--- EXPERIMENT NOTES




 --- EXPERIMENT PROPERTIES

#Thu Jan 23 14:11:59 GMT 2020
codeml.models=0 1 2 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=MUSCLE
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/12res/rpsT/input.fasta
input.names=
mrbayes.params=
codeml.params=



 --- PSRF SUMMARY

      Estimated marginal likelihoods for runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)

(Values are saved to the file /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)

Run   Arithmetic mean   Harmonic mean
--------------------------------------
1       -349.51          -352.77
2       -349.55          -352.72
--------------------------------------
TOTAL     -349.53          -352.75
--------------------------------------


Model parameter summaries over the runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".

95% HPD Interval
--------------------
Parameter         Mean      Variance     Lower       Upper       Median    min ESS*  avg ESS    PSRF+
------------------------------------------------------------------------------------------------------
TL{all}         0.889883    0.087259    0.373885    1.490329    0.857316   1472.68   1486.84    1.000
r(A<->C){all}   0.160454    0.017728    0.000025    0.428458    0.125238    301.96    411.06    1.003
r(A<->G){all}   0.174915    0.022689    0.000107    0.481316    0.132507    175.57    234.19    1.001
r(A<->T){all}   0.162989    0.021149    0.000009    0.460036    0.120701    155.50    216.67    1.000
r(C<->G){all}   0.176492    0.021281    0.000033    0.468418    0.140047    183.85    233.07    1.002
r(C<->T){all}   0.158302    0.019004    0.000123    0.445024    0.121412    145.05    210.62    1.011
r(G<->T){all}   0.166849    0.020755    0.000253    0.470555    0.126143    132.78    188.77    1.002
pi(A){all}      0.264036    0.000754    0.211385    0.318238    0.262907   1191.31   1299.11    1.000
pi(C){all}      0.297586    0.000800    0.240391    0.352497    0.297428   1197.22   1332.29    1.000
pi(G){all}      0.298058    0.000833    0.239678    0.350781    0.297674   1223.21   1286.46    1.001
pi(T){all}      0.140320    0.000463    0.097220    0.180942    0.139491   1171.40   1309.65    1.000
alpha{1,2}      0.411421    0.230906    0.000149    1.361843    0.240460   1010.02   1219.13    1.000
alpha{3}        0.438581    0.241406    0.000394    1.384557    0.278381   1256.94   1323.86    1.000
pinvar{all}     0.993875    0.000051    0.980346    1.000000    0.996201   1194.93   1262.31    1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.


Setting sumt conformat to Simple



 --- CODEML SUMMARY

Model 1: NearlyNeutral	-326.024548
Model 2: PositiveSelection	-326.024539
Model 0: one-ratio	-326.024572
Model 7: beta	-326.02452
Model 8: beta&w>1	-326.02457


Model 0 vs 1	4.799999999249849E-5

Model 2 vs 1	1.799999995455437E-5

Model 8 vs 7	9.999999997489795E-5
>C1
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C2
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C3
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C4
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C5
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C6
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=86 

C1              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C2              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C3              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C4              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C5              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C6              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
                **************************************************

C1              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C2              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C3              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C4              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C5              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C6              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
                ************************************




PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log      	S	[0] 
-genepred_score	S	[0] 	nsd
-run_name      	S	[0] 
-mem_mode      	S	[0] 	mem
-extend        	D	[1] 	1 
-extend_mode   	S	[0] 	very_fast_triplet
-max_n_pair    	D	[0] 	10 
-seq_name_for_quadruplet	S	[0] 	all
-compact       	S	[0] 	default
-clean         	S	[0] 	no
-do_self       	FL	[0] 	0
-do_normalise  	D	[0] 	1000 
-template_file 	S	[0] 
-setenv        	S	[0] 	0
-template_mode 	S	[0] 
-flip          	D	[0] 	0 
-remove_template_file	D	[0] 	0 
-profile_template_file	S	[0] 
-in            	S	[0] 
-seq           	S	[0] 
-aln           	S	[0] 
-method_limits 	S	[0] 
-method        	S	[0] 
-lib           	S	[0] 
-profile       	S	[0] 
-profile1      	S	[0] 
-profile2      	S	[0] 
-pdb           	S	[0] 
-relax_lib     	D	[0] 	1 
-filter_lib    	D	[0] 	0 
-shrink_lib    	D	[0] 	0 
-out_lib       	W_F	[0] 	no
-out_lib_mode  	S	[0] 	primary
-lib_only      	D	[0] 	0 
-outseqweight  	W_F	[0] 	no
-dpa           	FL	[0] 	0
-seq_source    	S	[0] 	ANY
-cosmetic_penalty	D	[0] 	0 
-gapopen       	D	[0] 	0 
-gapext        	D	[0] 	0 
-fgapopen      	D	[0] 	0 
-fgapext       	D	[0] 	0 
-nomatch       	D	[0] 	0 
-newtree       	W_F	[0] 	default
-tree          	W_F	[0] 	NO
-usetree       	R_F	[0] 
-tree_mode     	S	[0] 	nj
-distance_matrix_mode	S	[0] 	ktup
-distance_matrix_sim_mode	S	[0] 	idmat_sim1
-quicktree     	FL	[0] 	0
-outfile       	W_F	[0] 	default
-maximise      	FL	[1] 	1
-output        	S	[1] 	score_ascii	html	score_ascii
-len           	D	[0] 	0 
-infile        	R_F	[1] 	input.prot.fasta.muscle_rs_0_0.fasta.aln
-matrix        	S	[0] 	default
-tg_mode       	D	[0] 	1 
-profile_mode  	S	[0] 	cw_profile_profile
-profile_comparison	S	[0] 	profile
-dp_mode       	S	[0] 	linked_pair_wise
-ktuple        	D	[0] 	1 
-ndiag         	D	[0] 	0 
-diag_threshold	D	[0] 	0 
-diag_mode     	D	[0] 	0 
-sim_matrix    	S	[0] 	vasiliky
-transform     	S	[0] 
-extend_seq    	FL	[0] 	0
-outorder      	S	[0] 	input
-inorder       	S	[0] 	aligned
-seqnos        	S	[0] 	off
-case          	S	[0] 	keep
-cpu           	D	[0] 	0 
-maxnseq       	D	[0] 	1000 
-maxlen        	D	[0] 	-1 
-sample_dp     	D	[0] 	0 
-weight        	S	[0] 	default
-seq_weight    	S	[0] 	no
-align         	FL	[1] 	1
-mocca         	FL	[0] 	0
-domain        	FL	[0] 	0
-start         	D	[0] 	0 
-len           	D	[0] 	0 
-scale         	D	[0] 	0 
-mocca_interactive	FL	[0] 	0
-method_evaluate_mode	S	[0] 	default
-evaluate_mode 	S	[1] 	t_coffee_fast
-get_type      	FL	[0] 	0
-clean_aln     	D	[0] 	0 
-clean_threshold	D	[1] 	1 
-clean_iteration	D	[1] 	1 
-clean_evaluate_mode	S	[0] 	t_coffee_fast
-extend_matrix 	FL	[0] 	0
-prot_min_sim  	D	[40] 	40 
-prot_max_sim  	D	[90] 	90 
-prot_min_cov  	D	[40] 	40 
-pdb_type      	S	[0] 	d
-pdb_min_sim   	D	[35] 	35 
-pdb_max_sim   	D	[100] 	100 
-pdb_min_cov   	D	[50] 	50 
-pdb_blast_server	W_F	[0] 	EBI
-blast         	W_F	[0] 
-blast_server  	W_F	[0] 	EBI
-pdb_db        	W_F	[0] 	pdb
-protein_db    	W_F	[0] 	uniprot
-method_log    	W_F	[0] 	no
-struc_to_use  	S	[0] 
-cache         	W_F	[0] 	use
-align_pdb_param_file	W_F	[0] 	no
-align_pdb_hasch_mode	W_F	[0] 	hasch_ca_trace_bubble
-external_aligner	S	[0] 	NO
-msa_mode      	S	[0] 	tree
-master        	S	[0] 	no
-blast_nseq    	D	[0] 	0 
-lalign_n_top  	D	[0] 	10 
-iterate       	D	[1] 	0 
-trim          	D	[0] 	0 
-split         	D	[0] 	0 
-trimfile      	S	[0] 	default
-split         	D	[0] 	0 
-split_nseq_thres	D	[0] 	0 
-split_score_thres	D	[0] 	0 
-check_pdb_status	D	[0] 	0 
-clean_seq_name	D	[0] 	0 
-seq_to_keep   	S	[0] 
-dpa_master_aln	S	[0] 
-dpa_maxnseq   	D	[0] 	0 
-dpa_min_score1	D	[0] 
-dpa_min_score2	D	[0] 
-dpa_keep_tmpfile	FL	[0] 	0
-dpa_debug     	D	[0] 	0 
-multi_core    	S	[0] 	templates_jobs_relax_msa_evaluate
-n_core        	D	[0] 	0 
-max_n_proc    	D	[0] 	0 
-lib_list      	S	[0] 
-prune_lib_mode	S	[0] 	5
-tip           	S	[0] 	none
-rna_lib       	S	[0] 
-no_warning    	D	[0] 	0 
-run_local_script	D	[0] 	0 
-plugins       	S	[0] 	default
-proxy         	S	[0] 	unset
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
-email         	S	[0] 
-clean_overaln 	D	[0] 	0 
-overaln_param 	S	[0] 
-overaln_mode  	S	[0] 
-overaln_model 	S	[0] 
-overaln_threshold	D	[0] 	0 
-overaln_target	D	[0] 	0 
-overaln_P1    	D	[0] 	0 
-overaln_P2    	D	[0] 	0 
-overaln_P3    	D	[0] 	0 
-overaln_P4    	D	[0] 	0 
-exon_boundaries	S	[0] 
-dump          	S	[0] 	no
-display       	D	[0] 	100 

INPUT FILES
	Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln  Format clustal_aln
	Input File (M) proba_pair 

Identify Master Sequences [no]:

Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES  [PROTEIN]
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length   86 type PROTEIN Struct Unchecked
  Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length   86 type PROTEIN Struct Unchecked

	Multi Core Mode: 96 processors:

	--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	--- Process Method/Library/Aln Mproba_pair
	xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
	xxx Retrieved Mproba_pair

	All Methods Retrieved

MANUAL PENALTIES: gapopen=0 gapext=0

	Library Total Size: [2580]

Library Relaxation: Multi_proc [96]
 
Relaxation Summary: [2580]--->[2580]



UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1


OUTPUT RESULTS
	#### File Type= MSA             Format= score_ascii     Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
	#### File Type= MSA             Format= html            Name= input.prot.fasta.muscle_rs_0_0.fasta.html
	#### File Type= MSA             Format= score_ascii     Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii

# Command Line: t_coffee -infile input.prot.fasta.muscle_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast  [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.440 Mb, Max= 30.598 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/

FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment

C1              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C2              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C3              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C4              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C5              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C6              VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
                **************************************************

C1              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C2              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C3              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C4              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C5              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C6              LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
                ************************************




FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.muscle_rs_0_0.fasta.aln I:93 S:100 BS:94
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES 
BOT	    0    1	 100.00 C1	 C2	 100.00
TOP	    1    0	 100.00 C2	 C1	 100.00
BOT	    0    2	 100.00 C1	 C3	 100.00
TOP	    2    0	 100.00 C3	 C1	 100.00
BOT	    0    3	 100.00 C1	 C4	 100.00
TOP	    3    0	 100.00 C4	 C1	 100.00
BOT	    0    4	 100.00 C1	 C5	 100.00
TOP	    4    0	 100.00 C5	 C1	 100.00
BOT	    0    5	 100.00 C1	 C6	 100.00
TOP	    5    0	 100.00 C6	 C1	 100.00
BOT	    1    2	 100.00 C2	 C3	 100.00
TOP	    2    1	 100.00 C3	 C2	 100.00
BOT	    1    3	 100.00 C2	 C4	 100.00
TOP	    3    1	 100.00 C4	 C2	 100.00
BOT	    1    4	 100.00 C2	 C5	 100.00
TOP	    4    1	 100.00 C5	 C2	 100.00
BOT	    1    5	 100.00 C2	 C6	 100.00
TOP	    5    1	 100.00 C6	 C2	 100.00
BOT	    2    3	 100.00 C3	 C4	 100.00
TOP	    3    2	 100.00 C4	 C3	 100.00
BOT	    2    4	 100.00 C3	 C5	 100.00
TOP	    4    2	 100.00 C5	 C3	 100.00
BOT	    2    5	 100.00 C3	 C6	 100.00
TOP	    5    2	 100.00 C6	 C3	 100.00
BOT	    3    4	 100.00 C4	 C5	 100.00
TOP	    4    3	 100.00 C5	 C4	 100.00
BOT	    3    5	 100.00 C4	 C6	 100.00
TOP	    5    3	 100.00 C6	 C4	 100.00
BOT	    4    5	 100.00 C5	 C6	 100.00
TOP	    5    4	 100.00 C6	 C5	 100.00
AVG	 0	 C1	  *	 100.00
AVG	 1	 C2	  *	 100.00
AVG	 2	 C3	  *	 100.00
AVG	 3	 C4	  *	 100.00
AVG	 4	 C5	  *	 100.00
AVG	 5	 C6	  *	 100.00
TOT	 TOT	  *	 100.00
CLUSTAL W (1.83) multiple sequence alignment

C1              GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C2              GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C3              GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C4              GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C5              GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C6              GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
                **************************************************

C1              CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C2              CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C3              CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C4              CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C5              CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C6              CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
                **************************************************

C1              CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C2              CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C3              CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C4              CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C5              CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C6              CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
                **************************************************

C1              CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C2              CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C3              CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C4              CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C5              CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C6              CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
                **************************************************

C1              CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C2              CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C3              CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C4              CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C5              CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C6              CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
                **************************************************

C1              ACAAACTC
C2              ACAAACTC
C3              ACAAACTC
C4              ACAAACTC
C5              ACAAACTC
C6              ACAAACTC
                ********



>C1
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C2
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C3
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C4
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C5
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C6
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C1
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C2
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C3
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C4
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C5
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C6
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL


                            MrBayes v3.2.2 x64

                      (Bayesian Analysis of Phylogeny)

              Distributed under the GNU General Public License


               Type "help" or "help <command>" for information
                     on the commands that are available.

                   Type "about" for authorship and general
                       information about the program.



   Executing file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
   UNIX line termination
   Longest line length = 63
   Parsing file
   Expecting NEXUS formatted file
   Reading data block
      Allocated taxon set
      Allocated matrix
      Defining new matrix with 6 taxa and 258 characters
      Missing data coded as ?
      Data matrix is interleaved
      Data is Dna
      Gaps coded as -
      Matching characters coded as .
      Taxon 1 -> C1
      Taxon 2 -> C2
      Taxon 3 -> C3
      Taxon 4 -> C4
      Taxon 5 -> C5
      Taxon 6 -> C6
      Successfully read matrix
      Setting default partition (does not divide up characters)
      Setting model defaults
      Seed (for generating default start values) = 1579788647
      Setting output file names to "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
   Exiting data block
   Reading mrbayes block
      Setting autoclose to yes
      Setting nowarnings to yes
      Defining charset called first_pos
      Defining charset called second_pos
      Defining charset called third_pos
      Defining partition called by_codon
      Setting by_codon as the partition, dividing characters into 3 parts.
      Setting model defaults
      Seed (for generating default start values) = 269485462
      Setting Nst to 6 for partition 1
      Setting Nst to 6 for partition 2
      Setting Nst to 6 for partition 3
      Setting Rates to Invgamma for partition 1
      Setting Rates to Invgamma for partition 2
      Setting Rates to Invgamma for partition 3
      Successfully set likelihood model parameters to all
         applicable data partitions 
      Unlinking
      Setting number of generations to 1000000
      Running Markov chain
      MCMC stamp = 0363175584
      Seed = 500993794
      Swapseed = 1579788647
      Model settings:

         Settings for partition 1 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

         Settings for partition 2 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

         Settings for partition 3 --
            Datatype  = DNA
            Nucmodel  = 4by4
            Nst       = 6
                        Substitution rates, expressed as proportions
                        of the rate sum, have a Dirichlet prior
                        (1.00,1.00,1.00,1.00,1.00,1.00)
            Covarion  = No
            # States  = 4
                        State frequencies have a Dirichlet prior
                        (1.00,1.00,1.00,1.00)
            Rates     = Invgamma
                        Gamma shape parameter is exponentially
                        distributed with parameter (2.00).
                        Proportion of invariable sites is uniformly dist-
                        ributed on the interval (0.00,1.00).
                        Gamma distribution is approximated using 4 categories.
                        Likelihood summarized over all rate categories in each generation.

      Active parameters: 

                          Partition(s)
         Parameters       1  2  3
         ------------------------
         Revmat           1  1  1
         Statefreq        2  2  2
         Shape            3  3  4
         Pinvar           5  5  5
         Ratemultiplier   6  6  6
         Topology         7  7  7
         Brlens           8  8  8
         ------------------------

         Parameters can be linked or unlinked across partitions using 'link' and 'unlink'

         1 --  Parameter  = Revmat{all}
               Type       = Rates of reversible rate matrix
               Prior      = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
               Partitions = All

         2 --  Parameter  = Pi{all}
               Type       = Stationary state frequencies
               Prior      = Dirichlet
               Partitions = All

         3 --  Parameter  = Alpha{1,2}
               Type       = Shape of scaled gamma distribution of site rates
               Prior      = Exponential(2.00)
               Partitions = 1 and 2

         4 --  Parameter  = Alpha{3}
               Type       = Shape of scaled gamma distribution of site rates
               Prior      = Exponential(2.00)
               Partition  = 3

         5 --  Parameter  = Pinvar{all}
               Type       = Proportion of invariable sites
               Prior      = Uniform(0.00,1.00)
               Partitions = All

         6 --  Parameter  = Ratemultiplier{all}
               Type       = Partition-specific rate multiplier
               Prior      = Fixed(1.0)
               Partitions = All

         7 --  Parameter  = Tau{all}
               Type       = Topology
               Prior      = All topologies equally probable a priori
               Partitions = All
               Subparam.  = V{all}

         8 --  Parameter  = V{all}
               Type       = Branch lengths
               Prior      = Unconstrained:Exponential(10.0)
               Partitions = All



      The MCMC sampler will use the following moves:
         With prob.  Chain will use move
            1.06 %   Dirichlet(Revmat{all})
            1.06 %   Slider(Revmat{all})
            1.06 %   Dirichlet(Pi{all})
            1.06 %   Slider(Pi{all})
            2.13 %   Multiplier(Alpha{1,2})
            2.13 %   Multiplier(Alpha{3})
            2.13 %   Slider(Pinvar{all})
           10.64 %   ExtSPR(Tau{all},V{all})
           10.64 %   ExtTBR(Tau{all},V{all})
           10.64 %   NNI(Tau{all},V{all})
           10.64 %   ParsSPR(Tau{all},V{all})
           31.91 %   Multiplier(V{all})
           10.64 %   Nodeslider(V{all})
            4.26 %   TLMultiplier(V{all})

      Division 1 has 4 unique site patterns
      Division 2 has 4 unique site patterns
      Division 3 has 4 unique site patterns
      Initializing conditional likelihoods
      Using standard SSE likelihood calculator for division 1 (single-precision)
      Using standard SSE likelihood calculator for division 2 (single-precision)
      Using standard SSE likelihood calculator for division 3 (single-precision)
      Initializing invariable-site conditional likelihoods

      Initial log likelihoods and log prior probs for run 1:
         Chain 1 -- -577.416283 -- -24.965149
         Chain 2 -- -577.416338 -- -24.965149
         Chain 3 -- -577.416371 -- -24.965149
         Chain 4 -- -577.416338 -- -24.965149

      Initial log likelihoods and log prior probs for run 2:
         Chain 1 -- -577.416283 -- -24.965149
         Chain 2 -- -577.416371 -- -24.965149
         Chain 3 -- -577.416338 -- -24.965149
         Chain 4 -- -577.416371 -- -24.965149


      Using a relative burnin of 25.0 % for diagnostics

      Chain results (1000000 generations requested):

          0 -- [-577.416] (-577.416) (-577.416) (-577.416) * [-577.416] (-577.416) (-577.416) (-577.416) 
        500 -- (-366.085) (-361.517) (-361.432) [-366.580] * (-371.240) (-359.265) [-355.008] (-360.371) -- 0:00:00
       1000 -- [-358.649] (-364.187) (-359.416) (-361.670) * [-360.093] (-353.112) (-361.207) (-359.119) -- 0:00:00
       1500 -- (-362.735) (-360.223) (-362.441) [-359.255] * (-356.769) (-363.567) [-354.385] (-362.455) -- 0:00:00
       2000 -- (-363.737) (-354.969) (-360.074) [-359.288] * [-362.918] (-363.565) (-363.251) (-356.033) -- 0:00:00
       2500 -- (-355.840) (-361.502) [-362.851] (-356.994) * (-353.909) (-357.052) (-359.950) [-361.036] -- 0:06:39
       3000 -- (-361.452) (-361.524) (-365.335) [-358.158] * (-363.262) (-357.840) [-358.069] (-360.997) -- 0:05:32
       3500 -- (-358.413) (-357.910) (-358.256) [-364.929] * (-356.202) (-362.136) (-353.802) [-353.850] -- 0:04:44
       4000 -- (-364.295) [-356.661] (-359.380) (-359.469) * (-362.664) [-369.539] (-362.617) (-359.330) -- 0:04:09
       4500 -- (-356.338) [-364.152] (-361.431) (-354.593) * (-356.407) [-357.424] (-361.875) (-368.451) -- 0:03:41
       5000 -- (-364.028) [-355.467] (-359.386) (-358.910) * (-359.164) (-360.677) (-357.043) [-358.332] -- 0:03:19

      Average standard deviation of split frequencies: 0.085710

       5500 -- [-354.520] (-368.935) (-360.990) (-357.040) * (-365.152) (-365.357) (-357.195) [-361.105] -- 0:03:00
       6000 -- [-356.245] (-361.334) (-355.980) (-360.993) * [-357.106] (-369.014) (-356.331) (-356.550) -- 0:02:45
       6500 -- (-368.369) (-360.583) (-354.476) [-358.306] * (-362.558) [-361.588] (-359.857) (-355.155) -- 0:02:32
       7000 -- (-374.189) [-360.593] (-363.887) (-367.670) * (-354.864) (-357.631) [-357.333] (-367.855) -- 0:02:21
       7500 -- [-351.672] (-362.010) (-361.680) (-354.074) * (-362.313) (-366.120) (-361.527) [-361.491] -- 0:02:12
       8000 -- [-350.434] (-350.353) (-352.663) (-358.094) * (-363.026) [-355.946] (-352.267) (-352.862) -- 0:02:04
       8500 -- [-352.930] (-354.831) (-357.485) (-369.156) * (-365.480) (-367.201) [-359.733] (-366.120) -- 0:01:56
       9000 -- (-352.497) (-352.251) [-362.941] (-364.400) * (-360.470) (-359.026) (-358.579) [-367.619] -- 0:01:50
       9500 -- (-353.049) [-349.052] (-360.185) (-356.908) * (-360.683) [-356.844] (-356.240) (-375.808) -- 0:01:44
      10000 -- (-350.559) [-349.076] (-355.152) (-354.040) * (-360.551) (-361.015) (-361.159) [-367.336] -- 0:01:39

      Average standard deviation of split frequencies: 0.086179

      10500 -- [-348.568] (-349.400) (-358.489) (-349.101) * (-353.344) [-357.505] (-365.393) (-368.200) -- 0:01:34
      11000 -- [-353.393] (-350.410) (-360.163) (-351.963) * [-356.567] (-359.765) (-365.032) (-359.477) -- 0:01:29
      11500 -- (-355.292) [-348.867] (-363.291) (-350.951) * [-362.188] (-359.204) (-363.570) (-353.166) -- 0:01:25
      12000 -- (-354.827) [-348.884] (-360.409) (-349.675) * (-367.392) (-361.292) [-356.440] (-350.082) -- 0:01:22
      12500 -- [-351.376] (-349.419) (-361.955) (-350.705) * (-370.893) [-356.974] (-355.192) (-351.063) -- 0:01:19
      13000 -- (-351.130) (-349.368) [-355.021] (-351.734) * (-361.117) (-362.644) [-359.001] (-349.663) -- 0:01:15
      13500 -- (-350.839) (-349.900) [-356.664] (-351.609) * (-357.789) (-357.568) (-363.395) [-349.539] -- 0:01:13
      14000 -- (-349.885) [-349.509] (-361.400) (-351.377) * (-357.863) (-355.620) [-357.093] (-349.811) -- 0:01:10
      14500 -- [-350.387] (-348.854) (-357.321) (-349.977) * [-358.404] (-355.196) (-363.190) (-349.131) -- 0:01:07
      15000 -- [-348.501] (-348.053) (-358.190) (-350.725) * (-353.678) (-354.482) [-354.776] (-349.254) -- 0:01:05

      Average standard deviation of split frequencies: 0.080204

      15500 -- (-348.757) (-348.687) (-356.079) [-350.524] * (-357.042) (-364.161) [-359.041] (-349.150) -- 0:01:03
      16000 -- [-349.980] (-351.635) (-357.808) (-352.137) * (-355.986) (-367.899) [-360.591] (-349.469) -- 0:01:01
      16500 -- (-352.776) (-350.896) (-362.504) [-348.634] * (-364.877) (-356.497) [-355.260] (-349.205) -- 0:00:59
      17000 -- (-350.049) (-351.824) (-354.270) [-351.316] * (-369.009) (-356.537) (-361.411) [-349.059] -- 0:00:57
      17500 -- [-351.566] (-352.454) (-357.907) (-350.631) * (-364.229) (-365.692) [-358.375] (-355.933) -- 0:00:56
      18000 -- [-352.314] (-354.177) (-358.758) (-352.887) * (-367.221) (-357.685) (-361.147) [-351.720] -- 0:00:54
      18500 -- [-350.711] (-354.133) (-362.952) (-348.992) * (-376.485) (-367.101) [-355.366] (-349.212) -- 0:01:46
      19000 -- (-351.766) (-350.987) (-359.463) [-352.201] * (-360.768) (-354.646) [-359.595] (-348.991) -- 0:01:43
      19500 -- (-352.809) [-351.901] (-353.969) (-349.247) * (-370.268) [-353.594] (-362.670) (-349.751) -- 0:01:40
      20000 -- (-351.485) (-351.386) [-357.605] (-349.719) * (-372.656) [-363.510] (-361.869) (-348.276) -- 0:01:38

      Average standard deviation of split frequencies: 0.052463

      20500 -- [-348.382] (-350.765) (-367.468) (-351.116) * (-358.711) (-355.616) [-359.722] (-350.510) -- 0:01:35
      21000 -- [-348.571] (-351.620) (-357.031) (-349.126) * (-350.780) (-361.783) (-362.376) [-350.396] -- 0:01:33
      21500 -- (-348.668) [-350.982] (-361.289) (-349.081) * (-351.169) [-358.198] (-360.742) (-355.035) -- 0:01:31
      22000 -- [-353.168] (-349.167) (-357.358) (-350.575) * (-350.319) (-369.260) [-363.161] (-350.342) -- 0:01:28
      22500 -- (-350.263) [-350.948] (-355.807) (-348.645) * (-350.469) (-363.569) (-366.050) [-350.141] -- 0:01:26
      23000 -- [-355.103] (-348.917) (-363.186) (-348.631) * [-355.773] (-368.343) (-365.366) (-350.603) -- 0:01:24
      23500 -- [-349.235] (-350.536) (-367.136) (-349.753) * (-353.526) [-356.940] (-370.554) (-352.266) -- 0:01:23
      24000 -- (-348.839) [-352.380] (-356.914) (-349.595) * (-349.489) [-350.578] (-361.992) (-353.580) -- 0:01:21
      24500 -- (-350.084) (-349.279) (-360.462) [-351.356] * (-349.867) (-349.026) (-350.824) [-350.208] -- 0:01:19
      25000 -- (-349.236) (-349.732) (-364.287) [-349.697] * (-350.206) (-355.132) (-351.026) [-348.839] -- 0:01:18

      Average standard deviation of split frequencies: 0.048349

      25500 -- (-348.476) (-356.779) (-357.158) [-350.283] * (-350.877) (-359.221) [-349.473] (-349.126) -- 0:01:16
      26000 -- [-349.989] (-352.398) (-359.408) (-348.807) * (-349.357) (-348.645) (-349.479) [-351.382] -- 0:01:14
      26500 -- (-351.967) (-350.207) (-359.238) [-349.272] * (-351.473) (-352.856) (-349.817) [-348.732] -- 0:01:13
      27000 -- (-351.788) (-352.066) [-364.133] (-348.432) * (-351.248) (-349.530) (-349.376) [-350.141] -- 0:01:12
      27500 -- (-350.630) [-348.872] (-366.723) (-352.954) * (-350.064) (-352.046) [-348.993] (-350.321) -- 0:01:10
      28000 -- (-353.120) (-348.207) [-358.042] (-350.763) * (-349.044) [-350.890] (-351.296) (-348.886) -- 0:01:09
      28500 -- [-353.685] (-350.016) (-360.955) (-349.684) * [-350.317] (-352.315) (-349.293) (-350.696) -- 0:01:08
      29000 -- (-350.068) (-352.578) (-364.958) [-350.355] * (-351.044) (-352.644) (-347.998) [-351.504] -- 0:01:06
      29500 -- (-350.822) [-355.285] (-361.393) (-351.966) * (-351.639) (-354.335) [-349.179] (-349.748) -- 0:01:05
      30000 -- (-348.945) [-352.806] (-359.266) (-350.090) * (-353.241) [-352.171] (-351.379) (-350.027) -- 0:01:04

      Average standard deviation of split frequencies: 0.042700

      30500 -- (-348.645) [-351.355] (-360.103) (-349.847) * [-353.483] (-353.748) (-350.925) (-352.034) -- 0:01:03
      31000 -- (-350.010) [-349.453] (-369.387) (-348.365) * [-351.177] (-350.217) (-353.211) (-351.316) -- 0:01:02
      31500 -- (-348.973) (-351.024) (-366.565) [-348.734] * (-350.462) (-351.234) [-351.137] (-351.755) -- 0:01:01
      32000 -- (-348.452) (-351.093) (-360.574) [-348.827] * (-352.338) [-351.391] (-349.354) (-348.891) -- 0:01:00
      32500 -- (-349.030) (-352.664) (-361.821) [-353.311] * (-351.214) (-352.575) [-349.270] (-350.354) -- 0:00:59
      33000 -- (-353.134) [-349.338] (-360.937) (-351.114) * [-352.359] (-351.487) (-349.994) (-350.292) -- 0:00:58
      33500 -- (-350.215) (-350.137) [-355.063] (-350.968) * (-348.867) [-350.507] (-352.156) (-348.785) -- 0:00:57
      34000 -- (-350.420) [-353.258] (-363.021) (-350.689) * [-351.170] (-352.799) (-350.268) (-349.423) -- 0:01:25
      34500 -- (-348.288) [-351.712] (-360.523) (-349.360) * (-350.525) (-350.188) [-351.173] (-351.230) -- 0:01:23
      35000 -- (-349.243) [-350.315] (-361.033) (-349.127) * [-349.244] (-350.804) (-352.105) (-351.175) -- 0:01:22

      Average standard deviation of split frequencies: 0.043135

      35500 -- (-349.386) (-348.993) (-358.499) [-348.431] * (-352.386) (-349.313) [-350.663] (-349.274) -- 0:01:21
      36000 -- (-349.535) (-350.456) [-358.324] (-352.789) * (-349.901) (-348.227) [-348.343] (-350.371) -- 0:01:20
      36500 -- (-350.033) (-352.061) [-362.997] (-353.886) * (-350.475) (-348.376) [-350.886] (-348.915) -- 0:01:19
      37000 -- (-350.693) (-351.980) (-360.409) [-351.020] * (-350.883) (-351.264) (-348.655) [-349.260] -- 0:01:18
      37500 -- (-350.500) (-352.316) [-355.739] (-350.446) * (-350.440) [-350.084] (-350.677) (-349.313) -- 0:01:17
      38000 -- (-351.209) (-350.356) [-361.255] (-351.858) * (-350.033) [-349.789] (-351.617) (-348.609) -- 0:01:15
      38500 -- (-350.372) [-351.374] (-360.492) (-353.065) * (-349.605) (-353.350) [-349.672] (-352.505) -- 0:01:14
      39000 -- [-350.408] (-351.584) (-359.543) (-350.201) * [-348.734] (-350.498) (-349.803) (-357.138) -- 0:01:13
      39500 -- [-351.197] (-354.086) (-359.601) (-351.543) * (-349.010) (-351.414) (-352.149) [-349.256] -- 0:01:12
      40000 -- [-350.095] (-350.869) (-355.372) (-350.063) * (-348.445) (-351.055) (-350.142) [-351.388] -- 0:01:12

      Average standard deviation of split frequencies: 0.043927

      40500 -- (-351.754) (-349.224) (-355.704) [-353.202] * (-349.799) (-357.571) (-349.888) [-349.005] -- 0:01:11
      41000 -- (-350.007) (-350.535) [-362.679] (-350.241) * (-351.530) (-357.486) [-349.810] (-354.141) -- 0:01:10
      41500 -- (-349.550) (-350.209) [-355.445] (-349.453) * (-350.182) (-350.153) [-349.006] (-349.081) -- 0:01:09
      42000 -- [-349.631] (-351.751) (-356.382) (-349.001) * (-352.494) (-349.711) (-350.624) [-348.618] -- 0:01:08
      42500 -- (-354.165) (-351.497) [-365.989] (-352.813) * (-350.410) (-348.225) (-349.996) [-350.192] -- 0:01:07
      43000 -- (-348.411) (-350.315) (-356.438) [-350.387] * [-351.526] (-350.684) (-349.248) (-353.266) -- 0:01:06
      43500 -- (-350.311) (-348.823) (-357.693) [-350.352] * (-357.734) [-348.281] (-348.143) (-354.826) -- 0:01:05
      44000 -- (-354.441) [-349.115] (-353.505) (-350.216) * (-358.167) (-348.822) (-349.052) [-350.986] -- 0:01:05
      44500 -- (-350.515) (-349.117) (-358.058) [-349.242] * (-356.658) [-348.029] (-349.728) (-354.081) -- 0:01:04
      45000 -- (-349.189) [-352.336] (-362.709) (-349.775) * (-352.659) [-353.150] (-348.068) (-352.688) -- 0:01:03

      Average standard deviation of split frequencies: 0.044578

      45500 -- [-350.625] (-349.613) (-360.784) (-350.504) * (-350.838) [-351.955] (-350.555) (-352.370) -- 0:01:02
      46000 -- (-348.898) (-349.591) (-357.718) [-352.271] * (-351.403) (-353.661) [-349.472] (-350.498) -- 0:01:02
      46500 -- [-349.688] (-353.703) (-355.863) (-350.215) * (-352.610) (-349.749) (-352.573) [-349.220] -- 0:01:01
      47000 -- (-348.983) (-352.035) (-358.713) [-350.097] * [-349.276] (-350.264) (-351.524) (-351.758) -- 0:01:00
      47500 -- [-349.113] (-350.237) (-361.150) (-348.736) * [-348.874] (-351.265) (-349.957) (-352.027) -- 0:01:00
      48000 -- [-348.859] (-348.808) (-363.986) (-349.834) * (-350.500) (-348.767) (-352.567) [-354.007] -- 0:00:59
      48500 -- (-349.640) (-349.673) [-359.715] (-351.064) * (-348.720) [-348.253] (-348.859) (-349.704) -- 0:00:58
      49000 -- (-348.594) [-351.129] (-356.461) (-352.014) * (-348.785) (-353.120) (-349.718) [-350.147] -- 0:00:58
      49500 -- (-348.979) (-351.757) [-357.431] (-349.836) * (-349.381) [-348.799] (-349.472) (-351.267) -- 0:00:57
      50000 -- [-350.853] (-351.803) (-366.402) (-350.746) * [-348.793] (-349.009) (-350.574) (-350.349) -- 0:01:16

      Average standard deviation of split frequencies: 0.041868

      50500 -- (-350.619) (-353.204) (-363.321) [-350.735] * (-353.199) [-351.745] (-349.935) (-348.649) -- 0:01:15
      51000 -- (-350.125) [-349.044] (-362.984) (-348.656) * (-349.017) [-349.928] (-350.456) (-349.637) -- 0:01:14
      51500 -- (-353.526) (-348.421) (-363.225) [-349.648] * (-349.322) (-348.923) [-350.287] (-349.266) -- 0:01:13
      52000 -- (-350.718) (-349.807) [-363.627] (-351.654) * (-350.005) [-347.880] (-349.055) (-352.696) -- 0:01:12
      52500 -- [-348.299] (-348.154) (-361.805) (-350.898) * (-350.997) (-350.600) (-348.356) [-348.578] -- 0:01:12
      53000 -- (-351.570) (-350.776) [-359.546] (-350.856) * (-350.308) [-352.258] (-348.527) (-350.332) -- 0:01:11
      53500 -- (-351.647) [-350.283] (-362.660) (-350.990) * [-349.211] (-348.233) (-350.343) (-350.046) -- 0:01:10
      54000 -- (-349.934) [-350.081] (-360.370) (-351.821) * [-349.080] (-354.398) (-351.436) (-351.092) -- 0:01:10
      54500 -- (-352.829) [-351.481] (-359.758) (-351.339) * (-348.353) (-350.998) [-352.937] (-349.637) -- 0:01:09
      55000 -- (-349.374) [-352.218] (-364.457) (-351.060) * (-349.353) (-350.425) (-350.776) [-350.769] -- 0:01:08

      Average standard deviation of split frequencies: 0.040827

      55500 -- (-351.280) (-352.757) [-355.532] (-348.497) * (-349.428) [-351.801] (-354.414) (-348.790) -- 0:01:08
      56000 -- [-348.734] (-348.509) (-357.512) (-350.550) * (-350.252) [-348.527] (-350.286) (-355.767) -- 0:01:07
      56500 -- (-353.272) [-348.601] (-356.369) (-348.317) * (-352.100) [-349.000] (-350.085) (-354.186) -- 0:01:06
      57000 -- (-348.418) [-348.722] (-358.612) (-351.163) * (-348.489) (-351.613) [-349.784] (-348.144) -- 0:01:06
      57500 -- (-350.811) [-350.926] (-360.325) (-349.011) * (-348.595) (-351.455) (-349.486) [-349.644] -- 0:01:05
      58000 -- [-348.701] (-351.198) (-359.225) (-350.822) * [-348.244] (-350.166) (-351.167) (-350.310) -- 0:01:04
      58500 -- [-348.989] (-351.073) (-358.483) (-349.377) * (-349.450) (-350.323) [-348.665] (-351.198) -- 0:01:04
      59000 -- [-350.401] (-349.911) (-360.913) (-350.850) * (-354.737) [-349.010] (-349.431) (-350.434) -- 0:01:03
      59500 -- [-349.990] (-348.673) (-365.126) (-348.494) * (-356.325) (-356.350) (-352.706) [-348.457] -- 0:01:03
      60000 -- (-349.075) (-352.531) [-358.343] (-350.601) * [-349.242] (-350.914) (-351.319) (-348.754) -- 0:01:02

      Average standard deviation of split frequencies: 0.037298

      60500 -- (-348.728) (-352.760) [-353.624] (-353.103) * (-348.145) [-350.081] (-351.076) (-350.483) -- 0:01:02
      61000 -- [-349.643] (-351.400) (-364.646) (-353.386) * (-351.136) (-350.611) [-349.093] (-353.906) -- 0:01:01
      61500 -- (-347.959) (-353.085) [-362.463] (-353.208) * (-349.325) (-349.555) (-350.907) [-353.780] -- 0:01:01
      62000 -- (-352.538) (-353.628) (-362.910) [-350.126] * (-349.586) (-348.774) (-349.851) [-349.024] -- 0:01:00
      62500 -- [-351.221] (-350.631) (-359.196) (-349.548) * (-350.100) (-354.457) [-349.044] (-348.373) -- 0:01:00
      63000 -- (-351.392) [-349.327] (-359.663) (-349.944) * (-350.487) (-350.350) (-352.067) [-348.321] -- 0:00:59
      63500 -- (-350.593) [-349.236] (-364.621) (-350.152) * (-353.012) [-349.129] (-352.060) (-350.061) -- 0:00:58
      64000 -- [-349.780] (-348.302) (-356.539) (-350.113) * (-348.640) (-348.031) [-350.180] (-348.703) -- 0:00:58
      64500 -- [-348.279] (-351.747) (-364.651) (-349.336) * [-348.796] (-349.368) (-351.253) (-349.585) -- 0:00:58
      65000 -- [-350.414] (-355.987) (-361.821) (-348.981) * [-348.582] (-350.091) (-350.984) (-351.720) -- 0:01:11

      Average standard deviation of split frequencies: 0.034012

      65500 -- [-353.794] (-350.276) (-355.370) (-348.691) * [-349.541] (-354.161) (-353.841) (-349.307) -- 0:01:11
      66000 -- (-353.442) [-350.967] (-360.572) (-350.479) * [-350.503] (-351.720) (-350.767) (-351.767) -- 0:01:10
      66500 -- (-350.218) [-351.239] (-357.465) (-350.431) * (-351.048) (-350.535) (-352.592) [-349.218] -- 0:01:10
      67000 -- (-348.455) [-352.612] (-363.362) (-353.760) * [-352.440] (-349.076) (-351.500) (-351.081) -- 0:01:09
      67500 -- (-349.696) [-351.199] (-359.467) (-357.216) * (-349.694) [-352.217] (-349.071) (-349.989) -- 0:01:09
      68000 -- [-350.449] (-348.673) (-365.248) (-351.542) * (-349.141) (-350.961) (-349.450) [-354.684] -- 0:01:08
      68500 -- (-349.475) (-350.379) [-357.378] (-349.428) * (-348.978) (-348.885) (-350.636) [-348.937] -- 0:01:07
      69000 -- (-350.845) (-348.533) [-354.590] (-350.185) * (-351.566) (-352.228) (-350.972) [-349.194] -- 0:01:07
      69500 -- (-348.118) (-349.759) (-363.384) [-347.951] * (-350.234) (-350.360) (-349.319) [-349.552] -- 0:01:06
      70000 -- (-348.730) (-350.848) (-363.670) [-349.664] * (-350.911) (-350.511) (-350.124) [-349.623] -- 0:01:06

      Average standard deviation of split frequencies: 0.034355

      70500 -- [-349.607] (-351.901) (-369.918) (-349.462) * (-349.781) (-349.060) (-351.337) [-349.662] -- 0:01:05
      71000 -- [-351.800] (-348.358) (-361.451) (-353.652) * [-350.218] (-353.027) (-351.434) (-349.982) -- 0:01:05
      71500 -- (-350.222) (-352.822) [-358.373] (-349.651) * [-348.920] (-351.978) (-351.341) (-351.218) -- 0:01:04
      72000 -- [-351.308] (-351.552) (-359.779) (-349.265) * (-349.800) (-350.481) [-349.513] (-348.540) -- 0:01:04
      72500 -- (-349.850) (-349.504) [-363.156] (-349.858) * [-349.318] (-351.268) (-352.108) (-351.140) -- 0:01:03
      73000 -- (-349.222) (-349.246) (-362.423) [-351.093] * (-353.291) (-351.631) [-349.440] (-349.888) -- 0:01:03
      73500 -- (-349.935) [-350.891] (-357.951) (-350.574) * [-350.871] (-348.776) (-348.525) (-352.746) -- 0:01:03
      74000 -- [-349.800] (-349.169) (-365.714) (-350.258) * (-351.345) (-352.794) [-349.619] (-350.426) -- 0:01:02
      74500 -- (-351.871) (-353.383) [-355.644] (-352.506) * [-349.829] (-354.074) (-351.764) (-349.243) -- 0:01:02
      75000 -- [-349.334] (-350.695) (-357.252) (-349.034) * (-351.676) (-353.945) [-350.983] (-350.509) -- 0:01:01

      Average standard deviation of split frequencies: 0.031013

      75500 -- (-354.064) [-348.154] (-360.671) (-347.956) * (-352.112) (-351.301) [-354.772] (-348.498) -- 0:01:01
      76000 -- (-355.122) [-349.984] (-358.768) (-349.274) * (-351.906) [-353.372] (-349.726) (-350.808) -- 0:01:00
      76500 -- (-348.850) [-352.404] (-355.615) (-349.272) * (-353.941) (-350.667) [-349.456] (-350.796) -- 0:01:00
      77000 -- (-350.069) [-351.921] (-357.361) (-356.578) * (-351.648) (-350.919) (-348.465) [-348.683] -- 0:00:59
      77500 -- (-353.582) (-351.790) (-362.139) [-349.488] * (-349.656) (-351.618) (-349.165) [-348.257] -- 0:00:59
      78000 -- (-352.291) [-352.112] (-359.326) (-352.161) * [-350.084] (-351.106) (-352.181) (-348.326) -- 0:00:59
      78500 -- (-350.226) (-350.455) [-357.298] (-350.755) * (-348.875) (-349.931) [-351.383] (-348.936) -- 0:00:58
      79000 -- [-348.988] (-352.408) (-361.216) (-352.328) * [-350.424] (-353.370) (-349.116) (-350.372) -- 0:00:58
      79500 -- (-353.940) (-349.390) [-359.150] (-350.191) * (-349.229) (-352.045) [-348.498] (-349.394) -- 0:00:57
      80000 -- [-353.252] (-348.100) (-359.654) (-351.376) * (-350.452) (-349.466) (-348.985) [-349.918] -- 0:00:57

      Average standard deviation of split frequencies: 0.031167

      80500 -- (-348.981) [-348.862] (-362.581) (-356.546) * (-349.089) (-349.534) [-349.145] (-349.827) -- 0:00:57
      81000 -- (-349.018) [-349.285] (-361.214) (-351.635) * (-348.570) [-352.591] (-350.022) (-348.055) -- 0:00:56
      81500 -- (-349.538) [-352.718] (-360.101) (-349.676) * (-349.789) (-348.102) (-351.647) [-349.785] -- 0:00:56
      82000 -- (-348.602) (-350.947) [-352.960] (-348.786) * [-349.641] (-350.101) (-351.519) (-351.317) -- 0:00:55
      82500 -- (-353.840) (-349.481) (-357.566) [-349.520] * [-351.020] (-349.054) (-351.033) (-349.773) -- 0:01:06
      83000 -- (-349.439) (-351.079) (-356.981) [-351.183] * (-351.253) [-348.351] (-353.219) (-349.988) -- 0:01:06
      83500 -- (-350.040) [-351.265] (-365.569) (-354.811) * (-348.745) (-350.514) (-349.762) [-350.264] -- 0:01:05
      84000 -- (-349.544) (-349.835) (-367.191) [-349.946] * (-349.492) (-351.816) [-349.843] (-352.069) -- 0:01:05
      84500 -- [-350.873] (-350.741) (-366.720) (-348.340) * (-352.386) (-353.742) [-351.987] (-353.615) -- 0:01:05
      85000 -- (-349.338) [-350.411] (-359.175) (-357.141) * [-349.536] (-354.150) (-348.980) (-349.941) -- 0:01:04

      Average standard deviation of split frequencies: 0.031518

      85500 -- (-348.461) (-350.208) (-364.317) [-350.291] * (-353.407) (-349.759) [-348.055] (-348.902) -- 0:01:04
      86000 -- (-351.160) [-350.230] (-358.755) (-351.091) * (-349.470) (-354.535) (-350.259) [-350.596] -- 0:01:03
      86500 -- (-352.408) [-349.951] (-348.191) (-348.461) * (-349.490) (-351.186) (-349.522) [-349.036] -- 0:01:03
      87000 -- (-350.454) (-348.250) [-348.871] (-349.671) * (-352.819) [-348.772] (-350.028) (-349.332) -- 0:01:02
      87500 -- (-351.318) (-349.513) [-349.122] (-351.089) * [-350.640] (-351.675) (-349.009) (-350.236) -- 0:01:02
      88000 -- (-349.360) (-349.579) (-349.593) [-350.542] * (-352.474) (-350.093) [-347.878] (-350.184) -- 0:01:02
      88500 -- (-350.964) [-348.263] (-352.241) (-349.647) * (-359.459) (-354.277) (-351.454) [-350.818] -- 0:01:01
      89000 -- (-349.813) (-349.534) [-350.946] (-349.400) * [-353.254] (-349.359) (-351.118) (-352.589) -- 0:01:01
      89500 -- (-352.023) (-348.458) (-349.349) [-349.756] * (-351.191) [-348.847] (-349.857) (-350.115) -- 0:01:01
      90000 -- (-351.227) [-349.906] (-351.932) (-350.242) * (-350.248) (-352.116) (-349.232) [-349.707] -- 0:01:00

      Average standard deviation of split frequencies: 0.029215

      90500 -- (-350.275) (-348.819) [-351.886] (-353.003) * (-349.510) (-350.562) [-350.887] (-348.585) -- 0:01:00
      91000 -- [-350.520] (-353.155) (-352.617) (-349.807) * [-353.753] (-350.228) (-350.885) (-350.884) -- 0:00:59
      91500 -- [-349.369] (-349.819) (-350.670) (-356.052) * (-348.701) (-348.416) [-348.832] (-350.013) -- 0:00:59
      92000 -- (-355.030) (-349.549) (-349.217) [-348.476] * (-348.196) (-348.440) (-348.996) [-351.890] -- 0:00:59
      92500 -- (-350.404) (-349.081) (-350.136) [-351.575] * (-348.642) (-349.233) [-348.821] (-351.504) -- 0:00:58
      93000 -- (-353.032) (-351.585) (-349.868) [-351.259] * (-349.070) [-349.889] (-350.916) (-350.978) -- 0:00:58
      93500 -- (-350.254) (-351.143) (-349.819) [-352.271] * (-352.589) (-353.360) (-348.827) [-348.903] -- 0:00:58
      94000 -- (-352.110) (-351.501) [-349.593] (-348.517) * (-353.132) (-349.466) [-354.908] (-355.201) -- 0:00:57
      94500 -- (-353.152) (-351.819) (-348.481) [-350.275] * (-349.667) (-350.183) (-350.539) [-349.702] -- 0:00:57
      95000 -- (-350.908) [-351.011] (-349.365) (-351.366) * [-348.802] (-352.239) (-349.030) (-351.851) -- 0:00:57

      Average standard deviation of split frequencies: 0.032900

      95500 -- (-348.343) (-351.951) (-349.338) [-349.662] * (-348.712) (-348.348) (-349.165) [-352.244] -- 0:00:56
      96000 -- (-350.845) (-348.705) (-354.703) [-348.437] * (-356.994) (-350.714) (-349.186) [-349.221] -- 0:00:56
      96500 -- (-350.355) [-349.274] (-355.633) (-349.677) * (-354.300) (-351.658) (-351.186) [-351.151] -- 0:00:56
      97000 -- (-355.844) (-351.230) (-350.482) [-349.722] * (-353.197) [-349.957] (-348.587) (-349.332) -- 0:00:55
      97500 -- (-351.980) (-349.754) (-349.446) [-348.457] * (-351.016) (-348.596) [-351.105] (-352.094) -- 0:00:55
      98000 -- (-349.392) (-358.258) [-349.318] (-348.879) * (-356.278) (-349.981) (-351.441) [-351.542] -- 0:00:55
      98500 -- (-350.745) (-350.852) (-349.180) [-350.663] * [-358.970] (-353.591) (-357.154) (-349.293) -- 0:00:54
      99000 -- (-349.984) [-349.708] (-349.914) (-352.247) * (-358.603) (-354.108) [-354.834] (-352.718) -- 0:00:54
      99500 -- [-351.423] (-349.244) (-348.478) (-352.913) * (-349.816) (-356.803) [-348.783] (-350.557) -- 0:01:03
      100000 -- (-349.127) [-349.952] (-348.941) (-352.357) * (-349.282) (-353.434) (-352.702) [-350.356] -- 0:01:02

      Average standard deviation of split frequencies: 0.030808

      100500 -- (-349.009) [-350.258] (-350.435) (-353.080) * [-349.398] (-353.209) (-350.055) (-350.151) -- 0:01:02
      101000 -- (-348.822) (-350.722) [-349.230] (-350.315) * [-349.312] (-351.708) (-354.527) (-353.137) -- 0:01:02
      101500 -- (-354.418) [-349.171] (-358.017) (-352.751) * (-351.199) (-351.931) (-349.749) [-351.202] -- 0:01:01
      102000 -- (-350.911) (-348.791) (-350.603) [-351.577] * (-348.271) (-349.886) [-350.845] (-349.007) -- 0:01:01
      102500 -- [-350.095] (-350.631) (-349.942) (-352.135) * (-351.980) (-348.821) [-350.797] (-352.876) -- 0:01:01
      103000 -- (-348.489) (-349.418) (-350.036) [-353.226] * [-350.775] (-350.963) (-352.229) (-349.600) -- 0:01:00
      103500 -- (-348.630) [-351.882] (-349.920) (-350.780) * (-350.607) [-350.051] (-351.249) (-348.323) -- 0:01:00
      104000 -- (-352.102) [-350.360] (-351.223) (-350.294) * (-350.496) [-348.754] (-353.223) (-348.542) -- 0:01:00
      104500 -- [-353.023] (-349.144) (-350.800) (-349.255) * [-351.105] (-350.879) (-349.923) (-351.695) -- 0:00:59
      105000 -- (-350.182) [-351.512] (-351.020) (-349.194) * (-348.849) (-351.124) [-350.768] (-357.127) -- 0:00:59

      Average standard deviation of split frequencies: 0.026260

      105500 -- (-349.716) (-355.782) (-351.780) [-348.710] * [-349.523] (-354.276) (-353.715) (-351.679) -- 0:00:59
      106000 -- [-349.699] (-356.035) (-349.758) (-349.793) * (-353.891) [-352.258] (-356.781) (-349.700) -- 0:00:59
      106500 -- [-349.251] (-351.207) (-349.302) (-352.617) * [-348.200] (-351.434) (-353.541) (-351.391) -- 0:00:58
      107000 -- (-348.472) (-353.389) (-350.569) [-350.388] * [-350.272] (-350.399) (-349.931) (-354.179) -- 0:00:58
      107500 -- (-348.439) (-351.339) [-353.415] (-348.556) * (-349.273) (-349.926) [-351.721] (-352.722) -- 0:00:58
      108000 -- (-349.100) [-349.823] (-351.647) (-348.065) * (-353.618) [-349.519] (-349.126) (-351.060) -- 0:00:57
      108500 -- [-350.838] (-350.093) (-348.358) (-348.537) * (-356.128) (-350.144) [-349.686] (-349.606) -- 0:00:57
      109000 -- [-353.720] (-351.338) (-348.236) (-350.340) * [-350.138] (-352.226) (-351.611) (-349.514) -- 0:00:57
      109500 -- (-349.758) [-350.273] (-349.276) (-349.076) * (-355.089) [-348.349] (-350.470) (-350.218) -- 0:00:56
      110000 -- (-352.965) (-351.511) [-348.460] (-350.078) * [-350.977] (-350.659) (-350.277) (-350.264) -- 0:00:56

      Average standard deviation of split frequencies: 0.027992

      110500 -- (-350.944) (-350.138) (-348.384) [-350.179] * (-350.500) (-349.475) [-349.362] (-349.464) -- 0:00:56
      111000 -- (-348.450) (-348.835) [-350.075] (-348.897) * (-352.168) [-348.716] (-349.893) (-348.618) -- 0:00:56
      111500 -- (-350.069) [-348.520] (-348.963) (-351.635) * (-351.496) [-348.745] (-354.901) (-351.034) -- 0:00:55
      112000 -- (-348.287) [-349.179] (-348.778) (-348.174) * (-352.198) [-351.037] (-350.031) (-350.879) -- 0:00:55
      112500 -- [-348.402] (-348.865) (-350.376) (-348.378) * (-350.331) (-352.021) [-349.298] (-351.842) -- 0:00:55
      113000 -- (-348.106) (-349.552) (-349.413) [-350.718] * (-350.865) (-348.933) [-351.323] (-350.223) -- 0:00:54
      113500 -- (-349.626) (-348.573) [-349.514] (-353.726) * (-350.770) (-352.843) (-352.406) [-350.103] -- 0:00:54
      114000 -- (-352.333) (-354.648) [-348.676] (-349.730) * (-349.743) (-351.198) (-350.552) [-349.796] -- 0:00:54
      114500 -- (-354.392) (-355.882) (-349.070) [-349.755] * (-349.044) (-350.060) [-352.778] (-349.430) -- 0:00:54
      115000 -- (-349.575) (-350.885) [-350.969] (-350.589) * (-349.544) (-350.232) [-349.106] (-350.941) -- 0:00:53

      Average standard deviation of split frequencies: 0.028661

      115500 -- [-349.428] (-352.123) (-350.555) (-349.413) * (-352.033) (-352.117) [-349.853] (-351.638) -- 0:00:53
      116000 -- (-349.732) [-350.253] (-351.815) (-350.274) * (-351.247) [-352.938] (-350.532) (-348.868) -- 0:00:53
      116500 -- (-349.104) (-350.375) (-350.443) [-350.145] * (-350.157) (-350.493) (-348.315) [-348.720] -- 0:01:00
      117000 -- (-349.147) (-349.885) [-349.361] (-349.849) * (-353.132) (-348.816) (-349.883) [-349.920] -- 0:01:00
      117500 -- [-348.232] (-348.605) (-352.221) (-350.519) * (-352.752) (-355.342) [-352.358] (-351.618) -- 0:01:00
      118000 -- (-349.123) (-349.561) [-350.577] (-347.896) * [-351.988] (-349.402) (-349.214) (-350.913) -- 0:00:59
      118500 -- (-348.244) (-350.180) (-348.436) [-351.516] * (-350.774) (-349.961) [-351.553] (-349.333) -- 0:00:59
      119000 -- (-349.121) [-348.199] (-350.396) (-352.626) * (-349.137) (-349.153) [-352.509] (-350.604) -- 0:00:59
      119500 -- (-348.910) (-349.114) (-352.263) [-348.337] * [-349.130] (-348.405) (-349.609) (-356.251) -- 0:00:58
      120000 -- (-352.401) (-348.275) (-349.642) [-350.189] * (-348.558) (-349.659) (-349.612) [-351.484] -- 0:00:58

      Average standard deviation of split frequencies: 0.027552

      120500 -- (-350.064) (-350.588) (-351.946) [-351.278] * (-350.093) [-348.402] (-354.213) (-350.864) -- 0:00:58
      121000 -- (-348.391) (-351.725) [-349.885] (-349.708) * (-350.567) (-349.718) [-350.907] (-350.364) -- 0:00:58
      121500 -- (-348.801) [-352.377] (-350.927) (-349.499) * (-350.352) (-351.017) (-353.038) [-348.701] -- 0:00:57
      122000 -- [-348.919] (-354.932) (-349.517) (-352.201) * [-349.863] (-351.120) (-351.896) (-349.364) -- 0:00:57
      122500 -- (-355.427) (-355.356) (-350.239) [-350.088] * (-350.398) (-350.023) (-349.840) [-350.352] -- 0:00:57
      123000 -- (-353.140) (-351.069) (-349.555) [-352.092] * (-351.185) (-348.939) [-349.045] (-349.458) -- 0:00:57
      123500 -- [-350.909] (-349.665) (-350.758) (-349.846) * (-350.397) [-348.568] (-349.509) (-356.107) -- 0:00:56
      124000 -- (-350.423) (-353.466) (-357.241) [-350.905] * (-348.752) (-349.589) [-350.609] (-349.960) -- 0:00:56
      124500 -- (-350.978) (-351.142) (-354.846) [-350.757] * (-349.949) [-348.261] (-350.336) (-350.641) -- 0:00:56
      125000 -- [-352.381] (-352.723) (-348.349) (-350.662) * (-350.563) [-348.205] (-348.367) (-353.373) -- 0:00:56

      Average standard deviation of split frequencies: 0.027174

      125500 -- (-349.176) (-352.396) [-348.632] (-350.036) * (-352.395) (-351.675) (-348.169) [-356.009] -- 0:00:55
      126000 -- (-349.929) [-349.202] (-349.348) (-349.109) * (-351.684) (-349.695) (-350.625) [-349.324] -- 0:00:55
      126500 -- (-349.099) (-352.241) [-349.998] (-353.378) * [-349.637] (-348.835) (-349.586) (-348.978) -- 0:00:55
      127000 -- [-353.118] (-357.207) (-353.759) (-351.778) * [-348.562] (-348.280) (-349.808) (-348.805) -- 0:00:54
      127500 -- (-350.985) (-349.604) [-354.056] (-348.278) * [-348.785] (-349.798) (-351.470) (-350.043) -- 0:00:54
      128000 -- [-350.714] (-348.878) (-351.248) (-349.890) * [-350.433] (-348.174) (-351.971) (-352.914) -- 0:00:54
      128500 -- (-351.657) (-350.500) (-350.280) [-350.411] * (-349.430) (-349.998) [-348.435] (-353.024) -- 0:00:54
      129000 -- [-349.843] (-350.077) (-357.234) (-350.757) * (-348.668) [-353.080] (-348.526) (-351.066) -- 0:00:54
      129500 -- (-353.235) (-352.413) (-356.043) [-349.525] * [-348.395] (-353.996) (-350.612) (-350.034) -- 0:00:53
      130000 -- (-351.595) (-350.603) (-349.382) [-349.410] * [-354.114] (-351.734) (-351.396) (-358.323) -- 0:00:53

      Average standard deviation of split frequencies: 0.025855

      130500 -- (-350.477) (-354.776) (-351.716) [-348.766] * [-349.994] (-355.858) (-350.364) (-350.521) -- 0:00:53
      131000 -- [-348.313] (-349.130) (-347.964) (-351.812) * (-349.120) (-351.523) (-348.319) [-349.357] -- 0:00:53
      131500 -- (-349.485) (-354.851) (-350.746) [-353.202] * [-350.653] (-348.966) (-354.378) (-352.678) -- 0:00:52
      132000 -- [-353.207] (-349.012) (-350.022) (-349.249) * (-352.813) (-348.732) (-357.036) [-349.687] -- 0:00:52
      132500 -- (-351.792) (-352.035) (-352.924) [-349.411] * (-349.993) (-353.502) [-348.501] (-351.685) -- 0:00:52
      133000 -- (-349.565) (-349.991) [-350.329] (-351.320) * (-352.336) (-349.341) [-348.942] (-348.878) -- 0:00:52
      133500 -- (-357.570) [-356.097] (-350.226) (-352.018) * (-350.177) (-347.982) (-348.915) [-350.452] -- 0:00:58
      134000 -- (-351.243) (-352.537) [-348.951] (-350.362) * (-352.718) (-349.599) (-348.221) [-352.888] -- 0:00:58
      134500 -- (-350.561) [-348.293] (-349.552) (-349.358) * (-351.784) (-350.255) (-351.774) [-349.647] -- 0:00:57
      135000 -- (-350.972) [-350.359] (-349.738) (-349.830) * [-351.682] (-349.826) (-353.942) (-349.960) -- 0:00:57

      Average standard deviation of split frequencies: 0.025997

      135500 -- (-350.953) (-348.164) [-349.077] (-350.144) * (-354.312) (-349.552) [-352.407] (-351.171) -- 0:00:57
      136000 -- [-351.115] (-349.025) (-352.155) (-351.045) * (-352.110) (-350.611) [-349.108] (-349.298) -- 0:00:57
      136500 -- (-351.354) [-353.008] (-351.301) (-354.697) * (-351.154) [-350.671] (-349.698) (-349.855) -- 0:00:56
      137000 -- (-350.005) (-353.748) [-351.274] (-348.924) * (-352.117) [-348.477] (-349.173) (-350.140) -- 0:00:56
      137500 -- (-352.150) [-351.532] (-351.018) (-348.407) * (-350.554) (-350.563) (-353.345) [-349.961] -- 0:00:56
      138000 -- (-356.194) (-351.916) (-349.335) [-348.427] * (-353.777) [-348.704] (-351.186) (-351.993) -- 0:00:56
      138500 -- [-349.510] (-351.898) (-348.614) (-349.585) * (-354.356) [-352.354] (-350.299) (-350.216) -- 0:00:55
      139000 -- [-350.056] (-352.013) (-348.325) (-352.035) * (-348.199) (-350.853) [-349.059] (-350.671) -- 0:00:55
      139500 -- (-350.821) (-350.492) [-348.245] (-352.051) * [-348.939] (-349.011) (-353.172) (-350.735) -- 0:00:55
      140000 -- [-349.313] (-354.854) (-349.431) (-354.430) * [-350.871] (-353.626) (-354.636) (-348.508) -- 0:00:55

      Average standard deviation of split frequencies: 0.023831

      140500 -- (-350.064) [-349.124] (-348.159) (-351.030) * (-348.758) (-351.554) [-350.664] (-350.329) -- 0:00:55
      141000 -- (-348.545) (-351.830) [-348.690] (-349.539) * (-349.713) (-350.373) [-350.515] (-354.573) -- 0:00:54
      141500 -- (-349.285) (-349.490) [-349.597] (-349.563) * (-352.000) (-352.168) (-350.493) [-350.639] -- 0:00:54
      142000 -- [-351.474] (-351.269) (-348.715) (-348.563) * (-350.667) [-351.254] (-348.269) (-350.187) -- 0:00:54
      142500 -- (-349.594) (-348.900) (-352.330) [-349.070] * [-352.940] (-348.318) (-348.911) (-352.547) -- 0:00:54
      143000 -- (-349.500) (-350.761) [-349.991] (-352.022) * [-350.256] (-348.532) (-350.734) (-352.683) -- 0:00:53
      143500 -- (-351.824) [-351.073] (-350.395) (-351.352) * (-348.972) (-350.698) (-349.572) [-350.866] -- 0:00:53
      144000 -- [-349.611] (-350.400) (-350.729) (-351.120) * [-350.765] (-350.833) (-351.459) (-350.668) -- 0:00:53
      144500 -- (-351.047) [-352.400] (-352.606) (-352.890) * (-351.217) [-348.812] (-349.490) (-352.974) -- 0:00:53
      145000 -- (-349.746) (-350.024) [-352.693] (-348.627) * (-351.393) (-352.341) (-350.068) [-351.831] -- 0:00:53

      Average standard deviation of split frequencies: 0.023140

      145500 -- (-352.246) (-349.695) [-348.449] (-348.966) * (-349.705) (-349.339) [-350.034] (-350.358) -- 0:00:52
      146000 -- (-350.552) [-349.012] (-348.210) (-349.486) * (-350.393) [-351.365] (-352.632) (-352.621) -- 0:00:52
      146500 -- (-351.708) (-351.976) (-349.792) [-348.702] * (-349.019) (-350.616) (-356.361) [-348.262] -- 0:00:52
      147000 -- (-352.057) [-350.960] (-350.438) (-350.269) * (-351.973) [-348.690] (-355.960) (-348.963) -- 0:00:52
      147500 -- (-351.970) (-349.114) [-350.239] (-349.559) * (-350.287) [-348.892] (-351.226) (-351.243) -- 0:00:52
      148000 -- (-350.328) [-349.522] (-354.416) (-348.470) * [-351.262] (-348.544) (-350.889) (-350.121) -- 0:00:51
      148500 -- (-352.981) (-352.487) (-353.975) [-352.151] * (-351.652) (-352.400) (-349.769) [-348.157] -- 0:00:51
      149000 -- [-349.087] (-348.501) (-355.760) (-353.881) * [-352.520] (-349.870) (-349.555) (-350.177) -- 0:00:51
      149500 -- [-348.621] (-348.797) (-349.182) (-349.924) * (-352.421) (-350.702) [-350.201] (-352.478) -- 0:00:51
      150000 -- [-350.612] (-349.516) (-349.987) (-349.593) * (-348.256) [-348.797] (-350.589) (-355.287) -- 0:00:51

      Average standard deviation of split frequencies: 0.023006

      150500 -- (-352.832) [-350.879] (-348.136) (-351.222) * [-350.886] (-349.434) (-352.074) (-355.741) -- 0:00:50
      151000 -- (-351.603) (-349.265) [-349.562] (-351.897) * (-352.262) [-349.950] (-349.837) (-356.153) -- 0:00:56
      151500 -- (-349.570) (-351.538) (-351.770) [-350.018] * (-352.011) (-350.397) [-348.104] (-350.552) -- 0:00:56
      152000 -- (-350.720) (-349.092) (-348.544) [-349.937] * (-351.982) (-351.095) [-350.203] (-353.404) -- 0:00:55
      152500 -- (-348.760) [-349.845] (-349.460) (-351.465) * (-351.160) (-349.630) [-349.112] (-353.294) -- 0:00:55
      153000 -- [-348.653] (-351.923) (-352.015) (-348.472) * (-350.534) (-349.634) (-349.112) [-350.400] -- 0:00:55
      153500 -- (-350.099) (-353.454) [-351.412] (-350.128) * [-352.344] (-350.365) (-349.011) (-354.019) -- 0:00:55
      154000 -- [-348.396] (-351.485) (-349.898) (-350.395) * [-349.816] (-350.001) (-348.366) (-352.831) -- 0:00:54
      154500 -- (-348.270) [-350.635] (-349.038) (-350.487) * [-348.649] (-351.511) (-350.015) (-350.007) -- 0:00:54
      155000 -- [-350.132] (-352.479) (-348.909) (-350.279) * (-349.843) (-350.654) (-348.631) [-350.657] -- 0:00:54

      Average standard deviation of split frequencies: 0.023335

      155500 -- (-348.568) (-349.007) [-350.167] (-350.593) * [-351.378] (-348.151) (-351.094) (-350.050) -- 0:00:54
      156000 -- (-349.845) (-350.570) (-349.341) [-350.243] * (-351.229) (-351.995) (-352.089) [-353.688] -- 0:00:54
      156500 -- (-348.901) (-349.050) [-350.952] (-350.827) * (-349.811) (-351.541) [-349.596] (-351.951) -- 0:00:53
      157000 -- (-348.326) (-352.302) [-354.167] (-350.458) * (-350.983) (-353.044) (-350.222) [-350.142] -- 0:00:53
      157500 -- [-349.535] (-349.143) (-351.351) (-350.150) * (-350.762) [-350.439] (-348.825) (-349.052) -- 0:00:53
      158000 -- [-352.031] (-355.509) (-348.953) (-350.069) * (-353.250) [-348.374] (-352.988) (-351.434) -- 0:00:53
      158500 -- (-348.901) (-351.577) (-350.637) [-348.949] * (-349.987) (-351.466) [-353.733] (-349.276) -- 0:00:53
      159000 -- (-348.479) (-351.014) [-353.378] (-353.612) * (-348.894) (-352.646) [-351.837] (-349.308) -- 0:00:52
      159500 -- (-352.554) (-349.130) [-349.915] (-350.863) * (-349.595) (-350.722) (-351.085) [-349.586] -- 0:00:52
      160000 -- (-349.610) (-349.128) [-351.294] (-353.243) * (-352.254) [-353.172] (-350.594) (-348.218) -- 0:00:52

      Average standard deviation of split frequencies: 0.024287

      160500 -- [-354.255] (-349.763) (-351.211) (-348.907) * (-354.370) [-350.151] (-351.450) (-348.849) -- 0:00:52
      161000 -- (-349.759) (-350.865) [-350.968] (-349.952) * (-351.224) [-350.513] (-350.118) (-348.359) -- 0:00:52
      161500 -- (-349.945) (-348.259) (-351.485) [-349.027] * [-348.142] (-351.886) (-353.154) (-354.048) -- 0:00:51
      162000 -- (-351.413) (-348.360) (-351.488) [-349.694] * [-349.597] (-350.398) (-350.395) (-351.418) -- 0:00:51
      162500 -- (-353.307) (-348.670) (-357.116) [-349.746] * [-349.562] (-353.033) (-349.067) (-348.939) -- 0:00:51
      163000 -- (-354.895) (-350.457) (-351.030) [-350.613] * (-350.135) [-352.612] (-353.059) (-348.309) -- 0:00:51
      163500 -- (-352.181) (-350.052) [-351.870] (-350.446) * (-352.326) (-351.716) (-350.092) [-354.002] -- 0:00:51
      164000 -- (-352.035) [-351.590] (-350.835) (-350.473) * (-352.878) [-348.287] (-350.033) (-350.831) -- 0:00:50
      164500 -- [-349.950] (-349.650) (-350.804) (-348.702) * (-351.031) [-348.903] (-350.297) (-352.830) -- 0:00:50
      165000 -- (-351.250) [-353.025] (-349.768) (-351.347) * (-349.696) (-349.594) [-350.801] (-350.725) -- 0:00:50

      Average standard deviation of split frequencies: 0.021298

      165500 -- (-352.257) (-352.394) (-352.784) [-350.013] * (-350.148) (-350.667) [-349.672] (-352.224) -- 0:00:50
      166000 -- (-349.237) (-349.423) (-352.973) [-349.676] * (-349.763) (-350.267) [-350.212] (-350.641) -- 0:00:50
      166500 -- (-348.676) (-351.562) [-350.929] (-348.936) * (-353.060) (-353.606) (-350.728) [-350.355] -- 0:00:50
      167000 -- (-350.259) [-351.114] (-350.979) (-349.247) * [-351.607] (-349.568) (-348.752) (-354.658) -- 0:00:49
      167500 -- (-349.773) (-349.880) (-351.185) [-350.670] * (-350.321) (-352.452) (-350.019) [-351.699] -- 0:00:49
      168000 -- [-349.060] (-349.876) (-350.122) (-350.246) * (-349.947) (-351.082) (-348.515) [-349.758] -- 0:00:54
      168500 -- (-351.541) (-350.482) (-348.440) [-351.955] * (-349.529) (-353.107) (-350.300) [-349.846] -- 0:00:54
      169000 -- (-353.752) [-348.660] (-348.681) (-349.609) * [-348.001] (-351.005) (-352.045) (-352.645) -- 0:00:54
      169500 -- [-354.961] (-350.784) (-354.495) (-350.328) * (-350.270) [-349.984] (-349.336) (-349.138) -- 0:00:53
      170000 -- [-348.226] (-355.675) (-353.080) (-354.458) * (-351.695) (-350.274) [-350.225] (-350.646) -- 0:00:53

      Average standard deviation of split frequencies: 0.019916

      170500 -- (-349.370) (-350.061) [-350.434] (-351.198) * (-350.205) (-350.974) (-347.988) [-352.529] -- 0:00:53
      171000 -- (-349.252) [-349.885] (-354.471) (-351.780) * [-349.727] (-352.305) (-352.138) (-355.311) -- 0:00:53
      171500 -- (-350.436) [-350.326] (-352.239) (-352.651) * (-349.163) (-349.128) (-349.721) [-348.769] -- 0:00:53
      172000 -- (-348.659) (-350.737) (-349.436) [-348.388] * (-349.220) (-349.723) [-350.553] (-349.732) -- 0:00:52
      172500 -- [-349.301] (-350.620) (-351.566) (-348.933) * [-353.843] (-348.830) (-349.592) (-350.112) -- 0:00:52
      173000 -- (-353.260) (-350.644) [-350.053] (-349.404) * (-354.271) (-355.319) (-351.504) [-349.188] -- 0:00:52
      173500 -- (-348.913) (-352.860) (-349.668) [-350.034] * [-349.332] (-349.776) (-350.041) (-349.761) -- 0:00:52
      174000 -- (-350.824) (-348.306) [-353.927] (-350.636) * (-348.788) (-347.893) (-350.129) [-348.530] -- 0:00:52
      174500 -- (-348.998) [-350.040] (-350.258) (-352.548) * [-349.109] (-350.936) (-351.863) (-351.281) -- 0:00:52
      175000 -- (-351.847) (-348.535) (-351.345) [-349.557] * (-351.974) (-354.640) (-351.977) [-350.088] -- 0:00:51

      Average standard deviation of split frequencies: 0.020237

      175500 -- [-350.383] (-351.018) (-351.403) (-354.090) * (-351.655) (-349.724) (-350.354) [-350.347] -- 0:00:51
      176000 -- (-351.707) [-351.006] (-348.670) (-350.227) * [-349.912] (-351.618) (-351.812) (-351.348) -- 0:00:51
      176500 -- [-349.904] (-348.787) (-349.117) (-351.874) * (-350.464) [-350.617] (-350.932) (-359.160) -- 0:00:51
      177000 -- (-351.802) (-350.745) (-352.437) [-352.573] * (-353.711) (-348.784) (-351.696) [-351.120] -- 0:00:51
      177500 -- (-348.038) [-350.077] (-351.683) (-352.497) * [-352.415] (-349.851) (-348.661) (-350.673) -- 0:00:50
      178000 -- [-351.349] (-348.876) (-352.242) (-349.723) * [-353.209] (-350.084) (-350.729) (-349.438) -- 0:00:50
      178500 -- (-352.244) [-349.120] (-348.720) (-350.114) * [-350.365] (-349.526) (-349.988) (-349.408) -- 0:00:50
      179000 -- (-352.570) [-350.700] (-350.356) (-349.153) * (-350.729) [-349.771] (-353.474) (-349.512) -- 0:00:50
      179500 -- (-352.717) [-350.856] (-350.436) (-351.459) * [-355.441] (-352.190) (-361.654) (-350.303) -- 0:00:50
      180000 -- (-353.637) (-350.649) (-349.554) [-351.215] * [-350.366] (-351.472) (-350.460) (-349.992) -- 0:00:50

      Average standard deviation of split frequencies: 0.020004

      180500 -- (-350.362) (-353.957) [-349.132] (-350.308) * (-352.789) [-349.523] (-350.352) (-350.941) -- 0:00:49
      181000 -- (-349.078) (-350.042) (-350.909) [-350.751] * (-354.267) [-350.084] (-350.444) (-350.012) -- 0:00:49
      181500 -- (-353.019) (-349.855) [-352.909] (-348.530) * (-350.802) (-348.880) [-350.914] (-352.231) -- 0:00:49
      182000 -- (-350.292) [-349.329] (-349.877) (-350.495) * [-350.832] (-348.479) (-353.895) (-347.902) -- 0:00:49
      182500 -- (-349.541) [-348.826] (-351.174) (-349.718) * [-350.087] (-348.898) (-348.775) (-349.267) -- 0:00:49
      183000 -- (-349.306) (-355.170) (-354.153) [-351.547] * (-351.402) (-350.282) [-348.567] (-348.422) -- 0:00:49
      183500 -- [-350.080] (-352.510) (-352.623) (-350.090) * (-348.016) [-352.500] (-349.228) (-348.464) -- 0:00:48
      184000 -- (-350.127) (-353.521) [-348.431] (-350.848) * (-348.247) [-350.230] (-349.763) (-349.512) -- 0:00:48
      184500 -- [-348.612] (-349.457) (-350.012) (-349.492) * (-350.032) (-352.658) (-350.224) [-350.509] -- 0:00:48
      185000 -- [-351.858] (-350.674) (-348.026) (-349.454) * (-350.487) (-348.557) [-349.935] (-350.491) -- 0:00:52

      Average standard deviation of split frequencies: 0.020529

      185500 -- (-351.861) [-351.515] (-349.135) (-348.462) * (-350.505) (-349.395) [-349.172] (-351.096) -- 0:00:52
      186000 -- [-350.161] (-349.292) (-349.812) (-348.480) * (-354.651) (-349.919) [-350.181] (-349.850) -- 0:00:52
      186500 -- [-353.305] (-353.956) (-349.235) (-348.264) * (-349.303) [-351.418] (-349.466) (-349.895) -- 0:00:52
      187000 -- (-353.582) (-351.817) (-349.613) [-348.640] * (-349.571) (-351.417) [-351.042] (-350.094) -- 0:00:52
      187500 -- (-350.144) (-349.313) (-348.788) [-351.078] * (-349.494) (-349.082) [-348.504] (-350.462) -- 0:00:52
      188000 -- (-349.330) (-350.271) (-351.200) [-350.450] * [-355.264] (-354.171) (-349.698) (-348.859) -- 0:00:51
      188500 -- (-349.295) (-355.965) (-350.245) [-349.249] * (-353.342) [-349.948] (-352.216) (-348.500) -- 0:00:51
      189000 -- [-348.976] (-353.588) (-350.071) (-349.591) * (-349.617) [-349.135] (-350.824) (-349.356) -- 0:00:51
      189500 -- (-349.551) (-357.658) (-349.724) [-348.964] * (-350.287) (-348.214) [-349.512] (-350.489) -- 0:00:51
      190000 -- (-351.467) [-355.285] (-352.284) (-349.136) * (-350.145) [-349.682] (-351.569) (-349.067) -- 0:00:51

      Average standard deviation of split frequencies: 0.020170

      190500 -- (-351.789) (-355.305) [-353.089] (-349.010) * (-351.656) (-349.527) (-350.342) [-350.306] -- 0:00:50
      191000 -- (-349.016) [-351.288] (-350.843) (-348.537) * (-350.066) (-351.197) [-349.889] (-350.296) -- 0:00:50
      191500 -- [-350.202] (-350.455) (-351.237) (-349.527) * (-351.832) (-352.091) [-352.136] (-348.646) -- 0:00:50
      192000 -- (-348.623) (-350.034) [-348.928] (-353.107) * (-352.681) (-353.809) (-351.727) [-348.592] -- 0:00:50
      192500 -- [-350.103] (-350.879) (-351.616) (-350.863) * [-352.798] (-351.172) (-348.596) (-351.086) -- 0:00:50
      193000 -- (-350.590) (-349.488) (-352.219) [-349.159] * (-351.361) (-350.247) (-350.440) [-348.142] -- 0:00:50
      193500 -- (-350.095) [-349.736] (-350.759) (-349.194) * (-351.127) [-350.836] (-350.568) (-347.893) -- 0:00:50
      194000 -- (-349.978) [-349.175] (-350.079) (-348.419) * (-349.027) (-348.737) [-349.926] (-348.947) -- 0:00:49
      194500 -- (-350.551) [-350.163] (-351.582) (-350.800) * (-355.647) [-350.018] (-349.066) (-349.395) -- 0:00:49
      195000 -- (-350.244) (-349.655) (-350.864) [-349.628] * (-350.530) (-352.788) (-351.307) [-350.691] -- 0:00:49

      Average standard deviation of split frequencies: 0.019602

      195500 -- (-350.037) (-349.579) [-350.144] (-348.723) * (-350.950) (-349.504) [-350.142] (-350.308) -- 0:00:49
      196000 -- (-350.929) (-349.874) (-349.452) [-349.548] * (-350.206) [-350.457] (-350.002) (-348.343) -- 0:00:49
      196500 -- (-355.809) [-349.704] (-352.156) (-352.431) * (-350.638) [-349.610] (-349.490) (-350.405) -- 0:00:49
      197000 -- (-348.429) (-352.432) (-357.828) [-349.523] * [-348.417] (-351.129) (-350.803) (-348.388) -- 0:00:48
      197500 -- (-348.837) (-351.933) [-351.223] (-351.077) * (-350.939) (-351.257) [-350.523] (-352.252) -- 0:00:48
      198000 -- [-348.458] (-351.102) (-349.638) (-351.451) * (-348.850) (-355.153) (-349.815) [-351.369] -- 0:00:48
      198500 -- (-350.674) (-350.052) [-349.138] (-348.351) * (-349.103) (-348.885) (-354.726) [-352.384] -- 0:00:48
      199000 -- [-349.604] (-349.630) (-348.280) (-350.760) * (-349.326) [-350.574] (-348.998) (-352.664) -- 0:00:48
      199500 -- (-350.499) (-350.023) (-349.250) [-350.985] * (-350.196) [-350.037] (-348.241) (-351.424) -- 0:00:48
      200000 -- (-353.638) (-351.509) (-350.528) [-349.667] * (-354.824) (-351.704) [-350.623] (-349.417) -- 0:00:48

      Average standard deviation of split frequencies: 0.018175

      200500 -- (-350.117) [-349.411] (-350.276) (-352.333) * [-349.173] (-353.954) (-348.958) (-348.947) -- 0:00:47
      201000 -- [-349.173] (-352.163) (-349.805) (-349.439) * (-350.137) (-352.295) [-350.705] (-349.407) -- 0:00:47
      201500 -- [-348.798] (-351.783) (-349.021) (-353.413) * [-352.456] (-349.069) (-352.015) (-350.786) -- 0:00:47
      202000 -- (-351.550) (-354.039) [-349.721] (-349.368) * (-350.556) [-352.351] (-354.041) (-351.657) -- 0:00:51
      202500 -- (-348.268) (-350.293) (-350.338) [-353.445] * (-350.405) [-353.550] (-348.786) (-349.324) -- 0:00:51
      203000 -- (-350.920) (-351.257) (-350.995) [-350.020] * (-349.615) [-350.993] (-348.749) (-350.014) -- 0:00:51
      203500 -- (-349.876) (-352.185) (-350.249) [-348.234] * (-349.587) [-353.050] (-352.097) (-350.144) -- 0:00:50
      204000 -- (-350.528) [-351.422] (-352.002) (-352.576) * [-350.420] (-350.315) (-350.636) (-349.103) -- 0:00:50
      204500 -- [-349.775] (-353.958) (-350.013) (-350.457) * (-349.582) (-351.022) [-349.690] (-350.479) -- 0:00:50
      205000 -- (-350.128) [-356.733] (-350.308) (-351.616) * (-352.332) (-350.300) [-350.102] (-350.469) -- 0:00:50

      Average standard deviation of split frequencies: 0.017464

      205500 -- (-352.469) [-352.248] (-349.477) (-352.064) * [-350.406] (-351.325) (-350.409) (-352.025) -- 0:00:50
      206000 -- (-353.376) [-350.579] (-354.821) (-349.235) * (-348.581) (-351.488) [-351.246] (-352.497) -- 0:00:50
      206500 -- [-350.678] (-350.916) (-352.544) (-350.058) * (-350.322) (-350.958) [-352.399] (-350.975) -- 0:00:49
      207000 -- (-348.982) [-349.702] (-351.207) (-350.800) * [-351.063] (-350.046) (-348.061) (-355.127) -- 0:00:49
      207500 -- [-349.874] (-349.051) (-349.321) (-348.143) * [-348.890] (-353.119) (-349.846) (-350.191) -- 0:00:49
      208000 -- (-350.129) [-349.564] (-354.444) (-348.431) * (-348.927) [-351.469] (-354.634) (-350.433) -- 0:00:49
      208500 -- (-350.491) (-350.698) (-351.006) [-348.720] * (-349.753) (-352.508) (-353.244) [-350.369] -- 0:00:49
      209000 -- [-349.379] (-349.360) (-351.330) (-349.840) * (-355.212) [-353.487] (-353.443) (-350.778) -- 0:00:49
      209500 -- (-350.545) (-350.186) [-350.244] (-349.890) * (-350.005) [-349.319] (-353.420) (-352.634) -- 0:00:49
      210000 -- (-349.840) (-352.968) [-349.276] (-349.506) * (-348.446) [-348.419] (-352.884) (-349.940) -- 0:00:48

      Average standard deviation of split frequencies: 0.019132

      210500 -- (-352.812) (-352.513) (-348.015) [-349.351] * (-348.962) (-352.872) (-349.439) [-349.083] -- 0:00:48
      211000 -- (-353.372) [-354.738] (-350.666) (-351.342) * [-349.818] (-350.599) (-349.211) (-349.382) -- 0:00:48
      211500 -- (-349.480) (-352.547) [-348.263] (-350.660) * (-352.404) (-350.941) [-350.679] (-349.197) -- 0:00:48
      212000 -- (-353.300) [-350.545] (-349.998) (-348.241) * (-350.829) (-353.034) [-349.386] (-349.275) -- 0:00:48
      212500 -- (-350.520) (-350.716) [-349.280] (-348.956) * (-349.167) [-352.970] (-348.467) (-354.377) -- 0:00:48
      213000 -- [-349.000] (-348.281) (-350.399) (-349.070) * (-349.437) (-350.306) [-349.452] (-354.339) -- 0:00:48
      213500 -- (-348.797) (-355.696) (-348.332) [-352.616] * (-350.444) [-349.205] (-349.346) (-351.060) -- 0:00:47
      214000 -- (-350.797) (-352.554) [-348.634] (-353.319) * (-351.159) [-349.270] (-348.285) (-349.510) -- 0:00:47
      214500 -- (-351.199) (-350.788) [-350.890] (-350.318) * (-351.753) (-350.012) [-348.538] (-348.556) -- 0:00:47
      215000 -- (-351.461) [-351.366] (-349.436) (-349.908) * [-353.815] (-348.787) (-350.935) (-350.849) -- 0:00:47

      Average standard deviation of split frequencies: 0.019314

      215500 -- [-351.897] (-353.573) (-350.103) (-349.402) * [-350.538] (-352.171) (-350.665) (-349.266) -- 0:00:47
      216000 -- (-350.153) [-349.719] (-349.428) (-355.827) * (-350.793) [-350.648] (-350.883) (-353.210) -- 0:00:47
      216500 -- (-352.013) (-354.316) (-351.295) [-348.489] * [-351.816] (-354.370) (-350.468) (-349.805) -- 0:00:47
      217000 -- (-351.188) (-350.622) [-350.479] (-349.112) * (-349.869) [-351.188] (-350.746) (-348.404) -- 0:00:46
      217500 -- (-352.542) (-354.100) (-349.679) [-348.390] * (-352.451) (-348.644) [-352.171] (-350.242) -- 0:00:46
      218000 -- [-350.003] (-351.930) (-352.283) (-351.755) * (-350.515) [-350.264] (-349.592) (-349.550) -- 0:00:46
      218500 -- [-350.418] (-351.140) (-354.706) (-354.072) * (-349.686) (-348.584) [-348.611] (-348.409) -- 0:00:46
      219000 -- [-349.904] (-350.129) (-352.241) (-349.246) * (-349.540) (-351.422) (-347.999) [-351.971] -- 0:00:46
      219500 -- (-353.001) (-351.686) [-352.815] (-347.905) * (-349.168) (-348.934) (-351.526) [-348.431] -- 0:00:49
      220000 -- (-352.116) (-350.259) (-349.477) [-347.905] * (-350.072) (-350.889) (-351.450) [-348.486] -- 0:00:49

      Average standard deviation of split frequencies: 0.020295

      220500 -- (-351.647) [-350.593] (-348.454) (-349.534) * (-349.608) [-350.233] (-349.782) (-348.577) -- 0:00:49
      221000 -- (-349.197) [-351.608] (-353.062) (-350.601) * (-351.801) [-348.273] (-349.033) (-349.772) -- 0:00:49
      221500 -- (-350.421) (-349.849) [-350.323] (-350.999) * [-349.588] (-356.133) (-351.409) (-355.216) -- 0:00:49
      222000 -- (-353.219) [-349.309] (-352.028) (-349.985) * (-348.292) [-351.581] (-351.237) (-349.267) -- 0:00:49
      222500 -- (-350.836) [-348.152] (-353.134) (-354.153) * (-351.062) (-350.725) [-348.550] (-349.706) -- 0:00:48
      223000 -- [-350.811] (-349.315) (-348.359) (-350.823) * [-350.459] (-352.487) (-349.543) (-349.600) -- 0:00:48
      223500 -- (-348.695) [-348.604] (-351.156) (-350.170) * (-349.225) (-352.127) (-350.339) [-349.251] -- 0:00:48
      224000 -- (-351.164) (-350.764) (-349.099) [-349.553] * (-349.913) (-350.332) [-349.447] (-351.104) -- 0:00:48
      224500 -- (-350.158) (-352.222) (-349.129) [-349.855] * (-354.386) (-350.453) [-353.058] (-351.556) -- 0:00:48
      225000 -- (-353.311) (-351.276) [-349.834] (-350.274) * (-348.862) (-351.562) [-352.769] (-351.633) -- 0:00:48

      Average standard deviation of split frequencies: 0.021171

      225500 -- (-348.064) (-350.512) [-350.796] (-349.919) * (-350.054) (-350.649) (-350.755) [-350.165] -- 0:00:48
      226000 -- [-348.530] (-349.477) (-349.426) (-351.775) * (-348.750) (-350.531) [-348.681] (-349.952) -- 0:00:47
      226500 -- [-352.511] (-350.329) (-350.691) (-350.268) * (-351.495) (-349.034) (-348.181) [-354.235] -- 0:00:47
      227000 -- (-348.539) (-347.991) [-350.475] (-350.986) * [-349.261] (-354.973) (-350.910) (-351.652) -- 0:00:47
      227500 -- [-349.290] (-349.124) (-349.022) (-350.559) * (-353.589) (-352.147) [-351.977] (-348.706) -- 0:00:47
      228000 -- (-348.849) (-349.350) (-350.207) [-348.565] * (-352.157) [-352.450] (-352.194) (-348.781) -- 0:00:47
      228500 -- (-349.399) (-351.593) (-350.945) [-348.841] * (-349.197) (-349.059) [-349.388] (-351.349) -- 0:00:47
      229000 -- (-355.166) (-351.351) (-349.457) [-350.040] * (-348.316) [-353.656] (-355.470) (-348.982) -- 0:00:47
      229500 -- (-351.127) (-350.795) (-350.689) [-348.401] * (-352.599) (-351.259) (-351.230) [-348.515] -- 0:00:47
      230000 -- (-353.049) (-350.151) [-351.397] (-350.460) * (-349.109) (-352.680) [-352.104] (-350.710) -- 0:00:46

      Average standard deviation of split frequencies: 0.021405

      230500 -- [-350.481] (-349.651) (-350.620) (-354.505) * [-349.679] (-352.000) (-350.216) (-352.953) -- 0:00:46
      231000 -- (-348.711) (-352.349) (-353.932) [-353.446] * (-351.372) (-348.655) (-351.355) [-352.028] -- 0:00:46
      231500 -- (-353.917) [-350.621] (-349.462) (-350.363) * (-349.086) [-350.062] (-349.232) (-348.846) -- 0:00:46
      232000 -- (-354.204) [-352.873] (-348.290) (-351.886) * (-349.490) (-351.319) [-349.165] (-350.839) -- 0:00:46
      232500 -- (-355.820) [-348.944] (-349.019) (-349.732) * (-350.600) [-349.652] (-353.379) (-351.417) -- 0:00:46
      233000 -- (-349.002) (-352.007) (-348.982) [-349.056] * (-350.444) (-353.107) [-348.163] (-350.123) -- 0:00:46
      233500 -- (-348.096) (-350.739) (-349.826) [-350.730] * (-352.060) (-349.824) [-351.869] (-350.784) -- 0:00:45
      234000 -- [-349.582] (-354.498) (-351.701) (-350.944) * [-350.066] (-352.748) (-349.714) (-349.074) -- 0:00:45
      234500 -- (-350.822) (-352.676) (-348.505) [-350.932] * (-350.926) [-354.053] (-349.485) (-349.187) -- 0:00:45
      235000 -- (-351.027) (-350.973) [-350.696] (-354.495) * (-348.321) (-353.531) [-351.631] (-353.543) -- 0:00:45

      Average standard deviation of split frequencies: 0.018754

      235500 -- (-353.979) [-351.396] (-350.550) (-351.751) * (-349.792) (-351.926) [-351.457] (-353.047) -- 0:00:45
      236000 -- (-351.960) (-355.921) [-349.963] (-349.894) * (-351.863) (-353.928) (-349.419) [-349.634] -- 0:00:45
      236500 -- (-350.963) (-349.649) [-350.692] (-348.221) * (-351.731) (-350.231) [-348.533] (-349.963) -- 0:00:48
      237000 -- (-349.452) (-350.672) (-349.838) [-351.629] * [-348.741] (-351.243) (-349.861) (-350.627) -- 0:00:48
      237500 -- (-351.528) [-351.002] (-353.279) (-352.805) * (-351.448) [-350.022] (-352.106) (-348.448) -- 0:00:48
      238000 -- [-348.747] (-354.049) (-350.372) (-354.946) * (-349.918) (-353.729) (-350.814) [-350.399] -- 0:00:48
      238500 -- (-352.790) [-349.539] (-349.175) (-350.971) * [-350.988] (-351.888) (-349.734) (-350.881) -- 0:00:47
      239000 -- [-349.055] (-354.819) (-351.551) (-351.512) * (-349.946) [-355.895] (-349.423) (-354.408) -- 0:00:47
      239500 -- (-348.846) (-354.138) [-348.634] (-348.565) * (-349.733) (-350.252) [-350.362] (-351.753) -- 0:00:47
      240000 -- (-349.914) (-349.299) (-351.692) [-350.215] * (-352.546) (-349.830) [-349.220] (-351.694) -- 0:00:47

      Average standard deviation of split frequencies: 0.017744

      240500 -- (-350.807) [-350.342] (-350.365) (-349.514) * [-352.088] (-350.292) (-353.652) (-351.543) -- 0:00:47
      241000 -- (-351.722) (-348.929) (-350.020) [-351.086] * (-353.187) (-352.174) [-351.672] (-348.540) -- 0:00:47
      241500 -- (-355.756) [-348.952] (-352.979) (-350.731) * (-348.544) [-347.842] (-349.625) (-349.543) -- 0:00:47
      242000 -- (-354.164) (-352.832) (-353.639) [-350.790] * (-349.146) [-350.148] (-348.680) (-351.554) -- 0:00:46
      242500 -- (-348.548) (-350.397) [-352.141] (-350.883) * (-349.237) [-350.387] (-349.855) (-349.029) -- 0:00:46
      243000 -- (-350.058) (-350.447) (-354.351) [-348.653] * (-351.723) [-350.387] (-352.698) (-351.369) -- 0:00:46
      243500 -- (-349.077) (-352.990) (-352.485) [-349.697] * [-348.302] (-348.665) (-352.835) (-349.097) -- 0:00:46
      244000 -- (-348.874) (-348.948) (-350.202) [-353.246] * (-348.500) [-349.585] (-350.214) (-351.159) -- 0:00:46
      244500 -- (-349.432) [-350.919] (-351.796) (-350.734) * (-349.053) [-352.412] (-350.704) (-350.731) -- 0:00:46
      245000 -- [-354.657] (-348.809) (-352.480) (-348.851) * (-349.545) (-350.252) [-349.459] (-349.428) -- 0:00:46

      Average standard deviation of split frequencies: 0.017034

      245500 -- (-348.848) (-348.445) (-348.575) [-349.485] * (-349.192) (-347.938) (-350.129) [-349.113] -- 0:00:46
      246000 -- (-348.881) (-348.221) [-351.445] (-348.737) * (-348.747) (-354.769) (-351.355) [-349.786] -- 0:00:45
      246500 -- (-347.983) (-349.223) [-350.007] (-353.777) * (-349.141) (-354.765) [-349.864] (-350.274) -- 0:00:45
      247000 -- (-359.023) [-349.191] (-351.354) (-354.171) * [-348.926] (-349.018) (-350.575) (-351.780) -- 0:00:45
      247500 -- (-353.393) (-349.857) (-353.670) [-350.129] * [-349.304] (-350.421) (-348.050) (-351.746) -- 0:00:45
      248000 -- (-350.632) [-350.042] (-349.766) (-353.210) * (-349.925) [-350.174] (-348.354) (-353.291) -- 0:00:45
      248500 -- (-352.052) (-352.930) (-349.398) [-348.200] * (-351.070) [-349.884] (-352.093) (-354.300) -- 0:00:45
      249000 -- (-348.362) (-354.742) (-348.748) [-349.023] * [-350.349] (-349.682) (-348.450) (-355.617) -- 0:00:45
      249500 -- [-350.779] (-352.561) (-348.123) (-348.968) * (-349.121) [-348.705] (-351.008) (-349.346) -- 0:00:45
      250000 -- (-349.996) (-349.559) [-348.454] (-348.428) * (-349.909) (-349.108) (-350.503) [-349.714] -- 0:00:45

      Average standard deviation of split frequencies: 0.017239

      250500 -- (-349.547) [-351.009] (-348.841) (-352.242) * [-349.192] (-351.672) (-348.785) (-349.427) -- 0:00:44
      251000 -- (-349.311) [-349.590] (-349.997) (-350.254) * (-350.540) (-352.023) [-351.660] (-352.119) -- 0:00:44
      251500 -- (-348.663) (-348.377) (-353.205) [-349.699] * [-349.599] (-350.731) (-348.794) (-349.833) -- 0:00:44
      252000 -- [-348.397] (-352.218) (-352.069) (-349.531) * [-349.211] (-351.369) (-353.633) (-352.944) -- 0:00:44
      252500 -- [-348.609] (-348.956) (-351.318) (-355.802) * [-350.367] (-350.103) (-354.552) (-350.047) -- 0:00:44
      253000 -- (-351.141) (-352.784) (-350.252) [-348.894] * [-349.409] (-351.316) (-351.389) (-349.694) -- 0:00:44
      253500 -- [-350.068] (-354.223) (-351.876) (-354.270) * [-349.546] (-351.913) (-352.480) (-349.699) -- 0:00:47
      254000 -- (-351.542) [-353.670] (-349.920) (-350.469) * (-351.549) (-348.723) (-348.494) [-350.138] -- 0:00:46
      254500 -- [-349.507] (-352.955) (-348.534) (-350.997) * [-354.139] (-353.163) (-351.681) (-347.829) -- 0:00:46
      255000 -- (-349.237) (-349.893) [-351.501] (-352.434) * (-351.255) (-350.901) (-352.514) [-350.092] -- 0:00:46

      Average standard deviation of split frequencies: 0.017348

      255500 -- (-348.773) (-349.769) [-351.577] (-352.640) * (-352.366) [-349.281] (-353.353) (-350.586) -- 0:00:46
      256000 -- (-349.139) (-349.278) [-349.236] (-350.506) * (-351.722) [-353.135] (-351.101) (-350.158) -- 0:00:46
      256500 -- [-350.256] (-349.293) (-349.118) (-349.867) * (-350.657) [-351.641] (-350.125) (-351.788) -- 0:00:46
      257000 -- [-352.120] (-351.731) (-352.283) (-349.928) * (-352.405) (-353.643) [-349.035] (-349.946) -- 0:00:46
      257500 -- (-350.025) (-349.696) (-349.333) [-348.515] * (-349.074) (-350.787) (-349.208) [-351.059] -- 0:00:46
      258000 -- (-351.274) (-352.679) [-348.994] (-350.139) * [-350.815] (-349.463) (-351.401) (-350.527) -- 0:00:46
      258500 -- (-352.074) (-352.872) (-349.558) [-349.265] * [-353.593] (-350.141) (-348.943) (-354.356) -- 0:00:45
      259000 -- (-349.060) (-349.366) [-349.635] (-351.117) * [-349.906] (-348.925) (-349.267) (-352.977) -- 0:00:45
      259500 -- [-349.376] (-352.153) (-348.910) (-349.319) * (-351.154) (-348.137) [-351.183] (-350.969) -- 0:00:45
      260000 -- (-350.013) (-353.657) (-349.308) [-348.177] * (-350.180) (-351.444) [-349.284] (-348.366) -- 0:00:45

      Average standard deviation of split frequencies: 0.016879

      260500 -- (-348.828) (-350.576) (-349.362) [-350.741] * (-349.341) (-348.013) (-348.821) [-349.186] -- 0:00:45
      261000 -- [-353.578] (-350.874) (-350.621) (-354.122) * (-350.794) (-349.734) [-350.746] (-349.042) -- 0:00:45
      261500 -- (-350.213) (-351.812) (-350.051) [-348.576] * (-350.296) [-350.681] (-349.308) (-351.384) -- 0:00:45
      262000 -- (-349.905) (-351.082) [-349.335] (-350.032) * (-351.050) (-352.509) (-348.822) [-349.359] -- 0:00:45
      262500 -- [-348.498] (-348.225) (-349.459) (-351.949) * (-350.288) (-351.906) (-349.206) [-353.002] -- 0:00:44
      263000 -- (-349.179) [-349.164] (-351.684) (-354.165) * (-348.689) [-349.191] (-348.724) (-354.003) -- 0:00:44
      263500 -- (-350.017) [-348.740] (-349.939) (-350.682) * [-348.610] (-349.064) (-348.421) (-348.314) -- 0:00:44
      264000 -- (-350.768) [-350.447] (-352.209) (-348.921) * (-351.128) (-348.378) (-350.494) [-349.689] -- 0:00:44
      264500 -- (-351.249) [-352.193] (-349.194) (-353.932) * (-350.743) (-349.797) [-350.994] (-349.504) -- 0:00:44
      265000 -- (-351.788) [-354.808] (-349.810) (-349.606) * (-348.428) (-352.265) (-350.401) [-350.483] -- 0:00:44

      Average standard deviation of split frequencies: 0.016393

      265500 -- (-353.329) [-350.681] (-352.296) (-350.630) * (-350.280) (-352.625) [-352.850] (-350.119) -- 0:00:44
      266000 -- (-358.077) (-350.729) (-352.645) [-350.761] * (-350.667) [-349.863] (-350.776) (-353.932) -- 0:00:44
      266500 -- [-348.381] (-350.003) (-350.248) (-349.110) * (-352.564) (-351.185) (-349.189) [-351.500] -- 0:00:44
      267000 -- (-350.474) [-349.072] (-350.398) (-350.590) * (-348.409) (-354.702) [-350.994] (-348.808) -- 0:00:43
      267500 -- (-349.099) (-350.671) (-351.392) [-353.220] * [-349.433] (-351.852) (-358.046) (-350.530) -- 0:00:43
      268000 -- (-350.469) (-351.325) (-353.902) [-350.113] * (-350.953) [-348.212] (-352.706) (-353.942) -- 0:00:43
      268500 -- (-349.923) (-349.186) (-350.674) [-350.221] * (-355.935) [-349.488] (-352.431) (-354.716) -- 0:00:43
      269000 -- [-349.582] (-351.989) (-352.230) (-348.997) * (-349.714) [-349.312] (-355.673) (-350.460) -- 0:00:43
      269500 -- (-348.672) (-350.580) [-350.135] (-348.749) * (-351.720) (-350.082) (-350.095) [-350.011] -- 0:00:43
      270000 -- (-349.346) (-351.607) (-348.847) [-351.905] * (-347.892) (-353.416) (-349.563) [-350.877] -- 0:00:43

      Average standard deviation of split frequencies: 0.016159

      270500 -- (-350.083) (-349.310) (-349.228) [-350.169] * (-351.029) (-350.672) [-349.965] (-352.664) -- 0:00:45
      271000 -- [-351.631] (-350.168) (-349.534) (-350.305) * (-352.477) (-350.811) [-350.928] (-352.448) -- 0:00:45
      271500 -- (-353.052) [-349.433] (-349.399) (-351.321) * [-352.782] (-348.349) (-354.739) (-353.899) -- 0:00:45
      272000 -- [-350.665] (-351.353) (-348.411) (-349.298) * (-350.497) [-349.519] (-354.722) (-352.855) -- 0:00:45
      272500 -- (-351.267) (-350.325) (-357.146) [-350.035] * [-350.196] (-349.555) (-356.060) (-350.533) -- 0:00:45
      273000 -- (-350.858) [-351.293] (-353.138) (-353.030) * (-348.440) (-350.748) [-351.713] (-352.288) -- 0:00:45
      273500 -- (-351.281) [-350.031] (-354.721) (-353.892) * (-348.832) (-350.984) [-353.059] (-353.357) -- 0:00:45
      274000 -- (-353.458) (-350.197) (-350.490) [-354.328] * (-351.974) [-348.745] (-349.626) (-350.381) -- 0:00:45
      274500 -- (-352.440) (-349.077) [-352.247] (-355.828) * [-348.384] (-353.512) (-351.157) (-352.539) -- 0:00:44
      275000 -- (-350.153) [-348.621] (-350.112) (-350.063) * (-348.674) (-348.227) (-353.545) [-351.127] -- 0:00:44

      Average standard deviation of split frequencies: 0.016176

      275500 -- (-351.454) [-348.175] (-349.833) (-349.439) * (-350.259) [-355.896] (-350.270) (-354.712) -- 0:00:44
      276000 -- (-350.986) [-352.490] (-351.881) (-349.274) * (-348.768) (-348.563) [-350.618] (-350.663) -- 0:00:44
      276500 -- [-348.631] (-356.083) (-351.125) (-350.187) * (-351.254) (-348.816) [-348.568] (-348.962) -- 0:00:44
      277000 -- [-348.535] (-349.811) (-350.963) (-349.047) * (-348.908) (-349.972) (-349.839) [-348.941] -- 0:00:44
      277500 -- [-348.426] (-354.452) (-353.093) (-350.605) * (-350.801) [-350.407] (-349.603) (-348.803) -- 0:00:44
      278000 -- [-351.078] (-348.581) (-350.720) (-352.269) * [-350.736] (-352.343) (-351.898) (-349.261) -- 0:00:44
      278500 -- (-352.306) (-347.977) [-348.214] (-350.803) * (-349.069) (-350.805) (-350.594) [-350.456] -- 0:00:44
      279000 -- (-352.631) (-350.493) (-350.074) [-348.701] * (-349.343) [-350.586] (-354.967) (-350.174) -- 0:00:43
      279500 -- (-357.748) [-351.547] (-352.148) (-349.097) * (-348.940) [-352.003] (-352.127) (-348.365) -- 0:00:43
      280000 -- (-354.763) (-351.008) [-348.308] (-353.284) * (-350.286) (-351.356) [-349.979] (-352.559) -- 0:00:43

      Average standard deviation of split frequencies: 0.015676

      280500 -- (-349.664) (-349.311) (-352.342) [-352.196] * [-354.928] (-353.852) (-353.306) (-351.004) -- 0:00:43
      281000 -- [-350.931] (-348.950) (-351.402) (-349.381) * (-355.393) (-353.162) (-353.208) [-350.175] -- 0:00:43
      281500 -- (-351.332) (-354.231) (-350.564) [-348.759] * [-350.849] (-348.654) (-349.927) (-350.128) -- 0:00:43
      282000 -- (-351.359) (-350.012) (-353.999) [-348.391] * (-350.119) [-350.546] (-351.265) (-350.620) -- 0:00:43
      282500 -- [-349.179] (-350.309) (-350.723) (-353.191) * (-354.565) (-349.730) (-349.596) [-349.935] -- 0:00:43
      283000 -- (-350.372) (-348.606) [-348.918] (-351.061) * (-349.716) [-349.798] (-350.750) (-350.084) -- 0:00:43
      283500 -- (-348.809) (-349.195) [-348.695] (-348.542) * (-350.776) [-349.431] (-348.116) (-350.078) -- 0:00:42
      284000 -- (-349.610) (-349.930) (-352.447) [-348.754] * (-352.382) (-351.365) (-351.038) [-349.215] -- 0:00:42
      284500 -- (-351.407) (-354.304) (-354.369) [-350.576] * [-350.430] (-350.292) (-350.858) (-349.152) -- 0:00:42
      285000 -- [-352.043] (-352.198) (-351.524) (-352.542) * (-349.301) (-352.186) [-349.561] (-350.228) -- 0:00:42

      Average standard deviation of split frequencies: 0.014917

      285500 -- (-351.564) [-351.398] (-356.607) (-352.554) * (-350.420) (-351.055) [-349.138] (-350.169) -- 0:00:42
      286000 -- (-350.006) (-352.284) (-352.096) [-351.528] * (-350.060) (-348.940) [-351.954] (-354.165) -- 0:00:42
      286500 -- [-349.365] (-351.656) (-348.347) (-350.198) * (-349.587) (-348.734) (-352.869) [-350.724] -- 0:00:42
      287000 -- (-348.778) (-351.619) (-350.669) [-350.410] * (-349.652) (-352.841) (-348.871) [-350.690] -- 0:00:42
      287500 -- (-349.361) [-350.665] (-349.662) (-351.444) * (-349.794) [-351.593] (-352.725) (-349.939) -- 0:00:44
      288000 -- (-348.541) [-350.313] (-350.626) (-356.026) * (-351.873) (-351.726) (-350.660) [-353.220] -- 0:00:44
      288500 -- [-351.974] (-349.787) (-350.331) (-349.943) * (-351.243) (-350.268) [-354.583] (-350.638) -- 0:00:44
      289000 -- (-354.943) [-349.360] (-350.086) (-352.494) * (-352.060) (-351.193) [-351.075] (-352.535) -- 0:00:44
      289500 -- (-351.262) (-352.143) (-351.024) [-349.707] * [-350.438] (-349.269) (-351.265) (-351.148) -- 0:00:44
      290000 -- (-350.914) [-349.911] (-349.722) (-348.710) * (-350.182) (-353.410) [-350.218] (-349.199) -- 0:00:44

      Average standard deviation of split frequencies: 0.016137

      290500 -- (-350.411) (-349.655) (-348.584) [-350.198] * (-349.850) [-349.119] (-349.619) (-353.240) -- 0:00:43
      291000 -- (-350.553) [-349.036] (-350.295) (-350.482) * (-348.968) (-351.634) (-354.140) [-350.374] -- 0:00:43
      291500 -- (-348.298) [-348.116] (-349.425) (-352.265) * [-349.972] (-353.581) (-349.955) (-353.147) -- 0:00:43
      292000 -- (-350.352) (-348.638) [-351.302] (-349.769) * (-351.441) [-356.915] (-348.888) (-348.517) -- 0:00:43
      292500 -- [-351.089] (-349.446) (-355.842) (-349.053) * (-349.067) (-351.724) (-350.103) [-350.108] -- 0:00:43
      293000 -- [-350.790] (-349.095) (-351.992) (-352.318) * [-350.718] (-349.887) (-351.645) (-352.489) -- 0:00:43
      293500 -- [-348.860] (-351.570) (-353.954) (-348.673) * (-350.815) [-351.776] (-348.530) (-350.319) -- 0:00:43
      294000 -- (-349.335) (-348.527) [-352.272] (-349.127) * (-349.551) (-348.664) (-351.272) [-351.265] -- 0:00:43
      294500 -- (-350.337) (-348.999) [-348.455] (-348.509) * (-350.789) (-349.223) [-349.273] (-349.684) -- 0:00:43
      295000 -- (-350.447) (-348.826) [-352.358] (-348.946) * (-350.340) (-349.105) [-348.494] (-347.967) -- 0:00:43

      Average standard deviation of split frequencies: 0.014895

      295500 -- (-349.310) [-348.775] (-353.935) (-350.428) * (-351.810) (-348.867) (-350.091) [-349.666] -- 0:00:42
      296000 -- (-351.885) (-352.460) [-353.940] (-350.059) * [-350.695] (-349.692) (-350.645) (-350.801) -- 0:00:42
      296500 -- [-349.628] (-349.069) (-352.041) (-351.104) * [-350.860] (-351.660) (-348.973) (-351.579) -- 0:00:42
      297000 -- [-350.177] (-349.321) (-352.205) (-349.886) * (-348.971) (-350.170) [-350.113] (-350.423) -- 0:00:42
      297500 -- (-350.174) (-350.002) (-350.914) [-350.692] * (-348.673) (-350.681) (-356.070) [-350.669] -- 0:00:42
      298000 -- (-352.979) [-348.251] (-351.152) (-351.184) * [-347.971] (-350.706) (-353.221) (-353.123) -- 0:00:42
      298500 -- (-349.798) (-351.208) (-350.835) [-351.023] * (-349.431) (-349.109) [-350.855] (-350.068) -- 0:00:42
      299000 -- (-349.618) [-351.509] (-352.279) (-348.790) * [-348.364] (-353.584) (-348.384) (-349.821) -- 0:00:42
      299500 -- [-348.816] (-351.124) (-350.777) (-351.240) * (-349.073) (-351.485) [-351.527] (-350.458) -- 0:00:42
      300000 -- (-349.982) (-349.443) (-349.902) [-351.058] * (-354.683) [-349.488] (-349.867) (-353.061) -- 0:00:42

      Average standard deviation of split frequencies: 0.013834

      300500 -- (-351.970) (-353.654) [-349.580] (-349.803) * (-351.458) (-350.133) [-350.500] (-348.642) -- 0:00:41
      301000 -- (-349.056) (-352.338) (-348.747) [-349.544] * (-353.185) (-352.994) [-349.862] (-348.599) -- 0:00:41
      301500 -- (-349.359) (-350.518) (-351.794) [-350.712] * (-349.914) (-351.765) (-349.825) [-348.091] -- 0:00:41
      302000 -- (-349.752) (-349.660) [-351.714] (-351.810) * (-350.407) (-349.183) (-349.578) [-349.517] -- 0:00:41
      302500 -- (-352.527) (-349.727) [-348.677] (-350.355) * (-349.485) [-349.242] (-354.983) (-350.114) -- 0:00:41
      303000 -- (-349.845) [-350.324] (-350.684) (-349.019) * [-350.290] (-351.549) (-350.885) (-350.852) -- 0:00:41
      303500 -- (-353.052) (-350.523) [-349.471] (-349.628) * (-353.980) (-350.336) (-351.176) [-357.223] -- 0:00:41
      304000 -- (-348.893) [-350.076] (-349.659) (-350.356) * [-353.046] (-349.073) (-350.732) (-352.572) -- 0:00:41
      304500 -- (-349.809) (-351.465) (-351.479) [-351.228] * (-350.894) (-349.497) (-350.207) [-352.557] -- 0:00:43
      305000 -- [-349.727] (-350.150) (-351.442) (-351.126) * [-355.558] (-351.182) (-350.250) (-351.637) -- 0:00:43

      Average standard deviation of split frequencies: 0.014137

      305500 -- (-351.055) [-350.583] (-350.999) (-349.791) * [-352.298] (-354.823) (-350.515) (-352.010) -- 0:00:43
      306000 -- (-348.934) (-350.436) [-348.745] (-350.711) * (-353.666) (-352.568) [-348.244] (-352.581) -- 0:00:43
      306500 -- (-351.189) (-350.604) [-349.988] (-351.610) * (-354.457) [-350.531] (-347.921) (-348.869) -- 0:00:42
      307000 -- (-348.720) [-350.084] (-349.024) (-350.280) * (-355.477) [-350.878] (-348.611) (-351.681) -- 0:00:42
      307500 -- (-352.142) (-350.852) [-350.222] (-350.795) * [-352.870] (-350.124) (-350.223) (-363.283) -- 0:00:42
      308000 -- [-351.146] (-348.610) (-349.146) (-350.599) * (-349.423) (-349.078) (-348.740) [-348.644] -- 0:00:42
      308500 -- (-350.808) (-349.710) [-353.908] (-350.460) * (-350.216) (-351.146) [-348.787] (-349.843) -- 0:00:42
      309000 -- (-351.868) (-348.197) (-349.277) [-350.160] * (-351.731) (-350.262) [-352.195] (-354.516) -- 0:00:42
      309500 -- (-349.504) [-349.139] (-348.896) (-352.218) * [-350.358] (-349.356) (-351.191) (-348.760) -- 0:00:42
      310000 -- (-352.643) [-350.105] (-349.314) (-351.845) * (-348.351) (-350.145) [-350.264] (-351.554) -- 0:00:42

      Average standard deviation of split frequencies: 0.013835

      310500 -- (-351.950) [-348.669] (-349.060) (-351.870) * (-348.422) (-349.202) [-351.336] (-353.717) -- 0:00:42
      311000 -- (-351.587) (-348.513) (-351.310) [-349.815] * [-349.462] (-349.942) (-355.967) (-350.144) -- 0:00:42
      311500 -- (-348.182) [-351.537] (-351.342) (-350.352) * (-349.360) (-348.925) [-348.936] (-351.027) -- 0:00:41
      312000 -- (-349.592) (-353.888) (-349.506) [-350.452] * [-349.688] (-348.877) (-353.820) (-351.055) -- 0:00:41
      312500 -- (-348.629) (-352.782) [-348.657] (-349.084) * [-349.250] (-351.669) (-350.236) (-357.989) -- 0:00:41
      313000 -- (-351.649) (-355.181) (-351.732) [-348.783] * (-350.674) (-353.111) [-351.245] (-354.814) -- 0:00:41
      313500 -- [-352.732] (-352.229) (-353.970) (-349.901) * [-349.684] (-351.927) (-350.327) (-352.987) -- 0:00:41
      314000 -- (-358.128) (-354.730) (-348.349) [-350.236] * [-351.698] (-350.995) (-350.125) (-347.934) -- 0:00:41
      314500 -- (-350.432) (-351.606) [-348.809] (-349.329) * (-354.546) [-351.567] (-349.887) (-349.920) -- 0:00:41
      315000 -- [-349.921] (-353.970) (-348.205) (-348.748) * (-351.781) (-351.014) [-350.452] (-353.803) -- 0:00:41

      Average standard deviation of split frequencies: 0.012724

      315500 -- (-350.895) (-355.117) [-349.419] (-350.758) * (-351.649) [-349.272] (-352.233) (-355.601) -- 0:00:41
      316000 -- (-350.998) (-351.131) [-351.278] (-353.362) * (-348.364) (-351.043) [-348.851] (-349.329) -- 0:00:41
      316500 -- [-349.454] (-348.798) (-348.630) (-354.063) * (-349.449) (-349.037) (-348.703) [-350.816] -- 0:00:41
      317000 -- [-350.604] (-351.074) (-349.231) (-351.696) * (-350.201) (-353.501) (-348.473) [-350.974] -- 0:00:40
      317500 -- (-354.489) [-351.032] (-350.057) (-351.694) * (-351.216) [-351.330] (-349.574) (-354.490) -- 0:00:40
      318000 -- (-352.189) (-352.231) [-349.494] (-348.731) * [-349.937] (-353.645) (-349.404) (-349.902) -- 0:00:40
      318500 -- (-348.678) [-350.271] (-348.449) (-349.042) * (-348.750) (-349.828) [-350.219] (-352.699) -- 0:00:40
      319000 -- (-350.573) (-348.364) (-348.264) [-348.812] * (-348.724) (-348.014) (-350.822) [-354.322] -- 0:00:40
      319500 -- (-351.487) (-349.621) [-350.344] (-352.072) * (-352.441) [-351.148] (-351.365) (-349.376) -- 0:00:40
      320000 -- (-352.043) [-350.519] (-354.094) (-350.998) * (-354.781) (-351.691) (-350.562) [-350.048] -- 0:00:40

      Average standard deviation of split frequencies: 0.013144

      320500 -- (-349.949) [-349.258] (-349.943) (-351.694) * [-350.959] (-352.808) (-351.496) (-350.428) -- 0:00:40
      321000 -- (-350.980) [-348.608] (-354.384) (-349.878) * (-349.696) [-351.338] (-350.083) (-351.402) -- 0:00:40
      321500 -- (-349.488) (-351.403) [-351.352] (-349.300) * (-349.881) (-350.588) (-354.099) [-351.374] -- 0:00:40
      322000 -- (-354.163) (-349.000) [-353.786] (-349.073) * (-351.320) (-348.901) (-352.031) [-349.846] -- 0:00:42
      322500 -- (-355.568) [-349.366] (-349.641) (-353.147) * [-349.558] (-349.609) (-350.047) (-349.375) -- 0:00:42
      323000 -- [-354.850] (-350.236) (-354.563) (-351.391) * [-354.483] (-351.108) (-352.238) (-350.730) -- 0:00:41
      323500 -- (-351.385) (-349.159) (-351.164) [-348.992] * (-354.304) [-351.524] (-351.258) (-348.498) -- 0:00:41
      324000 -- (-351.767) (-350.127) [-348.577] (-353.305) * [-347.983] (-349.913) (-351.075) (-348.705) -- 0:00:41
      324500 -- (-350.148) [-350.312] (-348.399) (-349.165) * (-350.380) (-350.489) [-353.705] (-350.182) -- 0:00:41
      325000 -- [-349.839] (-353.038) (-348.937) (-352.650) * (-355.780) (-349.921) (-349.650) [-350.781] -- 0:00:41

      Average standard deviation of split frequencies: 0.012249

      325500 -- (-351.766) (-352.155) (-352.145) [-351.854] * [-352.724] (-350.926) (-349.097) (-349.618) -- 0:00:41
      326000 -- [-348.308] (-354.473) (-349.473) (-353.396) * [-349.918] (-348.782) (-349.298) (-351.730) -- 0:00:41
      326500 -- (-351.707) (-350.841) [-350.832] (-351.884) * (-350.789) (-351.836) [-351.668] (-348.782) -- 0:00:41
      327000 -- [-349.918] (-350.065) (-350.538) (-351.287) * [-350.004] (-352.417) (-350.581) (-349.916) -- 0:00:41
      327500 -- (-351.519) [-353.406] (-349.754) (-350.960) * (-349.849) (-349.426) [-349.372] (-350.415) -- 0:00:41
      328000 -- [-348.790] (-352.073) (-353.499) (-349.801) * (-349.512) (-351.119) [-350.934] (-350.696) -- 0:00:40
      328500 -- (-350.317) [-348.677] (-350.886) (-350.358) * (-350.264) [-352.004] (-349.972) (-349.746) -- 0:00:40
      329000 -- (-352.337) (-352.304) (-351.403) [-350.371] * (-351.391) (-351.331) (-348.894) [-349.098] -- 0:00:40
      329500 -- (-351.567) (-350.876) [-351.520] (-349.709) * (-354.613) (-352.224) [-352.754] (-356.835) -- 0:00:40
      330000 -- (-349.981) (-348.888) (-351.908) [-349.961] * (-355.898) [-350.242] (-351.378) (-354.077) -- 0:00:40

      Average standard deviation of split frequencies: 0.012579

      330500 -- [-349.493] (-351.646) (-351.549) (-352.431) * (-349.341) (-354.194) (-348.677) [-349.607] -- 0:00:40
      331000 -- (-349.658) (-351.233) (-351.740) [-349.714] * (-349.117) (-349.873) (-348.330) [-354.494] -- 0:00:40
      331500 -- (-354.097) [-352.238] (-350.569) (-351.082) * [-349.489] (-352.668) (-348.406) (-350.580) -- 0:00:40
      332000 -- (-354.818) (-349.119) [-348.002] (-349.791) * (-349.475) (-349.750) (-355.065) [-349.463] -- 0:00:40
      332500 -- [-351.759] (-349.349) (-349.087) (-349.707) * (-352.789) (-349.037) [-347.995] (-350.210) -- 0:00:40
      333000 -- (-347.963) (-352.206) [-350.388] (-352.417) * (-349.500) (-350.278) [-348.666] (-351.492) -- 0:00:40
      333500 -- [-348.088] (-353.126) (-350.480) (-351.324) * (-351.615) (-348.882) (-349.801) [-351.300] -- 0:00:39
      334000 -- (-348.865) [-350.801] (-352.397) (-349.847) * (-348.037) [-348.542] (-352.052) (-352.694) -- 0:00:39
      334500 -- [-349.597] (-349.344) (-349.566) (-348.365) * (-348.821) (-350.946) (-348.419) [-351.063] -- 0:00:39
      335000 -- (-351.908) (-349.566) (-349.829) [-352.900] * (-354.402) [-351.741] (-349.634) (-350.096) -- 0:00:39

      Average standard deviation of split frequencies: 0.012462

      335500 -- (-350.478) (-351.275) [-349.522] (-350.956) * [-350.167] (-352.893) (-351.300) (-349.599) -- 0:00:39
      336000 -- (-356.121) [-348.394] (-349.979) (-352.004) * (-350.934) (-354.377) (-350.856) [-352.267] -- 0:00:39
      336500 -- (-353.129) [-348.431] (-348.739) (-348.970) * (-350.359) (-351.311) [-348.682] (-349.933) -- 0:00:39
      337000 -- (-350.758) [-349.679] (-350.628) (-349.612) * (-350.235) [-348.871] (-350.948) (-350.248) -- 0:00:39
      337500 -- (-353.254) (-353.791) (-353.186) [-349.830] * [-348.832] (-348.659) (-351.956) (-350.398) -- 0:00:39
      338000 -- (-349.604) (-349.654) [-350.969] (-350.092) * (-351.258) (-349.717) (-352.093) [-349.891] -- 0:00:39
      338500 -- (-352.270) [-348.518] (-350.372) (-350.782) * (-350.792) [-352.100] (-357.243) (-351.954) -- 0:00:39
      339000 -- (-350.228) (-349.346) (-351.515) [-349.120] * (-349.639) (-350.057) (-353.818) [-350.290] -- 0:00:40
      339500 -- [-350.637] (-353.938) (-348.909) (-350.442) * (-351.588) (-350.887) [-351.891] (-351.238) -- 0:00:40
      340000 -- (-349.505) [-348.941] (-350.690) (-355.214) * (-349.871) (-350.601) [-349.040] (-351.751) -- 0:00:40

      Average standard deviation of split frequencies: 0.012454

      340500 -- (-349.570) [-349.374] (-354.633) (-352.691) * (-349.154) [-348.109] (-350.236) (-350.690) -- 0:00:40
      341000 -- (-348.586) [-348.980] (-354.949) (-350.023) * [-348.725] (-349.187) (-350.316) (-351.431) -- 0:00:40
      341500 -- (-354.561) (-354.587) [-351.794] (-347.986) * (-351.790) (-350.274) [-351.265] (-354.838) -- 0:00:40
      342000 -- [-348.471] (-353.501) (-352.626) (-352.946) * [-349.597] (-354.140) (-354.195) (-350.849) -- 0:00:40
      342500 -- (-354.750) (-350.465) [-352.276] (-349.492) * [-348.266] (-348.008) (-354.300) (-349.992) -- 0:00:40
      343000 -- (-349.530) [-348.546] (-348.940) (-349.361) * (-353.622) (-357.688) (-348.453) [-350.005] -- 0:00:40
      343500 -- (-348.411) [-353.493] (-351.353) (-348.457) * (-348.863) [-350.414] (-349.956) (-348.266) -- 0:00:40
      344000 -- (-348.923) [-352.607] (-349.201) (-349.220) * (-349.341) (-351.558) [-351.184] (-350.586) -- 0:00:40
      344500 -- (-351.947) (-351.394) [-349.901] (-352.614) * (-348.725) (-350.220) [-352.758] (-349.537) -- 0:00:39
      345000 -- (-350.806) (-349.371) (-348.908) [-349.832] * (-351.549) (-350.296) (-349.423) [-351.308] -- 0:00:39

      Average standard deviation of split frequencies: 0.012262

      345500 -- (-348.082) (-352.492) [-348.186] (-353.246) * (-351.646) (-349.519) [-350.498] (-350.940) -- 0:00:39
      346000 -- (-350.346) (-350.464) [-348.733] (-356.774) * (-349.554) (-351.361) (-350.247) [-351.541] -- 0:00:39
      346500 -- (-351.442) (-349.880) [-350.983] (-353.434) * [-348.507] (-348.644) (-350.775) (-349.872) -- 0:00:39
      347000 -- [-350.760] (-350.118) (-352.332) (-350.512) * (-355.409) [-348.400] (-355.109) (-350.495) -- 0:00:39
      347500 -- (-352.397) [-351.036] (-348.967) (-348.843) * [-354.873] (-356.493) (-353.121) (-350.604) -- 0:00:39
      348000 -- (-350.763) (-350.274) [-351.374] (-348.934) * (-352.066) [-349.282] (-348.365) (-348.968) -- 0:00:39
      348500 -- (-348.943) [-348.862] (-351.670) (-349.221) * (-348.910) (-351.042) (-353.205) [-354.722] -- 0:00:39
      349000 -- (-349.973) (-349.689) [-348.178] (-349.564) * (-353.660) [-351.957] (-349.125) (-356.716) -- 0:00:39
      349500 -- (-349.390) (-349.546) [-352.425] (-352.709) * [-350.028] (-350.894) (-355.496) (-351.083) -- 0:00:39
      350000 -- [-347.900] (-351.194) (-350.105) (-349.524) * [-349.330] (-351.024) (-351.425) (-350.286) -- 0:00:39

      Average standard deviation of split frequencies: 0.012494

      350500 -- [-349.049] (-351.448) (-349.203) (-349.479) * (-353.045) (-348.475) [-351.097] (-350.350) -- 0:00:38
      351000 -- (-349.442) [-350.161] (-352.141) (-350.787) * (-348.590) (-350.552) [-354.039] (-349.176) -- 0:00:38
      351500 -- [-348.871] (-352.172) (-348.173) (-350.481) * (-348.830) (-350.116) (-355.014) [-352.175] -- 0:00:38
      352000 -- (-349.923) (-351.980) [-349.968] (-352.466) * (-348.893) [-350.691] (-349.715) (-353.217) -- 0:00:38
      352500 -- (-350.915) (-352.038) (-351.937) [-348.608] * [-348.556] (-350.541) (-350.142) (-352.267) -- 0:00:38
      353000 -- (-352.259) (-348.920) [-349.195] (-350.472) * (-349.365) [-348.359] (-353.703) (-349.447) -- 0:00:38
      353500 -- (-350.675) [-353.134] (-349.046) (-351.654) * (-349.390) (-350.277) [-353.181] (-349.038) -- 0:00:38
      354000 -- [-352.917] (-351.939) (-353.367) (-349.498) * (-350.534) (-350.663) [-351.983] (-349.795) -- 0:00:38
      354500 -- [-348.608] (-350.657) (-351.607) (-350.504) * (-349.262) (-353.911) (-354.187) [-348.360] -- 0:00:38
      355000 -- (-348.196) (-352.413) [-352.067] (-353.140) * (-349.803) [-353.299] (-349.647) (-350.900) -- 0:00:38

      Average standard deviation of split frequencies: 0.012229

      355500 -- [-349.565] (-358.012) (-352.794) (-356.013) * (-350.048) (-352.497) [-350.122] (-349.693) -- 0:00:38
      356000 -- (-349.299) [-350.410] (-350.306) (-350.174) * [-348.603] (-350.469) (-348.593) (-351.181) -- 0:00:39
      356500 -- (-351.812) (-353.000) (-352.675) [-351.675] * [-349.341] (-349.175) (-350.549) (-352.019) -- 0:00:39
      357000 -- (-350.145) (-352.123) (-354.842) [-352.385] * (-349.509) (-349.995) [-349.367] (-352.756) -- 0:00:39
      357500 -- (-348.268) (-353.997) [-351.813] (-350.387) * [-349.025] (-354.810) (-349.529) (-349.065) -- 0:00:39
      358000 -- [-349.846] (-348.393) (-352.015) (-352.455) * (-349.272) (-351.526) [-351.908] (-350.552) -- 0:00:39
      358500 -- [-350.865] (-348.453) (-350.107) (-350.266) * (-350.255) (-350.861) (-352.378) [-348.486] -- 0:00:39
      359000 -- [-356.012] (-350.011) (-349.186) (-349.254) * [-350.003] (-349.333) (-350.754) (-349.699) -- 0:00:39
      359500 -- (-351.444) (-348.690) (-348.269) [-350.093] * (-349.150) (-356.734) (-349.085) [-348.967] -- 0:00:39
      360000 -- (-349.135) (-348.370) [-348.664] (-349.134) * [-349.285] (-353.077) (-348.857) (-351.538) -- 0:00:39

      Average standard deviation of split frequencies: 0.012148

      360500 -- [-348.669] (-351.407) (-349.819) (-349.935) * [-349.827] (-351.211) (-352.159) (-351.984) -- 0:00:39
      361000 -- (-351.740) (-348.574) [-348.574] (-349.842) * (-348.999) [-350.042] (-348.686) (-349.861) -- 0:00:38
      361500 -- (-351.491) [-349.739] (-348.441) (-350.442) * [-348.722] (-350.615) (-348.570) (-352.059) -- 0:00:38
      362000 -- [-350.144] (-349.935) (-355.005) (-351.221) * [-353.019] (-349.174) (-348.707) (-353.826) -- 0:00:38
      362500 -- (-352.537) [-349.929] (-351.328) (-348.452) * [-349.878] (-355.357) (-348.980) (-351.637) -- 0:00:38
      363000 -- (-350.799) [-355.097] (-351.836) (-350.977) * (-353.036) [-349.788] (-350.838) (-350.722) -- 0:00:38
      363500 -- (-348.269) (-348.721) [-351.420] (-353.742) * (-351.929) (-351.681) (-348.554) [-351.017] -- 0:00:38
      364000 -- (-348.939) (-350.332) [-350.642] (-351.052) * (-349.669) [-348.572] (-349.385) (-353.412) -- 0:00:38
      364500 -- (-350.781) (-348.619) [-349.598] (-348.208) * [-352.299] (-351.148) (-349.115) (-349.025) -- 0:00:38
      365000 -- (-350.525) [-349.544] (-350.911) (-349.502) * [-352.854] (-350.864) (-351.342) (-350.057) -- 0:00:38

      Average standard deviation of split frequencies: 0.012236

      365500 -- (-351.596) (-355.502) [-350.328] (-348.829) * [-349.874] (-348.614) (-350.404) (-348.781) -- 0:00:38
      366000 -- [-350.537] (-351.554) (-349.192) (-349.139) * (-352.646) (-350.152) [-352.636] (-348.620) -- 0:00:38
      366500 -- (-348.223) [-348.120] (-349.931) (-349.658) * (-352.125) [-349.910] (-351.240) (-348.107) -- 0:00:38
      367000 -- (-349.727) (-351.235) [-351.530] (-348.633) * (-356.923) [-349.873] (-351.372) (-348.012) -- 0:00:37
      367500 -- (-351.949) [-354.593] (-349.443) (-354.558) * [-349.169] (-349.687) (-351.086) (-350.500) -- 0:00:37
      368000 -- (-352.836) (-351.622) [-350.010] (-350.487) * (-349.116) [-349.158] (-351.082) (-349.724) -- 0:00:37
      368500 -- (-349.851) (-349.937) [-349.836] (-349.214) * (-348.665) (-352.643) (-352.343) [-351.515] -- 0:00:37
      369000 -- (-349.540) (-350.775) (-352.268) [-349.986] * (-352.023) (-349.200) [-350.522] (-348.985) -- 0:00:37
      369500 -- [-348.307] (-351.537) (-349.758) (-348.681) * (-352.724) (-349.061) (-353.543) [-352.298] -- 0:00:37
      370000 -- (-349.758) (-353.256) (-348.433) [-350.450] * (-350.357) [-351.925] (-352.616) (-351.975) -- 0:00:37

      Average standard deviation of split frequencies: 0.011941

      370500 -- (-353.869) (-348.825) [-351.687] (-348.994) * [-350.294] (-349.900) (-354.201) (-348.842) -- 0:00:37
      371000 -- [-350.018] (-350.457) (-348.837) (-356.277) * (-352.579) [-348.167] (-352.160) (-350.584) -- 0:00:37
      371500 -- (-349.204) [-351.243] (-349.774) (-357.590) * (-349.478) [-349.863] (-351.196) (-350.894) -- 0:00:37
      372000 -- (-350.422) [-352.174] (-348.165) (-352.520) * (-351.821) (-352.408) (-351.052) [-349.747] -- 0:00:37
      372500 -- [-350.084] (-349.032) (-350.705) (-349.145) * (-349.060) [-349.385] (-352.186) (-351.606) -- 0:00:37
      373000 -- (-348.389) [-348.152] (-356.363) (-348.817) * [-349.066] (-350.591) (-353.963) (-349.651) -- 0:00:38
      373500 -- (-349.198) (-348.940) (-352.363) [-350.494] * [-350.252] (-348.575) (-350.449) (-350.623) -- 0:00:38
      374000 -- [-352.386] (-354.425) (-353.503) (-349.662) * [-350.398] (-348.950) (-349.230) (-349.292) -- 0:00:38
      374500 -- (-352.165) (-357.988) [-353.529] (-351.182) * [-350.250] (-351.643) (-354.862) (-348.587) -- 0:00:38
      375000 -- (-352.450) [-350.021] (-349.408) (-350.871) * (-350.122) [-348.534] (-350.592) (-350.491) -- 0:00:38

      Average standard deviation of split frequencies: 0.012050

      375500 -- (-349.897) (-349.534) (-352.996) [-349.433] * (-350.114) (-347.915) [-349.756] (-349.415) -- 0:00:38
      376000 -- (-349.812) (-350.330) (-354.757) [-350.717] * (-349.779) (-348.790) [-349.181] (-349.401) -- 0:00:38
      376500 -- (-349.228) (-348.985) (-349.277) [-349.066] * (-350.098) (-351.111) [-350.067] (-351.233) -- 0:00:38
      377000 -- [-350.245] (-350.686) (-351.485) (-352.238) * (-348.400) (-352.656) [-353.261] (-351.387) -- 0:00:38
      377500 -- (-351.827) (-352.914) [-356.724] (-352.259) * (-348.468) (-349.128) [-349.673] (-353.749) -- 0:00:37
      378000 -- [-350.872] (-348.552) (-351.059) (-355.778) * (-350.247) (-353.889) [-348.917] (-351.768) -- 0:00:37
      378500 -- (-352.285) (-350.873) [-350.853] (-348.965) * (-350.735) [-348.734] (-349.457) (-348.976) -- 0:00:37
      379000 -- (-350.249) (-348.306) (-349.196) [-349.034] * (-349.205) (-353.434) [-352.550] (-349.761) -- 0:00:37
      379500 -- (-350.483) (-355.072) [-350.473] (-349.266) * (-349.979) (-350.094) [-349.584] (-352.677) -- 0:00:37
      380000 -- (-350.033) [-347.958] (-351.328) (-359.335) * (-351.007) (-351.944) (-357.062) [-350.076] -- 0:00:37

      Average standard deviation of split frequencies: 0.010870

      380500 -- [-351.692] (-349.118) (-352.446) (-352.929) * (-350.883) [-348.960] (-354.381) (-351.409) -- 0:00:37
      381000 -- (-349.104) [-350.033] (-350.654) (-348.495) * (-349.323) (-349.317) (-350.077) [-349.879] -- 0:00:37
      381500 -- (-352.951) (-351.836) [-351.519] (-350.984) * (-351.538) (-350.089) (-349.859) [-348.798] -- 0:00:37
      382000 -- (-350.242) [-350.813] (-351.716) (-352.376) * (-351.968) (-350.035) (-348.820) [-352.764] -- 0:00:37
      382500 -- (-348.860) [-351.525] (-354.953) (-349.727) * (-350.116) (-349.138) (-350.585) [-349.544] -- 0:00:37
      383000 -- (-350.694) (-349.164) (-350.561) [-348.430] * (-350.645) (-349.103) [-351.137] (-348.902) -- 0:00:37
      383500 -- [-349.447] (-349.367) (-350.280) (-350.695) * [-352.204] (-351.472) (-355.642) (-349.339) -- 0:00:36
      384000 -- (-349.333) (-349.747) (-351.137) [-349.110] * (-351.577) [-350.116] (-350.461) (-348.910) -- 0:00:36
      384500 -- (-349.448) (-350.177) [-349.588] (-350.119) * (-349.698) (-351.503) [-350.921] (-351.844) -- 0:00:36
      385000 -- (-351.636) (-351.757) [-349.354] (-348.349) * [-348.897] (-348.482) (-350.740) (-351.574) -- 0:00:36

      Average standard deviation of split frequencies: 0.010720

      385500 -- (-355.298) (-350.967) [-348.753] (-349.230) * [-349.702] (-350.242) (-354.349) (-349.038) -- 0:00:36
      386000 -- (-355.947) (-352.008) (-350.518) [-350.578] * (-350.097) [-350.519] (-348.146) (-348.168) -- 0:00:36
      386500 -- [-351.744] (-350.162) (-349.507) (-349.292) * (-348.843) (-351.424) [-348.294] (-348.536) -- 0:00:36
      387000 -- (-353.969) [-350.571] (-349.451) (-350.984) * (-349.742) (-348.891) [-351.374] (-350.279) -- 0:00:36
      387500 -- (-349.444) [-352.064] (-348.773) (-351.207) * (-348.362) (-349.663) (-349.236) [-348.535] -- 0:00:36
      388000 -- [-353.810] (-348.539) (-348.541) (-352.081) * (-349.253) [-350.659] (-348.993) (-349.667) -- 0:00:36
      388500 -- (-350.700) (-350.113) [-348.738] (-350.674) * (-350.474) (-348.245) [-349.088] (-353.896) -- 0:00:36
      389000 -- (-350.724) (-354.519) [-349.004] (-350.266) * (-354.309) [-350.369] (-354.223) (-351.504) -- 0:00:36
      389500 -- (-348.893) (-348.667) [-348.476] (-349.804) * (-348.383) [-349.788] (-355.154) (-350.975) -- 0:00:36
      390000 -- (-348.281) [-349.265] (-350.977) (-349.364) * (-348.892) [-349.465] (-350.473) (-350.893) -- 0:00:37

      Average standard deviation of split frequencies: 0.010994

      390500 -- [-349.927] (-348.845) (-349.600) (-348.166) * (-349.548) [-349.253] (-351.027) (-350.408) -- 0:00:37
      391000 -- (-348.834) [-349.690] (-350.321) (-349.693) * (-354.787) (-349.533) [-350.387] (-349.498) -- 0:00:37
      391500 -- (-348.268) (-349.871) (-350.086) [-350.866] * (-353.350) (-349.616) [-349.585] (-349.344) -- 0:00:37
      392000 -- (-348.467) [-348.148] (-350.188) (-351.133) * (-353.885) [-350.039] (-350.430) (-348.016) -- 0:00:37
      392500 -- (-349.949) (-348.341) (-351.194) [-351.534] * (-348.967) (-350.082) (-349.116) [-348.830] -- 0:00:37
      393000 -- (-350.698) (-349.685) [-353.666] (-348.858) * [-352.534] (-350.378) (-350.503) (-348.411) -- 0:00:37
      393500 -- (-348.855) [-351.340] (-349.828) (-348.951) * [-352.540] (-350.799) (-350.410) (-350.324) -- 0:00:36
      394000 -- [-349.605] (-349.103) (-349.788) (-351.605) * (-351.355) [-348.931] (-349.349) (-350.582) -- 0:00:36
      394500 -- [-350.292] (-350.118) (-353.341) (-349.746) * [-352.497] (-349.644) (-351.146) (-348.992) -- 0:00:36
      395000 -- [-348.671] (-350.475) (-351.354) (-350.210) * (-348.834) (-349.896) [-350.002] (-349.309) -- 0:00:36

      Average standard deviation of split frequencies: 0.010978

      395500 -- (-349.070) [-348.937] (-352.666) (-355.873) * (-354.142) (-353.604) (-351.915) [-353.030] -- 0:00:36
      396000 -- [-349.302] (-349.075) (-352.298) (-351.440) * (-348.716) [-349.073] (-350.804) (-354.648) -- 0:00:36
      396500 -- (-350.200) (-349.804) [-349.104] (-348.624) * (-348.516) (-349.338) (-349.827) [-348.903] -- 0:00:36
      397000 -- [-351.529] (-349.582) (-348.450) (-351.856) * (-354.806) (-351.396) (-348.630) [-352.712] -- 0:00:36
      397500 -- [-348.253] (-349.773) (-350.241) (-349.000) * (-351.681) (-349.594) (-348.482) [-351.868] -- 0:00:36
      398000 -- (-349.127) (-350.628) [-349.896] (-354.524) * (-348.766) (-357.576) [-348.966] (-351.805) -- 0:00:36
      398500 -- (-350.445) [-349.230] (-349.622) (-348.064) * (-348.743) [-349.483] (-353.361) (-350.603) -- 0:00:36
      399000 -- (-349.807) (-349.885) (-348.854) [-348.540] * (-349.535) (-351.651) (-348.682) [-351.911] -- 0:00:36
      399500 -- [-349.354] (-352.893) (-352.347) (-351.240) * (-353.224) [-349.700] (-350.153) (-352.699) -- 0:00:36
      400000 -- (-349.996) (-348.916) (-351.983) [-348.757] * (-352.849) (-349.899) [-348.632] (-352.489) -- 0:00:36

      Average standard deviation of split frequencies: 0.010785

      400500 -- [-349.485] (-352.870) (-350.329) (-347.987) * (-350.643) (-354.129) [-348.267] (-352.937) -- 0:00:35
      401000 -- (-355.796) [-350.714] (-351.054) (-350.585) * (-350.452) (-350.409) [-349.113] (-351.770) -- 0:00:35
      401500 -- (-352.227) (-349.819) (-353.931) [-349.362] * [-349.053] (-349.303) (-353.100) (-351.961) -- 0:00:35
      402000 -- (-352.181) (-350.100) (-354.119) [-349.941] * [-348.853] (-351.413) (-349.883) (-350.347) -- 0:00:35
      402500 -- (-351.263) (-351.061) [-350.963] (-350.382) * [-349.105] (-351.293) (-348.738) (-351.554) -- 0:00:35
      403000 -- (-352.029) (-351.144) [-349.564] (-349.213) * (-351.889) [-351.479] (-355.110) (-353.967) -- 0:00:35
      403500 -- (-351.469) (-350.776) [-348.753] (-349.045) * (-350.787) (-350.487) [-351.063] (-353.550) -- 0:00:35
      404000 -- (-349.223) (-349.488) (-351.297) [-349.759] * (-349.526) (-352.768) [-350.294] (-349.518) -- 0:00:35
      404500 -- (-349.945) (-353.381) (-350.411) [-350.333] * (-349.160) (-350.870) [-348.805] (-348.756) -- 0:00:35
      405000 -- (-350.162) (-348.430) (-348.511) [-351.645] * (-349.292) (-348.915) [-349.370] (-350.056) -- 0:00:35

      Average standard deviation of split frequencies: 0.011288

      405500 -- (-350.907) [-349.196] (-350.367) (-349.726) * (-348.956) [-348.683] (-348.334) (-349.261) -- 0:00:35
      406000 -- (-350.263) [-350.921] (-349.771) (-349.747) * (-349.647) (-349.064) (-349.110) [-352.256] -- 0:00:35
      406500 -- (-350.268) (-353.505) (-348.712) [-351.230] * (-353.618) (-348.546) [-349.995] (-349.379) -- 0:00:35
      407000 -- (-349.227) (-349.180) [-356.029] (-349.079) * (-356.409) [-350.208] (-352.002) (-352.588) -- 0:00:34
      407500 -- (-348.083) [-348.243] (-354.051) (-349.654) * (-351.643) (-350.393) (-351.924) [-350.017] -- 0:00:36
      408000 -- (-350.039) [-348.148] (-352.085) (-352.647) * [-350.695] (-350.694) (-352.789) (-350.415) -- 0:00:36
      408500 -- (-352.438) [-349.595] (-351.139) (-349.167) * (-350.695) [-348.654] (-351.018) (-350.727) -- 0:00:36
      409000 -- (-349.597) (-352.133) [-349.597] (-349.354) * (-354.283) (-349.305) (-354.168) [-348.964] -- 0:00:36
      409500 -- (-350.055) [-350.759] (-349.305) (-354.368) * (-353.567) [-352.474] (-352.318) (-350.725) -- 0:00:36
      410000 -- [-347.959] (-350.681) (-348.862) (-350.223) * (-352.414) [-351.326] (-350.147) (-349.114) -- 0:00:35

      Average standard deviation of split frequencies: 0.010395

      410500 -- (-349.028) [-348.763] (-348.566) (-354.449) * (-351.024) (-352.068) (-350.206) [-352.364] -- 0:00:35
      411000 -- (-351.767) [-351.578] (-349.580) (-351.069) * [-348.022] (-350.545) (-350.314) (-354.364) -- 0:00:35
      411500 -- (-353.453) [-350.159] (-350.337) (-350.795) * (-350.139) (-353.339) (-349.282) [-349.295] -- 0:00:35
      412000 -- [-348.300] (-354.285) (-353.010) (-352.188) * (-356.651) (-353.415) (-349.232) [-348.984] -- 0:00:35
      412500 -- (-348.927) [-352.347] (-350.439) (-349.906) * (-350.910) (-353.150) [-348.166] (-348.675) -- 0:00:35
      413000 -- [-352.450] (-351.143) (-351.517) (-348.117) * [-351.151] (-350.425) (-348.850) (-349.007) -- 0:00:35
      413500 -- (-355.353) (-349.442) (-350.826) [-351.743] * (-349.124) (-350.338) (-349.014) [-350.424] -- 0:00:35
      414000 -- (-352.167) (-349.592) (-351.378) [-350.950] * [-350.473] (-349.992) (-352.770) (-351.891) -- 0:00:35
      414500 -- (-352.004) (-350.376) (-348.655) [-349.712] * [-350.637] (-349.405) (-349.792) (-354.329) -- 0:00:35
      415000 -- [-349.615] (-351.638) (-348.875) (-353.760) * (-349.575) (-350.409) [-350.122] (-352.211) -- 0:00:35

      Average standard deviation of split frequencies: 0.010450

      415500 -- (-348.577) (-353.564) (-354.258) [-353.910] * [-348.322] (-348.669) (-350.043) (-350.392) -- 0:00:35
      416000 -- (-351.911) (-352.121) [-349.352] (-355.807) * (-350.330) (-351.753) (-350.319) [-349.111] -- 0:00:35
      416500 -- (-350.951) [-350.350] (-355.265) (-349.977) * (-351.307) (-349.959) [-349.441] (-348.033) -- 0:00:35
      417000 -- [-348.058] (-355.211) (-349.587) (-349.041) * [-348.381] (-350.563) (-349.207) (-348.622) -- 0:00:34
      417500 -- (-350.279) (-363.387) [-350.740] (-348.882) * (-350.118) [-349.338] (-350.499) (-351.735) -- 0:00:34
      418000 -- (-349.091) (-348.587) [-348.447] (-350.359) * [-353.871] (-351.211) (-354.561) (-349.282) -- 0:00:34
      418500 -- (-349.735) [-348.838] (-351.364) (-349.648) * (-350.958) (-350.203) [-348.753] (-348.765) -- 0:00:34
      419000 -- (-352.108) [-352.046] (-348.678) (-351.069) * (-349.524) (-350.141) (-349.458) [-349.124] -- 0:00:34
      419500 -- (-350.884) [-350.141] (-351.256) (-350.292) * (-352.362) [-349.436] (-352.181) (-350.881) -- 0:00:34
      420000 -- (-355.780) (-353.385) (-351.108) [-349.694] * (-349.964) (-349.714) (-349.029) [-351.637] -- 0:00:34

      Average standard deviation of split frequencies: 0.009463

      420500 -- [-349.303] (-350.304) (-350.892) (-348.808) * [-351.193] (-349.070) (-349.711) (-352.707) -- 0:00:34
      421000 -- (-349.960) (-349.393) [-348.956] (-350.173) * [-349.238] (-350.044) (-352.081) (-352.934) -- 0:00:34
      421500 -- (-349.482) [-350.117] (-349.460) (-350.502) * [-352.308] (-351.428) (-353.253) (-348.302) -- 0:00:34
      422000 -- (-351.294) (-352.757) (-351.335) [-350.805] * (-353.624) [-352.519] (-351.457) (-350.149) -- 0:00:34
      422500 -- (-350.591) (-351.885) (-353.374) [-352.119] * (-351.874) [-349.513] (-348.972) (-352.448) -- 0:00:34
      423000 -- (-350.449) (-349.123) (-351.170) [-350.282] * (-349.515) (-350.309) [-351.335] (-352.959) -- 0:00:34
      423500 -- [-352.601] (-351.439) (-351.598) (-348.392) * (-351.633) (-353.165) [-350.861] (-348.687) -- 0:00:34
      424000 -- (-351.996) (-354.007) (-352.392) [-350.729] * (-349.555) (-354.645) (-351.683) [-349.809] -- 0:00:33
      424500 -- (-351.738) (-349.479) [-348.868] (-350.263) * (-349.044) [-349.689] (-350.762) (-352.625) -- 0:00:35
      425000 -- [-350.091] (-350.582) (-349.244) (-352.289) * (-353.097) (-349.897) [-349.600] (-356.413) -- 0:00:35

      Average standard deviation of split frequencies: 0.009160

      425500 -- (-349.695) (-350.576) [-348.954] (-348.277) * (-349.162) (-350.757) (-349.229) [-352.142] -- 0:00:35
      426000 -- [-351.738] (-350.753) (-348.371) (-354.545) * (-349.815) [-351.541] (-349.370) (-349.215) -- 0:00:35
      426500 -- (-350.775) (-349.691) (-351.954) [-353.783] * (-351.393) (-350.498) (-354.182) [-348.823] -- 0:00:34
      427000 -- (-350.353) [-349.303] (-348.536) (-353.650) * (-348.814) [-351.293] (-351.377) (-351.869) -- 0:00:34
      427500 -- (-352.995) [-348.559] (-349.713) (-352.384) * (-349.899) (-350.287) (-351.042) [-351.605] -- 0:00:34
      428000 -- (-349.568) (-351.295) [-349.418] (-348.743) * (-348.763) (-349.219) [-352.467] (-348.224) -- 0:00:34
      428500 -- [-349.622] (-350.717) (-349.738) (-350.619) * (-353.482) (-349.255) (-352.111) [-352.747] -- 0:00:34
      429000 -- (-350.563) (-351.805) [-350.709] (-352.527) * (-350.634) (-350.159) (-350.562) [-352.931] -- 0:00:34
      429500 -- (-351.215) (-349.536) (-352.889) [-350.940] * [-351.302] (-349.320) (-351.484) (-355.714) -- 0:00:34
      430000 -- (-350.459) [-350.373] (-353.994) (-350.148) * [-353.000] (-351.030) (-353.132) (-357.191) -- 0:00:34

      Average standard deviation of split frequencies: 0.008939

      430500 -- (-349.265) (-350.622) (-351.092) [-355.795] * [-348.789] (-352.857) (-350.184) (-356.951) -- 0:00:34
      431000 -- (-352.952) [-349.526] (-353.542) (-352.190) * (-352.135) [-349.354] (-350.657) (-348.900) -- 0:00:34
      431500 -- [-348.196] (-354.630) (-348.890) (-351.169) * [-349.276] (-351.624) (-350.192) (-350.059) -- 0:00:34
      432000 -- (-350.377) [-352.670] (-350.129) (-350.297) * (-353.330) (-348.886) (-352.019) [-349.188] -- 0:00:34
      432500 -- (-357.176) (-353.828) (-351.370) [-350.834] * (-349.040) (-352.914) [-351.042] (-349.198) -- 0:00:34
      433000 -- [-349.584] (-350.927) (-353.117) (-351.174) * (-348.979) (-348.583) (-350.242) [-349.599] -- 0:00:34
      433500 -- [-349.895] (-350.805) (-353.040) (-351.750) * [-352.743] (-350.022) (-349.632) (-349.586) -- 0:00:33
      434000 -- (-351.637) (-350.686) [-349.933] (-350.052) * (-350.364) (-350.520) (-349.772) [-347.910] -- 0:00:33
      434500 -- (-350.519) (-349.392) [-349.052] (-355.000) * (-348.576) (-349.442) [-348.274] (-349.965) -- 0:00:33
      435000 -- [-351.293] (-349.520) (-349.131) (-349.870) * (-349.040) (-349.446) [-352.576] (-352.361) -- 0:00:33

      Average standard deviation of split frequencies: 0.008713

      435500 -- (-356.152) [-352.077] (-350.537) (-350.626) * (-350.084) [-348.812] (-354.988) (-350.289) -- 0:00:33
      436000 -- (-352.719) (-348.953) [-349.704] (-352.034) * [-348.526] (-352.420) (-351.425) (-348.494) -- 0:00:33
      436500 -- (-351.521) [-350.452] (-351.618) (-349.830) * (-348.711) (-353.649) [-348.155] (-353.060) -- 0:00:33
      437000 -- (-348.565) [-351.306] (-349.116) (-349.973) * (-348.893) (-355.015) [-349.649] (-350.816) -- 0:00:33
      437500 -- (-349.123) [-350.547] (-352.433) (-350.662) * (-349.641) (-350.903) (-349.679) [-350.910] -- 0:00:33
      438000 -- (-349.805) (-351.973) [-351.874] (-349.891) * (-348.582) (-348.765) [-350.192] (-351.271) -- 0:00:33
      438500 -- (-349.770) (-351.488) (-350.937) [-348.952] * (-351.813) (-350.934) (-352.852) [-349.404] -- 0:00:33
      439000 -- [-351.176] (-351.497) (-349.944) (-349.306) * (-348.747) (-352.729) (-351.098) [-349.225] -- 0:00:33
      439500 -- (-352.149) (-352.223) [-348.484] (-349.850) * (-349.092) (-349.033) [-348.100] (-349.885) -- 0:00:33
      440000 -- (-356.109) (-350.896) (-348.493) [-348.571] * (-348.453) [-350.603] (-355.289) (-349.929) -- 0:00:33

      Average standard deviation of split frequencies: 0.009124

      440500 -- (-351.339) (-349.893) (-350.596) [-348.422] * (-349.787) (-356.345) [-349.458] (-352.178) -- 0:00:33
      441000 -- (-355.291) (-348.941) (-349.506) [-348.445] * [-349.768] (-350.086) (-350.298) (-350.058) -- 0:00:32
      441500 -- (-352.193) [-348.765] (-348.985) (-349.203) * (-351.565) (-349.484) (-349.414) [-349.532] -- 0:00:34
      442000 -- (-349.789) (-355.771) (-349.232) [-349.354] * (-349.375) (-350.678) [-349.069] (-352.526) -- 0:00:34
      442500 -- (-351.640) (-349.600) (-353.593) [-349.186] * (-349.795) (-350.107) (-350.062) [-350.071] -- 0:00:34
      443000 -- (-353.614) (-351.801) (-351.989) [-357.454] * (-349.847) (-348.011) (-350.060) [-351.742] -- 0:00:33
      443500 -- (-351.455) (-348.018) [-350.291] (-352.501) * (-350.398) [-348.916] (-351.609) (-349.778) -- 0:00:33
      444000 -- (-352.796) [-350.660] (-349.838) (-351.534) * (-351.931) (-350.171) (-349.623) [-355.135] -- 0:00:33
      444500 -- (-351.779) (-349.333) [-349.356] (-350.316) * (-350.321) [-348.709] (-349.155) (-352.566) -- 0:00:33
      445000 -- [-349.509] (-350.193) (-353.720) (-350.141) * (-352.039) [-350.476] (-348.474) (-349.217) -- 0:00:33

      Average standard deviation of split frequencies: 0.009140

      445500 -- (-351.002) (-353.161) (-352.672) [-350.964] * (-349.731) (-352.296) [-348.655] (-352.535) -- 0:00:33
      446000 -- [-348.641] (-353.131) (-349.166) (-351.876) * (-349.374) [-349.420] (-354.273) (-347.976) -- 0:00:33
      446500 -- (-352.442) (-349.851) [-348.830] (-350.991) * (-350.137) [-350.551] (-352.526) (-354.043) -- 0:00:33
      447000 -- [-353.984] (-348.625) (-350.015) (-351.850) * (-350.047) (-348.178) [-348.727] (-349.289) -- 0:00:33
      447500 -- (-352.287) (-349.098) (-350.270) [-352.589] * (-350.842) [-350.049] (-349.489) (-351.256) -- 0:00:33
      448000 -- (-348.844) (-348.440) (-350.796) [-350.263] * (-356.063) (-348.485) (-349.089) [-349.609] -- 0:00:33
      448500 -- [-349.551] (-349.288) (-355.458) (-352.347) * (-353.917) (-349.226) (-349.378) [-348.893] -- 0:00:33
      449000 -- (-349.610) (-352.312) [-353.325] (-349.452) * (-352.082) [-348.797] (-349.799) (-349.116) -- 0:00:33
      449500 -- (-349.876) [-350.017] (-351.948) (-348.012) * (-352.285) (-349.879) (-350.235) [-354.341] -- 0:00:33
      450000 -- (-351.325) (-349.602) [-349.595] (-351.679) * [-349.174] (-351.921) (-350.976) (-350.073) -- 0:00:33

      Average standard deviation of split frequencies: 0.009906

      450500 -- (-351.924) (-348.007) (-353.393) [-348.042] * (-351.117) (-351.096) (-349.780) [-349.077] -- 0:00:32
      451000 -- (-349.929) (-348.887) [-351.605] (-349.238) * (-354.308) (-351.621) (-349.916) [-348.338] -- 0:00:32
      451500 -- (-353.145) (-355.120) (-348.891) [-352.416] * (-355.671) (-351.070) [-350.300] (-350.140) -- 0:00:32
      452000 -- (-349.789) [-348.723] (-353.450) (-348.597) * (-349.740) (-349.353) (-350.900) [-350.842] -- 0:00:32
      452500 -- (-352.120) (-350.712) (-349.071) [-348.434] * [-352.257] (-348.484) (-352.522) (-350.515) -- 0:00:32
      453000 -- (-351.720) [-350.624] (-349.086) (-350.734) * [-350.789] (-347.943) (-350.278) (-352.833) -- 0:00:32
      453500 -- (-350.167) (-351.619) [-351.357] (-349.846) * (-351.379) [-352.811] (-348.535) (-354.348) -- 0:00:32
      454000 -- (-352.206) (-348.837) [-349.180] (-350.888) * (-349.843) [-355.295] (-350.522) (-354.445) -- 0:00:32
      454500 -- (-355.614) (-348.028) (-353.586) [-349.771] * (-349.635) [-356.045] (-350.383) (-351.512) -- 0:00:32
      455000 -- (-351.321) (-348.328) [-352.107] (-349.768) * (-354.212) [-351.317] (-349.842) (-351.390) -- 0:00:32

      Average standard deviation of split frequencies: 0.009851

      455500 -- [-349.014] (-351.930) (-349.052) (-350.341) * (-349.554) (-351.993) [-348.697] (-351.814) -- 0:00:32
      456000 -- (-349.334) (-352.010) (-349.884) [-349.074] * (-348.828) (-353.254) (-352.268) [-349.969] -- 0:00:32
      456500 -- (-349.172) (-350.624) (-348.340) [-352.298] * (-351.980) (-349.266) [-351.305] (-355.120) -- 0:00:32
      457000 -- (-348.368) (-353.798) [-348.783] (-355.394) * (-350.341) (-349.140) [-351.909] (-350.763) -- 0:00:32
      457500 -- (-350.693) (-350.232) [-348.588] (-353.148) * (-349.414) (-351.523) (-349.802) [-349.958] -- 0:00:32
      458000 -- (-351.285) (-350.650) (-348.858) [-353.205] * (-348.913) (-354.242) (-355.248) [-350.353] -- 0:00:31
      458500 -- (-353.957) [-348.356] (-351.940) (-348.877) * (-350.985) (-355.021) (-350.292) [-350.311] -- 0:00:33
      459000 -- (-349.610) [-351.048] (-352.251) (-351.178) * (-349.311) [-357.800] (-349.566) (-349.989) -- 0:00:33
      459500 -- (-351.088) (-350.633) [-355.040] (-349.383) * (-349.236) (-349.986) [-351.620] (-349.324) -- 0:00:32
      460000 -- (-355.104) [-352.389] (-350.769) (-353.578) * [-349.793] (-349.006) (-350.644) (-352.101) -- 0:00:32

      Average standard deviation of split frequencies: 0.010414

      460500 -- [-350.117] (-348.315) (-351.388) (-350.264) * (-349.406) (-354.214) (-354.554) [-348.433] -- 0:00:32
      461000 -- (-352.198) (-349.442) (-354.598) [-351.328] * (-349.339) (-350.832) (-352.985) [-349.682] -- 0:00:32
      461500 -- (-351.905) (-349.673) [-348.674] (-349.569) * (-348.943) (-350.509) [-348.169] (-349.785) -- 0:00:32
      462000 -- [-351.029] (-353.080) (-353.271) (-349.589) * (-350.589) (-352.651) [-350.038] (-348.761) -- 0:00:32
      462500 -- (-353.405) [-349.692] (-355.341) (-352.737) * (-350.301) (-352.740) (-349.847) [-349.794] -- 0:00:32
      463000 -- (-351.351) (-350.440) (-352.032) [-350.760] * (-357.060) (-349.357) (-349.323) [-350.294] -- 0:00:32
      463500 -- (-351.384) (-350.664) [-348.909] (-351.512) * [-350.683] (-350.487) (-348.470) (-349.599) -- 0:00:32
      464000 -- (-349.597) [-348.158] (-349.532) (-350.812) * (-349.850) (-349.404) (-350.732) [-349.855] -- 0:00:32
      464500 -- (-350.950) (-348.568) [-349.576] (-350.614) * (-351.042) (-349.474) (-349.695) [-351.195] -- 0:00:32
      465000 -- [-349.370] (-348.962) (-352.927) (-348.377) * [-349.169] (-349.574) (-350.488) (-350.016) -- 0:00:32

      Average standard deviation of split frequencies: 0.009759

      465500 -- (-350.153) (-353.409) [-348.113] (-352.165) * [-348.870] (-352.253) (-350.912) (-353.879) -- 0:00:32
      466000 -- (-351.502) (-353.767) [-349.119] (-352.422) * [-349.928] (-349.256) (-350.126) (-348.819) -- 0:00:32
      466500 -- (-349.393) (-350.253) [-350.240] (-348.826) * (-349.361) (-349.605) (-349.665) [-350.982] -- 0:00:32
      467000 -- (-350.085) [-349.851] (-350.699) (-349.754) * (-353.271) [-350.481] (-349.587) (-355.106) -- 0:00:31
      467500 -- (-348.473) (-353.213) [-349.292] (-349.867) * [-349.200] (-350.123) (-349.179) (-351.937) -- 0:00:31
      468000 -- (-349.038) [-350.947] (-349.045) (-351.046) * (-351.664) [-350.185] (-349.129) (-354.404) -- 0:00:31
      468500 -- [-348.810] (-348.052) (-348.426) (-350.521) * [-350.538] (-348.679) (-350.136) (-353.668) -- 0:00:31
      469000 -- (-349.045) (-349.824) [-349.672] (-354.340) * [-352.567] (-350.150) (-349.385) (-352.673) -- 0:00:31
      469500 -- (-348.066) (-349.328) (-350.171) [-351.606] * (-349.564) [-350.755] (-350.675) (-355.798) -- 0:00:31
      470000 -- [-350.352] (-348.664) (-348.766) (-351.859) * [-349.474] (-351.494) (-352.815) (-351.277) -- 0:00:31

      Average standard deviation of split frequencies: 0.009544

      470500 -- (-352.936) (-350.298) [-353.394] (-352.426) * [-349.293] (-351.247) (-352.947) (-350.186) -- 0:00:31
      471000 -- (-356.386) [-349.599] (-349.135) (-350.493) * (-351.929) [-350.681] (-349.827) (-347.899) -- 0:00:31
      471500 -- (-349.963) (-350.460) [-352.107] (-351.201) * (-350.963) (-355.877) [-348.836] (-349.029) -- 0:00:31
      472000 -- (-354.275) [-355.226] (-349.695) (-348.166) * [-351.096] (-350.897) (-350.399) (-348.354) -- 0:00:31
      472500 -- (-348.261) [-349.315] (-347.999) (-351.006) * (-354.263) [-350.516] (-350.523) (-349.923) -- 0:00:31
      473000 -- [-350.734] (-350.282) (-351.958) (-351.417) * (-350.621) [-349.883] (-351.451) (-350.829) -- 0:00:31
      473500 -- [-348.767] (-350.368) (-349.767) (-349.367) * [-350.386] (-349.787) (-354.199) (-350.946) -- 0:00:31
      474000 -- [-348.104] (-355.706) (-348.863) (-347.854) * (-353.089) (-354.441) (-353.800) [-349.506] -- 0:00:31
      474500 -- (-349.618) [-351.667] (-352.214) (-349.277) * (-349.258) [-349.592] (-348.739) (-350.690) -- 0:00:31
      475000 -- (-349.199) (-349.943) (-349.266) [-349.488] * (-351.326) (-349.287) (-351.650) [-348.116] -- 0:00:30

      Average standard deviation of split frequencies: 0.009612

      475500 -- [-349.562] (-353.348) (-348.743) (-351.770) * [-350.225] (-348.512) (-347.886) (-349.664) -- 0:00:30
      476000 -- (-351.974) [-351.441] (-349.934) (-349.675) * (-351.871) (-348.775) (-349.918) [-351.635] -- 0:00:31
      476500 -- (-353.104) [-347.862] (-349.154) (-350.743) * [-349.642] (-349.169) (-352.348) (-348.378) -- 0:00:31
      477000 -- (-349.320) [-349.008] (-354.866) (-348.222) * (-350.095) [-350.145] (-351.558) (-348.221) -- 0:00:31
      477500 -- (-348.696) (-352.816) (-350.618) [-351.403] * [-350.132] (-350.010) (-349.055) (-350.983) -- 0:00:31
      478000 -- [-350.106] (-348.972) (-349.508) (-353.554) * (-352.250) (-350.170) [-349.287] (-348.681) -- 0:00:31
      478500 -- [-349.738] (-351.261) (-349.893) (-351.508) * (-350.697) (-348.002) [-350.549] (-348.619) -- 0:00:31
      479000 -- (-351.979) (-354.200) (-349.064) [-351.568] * (-348.046) (-350.989) [-350.124] (-348.967) -- 0:00:31
      479500 -- (-352.481) (-359.619) (-349.102) [-349.556] * (-349.523) (-350.013) [-349.992] (-348.994) -- 0:00:31
      480000 -- (-354.664) (-351.092) (-351.530) [-352.873] * (-350.810) (-351.420) [-349.655] (-354.012) -- 0:00:31

      Average standard deviation of split frequencies: 0.009634

      480500 -- (-350.807) [-349.057] (-350.990) (-350.312) * (-348.358) [-348.917] (-351.753) (-349.541) -- 0:00:31
      481000 -- (-349.749) (-350.901) (-351.461) [-349.171] * (-350.991) (-351.858) [-350.025] (-349.415) -- 0:00:31
      481500 -- [-349.013] (-351.241) (-349.841) (-350.213) * [-348.069] (-351.697) (-350.526) (-354.279) -- 0:00:31
      482000 -- (-350.963) (-351.921) (-349.636) [-351.522] * [-348.872] (-351.349) (-353.597) (-350.576) -- 0:00:31
      482500 -- (-349.244) [-352.225] (-348.089) (-349.177) * (-348.849) (-349.908) (-349.850) [-352.258] -- 0:00:31
      483000 -- [-349.396] (-350.541) (-351.101) (-347.993) * (-349.658) (-353.139) [-348.363] (-350.077) -- 0:00:31
      483500 -- [-349.378] (-352.384) (-351.068) (-349.973) * (-354.309) (-348.664) (-351.349) [-349.693] -- 0:00:30
      484000 -- (-351.679) [-349.566] (-352.361) (-349.880) * (-352.781) [-349.935] (-351.244) (-349.929) -- 0:00:30
      484500 -- (-348.942) [-350.587] (-351.503) (-349.678) * (-350.840) (-350.971) [-350.913] (-353.021) -- 0:00:30
      485000 -- (-349.727) (-349.902) (-352.172) [-348.395] * (-349.395) (-351.286) [-350.390] (-351.953) -- 0:00:30

      Average standard deviation of split frequencies: 0.009357

      485500 -- (-353.757) (-349.057) [-349.627] (-348.333) * (-349.151) (-350.253) [-348.330] (-351.313) -- 0:00:30
      486000 -- [-352.347] (-351.580) (-350.573) (-351.701) * [-351.819] (-352.782) (-348.479) (-349.675) -- 0:00:30
      486500 -- [-354.783] (-351.449) (-353.809) (-351.411) * [-353.160] (-351.318) (-351.073) (-349.777) -- 0:00:30
      487000 -- (-358.418) (-348.850) (-350.613) [-351.679] * (-351.537) (-350.636) (-353.858) [-353.320] -- 0:00:30
      487500 -- (-361.892) (-348.314) (-351.847) [-350.448] * (-353.898) (-353.398) [-350.758] (-349.504) -- 0:00:30
      488000 -- (-354.844) (-348.440) (-353.729) [-350.075] * (-349.184) [-350.932] (-351.644) (-351.902) -- 0:00:30
      488500 -- (-353.150) (-349.880) [-357.802] (-350.386) * (-356.458) (-350.421) (-349.834) [-350.697] -- 0:00:30
      489000 -- [-349.184] (-354.352) (-350.258) (-350.945) * (-356.463) (-351.515) [-348.829] (-350.839) -- 0:00:30
      489500 -- (-352.264) [-349.937] (-350.092) (-350.327) * (-350.083) (-351.257) (-349.771) [-348.961] -- 0:00:30
      490000 -- (-353.448) [-348.465] (-350.415) (-351.983) * (-356.369) (-350.531) (-348.708) [-349.686] -- 0:00:30

      Average standard deviation of split frequencies: 0.009438

      490500 -- [-349.292] (-351.051) (-349.928) (-352.330) * [-349.824] (-350.406) (-351.122) (-349.189) -- 0:00:30
      491000 -- (-351.337) (-350.623) (-352.606) [-349.657] * (-353.237) [-351.478] (-350.485) (-349.466) -- 0:00:30
      491500 -- (-348.053) (-353.575) (-349.495) [-350.107] * (-349.620) [-348.958] (-349.204) (-350.944) -- 0:00:30
      492000 -- (-348.592) (-348.909) (-348.841) [-349.041] * [-349.596] (-350.730) (-358.310) (-352.189) -- 0:00:29
      492500 -- (-349.867) (-352.376) (-349.216) [-352.487] * [-350.164] (-353.292) (-348.869) (-350.508) -- 0:00:29
      493000 -- [-351.623] (-350.008) (-351.067) (-351.144) * [-349.774] (-349.728) (-349.236) (-354.061) -- 0:00:30
      493500 -- [-348.486] (-351.109) (-350.272) (-348.916) * (-349.967) (-349.434) (-349.280) [-348.978] -- 0:00:30
      494000 -- [-351.601] (-351.848) (-348.436) (-348.384) * (-349.818) (-350.517) [-350.278] (-349.074) -- 0:00:30
      494500 -- (-348.672) [-349.204] (-350.460) (-350.156) * (-350.179) (-353.939) [-349.409] (-349.264) -- 0:00:30
      495000 -- (-348.178) [-348.705] (-348.505) (-348.896) * (-350.390) [-351.946] (-348.421) (-348.473) -- 0:00:30

      Average standard deviation of split frequencies: 0.009336

      495500 -- (-348.155) [-353.562] (-350.628) (-349.228) * (-350.972) [-350.906] (-350.645) (-349.535) -- 0:00:30
      496000 -- (-348.478) [-351.356] (-351.797) (-350.292) * (-351.397) [-350.131] (-351.133) (-348.734) -- 0:00:30
      496500 -- (-350.122) (-350.400) (-349.404) [-348.500] * (-354.835) (-349.434) (-350.563) [-349.666] -- 0:00:30
      497000 -- (-349.924) (-356.839) [-348.152] (-353.151) * (-350.480) (-350.197) (-349.466) [-349.466] -- 0:00:30
      497500 -- (-355.455) [-348.753] (-349.199) (-355.086) * [-349.794] (-347.890) (-352.568) (-349.571) -- 0:00:30
      498000 -- (-356.024) (-348.497) (-349.041) [-348.853] * (-351.170) [-349.248] (-349.066) (-349.832) -- 0:00:30
      498500 -- (-351.450) (-352.495) (-350.733) [-350.028] * (-350.260) (-349.289) (-349.236) [-348.464] -- 0:00:30
      499000 -- (-349.957) [-348.386] (-352.377) (-351.423) * (-351.877) [-349.568] (-352.438) (-348.402) -- 0:00:30
      499500 -- (-352.542) (-348.698) (-348.853) [-349.757] * (-350.439) [-349.789] (-353.376) (-353.329) -- 0:00:30
      500000 -- (-349.859) (-351.282) [-349.022] (-349.720) * (-350.481) (-351.840) (-349.472) [-350.555] -- 0:00:30

      Average standard deviation of split frequencies: 0.010191

      500500 -- [-349.556] (-349.286) (-349.471) (-351.822) * (-354.413) (-348.423) [-351.113] (-351.295) -- 0:00:29
      501000 -- (-349.046) (-354.556) [-351.363] (-350.783) * (-354.697) [-349.179] (-349.645) (-350.306) -- 0:00:29
      501500 -- (-351.564) (-358.273) [-350.860] (-351.460) * [-352.671] (-350.063) (-348.926) (-351.430) -- 0:00:29
      502000 -- (-357.969) (-351.390) (-350.671) [-350.483] * (-351.395) (-349.069) (-355.106) [-351.874] -- 0:00:29
      502500 -- (-348.581) (-349.685) (-350.220) [-350.306] * (-349.074) (-354.894) [-353.478] (-349.424) -- 0:00:29
      503000 -- (-351.796) [-350.060] (-349.667) (-349.407) * [-350.516] (-350.315) (-350.296) (-349.488) -- 0:00:29
      503500 -- (-351.430) (-349.725) [-354.078] (-349.914) * [-351.740] (-350.740) (-351.819) (-354.169) -- 0:00:29
      504000 -- [-352.757] (-351.512) (-350.814) (-349.228) * (-351.693) (-350.122) (-350.542) [-348.612] -- 0:00:29
      504500 -- (-351.008) [-351.157] (-351.517) (-349.041) * (-348.682) (-349.926) [-349.794] (-353.833) -- 0:00:29
      505000 -- [-349.667] (-350.046) (-350.058) (-351.373) * (-349.057) [-350.604] (-351.356) (-352.797) -- 0:00:29

      Average standard deviation of split frequencies: 0.010193

      505500 -- (-350.468) [-350.797] (-349.773) (-354.663) * (-350.845) (-348.752) (-349.542) [-349.695] -- 0:00:29
      506000 -- [-348.380] (-354.561) (-349.453) (-349.331) * (-348.930) (-350.068) (-349.142) [-350.860] -- 0:00:29
      506500 -- [-350.449] (-348.265) (-349.661) (-349.555) * (-350.079) (-349.084) [-349.018] (-351.724) -- 0:00:29
      507000 -- (-350.074) (-349.356) [-350.622] (-350.200) * (-349.649) [-349.964] (-348.893) (-352.616) -- 0:00:29
      507500 -- [-348.001] (-349.623) (-348.572) (-351.256) * [-349.366] (-349.236) (-349.224) (-349.533) -- 0:00:29
      508000 -- [-349.596] (-349.370) (-349.267) (-350.572) * (-350.725) [-348.571] (-350.677) (-348.588) -- 0:00:29
      508500 -- (-350.619) [-352.827] (-347.972) (-348.990) * (-349.997) [-351.457] (-349.954) (-348.899) -- 0:00:28
      509000 -- [-351.386] (-349.353) (-350.368) (-349.431) * [-352.321] (-348.671) (-350.104) (-349.170) -- 0:00:28
      509500 -- (-350.131) (-351.040) [-350.966] (-351.003) * (-353.939) [-349.049] (-350.627) (-350.323) -- 0:00:28
      510000 -- (-349.089) (-351.549) [-351.607] (-349.421) * (-349.752) (-350.463) [-350.344] (-350.222) -- 0:00:28

      Average standard deviation of split frequencies: 0.010643

      510500 -- (-348.547) [-351.060] (-352.033) (-351.835) * (-353.304) (-351.094) (-350.790) [-348.450] -- 0:00:29
      511000 -- (-350.619) (-350.955) (-348.536) [-348.511] * [-349.220] (-356.607) (-349.786) (-349.473) -- 0:00:29
      511500 -- [-348.454] (-349.996) (-349.790) (-349.085) * [-348.158] (-353.726) (-350.886) (-354.462) -- 0:00:29
      512000 -- (-349.332) [-351.056] (-351.744) (-349.827) * (-349.724) (-354.408) (-350.349) [-349.543] -- 0:00:29
      512500 -- (-350.378) (-353.416) (-349.166) [-348.849] * (-348.888) (-348.870) (-348.653) [-350.797] -- 0:00:29
      513000 -- [-348.705] (-355.044) (-350.020) (-352.448) * (-355.534) [-348.121] (-348.963) (-351.597) -- 0:00:29
      513500 -- (-351.615) (-350.663) (-352.963) [-350.338] * (-349.120) (-349.588) (-349.668) [-352.001] -- 0:00:29
      514000 -- (-350.019) (-351.734) (-349.750) [-349.819] * [-353.402] (-353.331) (-350.792) (-351.618) -- 0:00:29
      514500 -- (-349.384) (-350.101) (-352.551) [-349.035] * (-353.090) (-349.809) (-349.429) [-349.542] -- 0:00:29
      515000 -- (-351.183) (-349.944) [-349.879] (-348.710) * (-349.238) (-352.235) (-350.496) [-348.730] -- 0:00:29

      Average standard deviation of split frequencies: 0.009727

      515500 -- (-350.270) (-352.488) [-349.692] (-352.495) * (-348.290) [-350.725] (-351.943) (-348.652) -- 0:00:29
      516000 -- (-352.479) (-350.554) [-350.493] (-350.931) * [-350.921] (-351.670) (-350.568) (-348.407) -- 0:00:29
      516500 -- [-349.901] (-349.177) (-349.887) (-353.094) * [-348.640] (-351.673) (-349.337) (-348.711) -- 0:00:29
      517000 -- [-349.731] (-348.021) (-350.948) (-350.953) * [-350.604] (-351.485) (-355.121) (-349.463) -- 0:00:28
      517500 -- (-350.569) (-349.620) [-351.731] (-350.971) * [-348.976] (-350.741) (-353.455) (-349.382) -- 0:00:28
      518000 -- [-348.937] (-349.943) (-351.946) (-349.963) * (-348.776) [-348.742] (-351.183) (-350.881) -- 0:00:28
      518500 -- (-348.997) [-349.272] (-350.496) (-348.465) * (-350.611) (-349.718) [-353.222] (-354.026) -- 0:00:28
      519000 -- (-352.324) [-348.276] (-350.414) (-349.774) * (-351.962) (-349.192) [-349.891] (-349.948) -- 0:00:28
      519500 -- (-349.147) (-350.063) [-350.971] (-351.446) * [-350.016] (-351.084) (-350.485) (-349.251) -- 0:00:28
      520000 -- [-348.637] (-351.252) (-349.746) (-353.074) * (-350.441) [-350.356] (-351.927) (-350.538) -- 0:00:28

      Average standard deviation of split frequencies: 0.010545

      520500 -- (-348.371) [-350.264] (-348.956) (-351.078) * [-350.536] (-353.416) (-352.199) (-351.303) -- 0:00:28
      521000 -- (-348.706) (-351.572) [-351.576] (-350.746) * (-348.817) (-349.188) [-349.814] (-350.856) -- 0:00:28
      521500 -- (-349.996) (-351.702) [-351.322] (-354.878) * [-348.034] (-351.184) (-349.894) (-348.469) -- 0:00:28
      522000 -- (-350.314) [-348.387] (-350.221) (-348.886) * (-350.374) (-350.313) [-348.708] (-351.960) -- 0:00:28
      522500 -- [-350.034] (-348.131) (-348.609) (-350.333) * (-350.809) (-350.430) (-350.614) [-349.318] -- 0:00:28
      523000 -- (-350.454) [-351.410] (-348.582) (-348.804) * (-348.199) (-350.802) (-351.155) [-349.037] -- 0:00:28
      523500 -- (-353.817) (-350.212) [-350.305] (-350.571) * (-351.342) (-349.105) [-348.861] (-352.236) -- 0:00:28
      524000 -- (-349.906) (-348.271) [-350.093] (-349.290) * (-350.890) [-349.143] (-348.803) (-349.551) -- 0:00:28
      524500 -- [-351.235] (-353.066) (-349.713) (-349.197) * (-350.920) (-351.152) (-350.258) [-348.820] -- 0:00:28
      525000 -- [-350.182] (-350.902) (-350.286) (-349.882) * (-355.043) [-349.790] (-352.446) (-349.525) -- 0:00:28

      Average standard deviation of split frequencies: 0.010438

      525500 -- (-350.336) [-348.606] (-351.001) (-350.562) * (-354.411) (-351.224) (-350.605) [-349.990] -- 0:00:27
      526000 -- [-350.895] (-349.431) (-353.173) (-348.212) * [-352.145] (-350.596) (-353.131) (-348.935) -- 0:00:27
      526500 -- (-355.933) (-349.012) [-353.522] (-348.520) * (-351.010) (-348.984) [-353.395] (-352.094) -- 0:00:27
      527000 -- (-350.271) [-352.047] (-354.932) (-356.349) * (-354.801) [-349.738] (-352.514) (-349.026) -- 0:00:27
      527500 -- (-349.085) (-350.674) [-349.604] (-352.032) * (-351.382) (-348.292) [-350.062] (-351.037) -- 0:00:28
      528000 -- (-353.394) (-351.133) [-349.242] (-348.425) * (-352.693) [-349.270] (-349.920) (-349.926) -- 0:00:28
      528500 -- (-348.127) [-349.246] (-356.545) (-350.281) * (-350.677) (-351.149) [-348.984] (-356.324) -- 0:00:28
      529000 -- (-349.181) (-352.326) [-349.318] (-349.565) * (-350.285) (-351.221) (-354.988) [-351.047] -- 0:00:28
      529500 -- [-350.887] (-356.142) (-352.708) (-349.063) * (-351.755) (-350.076) (-349.278) [-351.045] -- 0:00:28
      530000 -- [-349.396] (-351.370) (-348.873) (-349.790) * [-351.342] (-349.636) (-348.839) (-351.812) -- 0:00:28

      Average standard deviation of split frequencies: 0.010503

      530500 -- (-349.606) (-355.015) (-350.547) [-349.518] * [-348.508] (-354.997) (-350.644) (-348.755) -- 0:00:28
      531000 -- (-348.776) (-350.119) (-349.784) [-349.122] * (-348.627) [-350.138] (-351.586) (-350.296) -- 0:00:28
      531500 -- (-349.566) [-349.377] (-350.440) (-350.914) * (-350.119) (-350.773) (-353.366) [-349.705] -- 0:00:28
      532000 -- [-352.259] (-349.236) (-349.210) (-348.814) * [-349.549] (-358.029) (-349.570) (-352.187) -- 0:00:28
      532500 -- (-348.641) (-350.850) [-349.130] (-349.610) * (-351.325) [-347.882] (-349.025) (-353.409) -- 0:00:28
      533000 -- (-353.426) (-351.354) [-349.650] (-350.222) * (-350.796) (-352.569) (-355.435) [-351.983] -- 0:00:28
      533500 -- (-352.126) (-352.926) (-351.800) [-349.097] * (-350.278) (-354.141) [-349.423] (-351.346) -- 0:00:27
      534000 -- (-354.425) (-349.560) (-349.716) [-350.042] * (-348.123) [-350.009] (-349.857) (-350.158) -- 0:00:27
      534500 -- (-352.140) (-349.364) [-349.099] (-349.106) * (-348.434) (-351.506) (-348.711) [-349.363] -- 0:00:27
      535000 -- (-350.856) (-350.003) [-349.589] (-350.310) * (-350.910) (-350.689) [-350.670] (-350.546) -- 0:00:27

      Average standard deviation of split frequencies: 0.010192

      535500 -- (-348.916) (-353.296) (-350.341) [-349.714] * (-349.788) [-348.570] (-353.705) (-349.890) -- 0:00:27
      536000 -- [-351.138] (-349.391) (-350.287) (-351.020) * (-349.813) (-351.781) (-351.153) [-348.404] -- 0:00:27
      536500 -- (-349.509) [-353.501] (-349.199) (-350.707) * [-351.180] (-349.912) (-352.131) (-351.723) -- 0:00:27
      537000 -- (-349.154) (-353.645) (-352.171) [-348.965] * (-349.650) (-350.480) [-350.755] (-350.112) -- 0:00:27
      537500 -- (-350.054) (-354.317) [-356.326] (-353.694) * [-349.472] (-349.169) (-352.120) (-348.085) -- 0:00:27
      538000 -- (-348.061) (-349.897) [-349.216] (-350.033) * (-351.669) (-349.279) [-350.455] (-348.610) -- 0:00:27
      538500 -- (-352.817) [-349.176] (-353.838) (-351.521) * (-350.490) [-348.527] (-349.136) (-348.928) -- 0:00:27
      539000 -- (-352.215) (-348.655) [-348.429] (-351.108) * (-350.274) (-349.718) (-352.288) [-350.751] -- 0:00:27
      539500 -- [-349.995] (-347.940) (-348.871) (-352.450) * [-349.922] (-350.956) (-350.028) (-349.284) -- 0:00:27
      540000 -- [-349.967] (-348.989) (-351.547) (-349.785) * (-349.856) (-352.289) (-350.170) [-349.260] -- 0:00:27

      Average standard deviation of split frequencies: 0.009918

      540500 -- (-348.805) [-350.535] (-353.256) (-350.008) * (-350.883) (-351.858) [-349.042] (-349.990) -- 0:00:27
      541000 -- [-352.384] (-353.545) (-349.128) (-350.217) * (-351.046) [-349.742] (-348.512) (-352.445) -- 0:00:27
      541500 -- (-355.838) [-351.161] (-348.972) (-350.505) * (-352.201) (-351.700) (-349.430) [-349.166] -- 0:00:27
      542000 -- (-350.470) (-349.337) [-349.529] (-348.137) * (-349.161) [-348.786] (-348.745) (-353.503) -- 0:00:27
      542500 -- (-349.052) (-350.383) (-349.115) [-350.899] * [-351.820] (-350.101) (-348.101) (-349.518) -- 0:00:26
      543000 -- [-350.953] (-350.369) (-351.029) (-354.975) * (-350.166) (-351.297) [-352.773] (-352.224) -- 0:00:26
      543500 -- (-349.726) (-350.472) [-348.682] (-354.906) * (-351.750) (-352.898) [-349.569] (-349.558) -- 0:00:26
      544000 -- (-351.108) (-349.242) [-352.634] (-352.666) * [-348.468] (-350.767) (-350.550) (-351.121) -- 0:00:26
      544500 -- (-351.689) (-349.495) [-348.282] (-352.221) * [-351.801] (-349.912) (-351.120) (-353.144) -- 0:00:27
      545000 -- (-350.175) (-349.446) [-348.979] (-352.173) * (-350.022) (-351.218) [-349.609] (-352.751) -- 0:00:27

      Average standard deviation of split frequencies: 0.010056

      545500 -- [-350.486] (-348.281) (-349.177) (-354.688) * (-349.876) (-351.480) (-351.143) [-349.100] -- 0:00:27
      546000 -- (-349.243) (-351.927) (-352.270) [-354.360] * (-352.677) (-351.070) (-349.732) [-353.494] -- 0:00:27
      546500 -- [-348.661] (-352.695) (-348.504) (-353.687) * (-350.645) (-350.559) (-349.004) [-350.938] -- 0:00:27
      547000 -- (-353.347) (-350.728) (-348.256) [-351.018] * (-351.590) [-349.810] (-351.317) (-350.902) -- 0:00:27
      547500 -- (-348.347) (-352.489) (-352.586) [-352.702] * (-349.520) (-351.455) [-349.420] (-353.052) -- 0:00:27
      548000 -- (-349.722) (-354.086) [-347.888] (-351.676) * (-349.152) [-352.559] (-351.234) (-349.833) -- 0:00:27
      548500 -- (-348.795) (-350.338) (-347.861) [-349.336] * (-350.161) (-351.067) (-352.263) [-348.783] -- 0:00:27
      549000 -- [-350.750] (-350.118) (-352.030) (-350.576) * (-349.504) (-350.174) [-350.965] (-349.840) -- 0:00:27
      549500 -- [-348.482] (-349.668) (-349.215) (-352.542) * (-349.676) [-352.051] (-348.677) (-349.789) -- 0:00:27
      550000 -- (-348.317) (-351.813) [-349.129] (-355.863) * (-357.031) (-350.904) [-351.187] (-349.597) -- 0:00:27

      Average standard deviation of split frequencies: 0.009203

      550500 -- (-352.127) [-349.222] (-349.425) (-350.233) * (-353.436) [-350.976] (-351.439) (-349.499) -- 0:00:26
      551000 -- (-349.771) (-350.011) [-348.376] (-351.789) * (-348.944) [-351.955] (-349.758) (-352.505) -- 0:00:26
      551500 -- (-349.886) [-350.035] (-349.468) (-349.771) * (-351.119) [-349.038] (-351.503) (-348.850) -- 0:00:26
      552000 -- (-350.378) (-353.101) (-351.252) [-349.920] * (-351.600) [-350.052] (-349.896) (-349.531) -- 0:00:26
      552500 -- (-348.864) (-349.085) (-352.688) [-352.496] * (-349.123) [-349.271] (-348.856) (-353.248) -- 0:00:26
      553000 -- [-350.253] (-348.865) (-351.793) (-349.241) * (-348.508) (-353.297) [-348.842] (-350.767) -- 0:00:26
      553500 -- (-351.421) [-355.302] (-350.731) (-351.792) * (-350.488) [-352.524] (-350.908) (-350.999) -- 0:00:26
      554000 -- (-348.949) (-350.519) [-349.939] (-351.215) * [-351.764] (-349.273) (-350.100) (-349.273) -- 0:00:26
      554500 -- [-349.901] (-351.637) (-350.604) (-348.193) * (-352.284) [-351.092] (-351.340) (-348.700) -- 0:00:26
      555000 -- [-349.524] (-349.419) (-348.486) (-350.029) * (-350.295) [-350.725] (-351.256) (-349.139) -- 0:00:26

      Average standard deviation of split frequencies: 0.008955

      555500 -- (-351.593) (-349.075) [-354.888] (-349.522) * (-350.560) (-348.968) (-354.129) [-351.181] -- 0:00:26
      556000 -- (-350.480) (-348.947) [-356.284] (-350.419) * (-350.571) (-349.125) (-356.051) [-348.999] -- 0:00:26
      556500 -- (-351.396) (-349.206) [-351.734] (-351.115) * [-350.020] (-349.024) (-350.926) (-350.490) -- 0:00:26
      557000 -- [-351.690] (-352.408) (-351.735) (-351.020) * (-349.522) (-348.962) [-349.557] (-350.828) -- 0:00:26
      557500 -- (-349.799) (-350.613) (-349.702) [-349.942] * [-350.840] (-352.340) (-357.008) (-352.713) -- 0:00:26
      558000 -- (-349.338) (-350.009) (-349.845) [-349.134] * (-350.886) (-349.249) (-359.105) [-350.496] -- 0:00:26
      558500 -- (-350.470) (-348.902) (-353.550) [-348.910] * (-349.412) (-350.200) (-354.373) [-348.320] -- 0:00:26
      559000 -- [-349.330] (-350.723) (-353.059) (-349.794) * (-351.434) (-351.194) (-354.034) [-350.476] -- 0:00:26
      559500 -- [-356.182] (-354.595) (-351.278) (-349.603) * (-352.487) (-355.727) (-351.490) [-348.472] -- 0:00:25
      560000 -- (-352.341) [-349.374] (-348.619) (-348.620) * [-350.226] (-351.527) (-349.723) (-353.384) -- 0:00:25

      Average standard deviation of split frequencies: 0.008303

      560500 -- (-350.107) (-350.055) (-349.776) [-349.222] * (-351.934) (-352.144) [-351.528] (-349.726) -- 0:00:25
      561000 -- (-348.989) [-348.872] (-350.339) (-349.864) * [-351.576] (-351.572) (-350.366) (-349.973) -- 0:00:25
      561500 -- [-349.119] (-348.898) (-348.438) (-351.293) * (-350.145) [-352.802] (-351.980) (-348.974) -- 0:00:26
      562000 -- [-353.577] (-349.652) (-350.313) (-355.728) * (-350.257) (-356.878) [-353.353] (-349.618) -- 0:00:26
      562500 -- (-350.621) (-350.164) [-350.582] (-350.577) * [-352.449] (-350.210) (-351.536) (-350.157) -- 0:00:26
      563000 -- (-349.811) (-350.847) (-352.007) [-353.882] * (-348.859) [-348.902] (-349.920) (-350.106) -- 0:00:26
      563500 -- (-355.323) [-352.793] (-351.610) (-352.820) * (-351.268) (-350.136) (-354.564) [-350.087] -- 0:00:26
      564000 -- [-349.112] (-354.251) (-348.858) (-350.141) * (-351.347) (-350.136) (-350.367) [-349.599] -- 0:00:26
      564500 -- (-351.835) [-349.618] (-349.324) (-349.150) * (-349.258) (-349.962) [-348.989] (-349.675) -- 0:00:26
      565000 -- (-350.239) (-352.033) [-352.412] (-350.813) * (-348.887) (-354.566) (-353.264) [-351.642] -- 0:00:26

      Average standard deviation of split frequencies: 0.007704

      565500 -- (-348.915) (-351.401) [-348.720] (-351.281) * (-349.775) (-351.131) [-348.134] (-351.980) -- 0:00:26
      566000 -- (-348.204) (-348.834) [-348.592] (-348.239) * (-348.849) (-350.300) [-349.504] (-349.884) -- 0:00:26
      566500 -- (-349.188) (-350.131) [-349.013] (-350.990) * (-350.539) (-349.961) (-347.968) [-351.823] -- 0:00:26
      567000 -- (-349.349) (-349.855) [-351.115] (-350.013) * [-349.273] (-349.647) (-348.026) (-349.282) -- 0:00:25
      567500 -- (-352.359) [-350.339] (-353.282) (-353.759) * (-350.699) (-349.712) [-349.798] (-348.463) -- 0:00:25
      568000 -- (-350.101) (-349.085) (-349.937) [-348.859] * (-349.978) (-348.801) (-353.512) [-349.880] -- 0:00:25
      568500 -- (-349.349) (-348.648) [-350.436] (-350.014) * [-352.542] (-354.949) (-350.117) (-352.574) -- 0:00:25
      569000 -- (-349.563) (-348.758) (-350.739) [-351.773] * [-349.232] (-353.562) (-350.017) (-351.338) -- 0:00:25
      569500 -- [-349.069] (-349.790) (-348.275) (-352.327) * [-349.182] (-351.151) (-350.047) (-350.158) -- 0:00:25
      570000 -- [-351.278] (-349.323) (-349.921) (-352.571) * (-349.183) (-351.735) (-350.275) [-349.007] -- 0:00:25

      Average standard deviation of split frequencies: 0.008002

      570500 -- (-354.002) (-350.065) (-348.699) [-348.311] * (-351.019) (-350.928) (-351.024) [-349.753] -- 0:00:25
      571000 -- (-353.913) (-351.247) [-348.546] (-350.609) * (-349.687) [-348.575] (-349.589) (-350.411) -- 0:00:25
      571500 -- (-349.813) (-348.407) [-348.535] (-353.929) * (-350.544) (-349.483) (-350.494) [-348.862] -- 0:00:25
      572000 -- [-348.133] (-349.288) (-353.400) (-348.519) * (-354.264) [-349.195] (-350.308) (-348.632) -- 0:00:25
      572500 -- (-349.731) [-351.834] (-350.170) (-352.143) * (-352.447) (-350.735) [-350.009] (-349.320) -- 0:00:25
      573000 -- [-348.804] (-349.000) (-348.985) (-353.842) * (-352.334) [-350.651] (-351.002) (-349.766) -- 0:00:25
      573500 -- (-348.670) (-358.810) (-348.818) [-350.540] * (-353.767) [-347.968] (-349.867) (-349.413) -- 0:00:25
      574000 -- (-350.889) (-352.280) (-348.192) [-351.717] * (-352.860) (-349.594) (-351.267) [-349.208] -- 0:00:25
      574500 -- (-354.131) (-352.550) (-348.437) [-350.347] * [-352.346] (-350.756) (-353.816) (-349.331) -- 0:00:25
      575000 -- (-352.327) (-350.384) (-348.752) [-348.691] * (-351.190) (-348.429) (-353.025) [-351.015] -- 0:00:25

      Average standard deviation of split frequencies: 0.008644

      575500 -- [-349.884] (-355.059) (-351.354) (-350.173) * (-349.614) (-354.914) [-351.171] (-348.972) -- 0:00:25
      576000 -- (-349.911) (-352.006) (-348.370) [-349.040] * [-351.594] (-349.980) (-350.447) (-349.521) -- 0:00:25
      576500 -- (-349.337) (-349.864) (-349.564) [-349.731] * (-348.498) (-349.029) (-350.562) [-351.573] -- 0:00:24
      577000 -- [-349.041] (-351.152) (-350.664) (-349.725) * (-348.974) (-350.129) [-348.189] (-348.805) -- 0:00:24
      577500 -- (-353.054) (-351.188) (-349.018) [-348.701] * [-350.090] (-350.817) (-350.032) (-352.511) -- 0:00:24
      578000 -- (-349.686) [-349.142] (-350.488) (-349.504) * (-352.973) [-350.065] (-348.955) (-351.289) -- 0:00:24
      578500 -- (-350.699) (-348.135) (-350.367) [-352.923] * (-349.348) [-353.031] (-348.764) (-349.678) -- 0:00:24
      579000 -- (-348.769) (-351.016) (-350.965) [-351.614] * (-350.166) (-351.453) [-349.016] (-348.719) -- 0:00:25
      579500 -- (-348.165) (-349.605) [-349.191] (-353.195) * (-350.148) (-350.860) (-348.964) [-350.850] -- 0:00:25
      580000 -- (-349.247) (-351.244) (-349.196) [-352.304] * (-353.215) [-350.573] (-348.488) (-350.367) -- 0:00:25

      Average standard deviation of split frequencies: 0.009503

      580500 -- (-349.300) [-353.580] (-349.885) (-350.155) * (-348.733) (-351.446) (-352.490) [-351.286] -- 0:00:25
      581000 -- (-351.513) [-349.048] (-349.749) (-350.059) * (-349.395) (-351.514) [-349.672] (-351.054) -- 0:00:25
      581500 -- [-352.369] (-351.720) (-348.615) (-348.675) * (-348.830) (-352.715) [-352.098] (-349.807) -- 0:00:25
      582000 -- (-351.561) [-351.194] (-350.481) (-350.171) * (-348.910) (-353.540) [-350.624] (-349.471) -- 0:00:25
      582500 -- (-352.318) (-349.671) (-350.578) [-349.985] * (-348.835) (-351.469) [-351.871] (-349.333) -- 0:00:25
      583000 -- (-354.664) (-349.440) [-353.951] (-350.019) * [-349.519] (-351.019) (-350.543) (-349.731) -- 0:00:25
      583500 -- (-352.612) (-349.469) [-349.808] (-349.712) * [-349.768] (-352.361) (-348.706) (-348.932) -- 0:00:24
      584000 -- [-352.080] (-349.784) (-350.354) (-351.280) * (-349.292) [-352.861] (-348.971) (-348.567) -- 0:00:24
      584500 -- (-351.559) (-349.291) [-351.160] (-350.177) * (-350.744) (-350.100) (-348.979) [-350.488] -- 0:00:24
      585000 -- (-348.974) [-348.784] (-351.530) (-349.744) * (-351.819) [-350.471] (-348.979) (-354.041) -- 0:00:24

      Average standard deviation of split frequencies: 0.009464

      585500 -- (-348.117) [-352.260] (-350.614) (-348.899) * (-348.846) (-349.679) (-349.038) [-348.895] -- 0:00:24
      586000 -- (-351.001) [-353.400] (-351.172) (-350.672) * (-350.667) (-350.766) [-351.148] (-350.741) -- 0:00:24
      586500 -- (-350.891) (-351.117) (-350.874) [-350.195] * [-349.237] (-349.738) (-350.568) (-350.486) -- 0:00:24
      587000 -- (-350.093) [-349.802] (-350.481) (-351.907) * (-352.731) (-351.244) (-350.573) [-350.978] -- 0:00:24
      587500 -- (-349.896) (-349.405) (-353.092) [-351.051] * (-348.868) (-350.764) [-350.154] (-350.491) -- 0:00:24
      588000 -- (-349.452) (-352.700) (-349.583) [-349.155] * [-348.920] (-350.996) (-348.466) (-351.419) -- 0:00:24
      588500 -- (-350.217) (-354.593) [-352.057] (-349.804) * (-349.915) [-351.138] (-350.785) (-351.469) -- 0:00:24
      589000 -- (-348.637) [-348.378] (-353.860) (-353.893) * (-350.953) (-349.977) (-352.643) [-349.572] -- 0:00:24
      589500 -- (-349.727) (-349.059) [-350.014] (-350.623) * [-349.716] (-348.981) (-351.097) (-350.254) -- 0:00:24
      590000 -- [-349.690] (-349.125) (-349.765) (-350.866) * [-349.683] (-348.546) (-352.305) (-350.874) -- 0:00:24

      Average standard deviation of split frequencies: 0.009342

      590500 -- (-353.930) [-348.818] (-353.292) (-356.890) * [-352.022] (-349.900) (-350.174) (-350.399) -- 0:00:24
      591000 -- (-351.817) (-350.478) (-350.522) [-352.094] * [-348.137] (-350.866) (-354.164) (-353.759) -- 0:00:24
      591500 -- (-357.061) [-350.743] (-350.015) (-349.852) * [-350.498] (-351.213) (-355.786) (-354.491) -- 0:00:24
      592000 -- [-355.337] (-348.838) (-349.965) (-348.628) * [-350.115] (-351.485) (-350.687) (-348.873) -- 0:00:24
      592500 -- (-351.923) [-349.044] (-350.306) (-348.503) * (-351.982) (-352.781) (-348.592) [-349.231] -- 0:00:24
      593000 -- (-352.711) [-350.542] (-354.002) (-348.805) * (-348.900) [-350.650] (-351.686) (-349.090) -- 0:00:24
      593500 -- (-348.155) [-350.879] (-350.940) (-351.316) * [-348.946] (-349.860) (-353.410) (-351.282) -- 0:00:23
      594000 -- [-352.341] (-353.567) (-351.737) (-356.922) * (-350.908) (-350.135) [-349.258] (-352.736) -- 0:00:23
      594500 -- (-352.421) (-348.326) (-351.432) [-350.310] * (-348.612) [-350.948] (-355.999) (-349.689) -- 0:00:23
      595000 -- (-351.758) (-350.387) (-352.818) [-350.476] * (-350.338) (-349.371) [-351.661] (-350.791) -- 0:00:23

      Average standard deviation of split frequencies: 0.008651

      595500 -- [-348.679] (-349.867) (-349.450) (-349.052) * (-349.508) (-351.075) [-348.429] (-351.348) -- 0:00:23
      596000 -- [-349.873] (-353.664) (-349.849) (-349.444) * (-348.898) (-351.205) [-350.750] (-349.499) -- 0:00:24
      596500 -- [-349.715] (-354.483) (-349.482) (-350.232) * (-348.332) [-348.887] (-350.611) (-352.506) -- 0:00:24
      597000 -- (-349.081) [-355.027] (-350.034) (-349.881) * [-350.379] (-354.268) (-348.418) (-348.520) -- 0:00:24
      597500 -- [-348.870] (-351.443) (-349.752) (-353.368) * [-348.204] (-350.148) (-350.001) (-350.774) -- 0:00:24
      598000 -- (-348.774) (-350.832) (-352.970) [-349.955] * [-348.089] (-350.093) (-349.997) (-348.788) -- 0:00:24
      598500 -- (-351.689) [-348.170] (-352.507) (-349.536) * (-349.235) (-351.004) [-351.240] (-350.856) -- 0:00:24
      599000 -- (-348.976) [-352.213] (-349.647) (-349.359) * [-349.034] (-351.924) (-350.351) (-348.811) -- 0:00:24
      599500 -- (-350.019) [-349.261] (-348.324) (-351.582) * (-348.641) [-349.513] (-349.058) (-348.806) -- 0:00:24
      600000 -- (-350.363) (-349.601) (-350.216) [-350.742] * (-349.951) (-349.068) [-349.460] (-348.191) -- 0:00:24

      Average standard deviation of split frequencies: 0.008240

      600500 -- (-348.593) (-351.632) [-352.884] (-350.608) * (-351.570) (-350.199) [-349.629] (-354.367) -- 0:00:23
      601000 -- (-350.320) (-350.880) (-351.483) [-348.241] * [-348.679] (-348.595) (-356.638) (-350.233) -- 0:00:23
      601500 -- (-348.535) (-351.664) [-349.639] (-348.783) * (-348.354) [-350.350] (-360.219) (-354.771) -- 0:00:23
      602000 -- (-349.250) (-349.596) [-351.412] (-349.377) * [-348.880] (-351.738) (-350.872) (-354.255) -- 0:00:23
      602500 -- (-348.807) (-351.535) (-350.112) [-350.691] * [-349.727] (-351.374) (-349.135) (-351.866) -- 0:00:23
      603000 -- (-347.924) (-348.033) [-349.419] (-350.691) * [-349.910] (-350.509) (-352.350) (-349.945) -- 0:00:23
      603500 -- (-348.640) (-350.725) [-349.274] (-349.936) * (-350.083) [-348.474] (-348.833) (-348.693) -- 0:00:23
      604000 -- (-353.235) (-349.035) [-349.559] (-350.940) * (-348.607) (-349.436) (-350.102) [-350.913] -- 0:00:23
      604500 -- (-349.516) (-351.029) (-348.972) [-350.891] * (-348.498) (-350.186) [-349.862] (-351.084) -- 0:00:23
      605000 -- (-349.428) (-352.199) (-350.266) [-348.500] * (-349.942) (-349.812) (-352.223) [-348.751] -- 0:00:23

      Average standard deviation of split frequencies: 0.009197

      605500 -- [-350.450] (-352.938) (-352.334) (-349.766) * (-350.070) (-351.681) (-356.701) [-349.188] -- 0:00:23
      606000 -- (-350.667) (-349.097) [-349.835] (-349.682) * (-350.190) (-349.635) (-350.276) [-349.089] -- 0:00:23
      606500 -- (-348.849) (-354.285) (-350.115) [-349.754] * [-350.028] (-349.252) (-353.568) (-348.353) -- 0:00:23
      607000 -- [-349.442] (-349.300) (-349.823) (-348.399) * (-349.183) (-348.864) [-348.658] (-348.800) -- 0:00:23
      607500 -- (-351.611) [-349.921] (-351.592) (-352.364) * (-353.228) (-355.486) (-351.323) [-349.642] -- 0:00:23
      608000 -- [-349.235] (-350.496) (-348.284) (-349.632) * (-349.759) (-351.568) (-350.433) [-349.095] -- 0:00:23
      608500 -- (-349.346) [-349.574] (-348.728) (-348.133) * (-349.329) (-353.453) (-348.118) [-349.468] -- 0:00:23
      609000 -- (-353.561) (-348.604) (-348.398) [-349.403] * (-350.473) (-350.725) (-349.779) [-349.518] -- 0:00:23
      609500 -- (-348.735) (-350.345) [-349.097] (-354.468) * [-351.717] (-356.081) (-353.849) (-352.437) -- 0:00:23
      610000 -- (-349.650) (-349.780) [-348.927] (-352.742) * (-356.255) [-351.421] (-350.544) (-354.985) -- 0:00:23

      Average standard deviation of split frequencies: 0.008719

      610500 -- [-348.922] (-352.730) (-349.318) (-348.504) * (-349.968) (-349.087) (-349.195) [-349.947] -- 0:00:22
      611000 -- [-348.780] (-349.772) (-349.891) (-348.976) * (-352.030) (-352.637) (-348.089) [-353.276] -- 0:00:22
      611500 -- (-348.904) (-352.862) [-349.018] (-350.545) * (-350.927) (-352.466) [-353.484] (-350.032) -- 0:00:22
      612000 -- (-349.367) (-351.956) [-349.586] (-349.836) * (-352.543) (-350.035) (-352.132) [-350.873] -- 0:00:22
      612500 -- (-351.194) (-350.298) [-349.497] (-349.597) * (-352.720) (-350.042) (-354.151) [-352.302] -- 0:00:22
      613000 -- (-349.967) (-349.495) [-350.408] (-348.616) * [-350.601] (-350.105) (-356.524) (-351.999) -- 0:00:22
      613500 -- (-352.770) (-348.793) [-348.460] (-350.439) * [-350.249] (-348.034) (-356.086) (-353.957) -- 0:00:23
      614000 -- (-354.000) (-350.404) (-351.865) [-350.764] * (-354.027) [-349.507] (-348.262) (-348.973) -- 0:00:23
      614500 -- (-350.750) [-349.688] (-348.646) (-348.811) * (-349.525) (-348.903) (-348.720) [-349.218] -- 0:00:23
      615000 -- (-351.131) (-352.827) (-348.785) [-349.499] * (-354.911) (-349.846) (-350.014) [-350.504] -- 0:00:23

      Average standard deviation of split frequencies: 0.008823

      615500 -- (-350.894) [-350.069] (-350.690) (-348.444) * [-349.439] (-351.877) (-352.671) (-352.585) -- 0:00:23
      616000 -- [-350.066] (-351.833) (-350.515) (-349.593) * [-348.294] (-351.502) (-349.141) (-350.795) -- 0:00:23
      616500 -- (-349.108) [-349.793] (-349.049) (-350.431) * (-348.388) (-351.169) (-353.273) [-349.744] -- 0:00:23
      617000 -- (-352.094) (-354.443) [-349.195] (-357.828) * [-349.128] (-350.526) (-351.074) (-350.821) -- 0:00:22
      617500 -- (-349.535) [-351.809] (-350.784) (-349.868) * (-352.418) [-350.085] (-350.484) (-349.199) -- 0:00:22
      618000 -- (-348.454) [-349.137] (-351.595) (-350.497) * (-351.128) (-358.805) (-348.821) [-349.429] -- 0:00:22
      618500 -- [-349.464] (-349.085) (-350.755) (-349.280) * (-348.314) (-350.692) (-350.011) [-348.256] -- 0:00:22
      619000 -- (-349.287) (-349.512) (-349.142) [-349.900] * (-348.866) [-353.227] (-352.149) (-350.493) -- 0:00:22
      619500 -- (-350.854) (-350.896) [-348.007] (-349.893) * [-352.241] (-349.446) (-351.845) (-348.730) -- 0:00:22
      620000 -- (-350.685) [-349.535] (-351.047) (-351.250) * [-350.344] (-352.450) (-350.427) (-348.306) -- 0:00:22

      Average standard deviation of split frequencies: 0.008980

      620500 -- (-350.609) (-348.754) [-348.706] (-352.195) * [-349.257] (-353.494) (-353.153) (-350.270) -- 0:00:22
      621000 -- (-348.668) [-349.131] (-352.665) (-351.746) * (-351.668) [-350.788] (-351.780) (-351.854) -- 0:00:22
      621500 -- (-351.269) (-349.173) (-350.837) [-351.473] * (-351.214) [-348.680] (-351.281) (-351.160) -- 0:00:22
      622000 -- (-349.603) (-349.293) [-349.802] (-351.952) * (-350.347) (-354.961) (-350.391) [-348.681] -- 0:00:22
      622500 -- [-350.174] (-350.620) (-354.974) (-349.797) * (-350.704) [-348.021] (-348.777) (-349.418) -- 0:00:22
      623000 -- (-354.841) (-351.367) (-349.669) [-353.231] * [-349.430] (-350.357) (-353.627) (-352.889) -- 0:00:22
      623500 -- (-353.041) (-351.627) [-348.982] (-353.073) * [-349.322] (-352.101) (-350.156) (-349.779) -- 0:00:22
      624000 -- [-350.280] (-350.331) (-348.942) (-349.386) * (-351.615) [-349.053] (-351.016) (-350.907) -- 0:00:22
      624500 -- (-351.993) (-348.189) [-349.514] (-348.944) * (-351.799) (-351.070) (-351.230) [-348.988] -- 0:00:22
      625000 -- (-349.137) (-351.321) (-348.688) [-350.023] * [-351.538] (-350.305) (-350.638) (-356.211) -- 0:00:22

      Average standard deviation of split frequencies: 0.008505

      625500 -- (-351.078) (-350.887) [-350.354] (-351.160) * (-351.141) [-353.974] (-353.023) (-348.581) -- 0:00:22
      626000 -- [-349.813] (-349.970) (-349.836) (-352.369) * (-351.784) (-349.167) [-351.742] (-349.430) -- 0:00:22
      626500 -- (-349.038) (-348.867) (-348.715) [-348.219] * (-350.118) (-352.975) (-349.122) [-350.422] -- 0:00:22
      627000 -- (-350.839) (-349.862) [-349.115] (-350.082) * (-350.261) (-348.880) (-350.621) [-350.401] -- 0:00:22
      627500 -- [-351.389] (-349.967) (-350.974) (-349.367) * [-348.729] (-348.760) (-348.829) (-350.474) -- 0:00:21
      628000 -- (-349.266) (-351.097) (-348.897) [-350.230] * (-348.575) (-354.654) (-352.530) [-349.968] -- 0:00:21
      628500 -- [-349.217] (-350.075) (-348.488) (-351.579) * (-350.194) (-349.922) (-350.200) [-350.058] -- 0:00:21
      629000 -- (-349.963) (-349.987) (-352.474) [-351.331] * (-350.268) (-348.955) [-350.628] (-349.470) -- 0:00:21
      629500 -- (-350.414) [-349.641] (-352.682) (-349.424) * [-352.745] (-351.649) (-349.142) (-349.119) -- 0:00:21
      630000 -- (-349.340) (-351.918) [-350.843] (-350.047) * (-349.904) [-348.813] (-352.086) (-350.304) -- 0:00:21

      Average standard deviation of split frequencies: 0.008310

      630500 -- [-348.428] (-350.411) (-350.060) (-350.602) * (-349.185) [-348.952] (-354.275) (-349.172) -- 0:00:22
      631000 -- (-350.840) [-352.069] (-350.641) (-349.588) * [-351.748] (-354.580) (-349.820) (-351.797) -- 0:00:22
      631500 -- (-351.909) (-352.084) (-352.088) [-348.421] * (-350.830) (-348.654) (-349.503) [-352.881] -- 0:00:22
      632000 -- (-348.920) (-355.223) (-353.247) [-350.542] * (-351.841) [-353.362] (-353.537) (-350.832) -- 0:00:22
      632500 -- (-351.479) (-351.079) [-351.846] (-349.856) * [-350.308] (-350.350) (-350.153) (-349.062) -- 0:00:22
      633000 -- (-351.528) (-351.845) [-349.293] (-352.288) * [-350.126] (-349.132) (-352.307) (-350.542) -- 0:00:22
      633500 -- (-350.825) (-354.494) (-349.087) [-349.034] * (-351.807) [-350.876] (-350.871) (-348.376) -- 0:00:21
      634000 -- [-348.828] (-351.834) (-349.174) (-349.339) * (-349.374) [-352.896] (-352.438) (-350.019) -- 0:00:21
      634500 -- [-350.504] (-352.956) (-351.928) (-349.409) * (-350.094) [-354.928] (-349.475) (-350.638) -- 0:00:21
      635000 -- (-348.015) (-350.539) (-350.343) [-348.886] * (-351.395) (-351.018) (-350.916) [-349.889] -- 0:00:21

      Average standard deviation of split frequencies: 0.007935

      635500 -- (-349.446) (-354.188) [-348.695] (-349.647) * (-349.763) (-349.899) (-353.771) [-348.259] -- 0:00:21
      636000 -- (-349.429) (-354.760) [-352.172] (-350.221) * [-350.508] (-352.246) (-349.301) (-349.395) -- 0:00:21
      636500 -- (-348.885) (-351.120) (-350.998) [-349.439] * (-350.423) (-352.439) [-349.789] (-350.996) -- 0:00:21
      637000 -- (-352.750) (-348.895) [-351.314] (-349.155) * (-352.074) (-356.333) [-349.103] (-349.393) -- 0:00:21
      637500 -- (-349.732) [-352.510] (-348.671) (-350.164) * [-350.559] (-351.013) (-348.910) (-354.236) -- 0:00:21
      638000 -- (-351.241) (-351.564) (-348.431) [-350.784] * (-349.701) (-352.184) (-356.292) [-354.448] -- 0:00:21
      638500 -- (-351.741) (-353.568) (-349.804) [-353.950] * (-351.241) (-351.367) (-350.249) [-349.563] -- 0:00:21
      639000 -- (-350.626) (-353.952) [-349.860] (-350.076) * (-349.818) (-350.043) (-348.459) [-349.978] -- 0:00:21
      639500 -- (-351.340) (-352.034) (-352.235) [-351.770] * (-349.085) (-348.970) [-348.869] (-349.781) -- 0:00:21
      640000 -- [-349.940] (-351.325) (-354.661) (-351.900) * [-350.084] (-348.154) (-349.734) (-349.569) -- 0:00:21

      Average standard deviation of split frequencies: 0.007877

      640500 -- (-352.953) [-350.544] (-351.663) (-349.286) * (-348.819) [-352.208] (-354.756) (-349.692) -- 0:00:21
      641000 -- (-351.340) (-349.598) (-351.030) [-349.035] * [-347.976] (-348.784) (-351.924) (-350.826) -- 0:00:21
      641500 -- (-352.104) [-349.401] (-354.498) (-348.846) * (-349.801) [-348.271] (-349.662) (-353.254) -- 0:00:21
      642000 -- (-354.278) (-350.466) [-348.294] (-348.925) * (-352.739) (-348.346) (-351.101) [-350.113] -- 0:00:21
      642500 -- (-353.660) (-352.329) (-350.065) [-348.826] * [-349.200] (-350.264) (-351.722) (-349.017) -- 0:00:21
      643000 -- (-351.675) (-351.447) [-347.884] (-355.654) * (-350.919) [-348.896] (-353.377) (-349.304) -- 0:00:21
      643500 -- (-353.194) (-349.451) (-351.738) [-349.712] * (-353.604) [-348.451] (-351.381) (-351.189) -- 0:00:21
      644000 -- [-351.359] (-355.590) (-350.749) (-351.439) * (-348.717) (-357.800) [-349.530] (-350.721) -- 0:00:21
      644500 -- (-350.075) [-352.176] (-353.732) (-349.563) * (-348.614) (-351.265) [-351.072] (-353.845) -- 0:00:20
      645000 -- (-349.668) (-348.384) [-355.461] (-350.007) * [-348.589] (-350.047) (-351.688) (-350.778) -- 0:00:20

      Average standard deviation of split frequencies: 0.007727

      645500 -- (-350.782) (-350.879) (-352.116) [-350.095] * (-348.605) (-348.989) [-349.619] (-352.408) -- 0:00:20
      646000 -- (-348.807) [-349.199] (-351.227) (-349.453) * (-349.091) [-351.000] (-349.907) (-353.425) -- 0:00:20
      646500 -- [-351.450] (-351.941) (-350.643) (-350.116) * (-351.460) (-351.506) [-350.263] (-351.371) -- 0:00:20
      647000 -- (-349.461) (-348.593) [-348.831] (-349.518) * [-349.018] (-350.531) (-350.321) (-349.059) -- 0:00:20
      647500 -- [-349.661] (-348.990) (-351.833) (-351.883) * (-353.462) (-352.242) [-349.693] (-348.567) -- 0:00:20
      648000 -- (-351.676) [-350.430] (-354.717) (-356.715) * (-350.535) [-350.438] (-350.826) (-349.887) -- 0:00:21
      648500 -- (-349.087) (-350.021) [-350.392] (-356.668) * [-351.841] (-350.056) (-349.857) (-349.104) -- 0:00:21
      649000 -- [-349.336] (-350.475) (-348.604) (-348.483) * [-352.562] (-351.059) (-349.868) (-349.142) -- 0:00:21
      649500 -- (-353.186) (-348.511) [-348.431] (-350.850) * (-352.350) [-351.116] (-352.296) (-350.011) -- 0:00:21
      650000 -- (-349.027) (-352.888) (-349.523) [-349.102] * (-349.928) (-350.237) [-350.167] (-353.695) -- 0:00:21

      Average standard deviation of split frequencies: 0.007471

      650500 -- (-349.339) (-350.550) [-349.249] (-348.453) * (-349.436) (-349.001) [-350.802] (-348.448) -- 0:00:20
      651000 -- [-348.973] (-352.092) (-351.470) (-348.798) * (-351.910) (-351.693) (-350.196) [-351.851] -- 0:00:20
      651500 -- (-348.467) (-349.764) [-354.485] (-351.646) * (-351.707) (-352.624) (-353.662) [-350.828] -- 0:00:20
      652000 -- (-349.878) [-351.376] (-351.981) (-351.097) * (-350.136) (-351.177) (-352.050) [-350.686] -- 0:00:20
      652500 -- [-349.421] (-350.373) (-350.615) (-349.643) * (-351.114) [-351.772] (-354.845) (-351.273) -- 0:00:20
      653000 -- (-349.619) (-351.821) (-353.050) [-351.429] * [-351.390] (-350.683) (-354.151) (-347.978) -- 0:00:20
      653500 -- (-352.165) (-349.120) [-349.594] (-351.053) * (-351.349) (-349.004) [-351.474] (-348.152) -- 0:00:20
      654000 -- (-350.051) [-348.960] (-350.613) (-351.801) * (-349.820) [-348.913] (-349.825) (-348.959) -- 0:00:20
      654500 -- [-350.327] (-351.862) (-357.366) (-351.156) * (-350.457) (-350.764) [-352.509] (-350.868) -- 0:00:20
      655000 -- (-349.209) [-351.155] (-350.319) (-350.840) * (-350.407) (-348.708) (-350.757) [-350.289] -- 0:00:20

      Average standard deviation of split frequencies: 0.007456

      655500 -- (-351.463) (-361.161) (-349.294) [-349.522] * (-352.820) [-348.341] (-350.793) (-349.261) -- 0:00:20
      656000 -- (-355.531) (-354.556) [-348.527] (-352.971) * [-351.053] (-349.282) (-348.136) (-348.078) -- 0:00:20
      656500 -- (-351.552) [-350.107] (-350.552) (-351.786) * (-351.541) (-350.979) (-348.418) [-349.012] -- 0:00:20
      657000 -- [-351.651] (-348.856) (-350.758) (-351.458) * (-349.056) [-349.982] (-351.770) (-350.184) -- 0:00:20
      657500 -- (-350.263) [-349.513] (-350.062) (-357.187) * (-350.040) [-350.010] (-353.977) (-350.222) -- 0:00:20
      658000 -- (-348.960) (-351.867) (-350.803) [-353.822] * (-350.909) [-349.927] (-350.096) (-349.194) -- 0:00:20
      658500 -- [-348.634] (-350.233) (-354.947) (-353.914) * (-349.658) [-348.351] (-351.357) (-354.658) -- 0:00:20
      659000 -- (-348.266) (-351.039) (-351.107) [-353.687] * (-348.915) [-348.761] (-350.163) (-351.200) -- 0:00:20
      659500 -- (-356.576) (-351.480) (-350.804) [-348.439] * (-350.055) (-352.994) (-351.945) [-349.195] -- 0:00:20
      660000 -- (-357.462) (-348.940) (-353.135) [-348.865] * [-349.590] (-349.800) (-349.606) (-351.575) -- 0:00:20

      Average standard deviation of split frequencies: 0.007670

      660500 -- (-356.653) (-353.040) [-350.037] (-352.073) * [-350.286] (-348.704) (-349.217) (-349.699) -- 0:00:20
      661000 -- (-351.617) (-353.390) (-348.765) [-350.393] * [-349.985] (-349.606) (-349.856) (-349.366) -- 0:00:20
      661500 -- (-350.616) (-349.451) (-353.370) [-348.832] * [-353.253] (-348.822) (-351.005) (-349.860) -- 0:00:19
      662000 -- [-349.823] (-350.508) (-348.748) (-349.952) * (-350.765) [-349.302] (-349.168) (-350.411) -- 0:00:19
      662500 -- (-351.214) (-352.997) [-348.832] (-348.719) * [-350.590] (-348.308) (-351.472) (-354.061) -- 0:00:19
      663000 -- (-348.336) (-350.776) [-349.315] (-351.570) * (-349.612) [-349.647] (-348.718) (-357.303) -- 0:00:19
      663500 -- [-349.534] (-349.030) (-351.982) (-352.441) * (-349.321) [-351.892] (-349.604) (-351.475) -- 0:00:19
      664000 -- [-348.827] (-350.914) (-354.490) (-355.464) * (-349.945) (-348.760) [-349.254] (-348.164) -- 0:00:19
      664500 -- (-353.450) (-350.094) [-352.272] (-350.621) * (-349.570) (-348.881) [-348.320] (-350.256) -- 0:00:19
      665000 -- (-353.618) (-351.151) (-348.534) [-352.493] * (-353.210) (-350.412) (-348.422) [-350.537] -- 0:00:20

      Average standard deviation of split frequencies: 0.007653

      665500 -- [-351.739] (-350.716) (-351.493) (-348.326) * [-351.709] (-349.682) (-348.406) (-349.401) -- 0:00:20
      666000 -- (-349.067) [-350.474] (-351.962) (-348.435) * (-352.935) [-350.261] (-349.216) (-349.245) -- 0:00:20
      666500 -- (-348.109) (-349.244) (-349.871) [-348.658] * [-350.020] (-348.484) (-350.625) (-348.737) -- 0:00:20
      667000 -- (-349.419) [-352.716] (-350.178) (-354.392) * (-350.414) (-352.639) [-348.706] (-348.448) -- 0:00:19
      667500 -- (-348.581) (-350.315) (-348.942) [-352.864] * (-351.378) (-351.791) (-348.177) [-351.229] -- 0:00:19
      668000 -- (-351.838) (-349.750) (-348.920) [-348.855] * (-351.364) [-350.076] (-350.143) (-352.855) -- 0:00:19
      668500 -- (-351.688) (-349.044) [-350.767] (-349.753) * (-349.222) [-350.673] (-351.202) (-350.021) -- 0:00:19
      669000 -- [-353.083] (-351.116) (-348.762) (-352.376) * [-350.741] (-352.261) (-352.890) (-350.415) -- 0:00:19
      669500 -- (-349.487) (-349.340) (-350.003) [-348.590] * (-350.102) [-350.987] (-354.384) (-351.681) -- 0:00:19
      670000 -- (-348.425) [-350.008] (-352.877) (-349.802) * [-349.425] (-357.198) (-348.592) (-351.015) -- 0:00:19

      Average standard deviation of split frequencies: 0.007600

      670500 -- (-348.636) [-349.591] (-350.344) (-350.878) * (-352.338) [-352.329] (-349.285) (-350.353) -- 0:00:19
      671000 -- (-349.535) [-348.423] (-352.576) (-350.268) * (-350.162) [-349.609] (-354.677) (-349.142) -- 0:00:19
      671500 -- (-348.409) (-347.936) [-350.415] (-352.376) * (-355.701) (-350.409) (-348.879) [-348.943] -- 0:00:19
      672000 -- (-351.767) (-348.049) (-350.474) [-349.164] * (-350.960) (-350.981) (-349.294) [-350.684] -- 0:00:19
      672500 -- [-351.285] (-349.875) (-349.238) (-351.513) * [-349.083] (-350.654) (-348.612) (-350.414) -- 0:00:19
      673000 -- (-353.845) (-350.575) (-349.413) [-351.060] * (-350.284) (-351.187) (-348.945) [-349.811] -- 0:00:19
      673500 -- (-350.180) [-349.452] (-350.063) (-350.059) * (-353.039) (-354.383) [-348.607] (-351.825) -- 0:00:19
      674000 -- (-349.044) (-351.173) [-350.976] (-349.611) * [-349.954] (-351.615) (-348.431) (-353.078) -- 0:00:19
      674500 -- [-356.341] (-349.376) (-353.067) (-348.524) * (-349.802) (-351.746) (-351.458) [-349.793] -- 0:00:19
      675000 -- (-350.085) [-349.236] (-349.704) (-350.874) * (-349.949) (-352.456) [-351.963] (-352.271) -- 0:00:19

      Average standard deviation of split frequencies: 0.007712

      675500 -- (-348.409) (-351.659) [-349.031] (-350.740) * (-349.163) (-351.887) [-349.420] (-350.073) -- 0:00:19
      676000 -- (-349.627) (-349.397) (-351.468) [-351.616] * (-348.698) [-349.182] (-350.679) (-349.890) -- 0:00:19
      676500 -- [-353.782] (-349.590) (-352.262) (-349.604) * (-348.520) [-350.618] (-352.840) (-352.556) -- 0:00:19
      677000 -- (-350.076) [-348.566] (-351.075) (-350.707) * (-348.019) [-348.027] (-351.241) (-351.868) -- 0:00:19
      677500 -- (-349.499) (-349.038) [-350.398] (-353.878) * (-349.294) [-348.712] (-352.161) (-353.873) -- 0:00:19
      678000 -- [-349.740] (-349.374) (-350.859) (-349.907) * (-352.688) (-348.874) [-351.264] (-349.540) -- 0:00:18
      678500 -- (-349.234) (-352.265) (-350.784) [-352.347] * (-350.363) [-348.713] (-350.008) (-349.272) -- 0:00:18
      679000 -- (-349.050) (-349.450) (-350.223) [-354.362] * (-354.250) (-350.778) [-349.353] (-349.755) -- 0:00:18
      679500 -- (-350.374) (-351.060) [-348.568] (-351.261) * [-348.676] (-353.722) (-349.223) (-350.068) -- 0:00:18
      680000 -- [-350.019] (-350.055) (-349.885) (-348.468) * (-352.104) [-351.193] (-349.017) (-353.603) -- 0:00:18

      Average standard deviation of split frequencies: 0.007740

      680500 -- [-350.818] (-352.782) (-350.459) (-356.502) * (-353.768) (-350.066) [-348.481] (-353.808) -- 0:00:18
      681000 -- (-352.533) (-352.697) [-348.624] (-352.578) * (-349.396) (-350.197) (-349.240) [-352.537] -- 0:00:18
      681500 -- (-350.805) [-351.220] (-350.125) (-350.136) * (-349.398) [-349.239] (-348.930) (-349.397) -- 0:00:18
      682000 -- (-348.679) [-352.522] (-350.549) (-349.775) * (-356.564) (-351.146) (-348.987) [-351.333] -- 0:00:19
      682500 -- (-352.973) [-351.190] (-350.923) (-350.538) * [-351.646] (-353.754) (-351.704) (-348.590) -- 0:00:19
      683000 -- (-350.047) (-353.742) (-352.190) [-354.345] * (-354.383) [-349.660] (-348.795) (-351.665) -- 0:00:19
      683500 -- [-350.256] (-350.079) (-349.143) (-352.287) * (-349.359) (-349.440) [-348.236] (-350.537) -- 0:00:18
      684000 -- [-350.703] (-350.396) (-348.930) (-351.861) * (-349.660) [-349.668] (-348.387) (-348.359) -- 0:00:18
      684500 -- (-351.538) [-349.403] (-349.791) (-353.141) * [-350.062] (-349.827) (-348.384) (-354.277) -- 0:00:18
      685000 -- (-351.189) [-351.478] (-348.433) (-350.810) * (-349.286) (-351.499) [-351.875] (-351.444) -- 0:00:18

      Average standard deviation of split frequencies: 0.007357

      685500 -- (-350.958) [-350.973] (-350.627) (-349.337) * (-352.179) (-350.593) (-348.999) [-351.305] -- 0:00:18
      686000 -- (-352.978) (-349.378) (-349.250) [-348.380] * (-356.127) [-349.227] (-349.881) (-349.029) -- 0:00:18
      686500 -- [-348.301] (-350.701) (-350.542) (-351.539) * [-349.055] (-351.702) (-348.010) (-349.999) -- 0:00:18
      687000 -- (-351.863) (-349.657) [-349.789] (-351.469) * (-349.142) (-349.294) [-349.522] (-350.639) -- 0:00:18
      687500 -- [-351.297] (-349.690) (-351.350) (-351.775) * (-350.550) (-349.773) (-351.568) [-351.454] -- 0:00:18
      688000 -- [-350.180] (-354.041) (-348.862) (-350.585) * (-354.610) [-350.139] (-349.464) (-350.648) -- 0:00:18
      688500 -- (-354.619) (-350.026) (-351.430) [-349.687] * (-350.025) [-351.761] (-353.501) (-353.176) -- 0:00:18
      689000 -- (-351.181) [-349.337] (-350.866) (-349.389) * (-348.428) [-353.216] (-349.668) (-348.740) -- 0:00:18
      689500 -- [-352.356] (-349.186) (-350.612) (-353.048) * (-351.597) (-348.957) [-349.002] (-349.631) -- 0:00:18
      690000 -- (-352.715) (-349.150) (-353.835) [-351.280] * (-348.757) (-349.240) (-348.492) [-349.411] -- 0:00:18

      Average standard deviation of split frequencies: 0.007548

      690500 -- [-350.223] (-351.057) (-353.197) (-354.833) * (-351.804) [-350.064] (-349.576) (-349.991) -- 0:00:18
      691000 -- [-348.627] (-351.687) (-349.542) (-353.785) * (-354.249) (-349.118) (-351.102) [-349.640] -- 0:00:18
      691500 -- (-351.131) (-349.834) [-350.791] (-349.459) * (-349.875) [-351.963] (-349.678) (-353.589) -- 0:00:18
      692000 -- [-349.274] (-349.349) (-350.815) (-352.862) * (-351.219) (-350.230) [-349.117] (-350.846) -- 0:00:18
      692500 -- (-349.933) (-350.045) [-349.135] (-353.059) * (-350.421) (-348.643) (-349.489) [-351.300] -- 0:00:18
      693000 -- [-349.424] (-351.662) (-349.759) (-351.944) * (-348.954) [-349.511] (-349.899) (-349.620) -- 0:00:18
      693500 -- (-352.320) (-349.858) (-349.430) [-349.415] * (-351.004) [-349.442] (-350.008) (-349.674) -- 0:00:18
      694000 -- (-348.707) (-349.564) [-350.527] (-350.756) * (-349.726) (-349.977) [-348.966] (-351.292) -- 0:00:18
      694500 -- (-349.035) [-352.762] (-350.813) (-350.336) * (-350.615) (-349.203) [-350.281] (-350.760) -- 0:00:18
      695000 -- (-350.524) (-348.686) [-348.316] (-348.850) * [-348.920] (-348.923) (-350.830) (-350.033) -- 0:00:17

      Average standard deviation of split frequencies: 0.007411

      695500 -- (-349.915) [-349.264] (-348.598) (-350.933) * (-353.218) [-349.665] (-348.714) (-349.174) -- 0:00:17
      696000 -- (-348.934) [-350.623] (-348.377) (-349.037) * (-355.476) (-349.014) (-349.084) [-354.677] -- 0:00:17
      696500 -- [-349.341] (-350.036) (-348.881) (-353.728) * (-349.426) [-350.458] (-350.957) (-353.164) -- 0:00:17
      697000 -- (-349.890) (-351.065) [-349.622] (-350.686) * (-350.208) (-349.136) [-349.802] (-348.799) -- 0:00:17
      697500 -- (-352.588) (-351.718) [-350.757] (-353.201) * (-349.769) [-351.165] (-350.367) (-348.798) -- 0:00:17
      698000 -- [-350.003] (-353.646) (-350.825) (-357.642) * (-349.757) (-351.346) (-356.275) [-357.037] -- 0:00:17
      698500 -- (-350.251) [-351.745] (-349.873) (-350.140) * (-349.148) (-348.785) (-351.001) [-351.791] -- 0:00:17
      699000 -- (-348.678) [-349.692] (-349.404) (-350.874) * (-350.298) (-348.865) [-353.314] (-353.081) -- 0:00:17
      699500 -- [-349.746] (-352.574) (-349.071) (-349.896) * (-351.832) [-349.547] (-347.957) (-350.570) -- 0:00:18
      700000 -- [-349.653] (-352.947) (-349.182) (-350.023) * [-349.453] (-349.059) (-348.733) (-350.115) -- 0:00:18

      Average standard deviation of split frequencies: 0.006938

      700500 -- (-349.002) [-349.579] (-351.992) (-348.312) * (-349.003) [-349.173] (-349.221) (-353.748) -- 0:00:17
      701000 -- (-350.546) (-352.050) (-358.278) [-350.683] * (-349.036) [-349.846] (-352.577) (-349.268) -- 0:00:17
      701500 -- (-351.809) [-350.837] (-350.391) (-351.417) * [-351.108] (-350.076) (-351.826) (-350.492) -- 0:00:17
      702000 -- (-348.445) (-351.213) (-353.368) [-351.588] * (-349.160) (-350.791) [-350.510] (-351.669) -- 0:00:17
      702500 -- (-349.450) (-350.382) (-350.655) [-350.487] * (-349.066) (-350.798) (-350.180) [-349.270] -- 0:00:17
      703000 -- (-349.629) [-352.169] (-350.349) (-350.705) * (-348.503) [-349.926] (-350.628) (-348.114) -- 0:00:17
      703500 -- (-356.187) (-348.964) (-356.698) [-350.336] * [-350.465] (-349.831) (-349.554) (-348.592) -- 0:00:17
      704000 -- [-348.273] (-350.138) (-351.227) (-350.819) * (-351.333) (-349.382) (-350.542) [-348.146] -- 0:00:17
      704500 -- (-348.244) [-351.924] (-354.936) (-350.360) * (-350.816) (-349.400) [-348.859] (-348.833) -- 0:00:17
      705000 -- (-348.929) (-348.960) [-350.889] (-353.933) * (-350.669) (-349.699) (-349.651) [-349.761] -- 0:00:17

      Average standard deviation of split frequencies: 0.007227

      705500 -- [-349.557] (-349.524) (-350.126) (-348.534) * (-348.731) [-351.322] (-351.763) (-349.316) -- 0:00:17
      706000 -- (-350.535) (-350.481) [-348.917] (-349.925) * [-350.649] (-349.739) (-349.677) (-348.998) -- 0:00:17
      706500 -- [-351.006] (-351.893) (-351.432) (-351.480) * (-348.748) (-353.499) [-350.297] (-348.724) -- 0:00:17
      707000 -- (-352.087) (-350.464) [-350.987] (-350.255) * (-348.219) (-351.009) (-349.520) [-349.760] -- 0:00:17
      707500 -- (-354.163) (-349.202) [-349.181] (-348.104) * (-349.981) [-348.595] (-349.005) (-348.775) -- 0:00:17
      708000 -- (-353.156) (-348.354) (-349.398) [-348.739] * (-349.817) (-349.065) [-350.601] (-350.438) -- 0:00:17
      708500 -- (-348.287) (-350.569) (-351.639) [-348.874] * (-350.497) (-353.202) (-350.307) [-353.007] -- 0:00:17
      709000 -- (-349.181) [-350.191] (-353.415) (-351.456) * (-350.642) [-351.435] (-350.117) (-351.436) -- 0:00:17
      709500 -- (-350.442) (-349.505) (-363.144) [-349.564] * (-350.319) [-350.639] (-349.097) (-353.696) -- 0:00:17
      710000 -- [-349.529] (-348.598) (-356.786) (-354.922) * (-354.108) [-353.185] (-350.243) (-351.330) -- 0:00:17

      Average standard deviation of split frequencies: 0.007023

      710500 -- (-350.237) (-349.599) (-350.558) [-348.905] * (-352.613) (-351.572) [-350.005] (-354.293) -- 0:00:17
      711000 -- (-351.285) (-348.814) [-350.881] (-349.938) * [-350.213] (-349.986) (-349.214) (-348.899) -- 0:00:17
      711500 -- (-350.679) (-350.668) (-350.252) [-349.654] * (-349.778) (-350.736) (-351.444) [-348.962] -- 0:00:17
      712000 -- (-349.262) [-349.539] (-348.981) (-349.510) * (-351.445) [-352.972] (-353.093) (-349.025) -- 0:00:16
      712500 -- [-351.129] (-352.126) (-351.174) (-348.854) * (-350.031) [-350.472] (-353.756) (-351.688) -- 0:00:16
      713000 -- (-349.572) [-349.048] (-351.624) (-355.207) * (-352.313) (-353.739) (-353.016) [-350.231] -- 0:00:16
      713500 -- (-356.875) (-350.597) [-350.828] (-351.731) * (-350.526) [-350.649] (-348.469) (-349.534) -- 0:00:16
      714000 -- (-350.036) (-356.355) (-351.324) [-349.667] * (-351.069) (-351.856) [-348.806] (-352.180) -- 0:00:16
      714500 -- [-350.175] (-352.277) (-351.017) (-351.113) * (-349.735) (-348.224) (-349.729) [-351.609] -- 0:00:16
      715000 -- (-351.995) (-347.961) (-351.063) [-349.338] * [-350.384] (-350.061) (-348.651) (-348.880) -- 0:00:16

      Average standard deviation of split frequencies: 0.006816

      715500 -- (-353.095) [-350.828] (-352.792) (-351.094) * [-350.625] (-352.129) (-350.687) (-348.857) -- 0:00:16
      716000 -- (-352.464) (-351.110) [-351.443] (-348.088) * [-347.888] (-351.440) (-351.582) (-350.298) -- 0:00:16
      716500 -- [-348.715] (-354.768) (-353.165) (-351.726) * (-350.024) (-347.972) (-351.720) [-351.165] -- 0:00:17
      717000 -- [-349.471] (-349.535) (-350.831) (-351.217) * (-353.674) (-351.851) (-352.184) [-348.441] -- 0:00:16
      717500 -- (-350.909) (-350.473) (-350.958) [-351.377] * (-354.522) (-351.179) (-349.473) [-351.092] -- 0:00:16
      718000 -- (-350.326) [-352.352] (-349.656) (-352.882) * (-353.765) [-352.948] (-352.927) (-352.777) -- 0:00:16
      718500 -- [-350.947] (-355.618) (-351.773) (-348.613) * (-350.195) [-348.874] (-350.337) (-351.052) -- 0:00:16
      719000 -- (-348.981) [-350.500] (-354.358) (-349.663) * [-348.635] (-349.321) (-355.887) (-353.541) -- 0:00:16
      719500 -- (-352.430) (-349.295) [-350.632] (-350.858) * [-351.685] (-349.370) (-353.494) (-353.013) -- 0:00:16
      720000 -- (-350.849) (-352.692) (-351.143) [-351.018] * [-350.586] (-349.005) (-350.355) (-350.047) -- 0:00:16

      Average standard deviation of split frequencies: 0.007234

      720500 -- (-349.809) (-351.058) (-349.537) [-352.168] * [-349.459] (-349.420) (-351.571) (-354.466) -- 0:00:16
      721000 -- (-349.875) [-351.685] (-352.859) (-352.545) * (-352.463) (-352.046) [-351.540] (-350.928) -- 0:00:16
      721500 -- (-349.390) (-350.446) (-349.597) [-351.094] * (-350.980) (-354.410) (-350.695) [-351.013] -- 0:00:16
      722000 -- (-351.898) (-349.393) [-352.217] (-350.740) * (-349.697) (-354.917) [-351.029] (-349.266) -- 0:00:16
      722500 -- [-348.534] (-348.859) (-350.906) (-358.289) * [-349.119] (-349.951) (-351.380) (-350.469) -- 0:00:16
      723000 -- (-349.978) [-348.108] (-348.629) (-350.287) * (-355.071) (-350.397) (-349.922) [-348.929] -- 0:00:16
      723500 -- [-350.587] (-349.720) (-350.738) (-352.494) * (-351.165) (-351.302) [-350.265] (-350.213) -- 0:00:16
      724000 -- (-348.620) (-352.981) [-352.524] (-349.738) * (-349.796) (-350.310) [-350.260] (-349.807) -- 0:00:16
      724500 -- (-350.096) (-351.527) (-350.107) [-349.123] * (-350.155) (-349.020) (-349.230) [-353.229] -- 0:00:16
      725000 -- (-353.129) [-351.433] (-349.005) (-349.758) * (-350.762) (-352.369) (-350.467) [-349.684] -- 0:00:16

      Average standard deviation of split frequencies: 0.007028

      725500 -- [-348.512] (-351.606) (-351.205) (-352.121) * [-352.159] (-351.553) (-352.862) (-352.431) -- 0:00:16
      726000 -- (-348.775) [-349.388] (-353.468) (-355.625) * (-354.207) (-348.851) (-354.049) [-353.577] -- 0:00:16
      726500 -- (-348.616) [-348.387] (-350.332) (-350.382) * (-350.463) [-349.946] (-350.979) (-352.064) -- 0:00:16
      727000 -- [-348.572] (-351.315) (-352.221) (-348.313) * [-350.167] (-350.589) (-355.401) (-350.436) -- 0:00:16
      727500 -- (-349.778) (-355.569) [-350.127] (-349.585) * [-351.607] (-352.305) (-350.490) (-350.172) -- 0:00:16
      728000 -- (-350.020) (-348.982) [-348.855] (-350.342) * (-350.560) (-352.593) (-349.964) [-351.277] -- 0:00:16
      728500 -- [-352.184] (-351.207) (-348.537) (-351.662) * (-349.201) [-350.926] (-349.576) (-349.104) -- 0:00:16
      729000 -- (-349.534) (-351.124) (-350.607) [-350.686] * (-352.120) (-351.251) [-351.246] (-349.392) -- 0:00:15
      729500 -- (-350.003) [-350.138] (-352.227) (-351.659) * [-354.489] (-352.915) (-353.343) (-348.550) -- 0:00:15
      730000 -- (-350.161) [-350.489] (-350.609) (-348.758) * (-351.577) [-352.813] (-349.111) (-348.248) -- 0:00:15

      Average standard deviation of split frequencies: 0.006452

      730500 -- (-349.317) (-350.037) [-348.249] (-348.523) * (-350.140) (-350.966) [-349.812] (-348.925) -- 0:00:15
      731000 -- (-348.641) (-349.715) (-348.317) [-349.141] * (-349.246) (-353.882) [-352.023] (-349.181) -- 0:00:15
      731500 -- (-350.972) [-349.846] (-349.398) (-349.823) * (-353.772) (-349.936) (-350.482) [-348.733] -- 0:00:15
      732000 -- (-354.288) (-349.456) [-351.239] (-349.945) * (-349.061) (-349.782) [-352.714] (-348.712) -- 0:00:15
      732500 -- (-351.939) [-349.798] (-348.783) (-350.267) * (-348.592) (-350.108) (-351.473) [-348.411] -- 0:00:15
      733000 -- (-351.454) (-350.159) [-348.540] (-355.467) * (-349.911) (-349.841) [-349.806] (-349.883) -- 0:00:15
      733500 -- (-352.254) (-353.246) (-350.049) [-350.749] * (-350.441) (-349.491) (-352.058) [-351.706] -- 0:00:15
      734000 -- [-348.888] (-350.532) (-350.941) (-349.578) * (-360.183) [-349.954] (-351.979) (-350.735) -- 0:00:15
      734500 -- (-350.008) [-348.577] (-350.446) (-354.817) * (-354.580) (-350.040) [-352.333] (-353.961) -- 0:00:15
      735000 -- (-352.923) (-349.919) (-349.568) [-352.267] * (-356.439) (-350.553) [-352.196] (-352.742) -- 0:00:15

      Average standard deviation of split frequencies: 0.006932

      735500 -- [-349.037] (-350.256) (-352.555) (-349.326) * [-358.530] (-351.273) (-351.841) (-350.698) -- 0:00:15
      736000 -- (-348.328) (-349.845) [-351.433] (-352.744) * (-357.979) (-351.137) [-348.305] (-349.892) -- 0:00:15
      736500 -- (-348.427) (-350.269) (-358.457) [-349.665] * (-354.536) (-349.925) (-349.316) [-349.300] -- 0:00:15
      737000 -- (-348.046) (-349.919) [-350.211] (-350.191) * (-349.480) (-350.985) (-352.716) [-351.190] -- 0:00:15
      737500 -- (-350.294) (-350.943) [-349.110] (-350.306) * [-353.215] (-353.015) (-350.985) (-348.909) -- 0:00:15
      738000 -- (-353.807) [-349.478] (-349.716) (-353.304) * [-350.439] (-355.751) (-355.360) (-349.999) -- 0:00:15
      738500 -- (-350.206) (-351.335) [-349.281] (-352.149) * [-349.925] (-351.230) (-358.168) (-350.111) -- 0:00:15
      739000 -- [-349.544] (-353.732) (-349.058) (-351.806) * (-352.006) (-351.196) (-355.264) [-349.181] -- 0:00:15
      739500 -- (-350.461) (-354.616) [-352.718] (-351.462) * (-356.503) [-349.705] (-351.302) (-351.358) -- 0:00:15
      740000 -- (-348.290) (-354.601) (-351.332) [-350.206] * (-353.063) [-349.223] (-352.217) (-350.318) -- 0:00:15

      Average standard deviation of split frequencies: 0.006702

      740500 -- [-349.496] (-349.124) (-349.648) (-352.807) * (-350.938) [-350.446] (-353.837) (-348.771) -- 0:00:15
      741000 -- (-349.413) (-349.282) [-350.362] (-350.259) * (-348.701) [-349.140] (-351.769) (-349.333) -- 0:00:15
      741500 -- [-350.111] (-348.705) (-350.368) (-350.460) * [-348.492] (-353.172) (-349.600) (-348.454) -- 0:00:15
      742000 -- (-348.882) (-349.755) [-350.492] (-349.499) * (-352.840) (-349.254) [-349.988] (-348.750) -- 0:00:15
      742500 -- [-348.647] (-348.682) (-352.382) (-352.835) * (-351.980) (-352.386) (-349.651) [-350.127] -- 0:00:15
      743000 -- (-350.796) (-352.988) (-357.821) [-349.978] * (-348.734) (-350.969) (-348.673) [-352.485] -- 0:00:15
      743500 -- (-353.316) [-353.150] (-349.713) (-353.308) * (-351.230) [-350.888] (-349.599) (-350.588) -- 0:00:15
      744000 -- (-352.863) (-352.664) (-348.130) [-351.457] * (-350.572) (-349.141) [-348.380] (-350.254) -- 0:00:15
      744500 -- (-350.306) [-353.442] (-348.501) (-350.702) * (-351.090) (-349.169) [-349.867] (-355.940) -- 0:00:15
      745000 -- (-348.983) (-351.571) (-348.551) [-352.452] * [-350.967] (-351.547) (-350.554) (-353.130) -- 0:00:15

      Average standard deviation of split frequencies: 0.006616

      745500 -- (-350.097) (-350.213) [-352.168] (-350.696) * (-348.273) (-349.409) (-349.274) [-351.841] -- 0:00:15
      746000 -- (-351.794) (-352.048) (-351.600) [-351.704] * (-348.406) (-348.367) (-350.476) [-349.404] -- 0:00:14
      746500 -- (-350.113) [-348.879] (-349.892) (-349.628) * [-348.371] (-348.265) (-352.473) (-348.947) -- 0:00:14
      747000 -- (-349.511) (-353.551) (-350.817) [-348.845] * (-349.114) [-352.348] (-351.606) (-348.748) -- 0:00:14
      747500 -- (-351.420) (-352.107) [-351.894] (-350.470) * [-348.745] (-355.680) (-353.301) (-351.808) -- 0:00:14
      748000 -- (-352.075) (-352.387) [-349.494] (-351.770) * [-351.314] (-351.620) (-351.506) (-350.367) -- 0:00:14
      748500 -- (-351.670) (-348.846) [-351.891] (-348.601) * (-351.882) [-349.276] (-352.407) (-354.674) -- 0:00:14
      749000 -- [-350.720] (-348.686) (-349.075) (-349.919) * [-350.004] (-349.025) (-351.023) (-351.397) -- 0:00:14
      749500 -- (-357.633) [-349.774] (-350.088) (-350.522) * (-349.931) (-350.839) [-349.433] (-352.093) -- 0:00:14
      750000 -- (-350.858) (-350.249) [-350.231] (-348.940) * (-348.681) (-349.945) (-349.151) [-355.408] -- 0:00:14

      Average standard deviation of split frequencies: 0.006280

      750500 -- [-352.194] (-349.965) (-351.102) (-349.399) * [-348.482] (-349.260) (-353.272) (-350.354) -- 0:00:14
      751000 -- (-348.063) (-348.809) [-351.662] (-348.489) * (-353.624) (-348.601) (-350.204) [-348.850] -- 0:00:14
      751500 -- (-348.137) (-349.551) [-351.690] (-350.674) * (-351.012) (-349.685) [-349.291] (-350.557) -- 0:00:14
      752000 -- [-348.227] (-350.709) (-355.479) (-351.064) * (-352.510) (-349.981) [-351.910] (-352.491) -- 0:00:14
      752500 -- (-350.011) [-352.274] (-352.294) (-349.155) * (-351.514) [-354.004] (-350.003) (-349.066) -- 0:00:14
      753000 -- (-348.793) [-350.370] (-348.074) (-351.465) * (-349.000) (-350.215) (-350.725) [-349.368] -- 0:00:14
      753500 -- (-349.502) (-355.015) [-348.556] (-355.457) * (-349.288) [-352.183] (-348.977) (-350.026) -- 0:00:14
      754000 -- (-352.177) [-352.451] (-348.610) (-354.918) * [-348.748] (-352.523) (-348.608) (-349.483) -- 0:00:14
      754500 -- [-351.461] (-352.346) (-349.860) (-351.219) * (-349.299) (-352.863) (-348.828) [-349.739] -- 0:00:14
      755000 -- (-355.716) [-353.634] (-348.534) (-351.656) * (-350.441) (-349.888) [-352.434] (-352.192) -- 0:00:14

      Average standard deviation of split frequencies: 0.006125

      755500 -- (-350.875) (-353.811) (-350.244) [-351.707] * (-351.239) (-351.481) (-351.981) [-349.310] -- 0:00:14
      756000 -- (-349.089) [-350.666] (-348.195) (-349.240) * (-352.307) [-351.380] (-349.212) (-350.168) -- 0:00:14
      756500 -- (-350.830) [-350.675] (-353.014) (-349.586) * (-351.077) (-348.599) (-352.213) [-348.816] -- 0:00:14
      757000 -- (-352.311) (-349.883) (-351.042) [-352.103] * (-3