569) (-327.404) (-325.148) [-325.621] * (-325.462) [-323.652] (-327.534) (-323.936) -- 0:00:37
      371500 -- (-325.678) [-323.940] (-328.284) (-324.295) * [-325.786] (-329.290) (-327.825) (-324.423) -- 0:00:37
      372000 -- (-325.582) (-325.751) [-326.095] (-328.802) * (-324.544) (-328.439) [-324.563] (-326.607) -- 0:00:37
      372500 -- [-327.730] (-326.619) (-329.363) (-324.891) * (-326.694) (-324.059) [-328.598] (-324.823) -- 0:00:37
      373000 -- [-327.433] (-324.329) (-325.579) (-324.487) * (-324.723) (-327.420) [-326.457] (-324.923) -- 0:00:36
      373500 -- (-330.199) [-323.485] (-327.541) (-330.233) * (-324.464) (-327.482) (-324.641) [-323.377] -- 0:00:38
      374000 -- (-325.861) (-326.544) (-329.563) [-327.348] * (-326.477) (-330.538) (-329.456) [-323.907] -- 0:00:38
      374500 -- (-325.861) (-325.374) [-323.436] (-326.243) * (-325.450) [-324.052] (-327.396) (-324.665) -- 0:00:38
      375000 -- (-328.233) [-326.381] (-324.543) (-328.269) * (-324.662) [-324.377] (-325.660) (-324.448) -- 0:00:38

      Average standard deviation of split frequencies: 0.015515

      375500 -- (-327.784) [-324.397] (-325.863) (-331.087) * (-325.192) [-324.392] (-329.600) (-324.295) -- 0:00:38
      376000 -- (-330.247) [-325.051] (-328.744) (-328.104) * (-330.277) [-324.703] (-324.643) (-327.004) -- 0:00:38
      376500 -- (-328.605) (-328.454) (-325.119) [-325.659] * (-325.262) (-326.544) [-326.341] (-324.409) -- 0:00:38
      377000 -- [-325.304] (-327.683) (-331.072) (-326.415) * [-323.921] (-324.408) (-324.743) (-324.768) -- 0:00:38
      377500 -- (-327.426) (-327.005) [-326.435] (-326.975) * (-324.024) (-327.025) (-323.896) [-324.096] -- 0:00:37
      378000 -- [-326.625] (-327.816) (-324.489) (-328.373) * (-325.764) (-328.040) [-326.681] (-324.093) -- 0:00:37
      378500 -- (-326.173) (-325.444) [-325.737] (-326.250) * (-324.332) [-326.150] (-324.747) (-327.060) -- 0:00:37
      379000 -- [-325.763] (-326.687) (-323.864) (-328.415) * (-326.362) (-323.618) (-329.674) [-324.889] -- 0:00:37
      379500 -- (-325.723) (-326.689) [-325.372] (-324.031) * (-325.897) [-326.376] (-324.487) (-326.328) -- 0:00:37
      380000 -- [-327.021] (-326.290) (-326.980) (-324.022) * (-327.226) [-327.048] (-330.119) (-325.475) -- 0:00:37

      Average standard deviation of split frequencies: 0.015325

      380500 -- (-332.297) (-323.980) [-325.796] (-326.576) * (-325.420) [-324.594] (-325.920) (-333.437) -- 0:00:37
      381000 -- (-328.284) (-325.334) (-328.605) [-323.917] * (-326.691) (-326.543) [-324.734] (-326.741) -- 0:00:37
      381500 -- [-326.102] (-324.945) (-324.471) (-324.925) * (-327.497) (-325.373) [-327.339] (-329.708) -- 0:00:37
      382000 -- (-325.384) [-325.814] (-328.190) (-326.217) * (-328.311) (-325.241) (-331.193) [-325.475] -- 0:00:37
      382500 -- [-324.575] (-324.937) (-324.495) (-328.277) * (-329.300) (-324.792) [-323.970] (-325.222) -- 0:00:37
      383000 -- (-326.254) (-325.229) [-323.570] (-326.390) * (-326.286) (-326.627) [-325.296] (-328.878) -- 0:00:37
      383500 -- [-323.745] (-327.474) (-324.366) (-324.947) * (-325.096) (-324.273) [-326.696] (-324.666) -- 0:00:36
      384000 -- (-324.221) [-326.091] (-327.315) (-324.401) * (-324.828) (-325.138) (-325.425) [-323.482] -- 0:00:36
      384500 -- (-327.250) (-323.848) (-326.464) [-323.982] * (-325.099) (-325.526) [-324.507] (-325.775) -- 0:00:36
      385000 -- [-324.481] (-325.385) (-324.754) (-323.930) * (-326.593) (-328.810) (-326.559) [-327.141] -- 0:00:36

      Average standard deviation of split frequencies: 0.015113

      385500 -- (-326.945) [-324.531] (-323.839) (-324.235) * (-324.891) (-325.182) [-326.511] (-324.110) -- 0:00:36
      386000 -- [-326.087] (-324.745) (-326.778) (-327.863) * [-323.767] (-325.000) (-326.637) (-326.645) -- 0:00:36
      386500 -- [-324.933] (-328.386) (-324.384) (-327.391) * (-327.733) (-325.078) [-326.091] (-326.451) -- 0:00:36
      387000 -- (-328.423) (-325.332) [-325.562] (-324.520) * (-327.227) (-324.298) [-326.750] (-324.924) -- 0:00:36
      387500 -- [-324.157] (-324.504) (-332.502) (-326.752) * (-326.631) [-328.184] (-325.093) (-324.791) -- 0:00:36
      388000 -- (-325.162) [-324.853] (-324.429) (-330.367) * (-326.280) (-324.593) [-324.230] (-323.793) -- 0:00:36
      388500 -- (-327.413) [-324.455] (-326.648) (-327.199) * (-326.555) (-325.440) (-327.215) [-324.182] -- 0:00:36
      389000 -- (-328.471) [-326.186] (-325.974) (-326.273) * (-326.285) (-323.855) [-324.669] (-327.118) -- 0:00:36
      389500 -- (-331.069) [-324.111] (-326.856) (-325.915) * (-325.978) [-323.893] (-326.300) (-326.421) -- 0:00:36
      390000 -- (-324.877) [-323.860] (-324.926) (-325.683) * (-324.370) (-326.655) [-324.833] (-325.302) -- 0:00:35

      Average standard deviation of split frequencies: 0.015159

      390500 -- (-331.399) (-328.337) [-328.566] (-326.473) * (-325.609) (-326.253) (-327.790) [-323.910] -- 0:00:37
      391000 -- (-329.067) (-325.579) [-327.362] (-326.231) * (-326.228) (-329.748) [-324.730] (-324.999) -- 0:00:37
      391500 -- (-328.050) (-327.106) [-323.940] (-324.825) * [-324.459] (-325.939) (-329.586) (-327.667) -- 0:00:37
      392000 -- (-327.116) [-323.494] (-323.985) (-324.782) * [-327.671] (-325.666) (-324.537) (-323.626) -- 0:00:37
      392500 -- (-324.873) [-325.634] (-325.879) (-328.735) * (-327.292) [-325.688] (-326.492) (-329.023) -- 0:00:37
      393000 -- (-328.848) (-325.968) (-325.857) [-324.968] * (-326.709) (-325.789) [-325.082] (-331.042) -- 0:00:37
      393500 -- (-328.794) (-326.338) [-325.398] (-326.597) * (-325.226) [-327.519] (-325.421) (-328.682) -- 0:00:36
      394000 -- (-326.154) (-326.054) [-323.939] (-324.630) * (-324.819) (-330.591) (-325.593) [-325.611] -- 0:00:36
      394500 -- (-327.099) (-325.750) [-324.441] (-327.658) * (-323.986) (-329.243) (-323.543) [-326.874] -- 0:00:36
      395000 -- [-324.933] (-324.841) (-323.524) (-324.342) * (-327.367) (-331.171) [-324.283] (-327.402) -- 0:00:36

      Average standard deviation of split frequencies: 0.013839

      395500 -- (-324.089) (-324.061) (-324.564) [-324.841] * (-326.141) (-327.012) (-325.679) [-327.919] -- 0:00:36
      396000 -- (-331.236) (-324.810) [-326.390] (-324.075) * [-324.408] (-324.345) (-323.651) (-328.739) -- 0:00:36
      396500 -- (-327.251) (-327.277) (-323.993) [-327.415] * (-326.699) (-324.078) (-323.843) [-326.617] -- 0:00:36
      397000 -- (-324.446) [-325.922] (-327.500) (-325.717) * [-323.959] (-326.572) (-326.278) (-324.835) -- 0:00:36
      397500 -- [-323.847] (-331.542) (-325.059) (-324.694) * [-324.074] (-325.653) (-325.824) (-327.393) -- 0:00:36
      398000 -- [-325.637] (-328.028) (-326.412) (-324.528) * (-328.049) (-325.961) (-326.870) [-326.476] -- 0:00:36
      398500 -- [-324.848] (-325.160) (-324.250) (-326.135) * (-324.211) (-324.131) (-324.499) [-325.202] -- 0:00:36
      399000 -- (-324.907) (-326.715) (-324.698) [-324.684] * (-329.547) [-324.936] (-325.108) (-329.079) -- 0:00:36
      399500 -- (-324.827) (-326.226) [-324.233] (-324.683) * [-328.891] (-326.667) (-325.370) (-327.336) -- 0:00:36
      400000 -- (-327.680) [-325.174] (-328.798) (-326.460) * (-325.377) (-327.425) (-327.750) [-324.403] -- 0:00:36

      Average standard deviation of split frequencies: 0.014266

      400500 -- (-325.779) (-327.502) [-325.081] (-323.541) * (-323.629) (-325.697) [-327.558] (-324.429) -- 0:00:35
      401000 -- (-323.792) (-327.914) (-324.988) [-326.764] * (-325.627) [-323.884] (-324.423) (-325.596) -- 0:00:35
      401500 -- (-327.105) (-329.715) [-327.322] (-324.659) * (-326.035) [-323.582] (-325.812) (-325.049) -- 0:00:35
      402000 -- [-325.836] (-325.613) (-330.459) (-324.267) * (-329.160) (-326.150) (-331.442) [-325.940] -- 0:00:35
      402500 -- (-323.721) (-324.130) [-328.821] (-324.436) * (-324.714) [-332.136] (-325.543) (-330.946) -- 0:00:35
      403000 -- (-325.190) (-323.910) [-324.007] (-325.987) * (-324.552) (-323.766) [-324.911] (-327.360) -- 0:00:35
      403500 -- (-324.860) (-323.996) (-329.270) [-324.101] * (-326.157) [-328.091] (-326.281) (-326.661) -- 0:00:35
      404000 -- (-324.409) (-327.853) (-325.011) [-328.247] * [-324.475] (-326.032) (-324.414) (-325.705) -- 0:00:35
      404500 -- (-324.699) (-331.516) (-326.893) [-324.230] * (-323.792) [-324.952] (-323.744) (-324.338) -- 0:00:35
      405000 -- (-330.656) (-336.347) (-327.277) [-325.846] * (-324.614) (-323.936) (-323.510) [-324.517] -- 0:00:35

      Average standard deviation of split frequencies: 0.013498

      405500 -- (-326.517) (-323.994) [-325.885] (-323.819) * (-326.239) (-326.383) (-324.887) [-324.254] -- 0:00:35
      406000 -- (-325.222) [-324.789] (-324.690) (-324.759) * [-327.753] (-324.058) (-324.380) (-325.514) -- 0:00:35
      406500 -- (-325.688) (-323.770) (-325.332) [-327.153] * [-324.327] (-324.606) (-326.807) (-324.003) -- 0:00:35
      407000 -- (-327.388) [-324.546] (-325.432) (-326.104) * [-326.820] (-325.809) (-324.095) (-325.255) -- 0:00:34
      407500 -- [-327.774] (-324.891) (-324.464) (-325.174) * (-325.390) (-325.597) (-326.582) [-324.040] -- 0:00:36
      408000 -- [-324.213] (-324.622) (-325.329) (-327.993) * (-324.483) [-326.256] (-326.743) (-325.835) -- 0:00:36
      408500 -- (-329.679) (-324.496) [-326.030] (-325.800) * [-328.575] (-326.057) (-329.780) (-330.208) -- 0:00:36
      409000 -- (-326.399) [-324.678] (-327.904) (-327.701) * (-325.720) (-325.402) (-326.924) [-324.790] -- 0:00:36
      409500 -- [-324.484] (-324.413) (-324.122) (-324.935) * (-326.385) [-325.119] (-325.568) (-324.121) -- 0:00:36
      410000 -- (-325.664) (-327.296) [-324.777] (-327.497) * (-323.724) (-323.653) [-324.830] (-324.101) -- 0:00:35

      Average standard deviation of split frequencies: 0.012699

      410500 -- [-326.988] (-333.561) (-324.327) (-326.165) * (-325.273) (-328.470) (-328.694) [-326.198] -- 0:00:35
      411000 -- (-323.541) [-333.177] (-326.721) (-324.017) * [-325.287] (-329.764) (-325.369) (-324.294) -- 0:00:35
      411500 -- [-323.840] (-328.522) (-324.873) (-328.673) * (-324.458) [-324.348] (-328.071) (-326.361) -- 0:00:35
      412000 -- (-324.021) (-326.247) (-327.569) [-325.250] * (-326.864) [-327.453] (-328.271) (-326.380) -- 0:00:35
      412500 -- [-325.153] (-325.143) (-323.953) (-325.562) * (-324.499) (-326.075) [-325.738] (-328.981) -- 0:00:35
      413000 -- (-324.899) [-327.180] (-325.159) (-324.225) * (-327.381) [-326.786] (-324.449) (-326.915) -- 0:00:35
      413500 -- (-325.389) (-328.329) (-327.054) [-324.873] * (-329.622) (-325.059) (-326.088) [-326.516] -- 0:00:35
      414000 -- (-327.695) (-326.394) [-326.980] (-332.733) * (-324.010) [-324.500] (-325.696) (-325.407) -- 0:00:35
      414500 -- [-325.424] (-324.106) (-328.298) (-325.763) * (-325.264) (-326.358) [-327.274] (-328.534) -- 0:00:35
      415000 -- (-324.473) (-327.111) [-325.082] (-324.356) * (-325.024) [-323.508] (-324.539) (-325.843) -- 0:00:35

      Average standard deviation of split frequencies: 0.012748

      415500 -- (-326.497) [-327.351] (-324.333) (-324.876) * [-324.652] (-326.520) (-327.833) (-328.098) -- 0:00:35
      416000 -- [-326.035] (-332.935) (-325.257) (-324.388) * (-325.154) (-328.128) [-327.652] (-324.292) -- 0:00:35
      416500 -- [-325.018] (-329.786) (-325.668) (-327.084) * (-332.352) [-328.114] (-325.877) (-324.387) -- 0:00:35
      417000 -- (-326.652) (-323.806) (-326.089) [-326.695] * (-324.955) (-324.488) (-330.663) [-326.640] -- 0:00:34
      417500 -- (-325.718) (-324.823) (-325.017) [-325.406] * (-326.496) (-324.952) (-330.631) [-328.445] -- 0:00:34
      418000 -- (-325.800) [-324.082] (-327.276) (-327.090) * (-323.371) (-323.706) (-327.820) [-325.364] -- 0:00:34
      418500 -- (-327.306) (-325.675) [-328.748] (-329.755) * (-324.910) (-323.854) [-325.511] (-327.560) -- 0:00:34
      419000 -- (-328.787) [-326.437] (-326.770) (-327.233) * (-324.012) (-324.946) [-325.678] (-324.812) -- 0:00:34
      419500 -- (-328.719) (-326.078) [-325.570] (-324.146) * (-324.075) (-324.571) [-326.170] (-326.401) -- 0:00:34
      420000 -- (-325.023) [-326.156] (-327.900) (-323.747) * [-324.069] (-324.728) (-325.007) (-327.045) -- 0:00:34

      Average standard deviation of split frequencies: 0.011556

      420500 -- [-325.269] (-324.996) (-326.009) (-324.971) * (-324.849) [-326.785] (-324.155) (-324.235) -- 0:00:34
      421000 -- (-331.535) (-326.170) (-326.374) [-325.264] * (-325.216) (-324.173) [-324.871] (-324.357) -- 0:00:34
      421500 -- (-327.466) [-325.081] (-325.196) (-325.123) * (-327.327) (-324.519) [-324.318] (-328.681) -- 0:00:34
      422000 -- [-326.520] (-324.345) (-325.279) (-327.093) * (-326.185) (-325.575) [-324.291] (-328.854) -- 0:00:34
      422500 -- [-324.274] (-323.890) (-324.914) (-326.116) * (-327.066) [-325.202] (-326.081) (-327.198) -- 0:00:34
      423000 -- (-328.691) (-328.245) [-325.868] (-324.646) * (-327.420) [-326.262] (-327.283) (-326.486) -- 0:00:34
      423500 -- (-324.245) [-326.349] (-325.170) (-325.640) * [-325.256] (-324.311) (-326.592) (-329.099) -- 0:00:34
      424000 -- (-329.033) (-325.088) (-331.489) [-330.198] * [-327.124] (-325.418) (-328.179) (-326.638) -- 0:00:33
      424500 -- (-324.113) (-324.877) [-326.743] (-328.688) * (-330.269) [-325.999] (-327.998) (-325.288) -- 0:00:35
      425000 -- (-325.149) (-325.177) [-327.554] (-326.505) * [-326.564] (-325.315) (-325.847) (-328.931) -- 0:00:35

      Average standard deviation of split frequencies: 0.011066

      425500 -- (-327.438) [-328.142] (-325.328) (-325.329) * (-332.816) (-327.901) [-324.102] (-327.094) -- 0:00:35
      426000 -- (-324.613) (-326.633) [-326.211] (-325.735) * (-327.898) (-325.273) [-324.929] (-324.451) -- 0:00:35
      426500 -- (-324.483) (-325.347) [-326.849] (-325.442) * (-326.328) [-324.552] (-325.217) (-325.034) -- 0:00:34
      427000 -- [-326.371] (-325.515) (-325.733) (-325.349) * (-324.955) (-327.016) (-325.624) [-325.190] -- 0:00:34
      427500 -- (-326.440) [-323.778] (-330.550) (-327.315) * (-323.618) [-326.784] (-324.617) (-325.372) -- 0:00:34
      428000 -- (-324.359) (-327.001) (-325.340) [-325.380] * (-326.580) (-326.984) [-325.266] (-327.058) -- 0:00:34
      428500 -- (-326.169) (-323.722) [-326.470] (-324.753) * (-325.358) (-328.091) (-325.102) [-326.637] -- 0:00:34
      429000 -- (-325.714) (-324.835) (-325.828) [-328.041] * [-323.852] (-325.890) (-328.963) (-326.953) -- 0:00:34
      429500 -- (-324.119) (-326.189) [-324.582] (-326.942) * [-324.782] (-327.857) (-325.434) (-328.027) -- 0:00:34
      430000 -- [-324.747] (-324.513) (-327.906) (-326.324) * (-324.019) [-324.487] (-325.207) (-325.667) -- 0:00:34

      Average standard deviation of split frequencies: 0.010467

      430500 -- (-326.359) [-324.337] (-326.412) (-325.165) * (-323.839) [-325.533] (-323.599) (-324.649) -- 0:00:34
      431000 -- (-330.419) (-327.242) [-327.702] (-326.036) * (-325.090) (-326.417) [-325.260] (-324.853) -- 0:00:34
      431500 -- (-324.550) (-325.415) [-324.389] (-323.976) * [-326.869] (-324.747) (-328.214) (-327.935) -- 0:00:34
      432000 -- (-323.488) (-324.430) [-324.213] (-325.105) * (-326.982) [-324.557] (-328.793) (-325.243) -- 0:00:34
      432500 -- (-324.485) (-324.467) [-323.538] (-326.953) * (-325.830) (-324.401) (-324.479) [-325.104] -- 0:00:34
      433000 -- (-327.399) [-324.841] (-327.247) (-325.690) * (-327.552) (-325.667) [-324.278] (-325.999) -- 0:00:34
      433500 -- (-327.299) (-330.333) [-325.799] (-325.043) * (-324.833) [-324.335] (-326.187) (-324.142) -- 0:00:33
      434000 -- (-326.907) (-325.063) (-324.448) [-323.722] * (-325.764) (-323.978) (-327.028) [-325.246] -- 0:00:33
      434500 -- (-325.190) (-323.959) (-329.913) [-323.710] * (-324.078) [-324.862] (-326.275) (-326.092) -- 0:00:33
      435000 -- (-328.993) (-327.702) (-324.654) [-323.746] * (-324.685) (-325.808) (-327.333) [-327.942] -- 0:00:33

      Average standard deviation of split frequencies: 0.011082

      435500 -- (-325.292) [-328.199] (-324.338) (-330.117) * [-324.481] (-328.970) (-326.704) (-325.685) -- 0:00:33
      436000 -- (-326.191) [-326.719] (-326.247) (-326.616) * [-327.021] (-325.993) (-324.460) (-328.105) -- 0:00:33
      436500 -- (-325.107) (-326.339) (-325.404) [-327.926] * (-326.645) [-331.001] (-328.185) (-331.968) -- 0:00:33
      437000 -- (-325.038) (-324.992) [-324.863] (-328.014) * (-326.718) [-324.156] (-327.471) (-326.316) -- 0:00:33
      437500 -- (-328.795) (-324.615) (-326.732) [-324.754] * (-324.377) [-327.067] (-324.866) (-331.398) -- 0:00:33
      438000 -- (-325.158) [-324.273] (-323.590) (-324.839) * [-325.580] (-328.152) (-324.260) (-325.591) -- 0:00:33
      438500 -- (-326.304) (-323.890) (-324.312) [-327.399] * (-326.884) (-328.572) (-323.555) [-324.525] -- 0:00:33
      439000 -- (-328.665) [-324.281] (-326.183) (-330.327) * [-326.669] (-333.008) (-325.242) (-324.970) -- 0:00:33
      439500 -- (-324.361) (-326.479) (-323.914) [-325.386] * (-325.861) (-330.609) (-325.935) [-324.289] -- 0:00:33
      440000 -- (-325.418) (-326.218) [-324.434] (-326.115) * [-325.262] (-329.113) (-325.166) (-328.761) -- 0:00:33

      Average standard deviation of split frequencies: 0.011567

      440500 -- (-325.986) (-327.486) [-324.476] (-324.596) * (-325.160) (-327.821) [-325.675] (-325.921) -- 0:00:33
      441000 -- (-326.686) (-325.590) (-324.746) [-324.913] * (-326.856) [-327.360] (-324.999) (-326.799) -- 0:00:32
      441500 -- (-325.627) (-324.859) (-325.775) [-326.937] * (-325.222) [-329.652] (-324.524) (-328.092) -- 0:00:32
      442000 -- (-327.216) (-324.381) [-324.058] (-329.704) * (-324.098) [-325.570] (-324.478) (-323.638) -- 0:00:34
      442500 -- (-326.488) [-324.042] (-327.056) (-326.736) * (-326.614) (-330.330) (-324.533) [-325.876] -- 0:00:34
      443000 -- (-324.031) (-326.511) [-325.272] (-329.666) * (-328.982) [-324.586] (-325.930) (-323.761) -- 0:00:33
      443500 -- (-325.243) (-325.390) [-325.600] (-332.358) * [-324.841] (-326.086) (-328.596) (-328.601) -- 0:00:33
      444000 -- [-326.140] (-325.355) (-324.524) (-325.689) * (-325.276) (-327.368) (-325.712) [-329.462] -- 0:00:33
      444500 -- (-324.686) (-326.687) [-324.033] (-327.696) * (-326.767) (-325.726) (-325.565) [-324.213] -- 0:00:33
      445000 -- (-323.848) [-325.253] (-325.790) (-327.598) * [-325.792] (-326.186) (-324.359) (-328.389) -- 0:00:33

      Average standard deviation of split frequencies: 0.011693

      445500 -- (-327.112) (-328.578) [-324.556] (-327.312) * (-327.600) (-329.559) (-327.322) [-324.671] -- 0:00:33
      446000 -- (-324.929) (-324.638) [-324.165] (-325.452) * (-326.223) (-324.794) (-327.435) [-324.593] -- 0:00:33
      446500 -- (-328.556) (-325.494) [-326.506] (-324.813) * [-326.592] (-328.276) (-330.154) (-327.787) -- 0:00:33
      447000 -- (-325.679) [-325.978] (-326.037) (-327.703) * (-324.188) [-329.447] (-328.320) (-325.695) -- 0:00:33
      447500 -- (-325.646) [-328.337] (-328.140) (-328.029) * [-326.682] (-326.968) (-324.397) (-328.410) -- 0:00:33
      448000 -- (-324.596) [-327.161] (-324.834) (-331.858) * (-325.247) [-324.130] (-324.622) (-325.633) -- 0:00:33
      448500 -- (-324.513) (-327.227) [-323.926] (-332.585) * (-326.232) (-325.592) (-326.333) [-328.324] -- 0:00:33
      449000 -- (-327.233) (-325.779) (-326.215) [-327.093] * (-328.473) (-332.161) (-325.244) [-324.091] -- 0:00:33
      449500 -- (-328.569) (-326.132) [-325.415] (-327.365) * (-325.523) [-327.591] (-325.621) (-324.822) -- 0:00:33
      450000 -- (-328.206) (-325.802) (-324.844) [-329.759] * (-326.038) (-326.038) (-324.120) [-324.789] -- 0:00:33

      Average standard deviation of split frequencies: 0.012029

      450500 -- (-324.033) (-325.682) (-323.722) [-325.654] * (-325.455) [-324.379] (-326.074) (-327.339) -- 0:00:32
      451000 -- (-324.579) (-331.206) [-329.315] (-325.015) * (-325.657) (-324.962) (-325.070) [-323.906] -- 0:00:32
      451500 -- (-326.064) [-326.679] (-325.154) (-327.184) * [-324.527] (-324.951) (-325.420) (-324.481) -- 0:00:32
      452000 -- (-325.098) (-324.976) [-325.669] (-324.640) * (-325.000) [-325.516] (-326.878) (-324.108) -- 0:00:32
      452500 -- [-325.145] (-326.284) (-324.617) (-326.416) * (-324.018) (-327.968) [-326.522] (-325.059) -- 0:00:32
      453000 -- (-325.002) (-327.933) (-325.989) [-324.932] * (-325.441) [-325.088] (-323.945) (-325.504) -- 0:00:32
      453500 -- (-325.916) (-324.624) [-325.129] (-327.482) * [-324.380] (-325.866) (-325.241) (-327.763) -- 0:00:32
      454000 -- (-325.583) [-324.662] (-323.739) (-326.057) * [-325.952] (-324.441) (-326.437) (-325.907) -- 0:00:32
      454500 -- [-326.733] (-325.386) (-324.615) (-325.123) * (-328.880) [-325.332] (-326.389) (-326.497) -- 0:00:32
      455000 -- (-325.376) (-324.588) [-326.851] (-325.487) * (-328.898) (-325.096) (-326.263) [-323.578] -- 0:00:32

      Average standard deviation of split frequencies: 0.012405

      455500 -- (-324.804) (-327.000) (-324.272) [-327.208] * (-328.464) (-327.899) (-329.295) [-325.249] -- 0:00:32
      456000 -- [-324.279] (-326.334) (-324.384) (-327.593) * (-329.525) (-327.464) [-325.601] (-325.586) -- 0:00:32
      456500 -- [-323.930] (-324.893) (-324.104) (-330.372) * (-329.889) (-324.537) (-323.731) [-327.583] -- 0:00:32
      457000 -- (-325.829) (-328.177) (-324.344) [-323.949] * (-329.169) (-325.243) [-326.467] (-327.856) -- 0:00:32
      457500 -- (-324.379) (-327.984) [-328.586] (-323.860) * (-324.532) (-327.401) (-330.908) [-329.749] -- 0:00:32
      458000 -- (-324.812) (-324.097) (-326.114) [-324.806] * [-325.449] (-328.769) (-329.817) (-325.581) -- 0:00:33
      458500 -- [-326.833] (-326.164) (-324.207) (-325.879) * [-325.358] (-327.592) (-328.052) (-324.388) -- 0:00:33
      459000 -- (-323.496) [-325.194] (-325.598) (-327.255) * (-330.469) (-327.928) [-326.389] (-325.895) -- 0:00:33
      459500 -- [-323.595] (-326.612) (-324.445) (-324.616) * [-325.631] (-325.408) (-325.882) (-327.661) -- 0:00:32
      460000 -- (-327.386) [-325.357] (-327.616) (-324.276) * (-326.576) [-324.293] (-327.788) (-323.457) -- 0:00:32

      Average standard deviation of split frequencies: 0.012216

      460500 -- [-324.971] (-325.285) (-324.443) (-325.742) * [-324.313] (-330.059) (-330.093) (-324.848) -- 0:00:32
      461000 -- (-326.818) [-325.771] (-324.431) (-329.049) * (-325.582) [-327.199] (-326.368) (-328.791) -- 0:00:32
      461500 -- (-324.769) (-325.188) [-324.450] (-325.064) * (-328.253) (-325.815) (-323.871) [-324.412] -- 0:00:32
      462000 -- (-329.360) (-323.716) (-324.807) [-324.167] * (-325.483) [-324.794] (-327.988) (-324.293) -- 0:00:32
      462500 -- (-330.141) [-326.617] (-328.395) (-325.056) * (-324.533) (-325.447) (-332.151) [-325.820] -- 0:00:32
      463000 -- (-325.324) (-325.920) (-327.573) [-325.057] * (-324.549) [-326.389] (-327.664) (-324.031) -- 0:00:32
      463500 -- [-327.529] (-326.300) (-330.915) (-325.975) * [-324.724] (-326.915) (-323.445) (-323.660) -- 0:00:32
      464000 -- (-325.507) (-326.340) (-326.877) [-325.658] * (-323.974) (-330.715) (-326.884) [-324.139] -- 0:00:32
      464500 -- (-324.689) (-325.872) [-323.994] (-324.882) * [-323.959] (-328.835) (-327.659) (-324.697) -- 0:00:32
      465000 -- (-323.677) (-327.508) [-323.874] (-325.838) * (-326.189) [-327.428] (-324.406) (-324.905) -- 0:00:32

      Average standard deviation of split frequencies: 0.011633

      465500 -- (-327.925) (-327.667) (-324.496) [-326.110] * (-324.726) (-326.261) [-326.371] (-325.337) -- 0:00:32
      466000 -- [-327.384] (-325.522) (-325.201) (-326.651) * (-326.748) (-324.514) [-323.492] (-324.321) -- 0:00:32
      466500 -- (-323.885) (-327.072) [-324.690] (-326.419) * (-324.961) (-324.132) [-326.385] (-327.062) -- 0:00:32
      467000 -- (-324.075) (-327.373) (-325.347) [-326.579] * (-327.792) (-326.548) (-326.582) [-325.539] -- 0:00:31
      467500 -- (-326.477) [-326.354] (-325.863) (-329.798) * (-325.667) (-328.730) (-323.801) [-327.660] -- 0:00:31
      468000 -- (-325.561) (-328.174) (-327.841) [-330.729] * (-326.815) (-325.381) [-323.620] (-326.110) -- 0:00:31
      468500 -- (-324.454) (-328.560) (-325.748) [-327.196] * [-324.719] (-325.517) (-323.553) (-325.287) -- 0:00:31
      469000 -- (-324.640) (-323.480) (-327.302) [-324.916] * [-324.278] (-333.746) (-325.373) (-324.619) -- 0:00:31
      469500 -- [-325.218] (-324.980) (-328.258) (-325.433) * (-324.673) (-326.011) (-325.398) [-325.095] -- 0:00:31
      470000 -- (-324.345) [-325.314] (-328.901) (-325.298) * [-329.192] (-328.033) (-328.764) (-327.715) -- 0:00:31

      Average standard deviation of split frequencies: 0.011831

      470500 -- (-325.940) (-329.729) (-324.708) [-324.378] * (-324.704) (-324.483) (-326.645) [-324.571] -- 0:00:31
      471000 -- (-325.011) (-323.995) [-324.925] (-327.898) * (-326.971) [-326.664] (-328.134) (-323.561) -- 0:00:31
      471500 -- [-324.950] (-325.424) (-326.639) (-327.199) * (-329.673) [-325.154] (-327.846) (-326.817) -- 0:00:31
      472000 -- (-324.975) (-324.700) (-328.666) [-324.666] * [-324.626] (-324.749) (-327.923) (-324.685) -- 0:00:31
      472500 -- (-324.866) (-325.151) [-325.968] (-324.287) * (-324.093) (-326.527) (-326.677) [-324.410] -- 0:00:31
      473000 -- (-324.407) (-329.997) [-324.589] (-327.944) * (-324.708) [-324.847] (-325.026) (-325.388) -- 0:00:31
      473500 -- [-325.527] (-326.201) (-327.007) (-326.208) * (-326.625) (-324.708) [-326.988] (-323.982) -- 0:00:31
      474000 -- [-324.558] (-325.161) (-326.645) (-326.339) * (-328.158) [-326.357] (-328.873) (-323.597) -- 0:00:31
      474500 -- (-325.072) (-325.095) (-323.888) [-327.139] * (-327.048) [-324.857] (-327.120) (-323.960) -- 0:00:32
      475000 -- (-325.847) [-326.490] (-327.690) (-325.463) * [-327.314] (-324.018) (-326.026) (-325.971) -- 0:00:32

      Average standard deviation of split frequencies: 0.011575

      475500 -- (-324.308) (-325.849) [-327.606] (-324.582) * (-325.602) [-326.655] (-327.200) (-326.885) -- 0:00:31
      476000 -- [-324.616] (-325.866) (-328.539) (-325.688) * (-324.496) [-326.310] (-327.009) (-326.865) -- 0:00:31
      476500 -- (-325.700) (-326.138) [-324.743] (-324.062) * (-327.213) [-325.919] (-327.270) (-325.034) -- 0:00:31
      477000 -- [-323.837] (-329.889) (-327.907) (-328.226) * (-325.550) (-327.782) (-326.334) [-325.187] -- 0:00:31
      477500 -- (-325.902) (-324.153) (-327.652) [-325.832] * (-326.669) (-329.573) (-326.522) [-323.961] -- 0:00:31
      478000 -- (-327.038) [-324.975] (-323.727) (-324.747) * (-325.497) (-326.043) (-328.537) [-323.634] -- 0:00:31
      478500 -- [-326.630] (-324.518) (-325.361) (-326.387) * (-327.075) (-326.576) [-326.646] (-325.154) -- 0:00:31
      479000 -- (-326.691) [-326.732] (-324.306) (-325.989) * (-325.628) (-329.335) [-324.900] (-326.219) -- 0:00:31
      479500 -- [-323.917] (-324.189) (-328.203) (-325.145) * (-325.573) (-331.992) (-325.765) [-325.832] -- 0:00:31
      480000 -- (-326.849) (-323.712) (-324.567) [-323.846] * (-323.936) [-327.076] (-328.276) (-326.643) -- 0:00:31

      Average standard deviation of split frequencies: 0.011830

      480500 -- [-329.700] (-324.134) (-326.603) (-326.325) * (-325.854) (-326.034) (-328.312) [-326.517] -- 0:00:31
      481000 -- (-325.544) (-326.886) (-326.773) [-324.591] * (-325.762) (-326.451) (-328.181) [-324.596] -- 0:00:31
      481500 -- [-324.103] (-327.426) (-328.245) (-324.556) * (-326.122) [-325.955] (-324.873) (-328.800) -- 0:00:31
      482000 -- (-326.270) [-325.228] (-326.157) (-324.244) * (-325.772) (-325.590) (-325.839) [-328.740] -- 0:00:31
      482500 -- (-325.120) (-326.277) (-327.998) [-326.182] * [-324.339] (-325.829) (-324.166) (-326.986) -- 0:00:31
      483000 -- [-327.708] (-325.360) (-324.747) (-323.715) * (-323.580) (-326.071) [-325.027] (-325.901) -- 0:00:31
      483500 -- [-326.453] (-325.951) (-325.503) (-324.108) * [-325.502] (-326.314) (-326.277) (-328.635) -- 0:00:30
      484000 -- (-332.271) (-327.371) (-328.066) [-324.044] * (-323.875) [-325.689] (-324.588) (-329.109) -- 0:00:30
      484500 -- [-328.291] (-325.045) (-329.351) (-325.003) * (-323.906) [-327.025] (-325.920) (-325.761) -- 0:00:30
      485000 -- (-328.317) (-325.520) [-324.271] (-324.688) * [-324.208] (-328.281) (-328.873) (-325.048) -- 0:00:30

      Average standard deviation of split frequencies: 0.012125

      485500 -- (-323.689) [-325.572] (-326.263) (-327.231) * [-327.291] (-326.336) (-325.115) (-325.845) -- 0:00:30
      486000 -- (-324.642) [-324.972] (-326.428) (-325.185) * (-325.852) [-327.081] (-324.365) (-326.784) -- 0:00:30
      486500 -- (-324.530) (-325.104) [-327.058] (-326.007) * (-325.792) (-325.484) [-324.831] (-325.286) -- 0:00:30
      487000 -- [-324.077] (-326.084) (-328.712) (-326.836) * (-325.827) (-325.300) (-325.622) [-324.880] -- 0:00:30
      487500 -- (-325.120) [-324.259] (-325.823) (-325.704) * (-324.071) (-324.042) (-326.684) [-323.923] -- 0:00:30
      488000 -- (-326.434) (-324.501) [-326.843] (-324.654) * (-325.760) (-323.372) [-326.517] (-323.932) -- 0:00:30
      488500 -- (-324.917) [-323.275] (-325.968) (-325.178) * (-323.393) [-331.807] (-324.239) (-324.103) -- 0:00:30
      489000 -- (-329.933) [-325.392] (-325.711) (-325.980) * (-325.900) (-325.489) (-326.503) [-325.456] -- 0:00:30
      489500 -- (-327.305) [-324.584] (-326.442) (-326.014) * (-324.570) [-325.672] (-325.834) (-325.508) -- 0:00:30
      490000 -- (-326.783) [-325.112] (-324.656) (-323.785) * (-330.003) [-325.457] (-325.753) (-328.309) -- 0:00:30

      Average standard deviation of split frequencies: 0.011529

      490500 -- [-325.415] (-326.313) (-327.271) (-325.171) * [-325.117] (-324.470) (-325.163) (-328.149) -- 0:00:30
      491000 -- (-325.544) (-325.019) [-324.699] (-325.846) * (-328.914) (-324.409) [-325.849] (-330.247) -- 0:00:31
      491500 -- (-324.267) (-326.190) [-325.319] (-326.490) * (-329.421) [-325.311] (-324.696) (-325.073) -- 0:00:31
      492000 -- [-325.402] (-324.086) (-328.541) (-327.850) * (-327.181) [-324.211] (-326.315) (-328.242) -- 0:00:30
      492500 -- (-325.781) [-324.019] (-326.894) (-325.015) * (-329.202) (-324.119) (-325.989) [-324.996] -- 0:00:30
      493000 -- (-326.946) [-324.705] (-326.989) (-326.427) * [-326.683] (-324.261) (-325.303) (-326.162) -- 0:00:30
      493500 -- [-326.865] (-324.394) (-325.177) (-327.993) * (-329.918) [-323.653] (-324.078) (-324.638) -- 0:00:30
      494000 -- [-323.916] (-324.878) (-326.838) (-325.535) * (-324.751) [-325.279] (-325.230) (-325.656) -- 0:00:30
      494500 -- [-328.358] (-324.540) (-327.815) (-325.264) * [-323.957] (-324.096) (-323.675) (-329.665) -- 0:00:30
      495000 -- (-325.439) (-324.937) [-325.607] (-324.972) * (-326.235) (-324.386) (-326.437) [-326.662] -- 0:00:30

      Average standard deviation of split frequencies: 0.011583

      495500 -- (-326.512) (-326.237) [-325.729] (-324.215) * [-324.176] (-323.645) (-324.688) (-327.612) -- 0:00:30
      496000 -- (-329.936) (-323.802) [-328.877] (-324.603) * (-325.268) (-324.084) (-326.579) [-324.268] -- 0:00:30
      496500 -- (-324.782) (-327.913) (-325.269) [-324.439] * (-323.846) (-327.967) (-324.268) [-324.994] -- 0:00:30
      497000 -- (-327.027) (-332.004) (-323.977) [-326.317] * (-324.810) (-325.516) [-325.589] (-326.895) -- 0:00:30
      497500 -- (-324.414) (-326.267) [-327.623] (-327.288) * [-325.287] (-324.116) (-326.120) (-326.221) -- 0:00:30
      498000 -- (-327.562) [-325.078] (-326.715) (-327.169) * (-325.410) (-327.746) [-323.668] (-325.891) -- 0:00:30
      498500 -- (-324.222) [-326.923] (-328.314) (-324.068) * (-325.173) (-327.054) [-326.324] (-326.859) -- 0:00:30
      499000 -- (-325.531) [-325.810] (-330.031) (-324.665) * [-326.764] (-324.102) (-325.391) (-326.332) -- 0:00:30
      499500 -- [-325.257] (-328.724) (-327.823) (-323.411) * (-327.027) (-323.624) (-328.513) [-326.861] -- 0:00:30
      500000 -- (-327.539) (-325.725) [-327.619] (-325.635) * [-325.087] (-324.652) (-329.923) (-326.585) -- 0:00:30

      Average standard deviation of split frequencies: 0.011828

      500500 -- (-323.454) [-323.960] (-327.546) (-325.691) * (-323.758) [-324.447] (-330.970) (-325.922) -- 0:00:29
      501000 -- (-325.135) [-328.725] (-328.271) (-328.322) * (-324.780) (-327.930) (-327.573) [-327.238] -- 0:00:29
      501500 -- (-325.902) [-329.105] (-326.175) (-326.611) * (-327.519) (-326.610) (-325.451) [-324.576] -- 0:00:29
      502000 -- (-323.867) (-328.528) [-326.089] (-327.221) * (-326.352) [-329.370] (-326.998) (-324.541) -- 0:00:29
      502500 -- (-326.025) [-327.639] (-327.161) (-327.477) * (-324.659) (-326.592) (-323.918) [-327.649] -- 0:00:29
      503000 -- [-325.451] (-326.326) (-328.712) (-330.665) * (-325.547) (-324.566) [-327.854] (-329.924) -- 0:00:29
      503500 -- (-326.345) (-330.855) (-324.807) [-330.099] * (-330.944) (-324.804) (-325.237) [-325.804] -- 0:00:29
      504000 -- [-327.764] (-324.864) (-324.425) (-326.640) * [-326.358] (-326.713) (-323.889) (-325.067) -- 0:00:29
      504500 -- (-326.099) [-325.276] (-326.040) (-325.879) * (-327.965) [-324.856] (-325.323) (-328.412) -- 0:00:29
      505000 -- (-326.165) (-323.925) (-325.281) [-325.551] * [-329.950] (-325.469) (-325.066) (-324.790) -- 0:00:29

      Average standard deviation of split frequencies: 0.011820

      505500 -- (-326.928) [-325.105] (-328.883) (-325.880) * [-323.783] (-323.910) (-324.508) (-328.373) -- 0:00:29
      506000 -- (-325.636) (-326.348) (-325.294) [-325.688] * [-324.313] (-324.390) (-327.732) (-327.806) -- 0:00:29
      506500 -- (-329.000) (-325.393) [-326.310] (-326.655) * (-330.604) (-329.200) [-324.382] (-327.693) -- 0:00:29
      507000 -- (-328.997) (-325.275) (-327.202) [-325.452] * (-323.727) (-327.711) [-325.914] (-327.990) -- 0:00:29
      507500 -- (-326.628) (-327.943) (-324.791) [-325.097] * (-325.818) (-326.166) (-324.630) [-331.091] -- 0:00:29
      508000 -- (-327.752) [-324.356] (-324.413) (-325.081) * (-327.821) (-325.617) [-323.697] (-327.481) -- 0:00:29
      508500 -- (-329.141) (-324.917) (-326.213) [-324.209] * [-325.494] (-326.372) (-326.784) (-325.317) -- 0:00:29
      509000 -- (-329.108) (-323.834) [-325.536] (-323.829) * [-324.075] (-323.489) (-327.264) (-324.244) -- 0:00:29
      509500 -- (-329.460) (-327.229) (-324.288) [-325.176] * [-324.600] (-325.578) (-323.863) (-325.034) -- 0:00:29
      510000 -- (-325.145) (-326.528) (-325.411) [-325.272] * (-327.008) [-326.577] (-325.010) (-325.713) -- 0:00:29

      Average standard deviation of split frequencies: 0.012058

      510500 -- (-326.416) [-325.828] (-324.796) (-324.935) * (-326.847) (-325.102) [-326.703] (-326.806) -- 0:00:29
      511000 -- [-325.595] (-325.236) (-326.876) (-328.216) * (-328.225) (-325.591) [-331.528] (-325.049) -- 0:00:29
      511500 -- (-324.955) [-325.231] (-324.765) (-326.171) * (-325.747) [-325.698] (-325.027) (-325.697) -- 0:00:29
      512000 -- (-324.301) (-326.546) (-324.204) [-326.614] * [-324.858] (-324.490) (-325.311) (-325.242) -- 0:00:29
      512500 -- (-326.314) (-326.094) [-323.976] (-327.415) * (-324.578) (-326.672) (-324.391) [-325.739] -- 0:00:29
      513000 -- [-325.353] (-325.024) (-323.593) (-326.189) * (-324.554) (-324.900) [-324.492] (-325.307) -- 0:00:29
      513500 -- (-327.391) (-327.431) [-325.647] (-328.411) * (-323.897) (-325.626) (-324.219) [-325.192] -- 0:00:29
      514000 -- (-329.685) (-329.087) (-324.036) [-326.116] * (-324.744) (-326.656) [-324.857] (-326.137) -- 0:00:29
      514500 -- (-331.961) (-325.515) (-324.264) [-324.583] * [-327.318] (-325.975) (-325.429) (-326.569) -- 0:00:29
      515000 -- [-329.442] (-326.576) (-324.088) (-325.527) * (-325.590) (-327.458) [-326.866] (-325.809) -- 0:00:29

      Average standard deviation of split frequencies: 0.011819

      515500 -- (-327.604) [-324.262] (-324.735) (-324.744) * (-325.911) (-329.640) [-323.648] (-326.422) -- 0:00:29
      516000 -- (-326.077) (-324.228) (-325.007) [-324.199] * (-327.332) (-324.042) [-325.011] (-325.343) -- 0:00:29
      516500 -- (-325.198) (-326.650) [-328.178] (-324.983) * (-326.416) (-325.001) [-326.958] (-328.171) -- 0:00:29
      517000 -- (-326.740) (-330.512) (-328.808) [-324.566] * (-326.264) [-330.420] (-326.815) (-325.364) -- 0:00:28
      517500 -- (-326.942) (-326.475) [-324.894] (-325.385) * (-324.263) (-326.464) [-326.956] (-325.460) -- 0:00:28
      518000 -- [-323.573] (-324.322) (-324.152) (-325.020) * (-324.035) [-327.166] (-326.336) (-324.300) -- 0:00:28
      518500 -- (-328.164) (-330.445) [-325.784] (-327.525) * (-325.556) (-324.187) (-326.022) [-325.143] -- 0:00:28
      519000 -- (-325.227) [-327.099] (-323.836) (-326.451) * (-326.113) (-327.685) (-324.798) [-325.300] -- 0:00:28
      519500 -- (-325.362) (-327.307) [-324.990] (-326.532) * (-324.994) [-324.337] (-324.693) (-324.173) -- 0:00:28
      520000 -- (-331.264) (-329.170) (-324.511) [-325.720] * [-325.617] (-327.349) (-325.438) (-324.622) -- 0:00:28

      Average standard deviation of split frequencies: 0.011261

      520500 -- (-329.935) (-325.951) [-324.130] (-326.180) * (-327.158) [-324.971] (-326.997) (-326.672) -- 0:00:28
      521000 -- (-326.955) [-325.162] (-324.207) (-323.879) * [-324.449] (-326.589) (-325.765) (-326.701) -- 0:00:28
      521500 -- (-325.184) (-324.626) (-323.381) [-323.770] * (-324.284) [-330.603] (-325.755) (-325.359) -- 0:00:28
      522000 -- (-325.237) (-326.287) [-325.394] (-324.805) * [-326.894] (-325.012) (-324.287) (-325.064) -- 0:00:28
      522500 -- (-325.402) (-325.769) [-324.073] (-324.127) * (-324.680) (-326.160) (-325.161) [-324.742] -- 0:00:28
      523000 -- (-325.703) (-324.415) (-326.659) [-323.761] * (-327.119) (-325.899) [-326.188] (-325.715) -- 0:00:28
      523500 -- [-327.048] (-329.135) (-324.207) (-327.334) * [-326.108] (-323.743) (-325.695) (-325.590) -- 0:00:28
      524000 -- (-324.702) (-333.045) [-327.176] (-326.621) * (-325.569) (-326.037) (-327.390) [-324.577] -- 0:00:28
      524500 -- (-324.182) (-324.848) [-323.500] (-325.307) * (-328.241) [-326.611] (-325.164) (-327.250) -- 0:00:28
      525000 -- (-324.240) (-324.161) (-325.333) [-324.991] * [-324.358] (-325.040) (-326.943) (-326.335) -- 0:00:28

      Average standard deviation of split frequencies: 0.010698

      525500 -- (-328.252) [-325.903] (-324.732) (-323.885) * (-327.568) [-324.730] (-330.196) (-328.157) -- 0:00:28
      526000 -- [-328.853] (-325.508) (-325.892) (-323.947) * [-324.628] (-324.640) (-329.250) (-325.273) -- 0:00:28
      526500 -- (-326.671) [-323.824] (-324.308) (-326.150) * [-324.705] (-327.098) (-326.242) (-323.376) -- 0:00:28
      527000 -- (-324.143) (-326.539) [-324.386] (-325.392) * (-326.072) (-326.477) [-324.014] (-324.418) -- 0:00:28
      527500 -- (-324.524) [-326.213] (-326.514) (-326.480) * (-326.105) (-324.335) (-324.548) [-325.996] -- 0:00:28
      528000 -- [-325.316] (-325.467) (-326.240) (-324.958) * (-328.681) (-327.962) (-326.646) [-324.015] -- 0:00:28
      528500 -- (-328.478) (-327.127) [-326.598] (-325.608) * (-325.020) [-325.063] (-323.568) (-327.456) -- 0:00:28
      529000 -- [-328.057] (-328.340) (-326.345) (-325.917) * (-324.072) (-325.798) (-327.911) [-326.075] -- 0:00:28
      529500 -- (-324.834) [-325.266] (-324.599) (-323.790) * (-325.409) (-323.416) (-328.650) [-325.083] -- 0:00:28
      530000 -- [-326.584] (-327.391) (-324.789) (-327.693) * (-330.442) (-328.861) (-326.165) [-325.622] -- 0:00:28

      Average standard deviation of split frequencies: 0.010549

      530500 -- (-332.163) (-323.484) [-325.060] (-326.198) * (-325.816) (-325.436) [-324.864] (-326.330) -- 0:00:28
      531000 -- (-333.396) [-324.622] (-325.897) (-325.722) * (-327.693) (-325.378) [-326.676] (-327.033) -- 0:00:28
      531500 -- [-328.896] (-326.099) (-325.357) (-328.331) * [-326.828] (-325.832) (-325.890) (-325.772) -- 0:00:28
      532000 -- (-324.337) (-324.899) (-330.450) [-323.874] * (-327.185) (-329.305) (-326.691) [-324.266] -- 0:00:28
      532500 -- (-324.387) [-324.999] (-325.444) (-323.804) * (-323.729) [-325.750] (-327.351) (-324.588) -- 0:00:28
      533000 -- (-327.197) (-325.106) [-325.733] (-326.221) * [-330.276] (-325.116) (-325.086) (-324.986) -- 0:00:28
      533500 -- (-325.455) (-324.175) (-331.667) [-324.131] * [-323.818] (-326.838) (-329.661) (-324.732) -- 0:00:27
      534000 -- (-327.174) (-323.471) [-329.615] (-326.412) * (-326.081) (-325.443) [-326.568] (-323.801) -- 0:00:27
      534500 -- [-326.964] (-326.817) (-324.029) (-324.303) * (-323.735) (-325.256) [-325.469] (-326.640) -- 0:00:27
      535000 -- (-325.079) (-326.144) (-324.754) [-325.048] * (-326.428) (-327.319) [-327.488] (-324.213) -- 0:00:27

      Average standard deviation of split frequencies: 0.010719

      535500 -- (-330.275) (-326.987) (-325.080) [-324.425] * (-324.429) (-328.506) [-325.366] (-328.992) -- 0:00:27
      536000 -- (-326.660) [-325.197] (-324.100) (-326.123) * (-325.281) [-325.562] (-325.623) (-327.148) -- 0:00:27
      536500 -- [-328.731] (-324.690) (-326.877) (-323.872) * (-330.652) (-332.204) [-325.371] (-327.490) -- 0:00:27
      537000 -- (-324.469) (-324.296) (-324.273) [-324.866] * (-325.076) (-327.215) [-327.020] (-324.615) -- 0:00:27
      537500 -- (-324.221) [-326.447] (-332.067) (-324.661) * (-326.512) (-326.044) [-327.459] (-324.205) -- 0:00:27
      538000 -- (-324.795) [-326.590] (-327.120) (-326.026) * [-324.068] (-325.482) (-323.935) (-324.495) -- 0:00:27
      538500 -- (-325.551) (-325.349) [-329.222] (-324.043) * (-325.037) (-329.295) (-325.975) [-326.058] -- 0:00:27
      539000 -- (-325.551) (-327.127) [-335.256] (-323.767) * [-325.123] (-325.336) (-323.857) (-328.652) -- 0:00:27
      539500 -- [-328.331] (-325.865) (-327.160) (-324.248) * (-328.048) [-325.685] (-326.027) (-327.525) -- 0:00:27
      540000 -- (-325.277) [-325.287] (-331.488) (-329.828) * (-327.550) (-330.203) [-325.968] (-328.265) -- 0:00:27

      Average standard deviation of split frequencies: 0.010408

      540500 -- (-325.523) (-327.293) [-323.901] (-329.625) * [-325.859] (-325.994) (-325.985) (-326.944) -- 0:00:27
      541000 -- (-327.910) (-325.420) (-324.617) [-329.920] * (-324.031) [-323.365] (-328.232) (-325.595) -- 0:00:27
      541500 -- (-330.356) (-326.729) [-325.657] (-326.526) * (-325.104) (-323.840) [-324.242] (-331.041) -- 0:00:27
      542000 -- (-328.044) (-327.863) (-325.817) [-328.085] * (-324.325) (-330.166) (-324.556) [-323.900] -- 0:00:27
      542500 -- (-326.893) [-324.775] (-326.885) (-326.283) * (-326.509) [-326.309] (-326.600) (-323.878) -- 0:00:27
      543000 -- [-324.177] (-324.529) (-327.099) (-323.734) * (-324.862) (-326.867) [-330.117] (-325.066) -- 0:00:27
      543500 -- (-324.987) (-326.179) [-327.941] (-327.183) * [-327.797] (-325.236) (-327.555) (-328.254) -- 0:00:27
      544000 -- [-328.148] (-323.820) (-325.608) (-326.538) * [-326.585] (-324.387) (-324.885) (-325.420) -- 0:00:27
      544500 -- (-329.632) (-325.223) [-326.696] (-325.262) * (-326.573) (-327.176) (-331.182) [-323.597] -- 0:00:27
      545000 -- (-324.650) (-326.490) (-324.600) [-323.877] * (-325.349) [-326.022] (-327.142) (-325.549) -- 0:00:27

      Average standard deviation of split frequencies: 0.009929

      545500 -- (-326.585) (-325.114) (-324.265) [-324.582] * (-325.868) (-327.225) (-327.575) [-325.913] -- 0:00:27
      546000 -- (-324.974) (-328.158) [-324.342] (-324.537) * (-324.208) [-324.915] (-325.660) (-326.818) -- 0:00:27
      546500 -- (-325.879) (-326.433) [-325.932] (-324.259) * (-325.049) [-325.246] (-325.262) (-323.647) -- 0:00:27
      547000 -- (-328.162) (-324.688) (-327.400) [-328.904] * [-326.392] (-324.773) (-326.616) (-325.032) -- 0:00:27
      547500 -- (-325.051) (-325.361) [-325.592] (-324.730) * (-328.246) (-324.298) [-327.227] (-325.518) -- 0:00:27
      548000 -- (-323.662) [-325.016] (-328.691) (-327.230) * (-329.348) (-329.883) [-325.250] (-325.108) -- 0:00:27
      548500 -- (-325.297) (-328.145) [-329.011] (-325.220) * (-328.105) (-330.689) [-329.171] (-326.777) -- 0:00:27
      549000 -- (-325.345) (-326.451) [-326.905] (-326.760) * (-326.646) (-325.962) [-325.576] (-329.650) -- 0:00:27
      549500 -- (-324.745) (-325.003) (-326.611) [-326.690] * (-328.442) (-324.857) [-327.529] (-327.595) -- 0:00:27
      550000 -- (-326.719) (-329.324) (-326.113) [-324.199] * (-328.285) (-324.158) [-325.064] (-326.977) -- 0:00:27

      Average standard deviation of split frequencies: 0.009577

      550500 -- (-325.990) (-331.125) [-327.470] (-326.611) * (-327.211) [-325.579] (-325.028) (-324.399) -- 0:00:26
      551000 -- (-330.860) (-328.619) (-328.773) [-323.866] * (-328.073) (-330.366) [-323.943] (-326.670) -- 0:00:26
      551500 -- (-330.128) [-324.852] (-328.526) (-323.826) * (-324.642) (-329.417) (-325.593) [-324.453] -- 0:00:26
      552000 -- (-328.208) [-331.411] (-326.087) (-325.951) * (-330.586) [-326.056] (-325.547) (-323.786) -- 0:00:26
      552500 -- (-329.843) (-325.604) (-324.803) [-325.847] * (-328.129) [-324.496] (-323.702) (-325.213) -- 0:00:26
      553000 -- [-325.681] (-325.671) (-324.285) (-328.053) * (-329.501) [-326.084] (-323.844) (-323.911) -- 0:00:26
      553500 -- (-323.703) (-325.689) [-324.662] (-332.905) * (-326.439) [-324.233] (-323.850) (-323.563) -- 0:00:26
      554000 -- [-326.968] (-326.114) (-325.037) (-328.528) * (-328.060) (-330.469) [-324.140] (-324.826) -- 0:00:26
      554500 -- (-328.318) (-328.648) (-324.600) [-325.551] * (-329.340) [-325.878] (-325.580) (-324.219) -- 0:00:26
      555000 -- (-327.070) (-326.867) [-324.152] (-328.217) * (-328.002) (-324.967) (-324.065) [-324.317] -- 0:00:26

      Average standard deviation of split frequencies: 0.010280

      555500 -- (-328.054) [-323.962] (-327.103) (-325.824) * (-329.356) [-323.797] (-323.965) (-324.149) -- 0:00:26
      556000 -- [-324.257] (-325.174) (-327.563) (-324.467) * (-331.003) (-327.190) (-325.581) [-325.112] -- 0:00:26
      556500 -- (-330.320) (-325.565) [-325.846] (-327.613) * [-324.098] (-326.630) (-324.345) (-327.008) -- 0:00:26
      557000 -- (-334.562) [-324.639] (-334.431) (-330.110) * (-325.795) (-326.649) (-324.297) [-325.331] -- 0:00:26
      557500 -- (-326.887) (-324.757) (-327.716) [-326.360] * (-326.734) (-326.220) (-325.870) [-326.197] -- 0:00:26
      558000 -- (-326.234) (-326.296) [-324.193] (-325.929) * (-326.148) (-327.180) [-326.940] (-330.574) -- 0:00:26
      558500 -- [-325.814] (-323.577) (-325.388) (-325.763) * (-326.583) (-327.762) (-327.940) [-325.405] -- 0:00:26
      559000 -- (-327.112) [-325.565] (-327.573) (-325.955) * (-324.369) (-324.552) [-326.684] (-325.419) -- 0:00:26
      559500 -- (-325.677) (-323.917) (-326.685) [-323.849] * (-327.238) (-324.340) [-324.371] (-329.313) -- 0:00:25
      560000 -- [-323.440] (-324.898) (-326.649) (-325.451) * (-325.394) (-324.604) (-323.637) [-326.166] -- 0:00:26

      Average standard deviation of split frequencies: 0.009984

      560500 -- [-325.004] (-327.928) (-326.243) (-323.816) * (-325.569) (-326.460) [-324.443] (-326.903) -- 0:00:26
      561000 -- (-324.909) (-324.504) [-327.056] (-331.864) * (-325.129) (-325.343) (-324.894) [-326.730] -- 0:00:26
      561500 -- (-327.692) [-329.039] (-331.507) (-326.070) * [-325.405] (-326.387) (-327.742) (-325.911) -- 0:00:26
      562000 -- (-328.915) [-324.695] (-325.607) (-327.131) * [-324.187] (-326.344) (-324.581) (-326.343) -- 0:00:26
      562500 -- (-325.492) (-327.600) (-327.132) [-327.453] * (-328.017) (-324.372) (-325.486) [-324.966] -- 0:00:26
      563000 -- (-326.581) [-325.033] (-324.160) (-329.490) * (-324.355) (-329.308) (-324.195) [-324.888] -- 0:00:26
      563500 -- (-324.810) (-325.451) (-324.673) [-324.478] * (-325.601) [-325.774] (-328.526) (-324.932) -- 0:00:26
      564000 -- [-326.034] (-326.634) (-333.767) (-324.570) * [-324.452] (-323.904) (-326.208) (-324.833) -- 0:00:26
      564500 -- [-324.648] (-328.189) (-327.170) (-326.200) * [-324.566] (-325.877) (-325.233) (-326.178) -- 0:00:26
      565000 -- [-323.474] (-329.702) (-325.071) (-326.023) * [-325.428] (-323.727) (-325.333) (-329.278) -- 0:00:26

      Average standard deviation of split frequencies: 0.009838

      565500 -- [-324.015] (-326.868) (-327.992) (-330.213) * (-325.208) (-324.765) (-327.753) [-326.372] -- 0:00:26
      566000 -- (-324.205) (-327.926) [-324.739] (-327.255) * (-325.686) (-324.026) [-326.465] (-328.635) -- 0:00:26
      566500 -- (-326.640) (-325.966) [-324.284] (-332.305) * (-326.096) (-323.599) (-327.393) [-325.543] -- 0:00:26
      567000 -- (-324.970) [-325.405] (-327.724) (-324.730) * (-327.730) (-327.295) [-325.533] (-323.949) -- 0:00:25
      567500 -- [-327.546] (-325.546) (-326.315) (-324.790) * (-326.277) [-323.875] (-324.875) (-325.624) -- 0:00:25
      568000 -- (-326.588) (-325.288) (-325.955) [-324.786] * (-325.167) (-327.606) [-326.240] (-324.695) -- 0:00:25
      568500 -- (-327.309) (-326.634) (-325.772) [-328.342] * (-327.368) [-329.435] (-324.639) (-323.943) -- 0:00:25
      569000 -- [-324.293] (-325.198) (-323.905) (-325.265) * (-327.263) (-326.420) (-327.741) [-327.142] -- 0:00:25
      569500 -- (-324.262) (-324.969) [-324.197] (-329.271) * (-324.767) [-325.657] (-323.761) (-325.224) -- 0:00:25
      570000 -- (-327.448) (-329.775) (-325.144) [-328.857] * (-325.406) (-324.595) (-324.730) [-326.680] -- 0:00:25

      Average standard deviation of split frequencies: 0.008701

      570500 -- (-325.229) (-325.817) (-324.918) [-325.001] * [-326.199] (-326.125) (-325.133) (-328.227) -- 0:00:25
      571000 -- (-328.304) [-323.965] (-327.089) (-323.792) * (-324.007) (-323.359) [-324.188] (-326.368) -- 0:00:25
      571500 -- (-327.278) [-324.291] (-326.096) (-325.703) * (-324.112) (-326.243) [-325.260] (-326.854) -- 0:00:25
      572000 -- [-325.087] (-325.807) (-328.699) (-324.820) * (-325.453) [-325.110] (-326.932) (-326.046) -- 0:00:25
      572500 -- (-325.933) (-325.583) [-324.600] (-324.798) * (-328.021) (-329.879) (-325.057) [-331.965] -- 0:00:25
      573000 -- [-326.285] (-325.595) (-324.291) (-324.584) * (-328.533) (-326.352) [-324.169] (-327.649) -- 0:00:25
      573500 -- (-324.290) [-327.505] (-325.526) (-323.781) * (-329.916) (-326.149) [-328.319] (-328.922) -- 0:00:25
      574000 -- (-324.790) (-324.069) [-327.444] (-324.572) * (-325.581) [-325.376] (-323.815) (-324.199) -- 0:00:25
      574500 -- (-328.009) (-324.246) (-328.360) [-325.769] * (-325.649) (-323.999) (-323.963) [-324.362] -- 0:00:25
      575000 -- (-324.983) (-325.588) (-325.345) [-324.245] * (-326.206) (-323.561) (-327.209) [-326.800] -- 0:00:25

      Average standard deviation of split frequencies: 0.008511

      575500 -- (-324.142) (-325.025) [-325.031] (-325.090) * (-324.385) (-326.284) (-327.392) [-324.593] -- 0:00:25
      576000 -- [-327.586] (-323.992) (-328.719) (-328.564) * (-328.866) [-323.500] (-324.376) (-324.936) -- 0:00:25
      576500 -- [-326.807] (-325.231) (-327.596) (-329.500) * (-329.345) (-325.725) (-324.546) [-325.577] -- 0:00:24
      577000 -- (-327.966) (-326.118) [-325.524] (-325.783) * (-327.390) [-328.272] (-324.228) (-323.848) -- 0:00:25
      577500 -- (-325.915) (-328.155) [-324.576] (-324.222) * (-326.192) (-324.856) [-325.426] (-326.810) -- 0:00:25
      578000 -- (-325.628) [-326.170] (-324.934) (-327.404) * (-325.294) (-324.984) [-324.815] (-325.842) -- 0:00:25
      578500 -- (-326.369) [-324.281] (-325.459) (-330.165) * (-326.299) (-326.732) (-324.946) [-324.910] -- 0:00:25
      579000 -- (-325.419) (-329.129) [-324.298] (-325.529) * (-324.288) (-325.787) [-324.575] (-323.930) -- 0:00:25
      579500 -- (-325.242) (-326.448) (-326.707) [-324.446] * (-327.226) (-324.624) (-324.428) [-323.989] -- 0:00:25
      580000 -- [-323.943] (-326.708) (-328.114) (-324.440) * (-326.060) (-326.640) [-323.239] (-323.671) -- 0:00:25

      Average standard deviation of split frequencies: 0.008551

      580500 -- (-326.122) (-327.972) [-326.469] (-323.996) * [-325.173] (-324.913) (-323.944) (-324.453) -- 0:00:25
      581000 -- (-324.269) [-323.784] (-325.777) (-325.617) * (-323.400) [-328.086] (-330.993) (-323.491) -- 0:00:25
      581500 -- (-326.130) (-325.096) (-323.802) [-325.710] * [-323.893] (-325.008) (-326.642) (-327.090) -- 0:00:25
      582000 -- (-327.023) (-330.720) (-326.326) [-325.656] * (-326.699) (-326.724) (-329.436) [-324.642] -- 0:00:25
      582500 -- (-328.151) (-327.743) [-326.620] (-325.046) * (-326.014) (-327.073) [-327.062] (-325.276) -- 0:00:25
      583000 -- (-324.940) [-327.814] (-325.340) (-327.057) * (-325.562) (-325.759) (-325.619) [-325.667] -- 0:00:25
      583500 -- (-325.614) [-326.110] (-325.015) (-324.081) * (-330.152) (-326.010) [-324.450] (-325.044) -- 0:00:24
      584000 -- (-324.639) (-325.532) (-327.812) [-328.029] * (-330.817) (-327.815) [-324.958] (-326.363) -- 0:00:24
      584500 -- (-326.039) (-324.477) (-328.294) [-326.672] * (-324.082) [-325.308] (-328.017) (-326.177) -- 0:00:24
      585000 -- (-326.454) (-324.169) (-326.414) [-326.295] * (-329.671) [-325.035] (-324.288) (-326.862) -- 0:00:24

      Average standard deviation of split frequencies: 0.008742

      585500 -- (-330.216) [-327.829] (-327.437) (-326.353) * (-325.733) (-323.984) (-325.262) [-325.939] -- 0:00:24
      586000 -- [-324.800] (-323.894) (-326.192) (-327.009) * (-326.516) [-323.897] (-323.808) (-327.097) -- 0:00:24
      586500 -- (-325.300) (-325.478) [-325.331] (-328.112) * [-326.877] (-325.710) (-328.724) (-326.806) -- 0:00:24
      587000 -- (-325.071) (-323.429) [-325.092] (-325.700) * (-330.284) (-329.737) [-325.249] (-324.802) -- 0:00:24
      587500 -- (-325.823) (-324.515) (-324.881) [-324.461] * (-331.599) (-325.952) [-324.744] (-325.603) -- 0:00:24
      588000 -- (-326.779) (-326.598) [-323.698] (-324.816) * (-327.129) (-324.821) [-325.067] (-325.891) -- 0:00:24
      588500 -- [-326.671] (-325.981) (-326.514) (-326.459) * (-323.790) (-324.947) (-325.994) [-324.640] -- 0:00:24
      589000 -- (-330.829) (-325.721) [-325.933] (-327.732) * [-325.065] (-328.181) (-325.442) (-325.782) -- 0:00:24
      589500 -- [-325.843] (-324.235) (-328.421) (-325.698) * (-325.501) [-330.368] (-325.647) (-327.372) -- 0:00:24
      590000 -- (-323.717) [-325.710] (-329.993) (-323.863) * [-326.607] (-324.250) (-328.364) (-326.177) -- 0:00:24

      Average standard deviation of split frequencies: 0.008141

      590500 -- (-325.665) (-328.917) (-327.000) [-326.243] * (-329.912) (-331.407) (-327.627) [-325.317] -- 0:00:24
      591000 -- (-324.865) (-328.442) [-327.103] (-324.447) * (-325.465) [-326.781] (-325.245) (-327.678) -- 0:00:24
      591500 -- (-329.105) (-326.310) [-324.988] (-327.407) * (-325.086) (-324.649) (-323.565) [-324.016] -- 0:00:24
      592000 -- (-323.385) (-330.429) [-330.653] (-331.840) * (-327.203) (-325.608) [-325.142] (-326.025) -- 0:00:24
      592500 -- (-324.130) [-331.516] (-327.918) (-331.322) * (-330.143) (-326.014) [-324.676] (-327.596) -- 0:00:24
      593000 -- (-327.021) (-326.785) (-326.661) [-327.117] * [-326.526] (-324.785) (-324.361) (-326.305) -- 0:00:24
      593500 -- (-326.432) (-326.813) (-328.173) [-325.942] * (-324.418) (-328.922) [-323.706] (-326.286) -- 0:00:23
      594000 -- [-328.723] (-326.442) (-326.987) (-324.591) * (-324.838) (-324.898) [-328.376] (-324.536) -- 0:00:24
      594500 -- [-328.491] (-328.473) (-324.192) (-330.045) * (-326.162) (-326.596) (-326.103) [-326.058] -- 0:00:24
      595000 -- (-327.298) (-329.048) [-325.707] (-328.929) * [-323.936] (-329.345) (-328.477) (-332.733) -- 0:00:24

      Average standard deviation of split frequencies: 0.007751

      595500 -- (-331.028) (-326.786) [-329.075] (-326.128) * (-326.315) (-329.032) [-325.562] (-331.126) -- 0:00:24
      596000 -- [-327.066] (-324.606) (-325.797) (-325.006) * (-328.754) (-327.214) [-325.527] (-325.066) -- 0:00:24
      596500 -- [-325.023] (-326.244) (-324.451) (-324.088) * (-329.419) [-327.419] (-325.519) (-325.797) -- 0:00:24
      597000 -- (-325.993) (-326.120) [-324.502] (-323.477) * (-325.993) [-323.968] (-325.891) (-324.838) -- 0:00:24
      597500 -- (-325.288) [-326.954] (-325.903) (-325.589) * [-325.017] (-324.473) (-327.304) (-324.288) -- 0:00:24
      598000 -- [-327.749] (-327.461) (-324.729) (-325.019) * (-324.467) (-324.540) (-324.136) [-324.472] -- 0:00:24
      598500 -- [-324.339] (-325.144) (-324.570) (-323.943) * [-324.036] (-325.428) (-330.175) (-324.764) -- 0:00:24
      599000 -- [-327.853] (-324.039) (-326.464) (-325.777) * (-324.443) (-328.414) (-324.870) [-325.694] -- 0:00:24
      599500 -- (-324.840) (-325.844) [-325.013] (-327.551) * (-324.083) [-326.066] (-323.999) (-325.816) -- 0:00:24
      600000 -- (-328.701) [-327.428] (-327.346) (-324.977) * [-325.992] (-324.466) (-326.551) (-325.693) -- 0:00:24

      Average standard deviation of split frequencies: 0.007743

      600500 -- (-323.382) [-325.510] (-325.302) (-323.830) * [-324.628] (-325.047) (-326.821) (-327.465) -- 0:00:23
      601000 -- [-326.363] (-325.365) (-327.648) (-325.479) * [-324.151] (-326.711) (-324.621) (-325.558) -- 0:00:23
      601500 -- (-327.365) [-326.774] (-326.264) (-324.850) * (-326.008) (-329.266) (-327.540) [-330.014] -- 0:00:23
      602000 -- (-325.798) (-324.333) (-324.224) [-324.281] * [-323.446] (-330.613) (-328.373) (-328.703) -- 0:00:23
      602500 -- [-325.491] (-326.736) (-325.023) (-325.245) * (-325.842) (-334.723) (-328.343) [-326.546] -- 0:00:23
      603000 -- [-328.585] (-326.812) (-324.125) (-324.443) * [-325.231] (-329.799) (-327.403) (-330.028) -- 0:00:23
      603500 -- (-324.648) (-325.731) [-325.672] (-325.438) * (-327.043) (-325.263) (-324.888) [-327.974] -- 0:00:23
      604000 -- [-323.566] (-327.472) (-326.245) (-325.699) * (-325.967) (-334.089) (-328.256) [-328.656] -- 0:00:23
      604500 -- (-324.568) (-325.334) [-328.099] (-323.778) * (-331.049) (-325.961) (-326.467) [-331.183] -- 0:00:23
      605000 -- (-324.329) (-325.768) (-325.883) [-324.993] * (-333.679) (-330.615) [-324.259] (-325.095) -- 0:00:23

      Average standard deviation of split frequencies: 0.007779

      605500 -- (-323.872) [-327.111] (-324.374) (-325.406) * (-327.021) (-329.900) (-325.764) [-324.445] -- 0:00:23
      606000 -- (-327.600) (-325.129) (-327.663) [-326.749] * (-327.474) (-327.530) [-328.037] (-326.665) -- 0:00:23
      606500 -- (-325.899) (-324.222) (-325.646) [-328.101] * (-329.103) [-324.768] (-328.222) (-324.490) -- 0:00:23
      607000 -- [-325.348] (-326.972) (-327.745) (-326.606) * [-327.057] (-327.983) (-324.779) (-337.047) -- 0:00:23
      607500 -- (-325.834) (-329.233) [-323.917] (-326.929) * (-326.547) [-324.287] (-324.114) (-325.000) -- 0:00:23
      608000 -- (-330.751) (-327.273) (-324.655) [-325.104] * (-326.086) (-325.012) [-325.366] (-324.396) -- 0:00:23
      608500 -- (-329.226) (-323.776) [-326.458] (-327.395) * (-327.124) (-326.050) (-328.187) [-323.694] -- 0:00:23
      609000 -- (-328.022) (-324.004) (-324.903) [-328.910] * [-327.603] (-325.625) (-327.070) (-326.643) -- 0:00:23
      609500 -- (-327.862) [-325.326] (-325.635) (-326.239) * [-326.203] (-324.063) (-325.206) (-324.846) -- 0:00:23
      610000 -- [-326.984] (-329.984) (-327.312) (-326.996) * (-326.550) [-324.277] (-326.758) (-327.145) -- 0:00:23

      Average standard deviation of split frequencies: 0.007977

      610500 -- (-327.588) (-323.396) (-324.934) [-324.041] * (-325.577) [-327.574] (-324.515) (-327.435) -- 0:00:22
      611000 -- (-331.503) [-324.634] (-326.793) (-327.402) * (-325.034) [-325.028] (-325.123) (-326.412) -- 0:00:23
      611500 -- (-324.733) [-326.255] (-324.952) (-323.945) * (-324.551) (-326.021) (-328.414) [-328.774] -- 0:00:23
      612000 -- (-327.618) (-324.007) [-326.082] (-326.001) * [-324.202] (-325.845) (-326.701) (-327.854) -- 0:00:23
      612500 -- [-325.305] (-325.230) (-328.083) (-329.609) * (-327.201) [-328.248] (-325.544) (-325.353) -- 0:00:23
      613000 -- (-324.262) (-327.260) [-326.089] (-329.291) * (-326.421) (-325.360) [-325.216] (-328.281) -- 0:00:23
      613500 -- (-323.344) [-324.142] (-327.605) (-329.789) * (-324.757) [-327.052] (-324.171) (-327.344) -- 0:00:23
      614000 -- (-328.670) (-326.656) [-324.760] (-325.768) * (-324.565) (-324.136) [-324.286] (-330.144) -- 0:00:23
      614500 -- (-327.641) (-324.870) (-325.524) [-324.130] * (-327.615) [-325.387] (-323.692) (-323.828) -- 0:00:23
      615000 -- (-325.226) [-325.037] (-325.377) (-331.848) * (-325.170) [-328.592] (-327.618) (-324.957) -- 0:00:23

      Average standard deviation of split frequencies: 0.007704

      615500 -- [-325.908] (-328.278) (-326.358) (-323.754) * (-324.905) (-328.221) (-328.122) [-325.639] -- 0:00:23
      616000 -- [-324.868] (-326.618) (-324.737) (-324.212) * (-327.420) (-324.834) (-326.496) [-325.998] -- 0:00:23
      616500 -- (-324.261) (-325.239) [-324.496] (-327.057) * [-325.336] (-326.276) (-324.567) (-327.456) -- 0:00:23
      617000 -- [-324.150] (-324.262) (-325.534) (-324.937) * [-328.073] (-326.289) (-325.492) (-326.537) -- 0:00:22
      617500 -- (-324.200) [-325.654] (-325.303) (-328.314) * [-326.878] (-325.564) (-325.254) (-328.097) -- 0:00:22
      618000 -- [-323.936] (-324.339) (-328.788) (-323.879) * [-325.009] (-330.904) (-324.264) (-330.949) -- 0:00:22
      618500 -- (-325.830) (-327.921) (-329.002) [-326.586] * (-325.928) [-323.712] (-327.366) (-330.956) -- 0:00:22
      619000 -- (-326.549) (-324.395) [-324.271] (-323.925) * (-326.203) (-326.112) (-326.201) [-329.627] -- 0:00:22
      619500 -- [-327.618] (-326.048) (-327.527) (-323.731) * (-325.949) [-327.217] (-323.693) (-325.778) -- 0:00:22
      620000 -- (-328.240) (-328.120) [-324.265] (-323.777) * (-324.862) [-327.163] (-324.725) (-327.369) -- 0:00:22

      Average standard deviation of split frequencies: 0.007089

      620500 -- (-326.615) [-324.432] (-325.225) (-327.021) * [-327.213] (-323.571) (-327.585) (-327.868) -- 0:00:22
      621000 -- (-325.227) [-324.718] (-326.538) (-325.740) * [-325.287] (-329.817) (-325.071) (-325.907) -- 0:00:22
      621500 -- [-325.553] (-323.817) (-325.924) (-327.765) * (-325.204) [-323.835] (-323.751) (-323.747) -- 0:00:22
      622000 -- [-324.791] (-324.848) (-324.406) (-325.800) * (-328.858) (-329.967) [-324.838] (-324.433) -- 0:00:22
      622500 -- (-324.541) (-326.314) (-324.549) [-330.789] * (-330.029) (-326.147) [-325.931] (-328.147) -- 0:00:22
      623000 -- (-325.452) (-325.059) [-325.155] (-327.911) * [-326.868] (-331.848) (-324.985) (-329.170) -- 0:00:22
      623500 -- (-329.235) [-326.476] (-325.745) (-326.036) * (-323.702) (-327.999) (-324.817) [-326.049] -- 0:00:22
      624000 -- (-324.582) (-327.930) [-323.938] (-323.867) * (-323.654) (-324.947) [-325.583] (-326.181) -- 0:00:22
      624500 -- (-324.746) (-325.744) (-323.424) [-326.006] * (-324.340) (-326.932) (-323.719) [-324.230] -- 0:00:22
      625000 -- (-325.507) [-326.831] (-323.713) (-323.927) * [-325.452] (-324.091) (-324.007) (-326.040) -- 0:00:22

      Average standard deviation of split frequencies: 0.007380

      625500 -- [-326.086] (-329.414) (-325.195) (-324.625) * (-324.270) [-325.412] (-324.099) (-329.978) -- 0:00:22
      626000 -- (-325.514) (-325.924) [-324.646] (-324.044) * (-328.376) (-323.963) (-324.872) [-328.281] -- 0:00:22
      626500 -- (-324.318) (-325.638) (-324.241) [-324.222] * [-324.027] (-325.188) (-323.816) (-323.941) -- 0:00:22
      627000 -- [-325.447] (-327.144) (-324.567) (-326.035) * (-323.771) [-328.816] (-325.988) (-324.960) -- 0:00:22
      627500 -- (-325.158) (-326.569) [-328.028] (-324.839) * (-324.263) [-324.543] (-323.914) (-323.727) -- 0:00:21
      628000 -- (-324.371) [-324.945] (-327.079) (-325.137) * (-328.637) (-325.238) [-325.550] (-324.178) -- 0:00:22
      628500 -- (-330.627) (-329.086) (-324.680) [-326.211] * (-326.937) (-324.396) (-324.225) [-324.620] -- 0:00:22
      629000 -- (-324.175) (-324.792) (-330.409) [-325.319] * (-329.035) (-325.044) [-325.427] (-333.380) -- 0:00:22
      629500 -- (-327.229) (-329.220) [-332.078] (-326.165) * (-330.702) [-324.526] (-325.909) (-326.943) -- 0:00:22
      630000 -- (-327.719) (-325.607) (-325.539) [-330.440] * (-325.722) (-323.728) (-327.963) [-326.437] -- 0:00:22

      Average standard deviation of split frequencies: 0.007275

      630500 -- (-328.913) (-325.912) (-331.220) [-328.271] * (-327.222) (-325.016) (-324.338) [-324.875] -- 0:00:22
      631000 -- (-328.756) [-331.671] (-325.685) (-325.503) * [-327.798] (-325.222) (-324.830) (-326.366) -- 0:00:22
      631500 -- [-323.878] (-332.765) (-326.195) (-325.952) * [-324.889] (-323.905) (-324.306) (-329.107) -- 0:00:22
      632000 -- (-326.356) [-326.246] (-326.047) (-325.557) * [-325.424] (-324.031) (-324.173) (-325.900) -- 0:00:22
      632500 -- (-325.363) [-325.191] (-323.835) (-325.930) * (-325.648) (-324.116) [-323.911] (-325.415) -- 0:00:22
      633000 -- (-324.677) (-325.103) [-324.706] (-323.705) * (-330.657) (-327.104) [-325.223] (-326.254) -- 0:00:22
      633500 -- (-325.422) (-326.383) (-324.770) [-324.773] * [-324.217] (-325.641) (-324.007) (-324.105) -- 0:00:21
      634000 -- (-327.147) (-327.398) (-327.934) [-324.626] * (-331.151) (-325.164) [-325.560] (-326.839) -- 0:00:21
      634500 -- (-325.601) (-329.521) (-327.164) [-325.310] * (-324.969) (-325.116) [-325.875] (-327.787) -- 0:00:21
      635000 -- (-330.955) (-325.959) [-326.719] (-325.548) * (-324.830) [-325.340] (-324.468) (-327.457) -- 0:00:21

      Average standard deviation of split frequencies: 0.006918

      635500 -- [-327.049] (-324.535) (-325.301) (-325.138) * (-334.240) (-323.981) (-324.541) [-326.039] -- 0:00:21
      636000 -- (-324.604) (-325.354) (-327.055) [-324.816] * (-326.457) [-327.311] (-324.786) (-329.880) -- 0:00:21
      636500 -- (-324.938) (-326.481) [-324.172] (-324.361) * (-327.126) (-326.206) (-325.038) [-325.830] -- 0:00:21
      637000 -- [-327.103] (-330.517) (-324.845) (-324.576) * (-328.680) (-324.787) (-327.108) [-325.109] -- 0:00:21
      637500 -- (-326.774) (-325.947) [-324.856] (-326.670) * [-326.072] (-324.525) (-327.229) (-324.817) -- 0:00:21
      638000 -- (-330.208) (-324.769) (-324.416) [-324.466] * (-324.646) (-324.434) (-326.762) [-324.456] -- 0:00:21
      638500 -- [-324.394] (-325.598) (-323.565) (-324.259) * (-328.349) (-327.200) [-325.802] (-326.898) -- 0:00:21
      639000 -- [-324.769] (-325.415) (-324.925) (-325.563) * [-325.410] (-324.468) (-325.278) (-326.293) -- 0:00:21
      639500 -- (-325.343) (-326.354) [-325.994] (-326.144) * (-327.579) (-325.348) [-324.794] (-324.292) -- 0:00:21
      640000 -- [-323.986] (-325.713) (-325.762) (-324.164) * (-328.483) (-333.603) (-329.317) [-327.494] -- 0:00:21

      Average standard deviation of split frequencies: 0.007358

      640500 -- (-325.423) [-325.846] (-327.248) (-323.545) * [-327.047] (-332.366) (-325.849) (-327.218) -- 0:00:21
      641000 -- (-327.716) [-326.446] (-325.317) (-327.220) * [-327.583] (-327.523) (-327.305) (-326.679) -- 0:00:21
      641500 -- [-326.075] (-324.222) (-325.799) (-325.583) * [-325.156] (-329.061) (-328.387) (-324.060) -- 0:00:21
      642000 -- (-327.371) [-324.174] (-325.176) (-326.349) * [-324.611] (-327.834) (-326.252) (-325.146) -- 0:00:21
      642500 -- (-329.012) (-324.897) (-325.286) [-325.310] * (-325.186) (-325.296) [-325.389] (-323.929) -- 0:00:21
      643000 -- (-326.165) (-323.902) [-326.814] (-324.217) * (-331.059) [-326.755] (-327.553) (-324.922) -- 0:00:21
      643500 -- [-324.548] (-323.816) (-325.664) (-324.948) * (-326.934) (-324.995) (-325.668) [-326.231] -- 0:00:21
      644000 -- (-324.399) [-330.515] (-326.915) (-326.574) * (-327.898) (-327.858) [-326.415] (-325.328) -- 0:00:21
      644500 -- (-325.428) (-324.368) (-330.394) [-325.343] * (-324.820) (-326.352) [-324.710] (-326.615) -- 0:00:20
      645000 -- (-328.283) (-325.704) (-324.443) [-324.273] * (-324.141) (-325.862) [-324.951] (-328.066) -- 0:00:20

      Average standard deviation of split frequencies: 0.006470

      645500 -- (-324.328) (-325.118) (-326.836) [-329.149] * [-326.705] (-325.319) (-327.726) (-326.779) -- 0:00:21
      646000 -- (-324.907) [-327.459] (-326.600) (-326.182) * (-326.828) (-327.742) (-325.977) [-325.344] -- 0:00:21
      646500 -- (-324.279) [-326.341] (-328.522) (-326.321) * (-326.193) [-324.453] (-325.807) (-326.801) -- 0:00:21
      647000 -- (-324.884) (-325.146) (-326.241) [-323.785] * (-325.776) (-326.598) [-326.139] (-325.298) -- 0:00:21
      647500 -- (-324.924) (-326.150) (-323.902) [-326.517] * [-329.710] (-326.440) (-325.187) (-323.472) -- 0:00:21
      648000 -- (-324.466) (-323.562) (-324.803) [-327.063] * (-327.383) [-328.113] (-325.019) (-323.967) -- 0:00:21
      648500 -- [-325.572] (-323.562) (-324.739) (-327.341) * [-327.795] (-326.437) (-324.049) (-325.449) -- 0:00:21
      649000 -- (-329.668) (-324.227) (-325.410) [-324.877] * [-327.263] (-325.321) (-324.373) (-326.532) -- 0:00:21
      649500 -- (-327.322) [-327.619] (-325.556) (-325.763) * (-325.905) (-324.639) (-327.176) [-327.402] -- 0:00:21
      650000 -- (-324.380) (-327.313) (-329.004) [-323.313] * (-328.951) (-324.136) [-328.143] (-325.238) -- 0:00:21

      Average standard deviation of split frequencies: 0.006472

      650500 -- (-325.444) (-324.211) (-326.403) [-326.494] * (-329.167) (-324.904) (-325.243) [-326.209] -- 0:00:20
      651000 -- (-324.523) (-329.088) (-326.146) [-325.145] * (-327.073) (-324.293) (-326.664) [-326.332] -- 0:00:20
      651500 -- (-323.644) [-325.685] (-325.439) (-326.815) * [-323.930] (-325.874) (-324.937) (-326.849) -- 0:00:20
      652000 -- (-323.707) (-327.589) (-328.396) [-323.569] * (-324.081) (-329.068) [-326.310] (-326.489) -- 0:00:20
      652500 -- [-323.577] (-324.305) (-325.757) (-325.513) * (-325.592) (-329.325) [-326.523] (-325.518) -- 0:00:20
      653000 -- (-325.980) [-326.197] (-326.077) (-325.979) * [-326.786] (-324.873) (-325.808) (-325.513) -- 0:00:20
      653500 -- (-324.573) [-326.373] (-324.806) (-327.422) * (-325.635) (-325.730) (-324.619) [-324.974] -- 0:00:20
      654000 -- (-324.413) (-325.241) [-324.111] (-325.320) * (-331.604) [-328.456] (-324.498) (-325.462) -- 0:00:20
      654500 -- (-326.176) (-324.771) [-327.045] (-325.100) * (-329.666) (-328.669) [-325.196] (-325.665) -- 0:00:20
      655000 -- (-324.842) (-325.654) [-325.716] (-324.888) * [-326.711] (-326.411) (-325.394) (-325.226) -- 0:00:20

      Average standard deviation of split frequencies: 0.006420

      655500 -- (-325.674) (-327.337) [-324.321] (-325.700) * (-324.397) [-326.650] (-326.373) (-326.145) -- 0:00:20
      656000 -- (-324.515) (-324.950) [-325.912] (-326.726) * (-323.681) (-324.625) [-324.949] (-325.566) -- 0:00:20
      656500 -- (-324.741) (-325.633) [-325.128] (-324.530) * [-324.943] (-325.393) (-329.001) (-325.416) -- 0:00:20
      657000 -- (-325.014) [-324.183] (-324.611) (-325.811) * [-324.567] (-326.504) (-333.259) (-324.111) -- 0:00:20
      657500 -- (-330.221) (-326.763) [-325.504] (-325.140) * (-323.666) (-326.726) [-325.375] (-329.609) -- 0:00:20
      658000 -- (-324.712) (-326.456) [-329.030] (-329.396) * (-325.509) (-330.020) [-323.420] (-324.300) -- 0:00:20
      658500 -- (-325.989) (-326.012) [-325.576] (-327.987) * (-326.062) (-326.006) (-326.320) [-323.949] -- 0:00:20
      659000 -- [-326.121] (-323.660) (-324.927) (-325.561) * [-327.185] (-326.434) (-325.403) (-326.018) -- 0:00:20
      659500 -- (-327.060) [-323.810] (-327.590) (-324.738) * (-329.708) (-325.764) (-327.138) [-325.225] -- 0:00:20
      660000 -- (-325.133) (-325.441) (-324.796) [-325.567] * (-327.375) (-329.754) (-323.706) [-323.544] -- 0:00:20

      Average standard deviation of split frequencies: 0.005756

      660500 -- (-325.192) [-327.664] (-324.094) (-325.165) * (-326.385) (-331.910) (-327.916) [-326.155] -- 0:00:20
      661000 -- [-324.645] (-324.671) (-325.915) (-327.775) * (-328.488) (-326.991) (-324.078) [-328.208] -- 0:00:20
      661500 -- (-327.736) (-324.377) [-328.374] (-328.132) * (-326.699) (-327.748) [-324.181] (-325.607) -- 0:00:19
      662000 -- [-334.584] (-324.726) (-326.790) (-325.026) * (-324.984) (-329.929) [-323.697] (-324.831) -- 0:00:19
      662500 -- (-332.538) (-325.923) (-326.954) [-327.090] * [-326.872] (-326.804) (-324.685) (-324.372) -- 0:00:20
      663000 -- (-328.678) (-325.746) (-325.494) [-325.645] * (-325.214) (-327.157) [-323.835] (-324.860) -- 0:00:20
      663500 -- (-325.930) (-324.769) [-323.454] (-325.675) * (-325.345) [-330.124] (-326.019) (-326.319) -- 0:00:20
      664000 -- [-325.814] (-327.414) (-324.785) (-324.922) * (-325.014) (-327.166) [-324.511] (-326.092) -- 0:00:20
      664500 -- (-327.227) (-324.783) (-325.785) [-328.985] * (-328.473) (-325.654) (-325.568) [-324.631] -- 0:00:20
      665000 -- [-326.600] (-325.022) (-328.339) (-327.246) * [-325.083] (-324.910) (-324.448) (-325.103) -- 0:00:20

      Average standard deviation of split frequencies: 0.005568

      665500 -- (-326.059) [-324.417] (-328.877) (-326.653) * [-326.257] (-324.967) (-325.834) (-328.070) -- 0:00:20
      666000 -- (-326.832) [-324.785] (-327.847) (-325.206) * [-324.808] (-323.882) (-330.801) (-325.266) -- 0:00:20
      666500 -- [-324.737] (-325.219) (-323.637) (-325.099) * (-325.584) [-324.220] (-325.232) (-324.674) -- 0:00:20
      667000 -- (-324.633) [-324.541] (-323.976) (-325.395) * (-327.653) [-326.151] (-323.797) (-324.351) -- 0:00:19
      667500 -- (-329.943) [-325.548] (-323.875) (-327.100) * [-323.525] (-326.999) (-324.334) (-325.086) -- 0:00:19
      668000 -- (-326.952) (-323.712) [-323.897] (-328.933) * (-324.861) (-323.941) (-326.981) [-326.282] -- 0:00:19
      668500 -- (-325.557) (-324.451) [-326.312] (-331.308) * (-325.248) [-323.961] (-324.615) (-325.664) -- 0:00:19
      669000 -- [-324.715] (-326.294) (-325.993) (-323.994) * (-325.309) (-328.092) (-324.096) [-323.814] -- 0:00:19
      669500 -- (-325.301) (-325.482) (-325.104) [-324.386] * (-325.148) [-325.228] (-324.785) (-326.109) -- 0:00:19
      670000 -- (-325.548) (-323.824) [-325.313] (-324.769) * (-330.735) (-324.515) [-323.929] (-328.246) -- 0:00:19

      Average standard deviation of split frequencies: 0.005857

      670500 -- (-332.341) [-323.798] (-327.630) (-325.185) * (-328.800) [-325.939] (-326.106) (-324.701) -- 0:00:19
      671000 -- [-324.886] (-323.845) (-324.539) (-325.603) * [-325.090] (-326.404) (-324.886) (-323.855) -- 0:00:19
      671500 -- (-326.545) (-325.488) [-323.793] (-328.713) * [-325.839] (-329.226) (-326.371) (-325.249) -- 0:00:19
      672000 -- (-325.466) (-324.759) [-324.886] (-325.688) * [-325.112] (-327.184) (-325.560) (-324.748) -- 0:00:19
      672500 -- (-327.500) (-329.821) [-324.382] (-325.774) * (-328.499) (-326.191) (-325.034) [-325.779] -- 0:00:19
      673000 -- (-333.173) (-329.073) [-326.603] (-325.903) * (-324.212) (-325.644) (-326.846) [-325.311] -- 0:00:19
      673500 -- (-334.486) [-326.564] (-325.227) (-325.323) * (-324.960) [-328.032] (-329.895) (-329.036) -- 0:00:19
      674000 -- (-331.927) [-325.580] (-324.190) (-325.032) * (-325.830) (-326.887) [-329.140] (-327.623) -- 0:00:19
      674500 -- (-327.170) (-325.387) [-326.457] (-324.566) * (-325.986) (-328.496) [-324.424] (-331.679) -- 0:00:19
      675000 -- (-326.678) [-326.612] (-325.449) (-330.292) * (-323.666) (-324.972) [-324.898] (-330.417) -- 0:00:19

      Average standard deviation of split frequencies: 0.005765

      675500 -- [-327.269] (-324.427) (-323.831) (-325.557) * (-325.555) [-326.185] (-325.068) (-325.624) -- 0:00:19
      676000 -- (-330.771) [-326.435] (-324.600) (-329.527) * (-325.073) (-326.284) [-325.550] (-326.095) -- 0:00:19
      676500 -- (-324.556) [-324.871] (-324.790) (-327.402) * (-326.718) [-327.093] (-326.451) (-324.555) -- 0:00:19
      677000 -- (-324.660) (-324.136) (-327.003) [-326.160] * [-328.981] (-331.197) (-325.552) (-324.412) -- 0:00:19
      677500 -- [-327.591] (-324.647) (-329.831) (-326.720) * (-326.464) (-331.353) (-326.816) [-324.826] -- 0:00:19
      678000 -- (-323.721) (-326.891) (-324.115) [-323.927] * [-324.369] (-334.978) (-325.329) (-325.607) -- 0:00:18
      678500 -- (-323.736) (-326.683) (-328.771) [-323.311] * (-323.815) [-325.352] (-324.549) (-325.330) -- 0:00:18
      679000 -- (-325.892) (-323.929) (-326.427) [-325.175] * (-324.120) (-328.984) (-325.552) [-327.164] -- 0:00:18
      679500 -- (-325.219) (-326.090) (-334.426) [-324.498] * (-324.587) (-327.039) (-325.405) [-324.871] -- 0:00:19
      680000 -- (-325.659) (-330.454) (-327.114) [-324.338] * (-326.734) (-325.795) (-327.590) [-324.628] -- 0:00:19

      Average standard deviation of split frequencies: 0.005633

      680500 -- [-325.728] (-323.892) (-325.735) (-325.371) * (-327.570) [-325.116] (-324.785) (-324.580) -- 0:00:19
      681000 -- (-326.187) (-323.643) (-327.090) [-323.505] * (-326.148) (-326.083) (-325.315) [-325.687] -- 0:00:19
      681500 -- [-323.512] (-323.522) (-325.057) (-326.068) * (-326.938) (-326.759) [-326.452] (-325.283) -- 0:00:19
      682000 -- (-324.651) [-327.257] (-325.968) (-327.135) * [-325.243] (-328.802) (-323.605) (-328.214) -- 0:00:19
      682500 -- (-323.616) [-326.274] (-325.036) (-325.705) * (-326.903) [-324.858] (-326.935) (-328.681) -- 0:00:19
      683000 -- (-323.621) [-326.073] (-326.969) (-330.605) * (-326.517) (-324.586) [-324.313] (-326.627) -- 0:00:19
      683500 -- [-325.676] (-329.111) (-327.564) (-327.534) * [-324.927] (-327.587) (-324.659) (-326.950) -- 0:00:18
      684000 -- (-326.499) [-324.885] (-326.113) (-324.013) * (-327.164) [-326.532] (-326.607) (-325.169) -- 0:00:18
      684500 -- (-330.401) (-324.570) [-323.630] (-327.178) * (-333.371) (-324.213) [-324.710] (-325.451) -- 0:00:18
      685000 -- [-325.280] (-326.228) (-325.323) (-324.638) * (-327.130) [-323.223] (-327.232) (-325.564) -- 0:00:18

      Average standard deviation of split frequencies: 0.005864

      685500 -- (-324.659) [-324.210] (-326.869) (-324.978) * (-324.681) (-323.896) [-325.790] (-326.852) -- 0:00:18
      686000 -- [-325.162] (-325.612) (-324.105) (-324.410) * (-323.828) (-324.823) (-327.430) [-324.242] -- 0:00:18
      686500 -- (-324.613) [-326.963] (-327.120) (-328.526) * (-324.665) (-324.656) [-325.067] (-324.031) -- 0:00:18
      687000 -- (-324.224) [-324.205] (-332.733) (-325.471) * [-325.034] (-325.628) (-325.814) (-326.703) -- 0:00:18
      687500 -- (-327.290) [-323.757] (-324.954) (-326.491) * (-327.325) (-325.852) [-329.873] (-326.794) -- 0:00:18
      688000 -- (-326.577) [-328.201] (-323.864) (-328.466) * [-324.071] (-326.102) (-327.381) (-326.681) -- 0:00:18
      688500 -- (-326.531) (-326.772) (-323.576) [-326.703] * [-327.257] (-324.559) (-328.108) (-327.185) -- 0:00:18
      689000 -- [-324.513] (-325.614) (-324.209) (-326.431) * (-336.151) [-325.629] (-325.406) (-326.076) -- 0:00:18
      689500 -- (-324.473) (-324.607) (-324.972) [-324.408] * (-325.293) (-325.116) (-325.250) [-327.118] -- 0:00:18
      690000 -- (-323.371) (-324.097) [-325.368] (-332.988) * (-326.023) (-327.902) (-325.525) [-325.329] -- 0:00:18

      Average standard deviation of split frequencies: 0.005779

      690500 -- (-325.112) (-325.424) [-325.164] (-330.386) * (-332.310) (-326.170) (-325.770) [-329.605] -- 0:00:18
      691000 -- (-325.803) (-324.025) [-329.837] (-327.683) * [-329.324] (-325.374) (-325.963) (-326.397) -- 0:00:18
      691500 -- (-326.307) [-326.687] (-328.067) (-326.804) * (-328.182) (-327.019) (-326.083) [-326.450] -- 0:00:18
      692000 -- (-328.929) (-329.142) (-326.679) [-325.051] * (-324.881) (-326.142) [-324.518] (-326.714) -- 0:00:18
      692500 -- (-331.818) (-329.045) [-327.683] (-326.424) * (-323.851) (-325.339) [-325.988] (-324.041) -- 0:00:18
      693000 -- (-327.348) (-327.016) [-327.250] (-325.706) * (-325.146) [-324.200] (-325.457) (-325.525) -- 0:00:18
      693500 -- [-326.941] (-329.963) (-330.087) (-325.147) * (-324.798) (-325.352) [-324.274] (-325.922) -- 0:00:18
      694000 -- [-325.645] (-325.914) (-325.486) (-326.859) * (-324.121) [-325.486] (-324.911) (-330.880) -- 0:00:18
      694500 -- (-325.661) (-325.871) (-326.252) [-325.217] * [-324.418] (-325.120) (-324.913) (-325.411) -- 0:00:18
      695000 -- (-324.554) [-323.814] (-324.516) (-325.342) * (-324.875) [-326.476] (-324.875) (-326.407) -- 0:00:17

      Average standard deviation of split frequencies: 0.006322

      695500 -- (-327.227) (-324.508) (-324.825) [-324.765] * [-324.833] (-324.927) (-324.575) (-324.224) -- 0:00:17
      696000 -- (-327.438) (-323.738) (-323.988) [-324.808] * (-329.600) (-325.367) [-325.223] (-326.182) -- 0:00:17
      696500 -- (-328.954) (-323.305) [-324.549] (-323.796) * (-326.511) (-325.139) (-324.658) [-324.746] -- 0:00:17
      697000 -- (-326.346) (-324.208) (-324.840) [-326.548] * [-324.367] (-324.329) (-325.263) (-323.733) -- 0:00:18
      697500 -- (-326.868) [-324.739] (-327.042) (-324.728) * (-324.509) (-329.580) [-324.107] (-324.499) -- 0:00:18
      698000 -- (-326.710) [-323.814] (-325.953) (-323.879) * [-325.084] (-333.289) (-324.866) (-325.841) -- 0:00:18
      698500 -- [-325.507] (-325.066) (-326.744) (-324.919) * [-324.505] (-324.894) (-327.793) (-325.700) -- 0:00:18
      699000 -- [-326.360] (-324.276) (-326.870) (-326.503) * (-326.162) (-324.035) [-325.254] (-327.012) -- 0:00:18
      699500 -- (-325.383) (-324.563) [-326.947] (-327.957) * (-326.669) (-325.020) [-326.434] (-324.438) -- 0:00:18
      700000 -- (-325.634) (-324.787) [-323.570] (-326.334) * (-326.184) (-327.746) (-327.606) [-327.556] -- 0:00:18

      Average standard deviation of split frequencies: 0.005921

      700500 -- [-326.361] (-324.497) (-325.385) (-326.466) * (-326.211) (-323.644) (-325.433) [-324.684] -- 0:00:17
      701000 -- (-330.599) (-324.895) (-325.272) [-326.064] * (-325.453) (-324.771) (-325.986) [-324.405] -- 0:00:17
      701500 -- (-324.749) (-324.491) (-328.426) [-327.246] * [-325.915] (-323.775) (-325.673) (-330.258) -- 0:00:17
      702000 -- (-324.654) (-326.945) (-328.099) [-324.283] * (-327.541) (-325.173) [-323.466] (-330.616) -- 0:00:17
      702500 -- (-325.167) (-329.535) [-323.897] (-324.675) * (-326.752) (-324.429) [-326.800] (-328.268) -- 0:00:17
      703000 -- (-323.249) (-327.987) [-324.686] (-324.991) * (-329.218) [-330.880] (-328.452) (-325.488) -- 0:00:17
      703500 -- [-325.478] (-327.707) (-325.655) (-332.143) * [-327.841] (-334.450) (-326.923) (-324.815) -- 0:00:17
      704000 -- (-326.683) [-325.326] (-328.518) (-325.452) * [-325.877] (-330.460) (-323.742) (-326.019) -- 0:00:17
      704500 -- [-325.906] (-328.942) (-329.758) (-324.891) * (-324.941) [-325.719] (-325.128) (-326.527) -- 0:00:17
      705000 -- [-326.685] (-323.665) (-324.396) (-324.076) * [-326.210] (-326.455) (-326.847) (-325.228) -- 0:00:17

      Average standard deviation of split frequencies: 0.005742

      705500 -- (-325.507) [-325.492] (-325.872) (-327.257) * (-325.398) [-326.659] (-323.912) (-323.664) -- 0:00:17
      706000 -- (-324.973) (-325.189) (-324.293) [-324.419] * (-328.656) (-326.519) (-323.859) [-324.708] -- 0:00:17
      706500 -- (-325.057) (-325.958) (-324.446) [-324.938] * (-327.078) [-326.979] (-328.497) (-325.605) -- 0:00:17
      707000 -- [-328.303] (-329.730) (-324.688) (-324.585) * (-331.783) (-327.045) [-325.172] (-326.579) -- 0:00:17
      707500 -- (-325.084) (-332.303) (-324.407) [-326.252] * (-329.511) (-323.871) (-329.173) [-324.781] -- 0:00:17
      708000 -- [-328.430] (-325.568) (-325.434) (-325.313) * (-324.932) (-324.604) (-324.974) [-328.433] -- 0:00:17
      708500 -- (-328.269) [-326.789] (-325.970) (-324.793) * [-324.366] (-325.334) (-327.022) (-325.092) -- 0:00:17
      709000 -- (-325.073) (-324.501) (-330.427) [-324.567] * (-328.156) (-328.239) (-325.411) [-325.338] -- 0:00:17
      709500 -- (-323.725) (-325.054) [-325.193] (-330.478) * [-324.479] (-326.239) (-328.112) (-328.675) -- 0:00:17
      710000 -- (-325.762) (-324.796) [-326.883] (-328.405) * (-325.167) (-328.684) [-324.875] (-328.685) -- 0:00:17

      Average standard deviation of split frequencies: 0.005837

      710500 -- (-325.002) [-327.188] (-326.055) (-325.184) * (-323.454) (-324.036) [-326.413] (-326.721) -- 0:00:17
      711000 -- (-330.792) (-325.099) (-326.621) [-330.002] * (-326.374) [-323.674] (-324.132) (-325.769) -- 0:00:17
      711500 -- (-325.678) [-328.349] (-324.319) (-325.480) * [-325.373] (-328.504) (-324.744) (-325.479) -- 0:00:17
      712000 -- (-327.165) (-325.904) [-325.617] (-327.084) * (-324.346) (-326.495) [-324.050] (-329.482) -- 0:00:16
      712500 -- (-328.727) (-327.225) (-326.258) [-324.310] * (-325.221) (-333.583) [-324.694] (-327.618) -- 0:00:16
      713000 -- [-324.822] (-325.329) (-326.176) (-327.810) * (-325.210) [-325.019] (-324.304) (-326.849) -- 0:00:16
      713500 -- [-325.522] (-326.018) (-324.011) (-325.446) * [-323.776] (-325.138) (-330.227) (-331.920) -- 0:00:17
      714000 -- (-324.215) (-325.868) (-325.399) [-325.654] * (-324.809) (-327.083) (-324.701) [-325.008] -- 0:00:17
      714500 -- (-323.784) [-327.235] (-325.528) (-324.781) * (-326.484) (-324.370) [-324.533] (-325.345) -- 0:00:17
      715000 -- (-326.522) (-324.610) (-324.002) [-324.228] * (-326.651) (-327.409) (-329.602) [-326.483] -- 0:00:17

      Average standard deviation of split frequencies: 0.005969

      715500 -- (-325.112) (-325.308) [-326.545] (-324.863) * [-326.677] (-333.289) (-330.165) (-326.447) -- 0:00:17
      716000 -- [-326.831] (-327.211) (-326.725) (-325.602) * (-327.910) (-325.091) (-324.104) [-325.461] -- 0:00:17
      716500 -- (-323.857) [-324.892] (-324.935) (-326.739) * [-325.362] (-328.498) (-324.897) (-326.906) -- 0:00:17
      717000 -- (-325.778) [-325.507] (-324.330) (-327.970) * (-325.114) [-324.873] (-324.935) (-329.972) -- 0:00:16
      717500 -- (-325.055) [-329.800] (-326.419) (-329.266) * (-327.165) (-324.894) [-325.302] (-325.120) -- 0:00:16
      718000 -- [-324.620] (-325.582) (-326.834) (-330.784) * (-327.675) (-327.134) (-324.838) [-328.201] -- 0:00:16
      718500 -- (-325.577) (-326.550) [-325.126] (-328.680) * (-325.327) (-325.450) [-330.735] (-326.024) -- 0:00:16
      719000 -- (-324.907) (-329.425) [-324.854] (-328.158) * (-326.497) [-325.290] (-326.598) (-324.620) -- 0:00:16
      719500 -- [-325.902] (-325.641) (-327.415) (-326.292) * (-325.972) (-326.498) (-324.198) [-325.308] -- 0:00:16
      720000 -- [-324.631] (-326.336) (-324.455) (-328.923) * (-324.735) [-327.799] (-324.039) (-324.105) -- 0:00:16

      Average standard deviation of split frequencies: 0.005843

      720500 -- [-324.789] (-325.430) (-324.552) (-326.775) * (-326.360) (-323.491) (-325.977) [-326.222] -- 0:00:16
      721000 -- (-324.002) [-324.679] (-324.147) (-334.137) * (-326.549) (-324.315) (-326.753) [-325.882] -- 0:00:16
      721500 -- (-326.089) (-324.288) [-325.109] (-326.511) * (-325.889) (-325.757) [-325.863] (-328.367) -- 0:00:16
      722000 -- (-326.898) (-324.306) (-324.423) [-327.440] * [-325.520] (-323.472) (-324.452) (-324.415) -- 0:00:16
      722500 -- (-327.105) (-323.982) (-326.087) [-325.911] * (-328.111) [-326.103] (-324.004) (-328.227) -- 0:00:16
      723000 -- (-325.455) (-327.293) (-328.229) [-325.892] * (-328.503) (-324.915) (-326.786) [-323.734] -- 0:00:16
      723500 -- (-325.861) [-324.401] (-327.909) (-329.911) * (-326.495) (-325.155) [-328.547] (-323.256) -- 0:00:16
      724000 -- (-326.290) [-324.341] (-324.586) (-329.748) * [-326.172] (-325.804) (-333.977) (-323.814) -- 0:00:16
      724500 -- (-326.945) (-327.358) [-328.182] (-326.928) * (-327.415) (-324.148) [-324.038] (-324.227) -- 0:00:16
      725000 -- (-329.878) (-328.785) (-326.119) [-327.620] * [-327.675] (-324.394) (-324.556) (-326.590) -- 0:00:16

      Average standard deviation of split frequencies: 0.006104

      725500 -- (-327.894) (-324.995) [-324.521] (-324.780) * (-327.067) [-324.308] (-324.428) (-324.403) -- 0:00:16
      726000 -- (-327.441) (-324.270) (-325.902) [-324.317] * (-333.807) [-324.912] (-324.072) (-324.730) -- 0:00:16
      726500 -- (-325.215) (-324.183) (-324.940) [-329.364] * [-327.110] (-328.537) (-323.764) (-327.151) -- 0:00:16
      727000 -- (-331.946) (-325.332) (-324.809) [-325.607] * (-323.773) [-327.602] (-323.420) (-325.834) -- 0:00:16
      727500 -- (-325.589) [-325.183] (-323.683) (-328.732) * (-325.016) (-325.272) (-323.849) [-324.988] -- 0:00:16
      728000 -- (-325.668) [-324.808] (-327.061) (-327.446) * [-328.163] (-324.567) (-324.371) (-325.007) -- 0:00:16
      728500 -- (-325.226) (-328.611) [-326.109] (-325.239) * (-326.530) (-323.542) (-325.415) [-325.811] -- 0:00:16
      729000 -- [-326.715] (-325.387) (-326.394) (-328.933) * (-326.492) (-328.612) [-325.305] (-324.799) -- 0:00:15
      729500 -- (-325.573) (-324.464) (-325.215) [-323.904] * (-325.878) (-328.339) [-323.972] (-324.209) -- 0:00:15
      730000 -- (-326.107) (-328.637) (-323.492) [-326.588] * (-330.509) (-334.429) [-325.138] (-324.581) -- 0:00:15

      Average standard deviation of split frequencies: 0.006280

      730500 -- (-326.240) (-327.709) [-325.360] (-326.352) * (-328.269) (-328.204) [-324.709] (-323.645) -- 0:00:16
      731000 -- (-327.870) (-326.802) [-324.704] (-327.448) * (-329.882) (-327.025) [-326.537] (-326.986) -- 0:00:16
      731500 -- [-327.526] (-324.512) (-325.416) (-325.329) * (-324.494) (-326.570) (-326.352) [-325.049] -- 0:00:16
      732000 -- (-332.142) (-324.827) [-324.747] (-325.910) * (-326.951) [-326.017] (-330.585) (-327.944) -- 0:00:16
      732500 -- [-323.404] (-328.135) (-327.931) (-326.813) * (-325.615) [-326.268] (-325.339) (-324.260) -- 0:00:16
      733000 -- (-324.301) [-326.839] (-327.679) (-324.629) * (-325.791) (-325.039) (-325.797) [-323.781] -- 0:00:16
      733500 -- (-327.785) [-324.539] (-326.786) (-326.792) * (-325.856) (-328.732) (-325.973) [-323.895] -- 0:00:15
      734000 -- [-324.167] (-326.657) (-326.758) (-324.464) * (-325.682) [-325.706] (-329.133) (-324.326) -- 0:00:15
      734500 -- (-326.826) [-327.028] (-323.742) (-330.306) * (-326.911) [-325.346] (-326.794) (-324.422) -- 0:00:15
      735000 -- (-327.071) [-325.238] (-325.575) (-326.403) * (-326.076) (-324.653) [-325.575] (-326.946) -- 0:00:15

      Average standard deviation of split frequencies: 0.006533

      735500 -- (-327.651) (-326.200) (-325.009) [-326.891] * [-324.976] (-326.983) (-325.705) (-324.947) -- 0:00:15
      736000 -- [-326.696] (-324.627) (-324.812) (-325.351) * (-324.673) (-325.997) [-325.507] (-323.928) -- 0:00:15
      736500 -- [-331.035] (-325.625) (-327.831) (-330.252) * (-324.230) [-326.366] (-328.906) (-323.663) -- 0:00:15
      737000 -- (-327.642) (-327.088) [-324.190] (-325.758) * (-324.921) (-323.983) (-330.419) [-323.617] -- 0:00:15
      737500 -- (-325.729) [-325.829] (-327.704) (-325.056) * (-328.511) (-324.070) (-325.845) [-328.655] -- 0:00:15
      738000 -- (-326.690) (-325.046) [-324.765] (-324.222) * [-325.583] (-323.983) (-325.978) (-325.940) -- 0:00:15
      738500 -- (-325.452) (-325.289) [-324.254] (-325.380) * [-325.304] (-325.393) (-326.359) (-325.413) -- 0:00:15
      739000 -- (-327.605) (-325.641) (-325.408) [-329.096] * (-325.069) (-324.216) (-325.286) [-326.316] -- 0:00:15
      739500 -- (-325.019) [-328.251] (-326.436) (-327.726) * (-326.379) (-323.526) [-324.974] (-324.882) -- 0:00:15
      740000 -- (-325.018) (-327.687) [-326.342] (-325.586) * (-327.658) (-324.315) (-324.453) [-323.901] -- 0:00:15

      Average standard deviation of split frequencies: 0.006237

      740500 -- (-324.161) [-325.536] (-326.525) (-325.367) * [-327.512] (-324.674) (-324.539) (-326.070) -- 0:00:15
      741000 -- (-329.746) (-330.675) [-325.398] (-325.050) * (-325.519) (-325.849) [-324.896] (-327.734) -- 0:00:15
      741500 -- (-324.501) (-327.633) [-325.512] (-324.553) * [-328.071] (-324.234) (-326.564) (-326.669) -- 0:00:15
      742000 -- (-325.022) (-325.288) (-326.118) [-323.677] * (-323.390) (-325.201) (-324.655) [-329.115] -- 0:00:15
      742500 -- (-327.806) (-326.511) [-326.215] (-326.331) * (-329.513) (-326.852) [-324.863] (-327.570) -- 0:00:15
      743000 -- (-329.882) [-325.961] (-324.380) (-328.382) * (-324.811) (-325.930) [-326.093] (-326.876) -- 0:00:15
      743500 -- (-326.753) (-326.578) (-331.124) [-325.217] * (-324.819) [-327.711] (-328.053) (-327.782) -- 0:00:15
      744000 -- (-325.783) (-327.571) [-324.664] (-326.531) * (-324.210) (-328.376) [-325.745] (-331.679) -- 0:00:15
      744500 -- (-324.400) [-326.525] (-323.992) (-324.239) * (-323.908) (-326.729) (-324.612) [-324.234] -- 0:00:15
      745000 -- [-324.596] (-324.581) (-324.810) (-327.262) * (-324.158) (-327.072) (-328.514) [-326.010] -- 0:00:15

      Average standard deviation of split frequencies: 0.006193

      745500 -- (-324.989) (-325.156) [-327.020] (-328.589) * (-325.582) (-329.354) (-324.891) [-324.480] -- 0:00:15
      746000 -- (-329.449) [-326.428] (-324.736) (-324.401) * (-326.210) (-325.736) (-328.341) [-325.534] -- 0:00:14
      746500 -- [-324.365] (-324.171) (-326.535) (-329.978) * (-328.036) (-327.063) (-326.479) [-326.372] -- 0:00:14
      747000 -- (-325.108) (-327.914) [-324.448] (-328.321) * (-331.010) [-329.996] (-326.338) (-323.495) -- 0:00:14
      747500 -- [-323.377] (-325.864) (-323.723) (-325.747) * (-326.083) [-325.897] (-323.998) (-325.111) -- 0:00:15
      748000 -- (-333.795) [-329.672] (-323.773) (-324.330) * [-325.607] (-326.425) (-325.188) (-323.737) -- 0:00:15
      748500 -- (-326.318) [-327.256] (-326.929) (-325.308) * (-324.545) (-325.026) [-324.798] (-323.633) -- 0:00:15
      749000 -- (-324.985) (-325.024) (-326.701) [-324.541] * [-325.349] (-325.129) (-324.689) (-323.934) -- 0:00:15
      749500 -- (-325.104) (-325.935) [-325.379] (-329.782) * (-325.335) (-323.928) (-324.993) [-326.711] -- 0:00:15
      750000 -- (-325.752) (-329.661) [-325.013] (-326.200) * (-326.407) (-323.625) [-326.069] (-328.061) -- 0:00:15

      Average standard deviation of split frequencies: 0.006154

      750500 -- (-329.978) [-325.940] (-326.538) (-327.107) * (-329.151) (-327.111) (-326.255) [-327.651] -- 0:00:14
      751000 -- (-325.569) (-325.224) [-327.314] (-326.353) * (-327.023) (-325.043) [-325.400] (-325.551) -- 0:00:14
      751500 -- [-326.053] (-326.950) (-325.086) (-326.614) * (-326.264) [-325.279] (-325.990) (-326.371) -- 0:00:14
      752000 -- (-323.901) (-327.704) [-324.893] (-327.675) * [-325.127] (-326.413) (-325.768) (-324.459) -- 0:00:14
      752500 -- [-326.459] (-326.140) (-325.592) (-328.012) * [-325.325] (-327.642) (-325.387) (-324.341) -- 0:00:14
      753000 -- (-324.338) (-326.034) (-324.872) [-327.719] * (-326.022) (-329.716) [-325.032] (-324.680) -- 0:00:14
      753500 -- (-326.496) (-326.032) [-326.696] (-327.781) * (-325.455) (-328.032) [-324.098] (-325.678) -- 0:00:14
      754000 -- [-325.215] (-325.656) (-324.941) (-325.526) * (-330.621) (-325.153) [-323.297] (-326.210) -- 0:00:14
      754500 -- (-326.044) [-326.596] (-325.184) (-326.723) * (-325.088) (-323.957) [-326.558] (-326.528) -- 0:00:14
      755000 -- (-326.475) (-326.754) [-325.009] (-325.471) * (-324.900) [-326.107] (-325.147) (-324.281) -- 0:00:14

      Average standard deviation of split frequencies: 0.006069

      755500 -- (-325.137) (-325.438) [-325.147] (-325.812) * [-324.546] (-325.003) (-324.783) (-323.733) -- 0:00:14
      756000 -- (-325.150) (-327.688) [-327.023] (-326.934) * (-323.796) [-325.697] (-326.640) (-324.053) -- 0:00:14
      756500 -- (-324.090) (-325.247) (-326.162) [-328.121] * (-324.761) (-325.741) [-323.449] (-324.349) -- 0:00:14
      757000 -- [-326.183] (-325.465) (-327.728) (-323.943) * (-324.917) [-325.267] (-323.428) (-324.676) -- 0:00:14
      757500 -- (-325.084) [-326.796] (-325.924) (-325.899) * [-323.771] (-325.106) (-327.049) (-324.486) -- 0:00:14
      758000 -- (-324.118) [-323.573] (-328.728) (-325.123) * (-327.852) (-323.757) [-329.457] (-324.629) -- 0:00:14
      758500 -- (-324.133) [-325.832] (-327.829) (-326.380) * (-333.193) (-326.005) (-324.676) [-326.700] -- 0:00:14
      759000 -- (-324.663) [-328.117] (-326.848) (-326.167) * (-334.504) [-324.897] (-324.274) (-327.970) -- 0:00:14
      759500 -- (-329.126) [-325.809] (-325.088) (-327.430) * (-323.934) (-324.236) (-323.951) [-326.496] -- 0:00:14
      760000 -- [-327.960] (-327.330) (-327.169) (-325.630) * (-329.354) (-325.356) [-325.508] (-326.647) -- 0:00:14

      Average standard deviation of split frequencies: 0.006280

      760500 -- (-325.310) [-327.328] (-324.827) (-324.142) * [-325.673] (-324.332) (-323.921) (-327.467) -- 0:00:14
      761000 -- (-327.643) (-327.095) (-324.393) [-325.287] * (-323.825) (-324.685) (-325.018) [-326.490] -- 0:00:14
      761500 -- (-323.850) (-324.668) [-328.533] (-324.463) * [-325.544] (-324.694) (-326.874) (-327.913) -- 0:00:14
      762000 -- (-325.241) (-323.651) [-324.072] (-326.375) * (-325.627) [-325.485] (-324.123) (-325.794) -- 0:00:14
      762500 -- [-327.702] (-324.806) (-323.983) (-327.713) * (-325.741) (-324.798) [-324.077] (-331.396) -- 0:00:14
      763000 -- (-327.840) (-324.066) [-324.235] (-325.449) * [-324.522] (-328.800) (-324.570) (-326.554) -- 0:00:13
      763500 -- (-328.328) (-323.590) (-325.595) [-326.221] * (-327.664) [-327.042] (-324.328) (-324.316) -- 0:00:14
      764000 -- [-324.340] (-326.764) (-327.934) (-331.769) * (-327.379) [-327.634] (-327.211) (-324.733) -- 0:00:14
      764500 -- (-331.385) [-323.990] (-324.915) (-329.882) * [-325.611] (-327.485) (-326.274) (-329.138) -- 0:00:14
      765000 -- [-324.733] (-323.998) (-325.508) (-325.829) * (-324.495) (-326.774) [-324.294] (-327.546) -- 0:00:14

      Average standard deviation of split frequencies: 0.006359

      765500 -- (-323.652) [-325.325] (-327.027) (-325.208) * (-324.539) (-326.503) [-327.229] (-330.000) -- 0:00:14
      766000 -- (-324.582) (-324.174) (-324.403) [-327.532] * [-325.100] (-325.700) (-325.314) (-327.290) -- 0:00:14
      766500 -- (-325.131) [-325.102] (-324.104) (-324.919) * (-324.676) (-324.329) (-324.314) [-324.171] -- 0:00:14
      767000 -- [-326.999] (-328.976) (-325.709) (-324.550) * [-325.649] (-327.331) (-326.163) (-329.124) -- 0:00:13
      767500 -- [-326.866] (-332.377) (-326.248) (-325.128) * (-324.904) [-325.160] (-324.694) (-326.458) -- 0:00:13
      768000 -- (-324.313) [-324.367] (-324.429) (-324.877) * (-326.051) (-325.414) [-326.680] (-326.975) -- 0:00:13
      768500 -- [-326.698] (-325.389) (-324.025) (-326.273) * (-326.990) (-326.743) [-327.821] (-324.892) -- 0:00:13
      769000 -- (-326.601) (-328.540) (-324.680) [-325.431] * (-328.069) (-330.660) (-326.719) [-324.992] -- 0:00:13
      769500 -- [-328.172] (-326.585) (-324.760) (-326.655) * (-325.438) (-324.751) (-329.031) [-325.820] -- 0:00:13
      770000 -- (-327.601) (-325.595) [-327.872] (-325.455) * (-324.127) [-326.722] (-327.510) (-328.735) -- 0:00:13

      Average standard deviation of split frequencies: 0.006443

      770500 -- (-323.848) (-324.778) (-329.888) [-327.921] * (-328.577) (-326.260) [-328.456] (-326.038) -- 0:00:13
      771000 -- [-324.534] (-325.421) (-325.584) (-326.162) * [-327.141] (-326.229) (-324.817) (-324.974) -- 0:00:13
      771500 -- (-325.914) (-325.742) [-326.533] (-329.879) * (-328.674) (-327.490) [-327.422] (-328.371) -- 0:00:13
      772000 -- (-325.477) (-325.549) (-325.970) [-323.646] * (-326.753) [-327.930] (-325.005) (-324.909) -- 0:00:13
      772500 -- (-325.050) [-325.439] (-326.061) (-323.989) * [-328.424] (-328.160) (-325.139) (-329.878) -- 0:00:13
      773000 -- (-324.550) (-330.975) (-325.313) [-325.777] * (-325.962) (-325.561) [-324.233] (-325.332) -- 0:00:13
      773500 -- (-325.382) [-327.276] (-324.951) (-329.794) * (-328.890) [-324.749] (-328.966) (-324.869) -- 0:00:13
      774000 -- (-330.457) (-324.034) (-324.531) [-325.420] * (-328.696) [-324.190] (-330.390) (-324.466) -- 0:00:13
      774500 -- (-325.959) [-325.807] (-323.720) (-323.878) * (-325.254) (-326.821) (-324.399) [-324.485] -- 0:00:13
      775000 -- (-330.650) [-323.916] (-327.114) (-327.868) * (-325.861) (-328.746) (-326.177) [-324.161] -- 0:00:13

      Average standard deviation of split frequencies: 0.006561

      775500 -- (-334.765) [-326.840] (-324.882) (-326.445) * (-325.805) (-329.738) [-325.609] (-328.077) -- 0:00:13
      776000 -- (-324.164) [-324.417] (-325.626) (-325.412) * [-325.029] (-324.363) (-325.927) (-326.523) -- 0:00:13
      776500 -- (-325.327) (-324.891) [-324.717] (-323.806) * (-324.287) (-326.117) [-325.265] (-324.921) -- 0:00:13
      777000 -- [-325.662] (-325.107) (-326.112) (-327.194) * (-327.008) (-327.719) (-325.035) [-324.373] -- 0:00:13
      777500 -- (-325.687) (-327.215) [-325.760] (-324.996) * [-325.645] (-325.447) (-323.513) (-325.205) -- 0:00:13
      778000 -- [-325.062] (-325.729) (-328.871) (-328.443) * (-324.859) [-328.869] (-326.327) (-324.766) -- 0:00:13
      778500 -- (-323.736) (-323.981) (-327.053) [-326.488] * (-328.070) [-329.177] (-325.462) (-325.173) -- 0:00:13
      779000 -- (-324.812) (-325.510) [-325.742] (-324.908) * (-327.549) (-328.199) [-327.037] (-327.559) -- 0:00:13
      779500 -- (-326.434) [-324.701] (-326.216) (-325.834) * (-326.290) (-323.599) (-327.570) [-328.760] -- 0:00:13
      780000 -- (-324.186) [-323.819] (-327.360) (-325.303) * (-327.578) (-324.656) [-325.639] (-325.047) -- 0:00:12

      Average standard deviation of split frequencies: 0.006320

      780500 -- (-325.575) [-329.099] (-326.858) (-333.759) * (-326.828) (-324.607) [-325.787] (-326.539) -- 0:00:12
      781000 -- (-326.808) (-327.037) (-327.035) [-325.059] * (-325.908) (-327.743) [-324.201] (-327.823) -- 0:00:13
      781500 -- (-327.478) (-324.035) [-325.335] (-324.326) * (-324.044) [-324.410] (-331.395) (-325.570) -- 0:00:13
      782000 -- [-324.883] (-325.381) (-336.952) (-325.835) * (-332.398) (-323.583) [-327.008] (-323.630) -- 0:00:13
      782500 -- (-325.157) (-325.111) [-329.100] (-326.369) * (-325.186) (-327.192) [-324.650] (-323.641) -- 0:00:13
      783000 -- (-325.424) [-326.423] (-328.461) (-327.089) * (-328.383) [-323.523] (-332.517) (-324.479) -- 0:00:13
      783500 -- [-325.886] (-325.100) (-325.923) (-323.979) * (-329.382) [-325.151] (-325.053) (-326.183) -- 0:00:12
      784000 -- (-328.120) [-325.677] (-328.648) (-328.215) * [-328.565] (-328.034) (-326.213) (-326.220) -- 0:00:12
      784500 -- (-327.659) (-326.454) [-326.885] (-325.432) * (-325.776) (-327.457) [-326.469] (-327.559) -- 0:00:12
      785000 -- (-323.693) (-327.560) [-326.831] (-326.263) * [-324.963] (-325.842) (-323.655) (-326.286) -- 0:00:12

      Average standard deviation of split frequencies: 0.006397

      785500 -- (-325.988) (-325.354) (-326.877) [-324.896] * (-323.543) (-329.602) (-324.326) [-331.845] -- 0:00:12
      786000 -- (-324.939) (-326.064) [-326.170] (-327.464) * (-323.944) (-325.221) [-324.255] (-325.271) -- 0:00:12
      786500 -- (-325.501) (-324.723) (-323.976) [-329.221] * (-329.914) (-330.452) [-323.973] (-326.512) -- 0:00:12
      787000 -- (-324.438) (-326.019) (-324.056) [-325.512] * (-326.598) (-327.449) [-323.969] (-327.789) -- 0:00:12
      787500 -- [-324.500] (-325.026) (-324.044) (-325.432) * [-328.369] (-324.748) (-324.652) (-327.187) -- 0:00:12
      788000 -- [-324.116] (-324.465) (-329.421) (-324.753) * (-327.448) (-328.103) (-325.112) [-323.971] -- 0:00:12
      788500 -- [-326.674] (-325.880) (-326.624) (-327.550) * (-324.271) [-327.962] (-328.175) (-324.940) -- 0:00:12
      789000 -- [-324.214] (-324.381) (-327.116) (-325.183) * (-326.441) (-324.877) [-323.637] (-326.061) -- 0:00:12
      789500 -- (-328.983) [-326.477] (-325.388) (-324.634) * (-328.474) (-328.674) [-324.539] (-324.868) -- 0:00:12
      790000 -- [-323.879] (-324.542) (-325.221) (-330.189) * (-326.226) (-326.216) [-324.262] (-326.297) -- 0:00:12

      Average standard deviation of split frequencies: 0.006558

      790500 -- (-324.870) [-324.043] (-325.566) (-324.662) * (-324.312) (-326.992) (-324.588) [-324.683] -- 0:00:12
      791000 -- (-325.739) [-327.682] (-326.759) (-326.331) * (-324.722) [-325.097] (-328.296) (-324.079) -- 0:00:12
      791500 -- (-324.310) [-328.095] (-325.719) (-325.790) * (-325.590) [-325.030] (-324.195) (-324.185) -- 0:00:12
      792000 -- (-326.734) (-324.923) [-326.786] (-328.780) * (-324.724) (-325.785) [-325.949] (-324.899) -- 0:00:12
      792500 -- (-328.854) (-324.236) (-327.568) [-323.228] * (-324.081) [-323.831] (-324.552) (-324.996) -- 0:00:12
      793000 -- [-325.903] (-325.110) (-325.983) (-323.879) * (-325.712) (-324.113) [-323.916] (-324.758) -- 0:00:12
      793500 -- (-324.458) [-326.056] (-325.313) (-325.502) * (-329.848) (-326.846) [-325.525] (-327.888) -- 0:00:12
      794000 -- (-325.957) [-325.020] (-327.128) (-324.162) * (-328.273) [-323.734] (-329.507) (-324.181) -- 0:00:12
      794500 -- (-326.400) (-326.062) (-325.517) [-324.570] * (-325.324) (-324.874) (-328.056) [-324.784] -- 0:00:12
      795000 -- (-325.204) (-326.035) (-325.667) [-324.722] * (-325.038) [-325.143] (-325.514) (-323.788) -- 0:00:12

      Average standard deviation of split frequencies: 0.006277

      795500 -- (-324.452) (-330.312) (-325.579) [-324.394] * [-326.469] (-331.334) (-326.695) (-324.263) -- 0:00:12
      796000 -- (-325.511) [-324.148] (-330.400) (-324.649) * (-325.968) [-328.031] (-328.276) (-324.645) -- 0:00:12
      796500 -- (-327.072) (-325.316) [-324.988] (-325.512) * (-326.029) [-327.482] (-326.537) (-324.339) -- 0:00:12
      797000 -- [-327.519] (-325.794) (-324.140) (-326.407) * (-331.772) (-325.859) (-326.348) [-325.718] -- 0:00:11
      797500 -- (-330.578) (-331.667) [-323.851] (-325.738) * (-329.841) (-331.386) (-327.419) [-325.326] -- 0:00:11
      798000 -- (-328.934) (-329.403) [-325.717] (-325.832) * (-327.708) [-324.339] (-324.976) (-328.392) -- 0:00:12
      798500 -- [-325.993] (-325.130) (-327.550) (-326.283) * (-328.458) (-325.313) (-329.652) [-325.761] -- 0:00:12
      799000 -- (-325.610) [-324.554] (-326.761) (-323.636) * (-323.775) (-323.455) [-326.409] (-327.027) -- 0:00:12
      799500 -- [-327.253] (-327.811) (-324.976) (-323.998) * (-323.924) [-325.193] (-329.887) (-329.271) -- 0:00:12
      800000 -- (-326.389) [-328.487] (-327.342) (-324.912) * (-325.953) (-324.764) [-324.118] (-325.231) -- 0:00:12

      Average standard deviation of split frequencies: 0.006359

      800500 -- (-330.980) (-327.527) [-325.017] (-327.313) * (-327.252) [-324.197] (-325.784) (-325.083) -- 0:00:11
      801000 -- (-325.051) (-325.159) (-324.667) [-324.261] * [-328.174] (-325.774) (-330.115) (-324.438) -- 0:00:11
      801500 -- (-323.676) [-326.156] (-324.562) (-327.522) * (-326.241) (-326.033) [-325.953] (-327.508) -- 0:00:11
      802000 -- (-324.968) (-324.765) (-329.852) [-325.372] * (-324.025) (-324.669) [-324.872] (-324.565) -- 0:00:11
      802500 -- [-325.045] (-327.944) (-325.307) (-323.950) * (-325.515) (-328.584) [-324.469] (-325.942) -- 0:00:11
      803000 -- (-329.687) (-326.006) (-325.930) [-323.581] * (-324.029) (-329.470) [-324.095] (-325.683) -- 0:00:11
      803500 -- (-324.486) (-325.199) [-326.588] (-329.373) * (-324.176) (-328.145) (-328.668) [-328.342] -- 0:00:11
      804000 -- [-326.826] (-326.123) (-324.887) (-326.205) * (-327.801) [-324.677] (-328.297) (-328.350) -- 0:00:11
      804500 -- (-328.608) (-328.414) [-327.137] (-325.043) * (-325.714) [-323.849] (-328.942) (-325.600) -- 0:00:11
      805000 -- (-330.844) (-326.264) (-326.941) [-324.405] * (-324.069) [-324.479] (-326.773) (-323.704) -- 0:00:11

      Average standard deviation of split frequencies: 0.006122

      805500 -- [-324.980] (-325.862) (-324.393) (-323.876) * (-324.792) [-324.513] (-330.953) (-325.285) -- 0:00:11
      806000 -- (-324.392) (-327.981) (-327.663) [-326.792] * (-330.912) (-324.460) [-325.807] (-324.135) -- 0:00:11
      806500 -- (-323.922) [-330.797] (-328.433) (-324.750) * [-327.779] (-326.230) (-326.333) (-326.351) -- 0:00:11
      807000 -- (-326.061) [-326.718] (-325.108) (-326.358) * [-326.305] (-324.414) (-326.064) (-324.444) -- 0:00:11
      807500 -- (-327.886) (-326.816) (-326.188) [-328.202] * [-326.280] (-324.300) (-325.666) (-324.911) -- 0:00:11
      808000 -- [-325.331] (-324.988) (-326.288) (-325.962) * (-324.157) [-324.077] (-328.284) (-324.912) -- 0:00:11
      808500 -- (-325.737) (-326.319) [-328.663] (-324.846) * [-323.863] (-323.776) (-326.790) (-328.262) -- 0:00:11
      809000 -- (-325.063) [-324.439] (-326.069) (-324.637) * (-326.305) (-324.262) (-330.054) [-323.282] -- 0:00:11
      809500 -- (-325.456) (-327.083) [-325.200] (-324.978) * (-326.649) (-324.216) (-327.721) [-327.563] -- 0:00:11
      810000 -- (-325.849) (-328.511) (-323.791) [-323.773] * (-330.010) (-325.114) [-327.792] (-326.469) -- 0:00:11

      Average standard deviation of split frequencies: 0.006203

      810500 -- [-326.638] (-325.849) (-324.222) (-326.293) * (-323.719) (-324.768) (-335.009) [-324.199] -- 0:00:11
      811000 -- (-326.978) [-325.630] (-325.196) (-328.320) * [-323.284] (-323.824) (-327.800) (-323.746) -- 0:00:11
      811500 -- (-325.803) (-324.518) (-326.680) [-327.171] * (-327.914) (-325.492) (-327.338) [-325.191] -- 0:00:11
      812000 -- (-327.950) (-327.797) (-324.956) [-325.160] * (-325.774) (-324.083) (-327.327) [-325.929] -- 0:00:11
      812500 -- (-327.068) (-324.770) (-327.025) [-325.312] * [-324.209] (-324.278) (-324.521) (-323.981) -- 0:00:11
      813000 -- (-326.396) (-327.440) (-329.704) [-326.162] * [-330.869] (-324.430) (-323.888) (-324.540) -- 0:00:11
      813500 -- [-324.265] (-326.016) (-325.976) (-324.042) * [-324.479] (-325.372) (-325.850) (-328.427) -- 0:00:11
      814000 -- (-326.154) (-324.688) (-327.584) [-323.664] * (-324.539) [-324.762] (-326.135) (-328.980) -- 0:00:10
      814500 -- (-326.157) [-324.642] (-328.349) (-324.936) * (-330.857) [-324.533] (-329.708) (-332.199) -- 0:00:10
      815000 -- [-324.396] (-323.523) (-325.513) (-324.554) * (-330.503) (-327.273) [-325.333] (-331.363) -- 0:00:11

      Average standard deviation of split frequencies: 0.006860

      815500 -- (-327.010) (-323.456) [-325.725] (-323.919) * (-326.555) [-324.711] (-332.106) (-327.565) -- 0:00:11
      816000 -- (-325.869) (-327.823) (-324.138) [-323.757] * (-325.612) [-324.856] (-324.530) (-325.612) -- 0:00:11
      816500 -- (-325.146) [-328.216] (-327.784) (-324.606) * (-331.295) [-330.037] (-325.003) (-324.674) -- 0:00:11
      817000 -- (-325.122) (-326.683) (-325.931) [-324.488] * (-324.442) (-331.753) (-325.582) [-324.562] -- 0:00:10
      817500 -- (-327.632) [-324.651] (-326.610) (-324.525) * (-326.844) (-326.658) (-324.848) [-323.500] -- 0:00:10
      818000 -- [-326.794] (-328.362) (-324.140) (-324.303) * (-325.265) (-326.724) (-323.865) [-327.515] -- 0:00:10
      818500 -- (-328.065) (-329.071) (-325.333) [-324.184] * (-325.215) (-326.593) [-326.755] (-324.640) -- 0:00:10
      819000 -- [-324.497] (-326.096) (-326.322) (-325.985) * [-326.303] (-323.929) (-328.262) (-324.692) -- 0:00:10
      819500 -- (-325.255) (-324.203) [-324.688] (-326.534) * (-329.180) [-324.317] (-326.058) (-324.884) -- 0:00:10
      820000 -- (-325.937) [-325.734] (-325.020) (-325.014) * (-328.711) (-325.624) (-326.623) [-325.036] -- 0:00:10

      Average standard devia