--- EXPERIMENT NOTES
--- EXPERIMENT PROPERTIES
#Thu Jan 23 14:11:59 GMT 2020
codeml.models=0 1 2 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=MUSCLE
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=/usr/bin/
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb
tcoffee.bin=t_coffee
mrbayes.dir=/opt/mrbayes_3.2.2/src
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/data/12res/rpsT/input.fasta
input.names=
mrbayes.params=
codeml.params=
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -349.51 -352.77
2 -349.55 -352.72
--------------------------------------
TOTAL -349.53 -352.75
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.889883 0.087259 0.373885 1.490329 0.857316 1472.68 1486.84 1.000
r(A<->C){all} 0.160454 0.017728 0.000025 0.428458 0.125238 301.96 411.06 1.003
r(A<->G){all} 0.174915 0.022689 0.000107 0.481316 0.132507 175.57 234.19 1.001
r(A<->T){all} 0.162989 0.021149 0.000009 0.460036 0.120701 155.50 216.67 1.000
r(C<->G){all} 0.176492 0.021281 0.000033 0.468418 0.140047 183.85 233.07 1.002
r(C<->T){all} 0.158302 0.019004 0.000123 0.445024 0.121412 145.05 210.62 1.011
r(G<->T){all} 0.166849 0.020755 0.000253 0.470555 0.126143 132.78 188.77 1.002
pi(A){all} 0.264036 0.000754 0.211385 0.318238 0.262907 1191.31 1299.11 1.000
pi(C){all} 0.297586 0.000800 0.240391 0.352497 0.297428 1197.22 1332.29 1.000
pi(G){all} 0.298058 0.000833 0.239678 0.350781 0.297674 1223.21 1286.46 1.001
pi(T){all} 0.140320 0.000463 0.097220 0.180942 0.139491 1171.40 1309.65 1.000
alpha{1,2} 0.411421 0.230906 0.000149 1.361843 0.240460 1010.02 1219.13 1.000
alpha{3} 0.438581 0.241406 0.000394 1.384557 0.278381 1256.94 1323.86 1.000
pinvar{all} 0.993875 0.000051 0.980346 1.000000 0.996201 1194.93 1262.31 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
--- CODEML SUMMARY
Model 1: NearlyNeutral -326.024548
Model 2: PositiveSelection -326.024539
Model 0: one-ratio -326.024572
Model 7: beta -326.02452
Model 8: beta&w>1 -326.02457
Model 0 vs 1 4.799999999249849E-5
Model 2 vs 1 1.799999995455437E-5
Model 8 vs 7 9.999999997489795E-5
>C1
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C2
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C3
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C4
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C5
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C6
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=86
C1 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C2 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C3 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C4 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C5 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C6 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
**************************************************
C1 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C2 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C3 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C4 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C5 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C6 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
************************************
PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
-full_log S [0]
-genepred_score S [0] nsd
-run_name S [0]
-mem_mode S [0] mem
-extend D [1] 1
-extend_mode S [0] very_fast_triplet
-max_n_pair D [0] 10
-seq_name_for_quadruplet S [0] all
-compact S [0] default
-clean S [0] no
-do_self FL [0] 0
-do_normalise D [0] 1000
-template_file S [0]
-setenv S [0] 0
-template_mode S [0]
-flip D [0] 0
-remove_template_file D [0] 0
-profile_template_file S [0]
-in S [0]
-seq S [0]
-aln S [0]
-method_limits S [0]
-method S [0]
-lib S [0]
-profile S [0]
-profile1 S [0]
-profile2 S [0]
-pdb S [0]
-relax_lib D [0] 1
-filter_lib D [0] 0
-shrink_lib D [0] 0
-out_lib W_F [0] no
-out_lib_mode S [0] primary
-lib_only D [0] 0
-outseqweight W_F [0] no
-dpa FL [0] 0
-seq_source S [0] ANY
-cosmetic_penalty D [0] 0
-gapopen D [0] 0
-gapext D [0] 0
-fgapopen D [0] 0
-fgapext D [0] 0
-nomatch D [0] 0
-newtree W_F [0] default
-tree W_F [0] NO
-usetree R_F [0]
-tree_mode S [0] nj
-distance_matrix_mode S [0] ktup
-distance_matrix_sim_mode S [0] idmat_sim1
-quicktree FL [0] 0
-outfile W_F [0] default
-maximise FL [1] 1
-output S [1] score_ascii html score_ascii
-len D [0] 0
-infile R_F [1] input.prot.fasta.muscle_rs_0_0.fasta.aln
-matrix S [0] default
-tg_mode D [0] 1
-profile_mode S [0] cw_profile_profile
-profile_comparison S [0] profile
-dp_mode S [0] linked_pair_wise
-ktuple D [0] 1
-ndiag D [0] 0
-diag_threshold D [0] 0
-diag_mode D [0] 0
-sim_matrix S [0] vasiliky
-transform S [0]
-extend_seq FL [0] 0
-outorder S [0] input
-inorder S [0] aligned
-seqnos S [0] off
-case S [0] keep
-cpu D [0] 0
-maxnseq D [0] 1000
-maxlen D [0] -1
-sample_dp D [0] 0
-weight S [0] default
-seq_weight S [0] no
-align FL [1] 1
-mocca FL [0] 0
-domain FL [0] 0
-start D [0] 0
-len D [0] 0
-scale D [0] 0
-mocca_interactive FL [0] 0
-method_evaluate_mode S [0] default
-evaluate_mode S [1] t_coffee_fast
-get_type FL [0] 0
-clean_aln D [0] 0
-clean_threshold D [1] 1
-clean_iteration D [1] 1
-clean_evaluate_mode S [0] t_coffee_fast
-extend_matrix FL [0] 0
-prot_min_sim D [40] 40
-prot_max_sim D [90] 90
-prot_min_cov D [40] 40
-pdb_type S [0] d
-pdb_min_sim D [35] 35
-pdb_max_sim D [100] 100
-pdb_min_cov D [50] 50
-pdb_blast_server W_F [0] EBI
-blast W_F [0]
-blast_server W_F [0] EBI
-pdb_db W_F [0] pdb
-protein_db W_F [0] uniprot
-method_log W_F [0] no
-struc_to_use S [0]
-cache W_F [0] use
-align_pdb_param_file W_F [0] no
-align_pdb_hasch_mode W_F [0] hasch_ca_trace_bubble
-external_aligner S [0] NO
-msa_mode S [0] tree
-master S [0] no
-blast_nseq D [0] 0
-lalign_n_top D [0] 10
-iterate D [1] 0
-trim D [0] 0
-split D [0] 0
-trimfile S [0] default
-split D [0] 0
-split_nseq_thres D [0] 0
-split_score_thres D [0] 0
-check_pdb_status D [0] 0
-clean_seq_name D [0] 0
-seq_to_keep S [0]
-dpa_master_aln S [0]
-dpa_maxnseq D [0] 0
-dpa_min_score1 D [0]
-dpa_min_score2 D [0]
-dpa_keep_tmpfile FL [0] 0
-dpa_debug D [0] 0
-multi_core S [0] templates_jobs_relax_msa_evaluate
-n_core D [0] 0
-max_n_proc D [0] 0
-lib_list S [0]
-prune_lib_mode S [0] 5
-tip S [0] none
-rna_lib S [0]
-no_warning D [0] 0
-run_local_script D [0] 0
-plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) input.prot.fasta.muscle_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 6 SEQUENCES [PROTEIN]
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C1 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C2 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C3 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C4 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C5 Length 86 type PROTEIN Struct Unchecked
Input File input.prot.fasta.muscle_rs_0_0.fasta.aln Seq C6 Length 86 type PROTEIN Struct Unchecked
Multi Core Mode: 96 processors:
--- Process Method/Library/Aln Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved Sinput.prot.fasta.muscle_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2580]
Library Relaxation: Multi_proc [96]
Relaxation Summary: [2580]--->[2580]
UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1
OUTPUT RESULTS
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
#### File Type= MSA Format= html Name= input.prot.fasta.muscle_rs_0_0.fasta.html
#### File Type= MSA Format= score_ascii Name= input.prot.fasta.muscle_rs_0_0.fasta.score_ascii
# Command Line: t_coffee -infile input.prot.fasta.muscle_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.440 Mb, Max= 30.598 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:09 - Revision 1613 - Build 432)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/
FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_i.fasta Not Supported[FATAL:T-COFFEE]
CLUSTAL W (1.83) multiple sequence alignment
C1 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C2 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C3 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C4 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C5 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
C6 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
**************************************************
C1 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C2 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C3 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C4 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C5 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
C6 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
************************************
FORMAT of file input.prot.fasta.muscle_rs_0_0.fasta.ipi_bs.fasta Not Supported[FATAL:T-COFFEE]
input.prot.fasta.muscle_rs_0_0.fasta.aln I:93 S:100 BS:94
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# PW_SEQ_DISTANCES
BOT 0 1 100.00 C1 C2 100.00
TOP 1 0 100.00 C2 C1 100.00
BOT 0 2 100.00 C1 C3 100.00
TOP 2 0 100.00 C3 C1 100.00
BOT 0 3 100.00 C1 C4 100.00
TOP 3 0 100.00 C4 C1 100.00
BOT 0 4 100.00 C1 C5 100.00
TOP 4 0 100.00 C5 C1 100.00
BOT 0 5 100.00 C1 C6 100.00
TOP 5 0 100.00 C6 C1 100.00
BOT 1 2 100.00 C2 C3 100.00
TOP 2 1 100.00 C3 C2 100.00
BOT 1 3 100.00 C2 C4 100.00
TOP 3 1 100.00 C4 C2 100.00
BOT 1 4 100.00 C2 C5 100.00
TOP 4 1 100.00 C5 C2 100.00
BOT 1 5 100.00 C2 C6 100.00
TOP 5 1 100.00 C6 C2 100.00
BOT 2 3 100.00 C3 C4 100.00
TOP 3 2 100.00 C4 C3 100.00
BOT 2 4 100.00 C3 C5 100.00
TOP 4 2 100.00 C5 C3 100.00
BOT 2 5 100.00 C3 C6 100.00
TOP 5 2 100.00 C6 C3 100.00
BOT 3 4 100.00 C4 C5 100.00
TOP 4 3 100.00 C5 C4 100.00
BOT 3 5 100.00 C4 C6 100.00
TOP 5 3 100.00 C6 C4 100.00
BOT 4 5 100.00 C5 C6 100.00
TOP 5 4 100.00 C6 C5 100.00
AVG 0 C1 * 100.00
AVG 1 C2 * 100.00
AVG 2 C3 * 100.00
AVG 3 C4 * 100.00
AVG 4 C5 * 100.00
AVG 5 C6 * 100.00
TOT TOT * 100.00
CLUSTAL W (1.83) multiple sequence alignment
C1 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C2 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C3 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C4 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C5 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
C6 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
**************************************************
C1 CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C2 CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C3 CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C4 CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C5 CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
C6 CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
**************************************************
C1 CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C2 CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C3 CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C4 CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C5 CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
C6 CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
**************************************************
C1 CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C2 CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C3 CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C4 CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C5 CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
C6 CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
**************************************************
C1 CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C2 CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C3 CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C4 CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C5 CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
C6 CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
**************************************************
C1 ACAAACTC
C2 ACAAACTC
C3 ACAAACTC
C4 ACAAACTC
C5 ACAAACTC
C6 ACAAACTC
********
>C1
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C2
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C3
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C4
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C5
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C6
GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC
CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG
CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG
CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT
CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA
ACAAACTC
>C1
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C2
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C3
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C4
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C5
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
>C6
VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
MrBayes v3.2.2 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 6 taxa and 258 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Taxon 5 -> C5
Taxon 6 -> C6
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1579788647
Setting output file names to "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called first_pos
Defining charset called second_pos
Defining charset called third_pos
Defining partition called by_codon
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 269485462
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 0363175584
Seed = 500993794
Swapseed = 1579788647
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Active parameters:
Partition(s)
Parameters 1 2 3
------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:Exponential(10.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.06 % Dirichlet(Revmat{all})
1.06 % Slider(Revmat{all})
1.06 % Dirichlet(Pi{all})
1.06 % Slider(Pi{all})
2.13 % Multiplier(Alpha{1,2})
2.13 % Multiplier(Alpha{3})
2.13 % Slider(Pinvar{all})
10.64 % ExtSPR(Tau{all},V{all})
10.64 % ExtTBR(Tau{all},V{all})
10.64 % NNI(Tau{all},V{all})
10.64 % ParsSPR(Tau{all},V{all})
31.91 % Multiplier(V{all})
10.64 % Nodeslider(V{all})
4.26 % TLMultiplier(V{all})
Division 1 has 4 unique site patterns
Division 2 has 4 unique site patterns
Division 3 has 4 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -577.416283 -- -24.965149
Chain 2 -- -577.416338 -- -24.965149
Chain 3 -- -577.416371 -- -24.965149
Chain 4 -- -577.416338 -- -24.965149
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -577.416283 -- -24.965149
Chain 2 -- -577.416371 -- -24.965149
Chain 3 -- -577.416338 -- -24.965149
Chain 4 -- -577.416371 -- -24.965149
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-577.416] (-577.416) (-577.416) (-577.416) * [-577.416] (-577.416) (-577.416) (-577.416)
500 -- (-366.085) (-361.517) (-361.432) [-366.580] * (-371.240) (-359.265) [-355.008] (-360.371) -- 0:00:00
1000 -- [-358.649] (-364.187) (-359.416) (-361.670) * [-360.093] (-353.112) (-361.207) (-359.119) -- 0:00:00
1500 -- (-362.735) (-360.223) (-362.441) [-359.255] * (-356.769) (-363.567) [-354.385] (-362.455) -- 0:00:00
2000 -- (-363.737) (-354.969) (-360.074) [-359.288] * [-362.918] (-363.565) (-363.251) (-356.033) -- 0:00:00
2500 -- (-355.840) (-361.502) [-362.851] (-356.994) * (-353.909) (-357.052) (-359.950) [-361.036] -- 0:06:39
3000 -- (-361.452) (-361.524) (-365.335) [-358.158] * (-363.262) (-357.840) [-358.069] (-360.997) -- 0:05:32
3500 -- (-358.413) (-357.910) (-358.256) [-364.929] * (-356.202) (-362.136) (-353.802) [-353.850] -- 0:04:44
4000 -- (-364.295) [-356.661] (-359.380) (-359.469) * (-362.664) [-369.539] (-362.617) (-359.330) -- 0:04:09
4500 -- (-356.338) [-364.152] (-361.431) (-354.593) * (-356.407) [-357.424] (-361.875) (-368.451) -- 0:03:41
5000 -- (-364.028) [-355.467] (-359.386) (-358.910) * (-359.164) (-360.677) (-357.043) [-358.332] -- 0:03:19
Average standard deviation of split frequencies: 0.085710
5500 -- [-354.520] (-368.935) (-360.990) (-357.040) * (-365.152) (-365.357) (-357.195) [-361.105] -- 0:03:00
6000 -- [-356.245] (-361.334) (-355.980) (-360.993) * [-357.106] (-369.014) (-356.331) (-356.550) -- 0:02:45
6500 -- (-368.369) (-360.583) (-354.476) [-358.306] * (-362.558) [-361.588] (-359.857) (-355.155) -- 0:02:32
7000 -- (-374.189) [-360.593] (-363.887) (-367.670) * (-354.864) (-357.631) [-357.333] (-367.855) -- 0:02:21
7500 -- [-351.672] (-362.010) (-361.680) (-354.074) * (-362.313) (-366.120) (-361.527) [-361.491] -- 0:02:12
8000 -- [-350.434] (-350.353) (-352.663) (-358.094) * (-363.026) [-355.946] (-352.267) (-352.862) -- 0:02:04
8500 -- [-352.930] (-354.831) (-357.485) (-369.156) * (-365.480) (-367.201) [-359.733] (-366.120) -- 0:01:56
9000 -- (-352.497) (-352.251) [-362.941] (-364.400) * (-360.470) (-359.026) (-358.579) [-367.619] -- 0:01:50
9500 -- (-353.049) [-349.052] (-360.185) (-356.908) * (-360.683) [-356.844] (-356.240) (-375.808) -- 0:01:44
10000 -- (-350.559) [-349.076] (-355.152) (-354.040) * (-360.551) (-361.015) (-361.159) [-367.336] -- 0:01:39
Average standard deviation of split frequencies: 0.086179
10500 -- [-348.568] (-349.400) (-358.489) (-349.101) * (-353.344) [-357.505] (-365.393) (-368.200) -- 0:01:34
11000 -- [-353.393] (-350.410) (-360.163) (-351.963) * [-356.567] (-359.765) (-365.032) (-359.477) -- 0:01:29
11500 -- (-355.292) [-348.867] (-363.291) (-350.951) * [-362.188] (-359.204) (-363.570) (-353.166) -- 0:01:25
12000 -- (-354.827) [-348.884] (-360.409) (-349.675) * (-367.392) (-361.292) [-356.440] (-350.082) -- 0:01:22
12500 -- [-351.376] (-349.419) (-361.955) (-350.705) * (-370.893) [-356.974] (-355.192) (-351.063) -- 0:01:19
13000 -- (-351.130) (-349.368) [-355.021] (-351.734) * (-361.117) (-362.644) [-359.001] (-349.663) -- 0:01:15
13500 -- (-350.839) (-349.900) [-356.664] (-351.609) * (-357.789) (-357.568) (-363.395) [-349.539] -- 0:01:13
14000 -- (-349.885) [-349.509] (-361.400) (-351.377) * (-357.863) (-355.620) [-357.093] (-349.811) -- 0:01:10
14500 -- [-350.387] (-348.854) (-357.321) (-349.977) * [-358.404] (-355.196) (-363.190) (-349.131) -- 0:01:07
15000 -- [-348.501] (-348.053) (-358.190) (-350.725) * (-353.678) (-354.482) [-354.776] (-349.254) -- 0:01:05
Average standard deviation of split frequencies: 0.080204
15500 -- (-348.757) (-348.687) (-356.079) [-350.524] * (-357.042) (-364.161) [-359.041] (-349.150) -- 0:01:03
16000 -- [-349.980] (-351.635) (-357.808) (-352.137) * (-355.986) (-367.899) [-360.591] (-349.469) -- 0:01:01
16500 -- (-352.776) (-350.896) (-362.504) [-348.634] * (-364.877) (-356.497) [-355.260] (-349.205) -- 0:00:59
17000 -- (-350.049) (-351.824) (-354.270) [-351.316] * (-369.009) (-356.537) (-361.411) [-349.059] -- 0:00:57
17500 -- [-351.566] (-352.454) (-357.907) (-350.631) * (-364.229) (-365.692) [-358.375] (-355.933) -- 0:00:56
18000 -- [-352.314] (-354.177) (-358.758) (-352.887) * (-367.221) (-357.685) (-361.147) [-351.720] -- 0:00:54
18500 -- [-350.711] (-354.133) (-362.952) (-348.992) * (-376.485) (-367.101) [-355.366] (-349.212) -- 0:01:46
19000 -- (-351.766) (-350.987) (-359.463) [-352.201] * (-360.768) (-354.646) [-359.595] (-348.991) -- 0:01:43
19500 -- (-352.809) [-351.901] (-353.969) (-349.247) * (-370.268) [-353.594] (-362.670) (-349.751) -- 0:01:40
20000 -- (-351.485) (-351.386) [-357.605] (-349.719) * (-372.656) [-363.510] (-361.869) (-348.276) -- 0:01:38
Average standard deviation of split frequencies: 0.052463
20500 -- [-348.382] (-350.765) (-367.468) (-351.116) * (-358.711) (-355.616) [-359.722] (-350.510) -- 0:01:35
21000 -- [-348.571] (-351.620) (-357.031) (-349.126) * (-350.780) (-361.783) (-362.376) [-350.396] -- 0:01:33
21500 -- (-348.668) [-350.982] (-361.289) (-349.081) * (-351.169) [-358.198] (-360.742) (-355.035) -- 0:01:31
22000 -- [-353.168] (-349.167) (-357.358) (-350.575) * (-350.319) (-369.260) [-363.161] (-350.342) -- 0:01:28
22500 -- (-350.263) [-350.948] (-355.807) (-348.645) * (-350.469) (-363.569) (-366.050) [-350.141] -- 0:01:26
23000 -- [-355.103] (-348.917) (-363.186) (-348.631) * [-355.773] (-368.343) (-365.366) (-350.603) -- 0:01:24
23500 -- [-349.235] (-350.536) (-367.136) (-349.753) * (-353.526) [-356.940] (-370.554) (-352.266) -- 0:01:23
24000 -- (-348.839) [-352.380] (-356.914) (-349.595) * (-349.489) [-350.578] (-361.992) (-353.580) -- 0:01:21
24500 -- (-350.084) (-349.279) (-360.462) [-351.356] * (-349.867) (-349.026) (-350.824) [-350.208] -- 0:01:19
25000 -- (-349.236) (-349.732) (-364.287) [-349.697] * (-350.206) (-355.132) (-351.026) [-348.839] -- 0:01:18
Average standard deviation of split frequencies: 0.048349
25500 -- (-348.476) (-356.779) (-357.158) [-350.283] * (-350.877) (-359.221) [-349.473] (-349.126) -- 0:01:16
26000 -- [-349.989] (-352.398) (-359.408) (-348.807) * (-349.357) (-348.645) (-349.479) [-351.382] -- 0:01:14
26500 -- (-351.967) (-350.207) (-359.238) [-349.272] * (-351.473) (-352.856) (-349.817) [-348.732] -- 0:01:13
27000 -- (-351.788) (-352.066) [-364.133] (-348.432) * (-351.248) (-349.530) (-349.376) [-350.141] -- 0:01:12
27500 -- (-350.630) [-348.872] (-366.723) (-352.954) * (-350.064) (-352.046) [-348.993] (-350.321) -- 0:01:10
28000 -- (-353.120) (-348.207) [-358.042] (-350.763) * (-349.044) [-350.890] (-351.296) (-348.886) -- 0:01:09
28500 -- [-353.685] (-350.016) (-360.955) (-349.684) * [-350.317] (-352.315) (-349.293) (-350.696) -- 0:01:08
29000 -- (-350.068) (-352.578) (-364.958) [-350.355] * (-351.044) (-352.644) (-347.998) [-351.504] -- 0:01:06
29500 -- (-350.822) [-355.285] (-361.393) (-351.966) * (-351.639) (-354.335) [-349.179] (-349.748) -- 0:01:05
30000 -- (-348.945) [-352.806] (-359.266) (-350.090) * (-353.241) [-352.171] (-351.379) (-350.027) -- 0:01:04
Average standard deviation of split frequencies: 0.042700
30500 -- (-348.645) [-351.355] (-360.103) (-349.847) * [-353.483] (-353.748) (-350.925) (-352.034) -- 0:01:03
31000 -- (-350.010) [-349.453] (-369.387) (-348.365) * [-351.177] (-350.217) (-353.211) (-351.316) -- 0:01:02
31500 -- (-348.973) (-351.024) (-366.565) [-348.734] * (-350.462) (-351.234) [-351.137] (-351.755) -- 0:01:01
32000 -- (-348.452) (-351.093) (-360.574) [-348.827] * (-352.338) [-351.391] (-349.354) (-348.891) -- 0:01:00
32500 -- (-349.030) (-352.664) (-361.821) [-353.311] * (-351.214) (-352.575) [-349.270] (-350.354) -- 0:00:59
33000 -- (-353.134) [-349.338] (-360.937) (-351.114) * [-352.359] (-351.487) (-349.994) (-350.292) -- 0:00:58
33500 -- (-350.215) (-350.137) [-355.063] (-350.968) * (-348.867) [-350.507] (-352.156) (-348.785) -- 0:00:57
34000 -- (-350.420) [-353.258] (-363.021) (-350.689) * [-351.170] (-352.799) (-350.268) (-349.423) -- 0:01:25
34500 -- (-348.288) [-351.712] (-360.523) (-349.360) * (-350.525) (-350.188) [-351.173] (-351.230) -- 0:01:23
35000 -- (-349.243) [-350.315] (-361.033) (-349.127) * [-349.244] (-350.804) (-352.105) (-351.175) -- 0:01:22
Average standard deviation of split frequencies: 0.043135
35500 -- (-349.386) (-348.993) (-358.499) [-348.431] * (-352.386) (-349.313) [-350.663] (-349.274) -- 0:01:21
36000 -- (-349.535) (-350.456) [-358.324] (-352.789) * (-349.901) (-348.227) [-348.343] (-350.371) -- 0:01:20
36500 -- (-350.033) (-352.061) [-362.997] (-353.886) * (-350.475) (-348.376) [-350.886] (-348.915) -- 0:01:19
37000 -- (-350.693) (-351.980) (-360.409) [-351.020] * (-350.883) (-351.264) (-348.655) [-349.260] -- 0:01:18
37500 -- (-350.500) (-352.316) [-355.739] (-350.446) * (-350.440) [-350.084] (-350.677) (-349.313) -- 0:01:17
38000 -- (-351.209) (-350.356) [-361.255] (-351.858) * (-350.033) [-349.789] (-351.617) (-348.609) -- 0:01:15
38500 -- (-350.372) [-351.374] (-360.492) (-353.065) * (-349.605) (-353.350) [-349.672] (-352.505) -- 0:01:14
39000 -- [-350.408] (-351.584) (-359.543) (-350.201) * [-348.734] (-350.498) (-349.803) (-357.138) -- 0:01:13
39500 -- [-351.197] (-354.086) (-359.601) (-351.543) * (-349.010) (-351.414) (-352.149) [-349.256] -- 0:01:12
40000 -- [-350.095] (-350.869) (-355.372) (-350.063) * (-348.445) (-351.055) (-350.142) [-351.388] -- 0:01:12
Average standard deviation of split frequencies: 0.043927
40500 -- (-351.754) (-349.224) (-355.704) [-353.202] * (-349.799) (-357.571) (-349.888) [-349.005] -- 0:01:11
41000 -- (-350.007) (-350.535) [-362.679] (-350.241) * (-351.530) (-357.486) [-349.810] (-354.141) -- 0:01:10
41500 -- (-349.550) (-350.209) [-355.445] (-349.453) * (-350.182) (-350.153) [-349.006] (-349.081) -- 0:01:09
42000 -- [-349.631] (-351.751) (-356.382) (-349.001) * (-352.494) (-349.711) (-350.624) [-348.618] -- 0:01:08
42500 -- (-354.165) (-351.497) [-365.989] (-352.813) * (-350.410) (-348.225) (-349.996) [-350.192] -- 0:01:07
43000 -- (-348.411) (-350.315) (-356.438) [-350.387] * [-351.526] (-350.684) (-349.248) (-353.266) -- 0:01:06
43500 -- (-350.311) (-348.823) (-357.693) [-350.352] * (-357.734) [-348.281] (-348.143) (-354.826) -- 0:01:05
44000 -- (-354.441) [-349.115] (-353.505) (-350.216) * (-358.167) (-348.822) (-349.052) [-350.986] -- 0:01:05
44500 -- (-350.515) (-349.117) (-358.058) [-349.242] * (-356.658) [-348.029] (-349.728) (-354.081) -- 0:01:04
45000 -- (-349.189) [-352.336] (-362.709) (-349.775) * (-352.659) [-353.150] (-348.068) (-352.688) -- 0:01:03
Average standard deviation of split frequencies: 0.044578
45500 -- [-350.625] (-349.613) (-360.784) (-350.504) * (-350.838) [-351.955] (-350.555) (-352.370) -- 0:01:02
46000 -- (-348.898) (-349.591) (-357.718) [-352.271] * (-351.403) (-353.661) [-349.472] (-350.498) -- 0:01:02
46500 -- [-349.688] (-353.703) (-355.863) (-350.215) * (-352.610) (-349.749) (-352.573) [-349.220] -- 0:01:01
47000 -- (-348.983) (-352.035) (-358.713) [-350.097] * [-349.276] (-350.264) (-351.524) (-351.758) -- 0:01:00
47500 -- [-349.113] (-350.237) (-361.150) (-348.736) * [-348.874] (-351.265) (-349.957) (-352.027) -- 0:01:00
48000 -- [-348.859] (-348.808) (-363.986) (-349.834) * (-350.500) (-348.767) (-352.567) [-354.007] -- 0:00:59
48500 -- (-349.640) (-349.673) [-359.715] (-351.064) * (-348.720) [-348.253] (-348.859) (-349.704) -- 0:00:58
49000 -- (-348.594) [-351.129] (-356.461) (-352.014) * (-348.785) (-353.120) (-349.718) [-350.147] -- 0:00:58
49500 -- (-348.979) (-351.757) [-357.431] (-349.836) * (-349.381) [-348.799] (-349.472) (-351.267) -- 0:00:57
50000 -- [-350.853] (-351.803) (-366.402) (-350.746) * [-348.793] (-349.009) (-350.574) (-350.349) -- 0:01:16
Average standard deviation of split frequencies: 0.041868
50500 -- (-350.619) (-353.204) (-363.321) [-350.735] * (-353.199) [-351.745] (-349.935) (-348.649) -- 0:01:15
51000 -- (-350.125) [-349.044] (-362.984) (-348.656) * (-349.017) [-349.928] (-350.456) (-349.637) -- 0:01:14
51500 -- (-353.526) (-348.421) (-363.225) [-349.648] * (-349.322) (-348.923) [-350.287] (-349.266) -- 0:01:13
52000 -- (-350.718) (-349.807) [-363.627] (-351.654) * (-350.005) [-347.880] (-349.055) (-352.696) -- 0:01:12
52500 -- [-348.299] (-348.154) (-361.805) (-350.898) * (-350.997) (-350.600) (-348.356) [-348.578] -- 0:01:12
53000 -- (-351.570) (-350.776) [-359.546] (-350.856) * (-350.308) [-352.258] (-348.527) (-350.332) -- 0:01:11
53500 -- (-351.647) [-350.283] (-362.660) (-350.990) * [-349.211] (-348.233) (-350.343) (-350.046) -- 0:01:10
54000 -- (-349.934) [-350.081] (-360.370) (-351.821) * [-349.080] (-354.398) (-351.436) (-351.092) -- 0:01:10
54500 -- (-352.829) [-351.481] (-359.758) (-351.339) * (-348.353) (-350.998) [-352.937] (-349.637) -- 0:01:09
55000 -- (-349.374) [-352.218] (-364.457) (-351.060) * (-349.353) (-350.425) (-350.776) [-350.769] -- 0:01:08
Average standard deviation of split frequencies: 0.040827
55500 -- (-351.280) (-352.757) [-355.532] (-348.497) * (-349.428) [-351.801] (-354.414) (-348.790) -- 0:01:08
56000 -- [-348.734] (-348.509) (-357.512) (-350.550) * (-350.252) [-348.527] (-350.286) (-355.767) -- 0:01:07
56500 -- (-353.272) [-348.601] (-356.369) (-348.317) * (-352.100) [-349.000] (-350.085) (-354.186) -- 0:01:06
57000 -- (-348.418) [-348.722] (-358.612) (-351.163) * (-348.489) (-351.613) [-349.784] (-348.144) -- 0:01:06
57500 -- (-350.811) [-350.926] (-360.325) (-349.011) * (-348.595) (-351.455) (-349.486) [-349.644] -- 0:01:05
58000 -- [-348.701] (-351.198) (-359.225) (-350.822) * [-348.244] (-350.166) (-351.167) (-350.310) -- 0:01:04
58500 -- [-348.989] (-351.073) (-358.483) (-349.377) * (-349.450) (-350.323) [-348.665] (-351.198) -- 0:01:04
59000 -- [-350.401] (-349.911) (-360.913) (-350.850) * (-354.737) [-349.010] (-349.431) (-350.434) -- 0:01:03
59500 -- [-349.990] (-348.673) (-365.126) (-348.494) * (-356.325) (-356.350) (-352.706) [-348.457] -- 0:01:03
60000 -- (-349.075) (-352.531) [-358.343] (-350.601) * [-349.242] (-350.914) (-351.319) (-348.754) -- 0:01:02
Average standard deviation of split frequencies: 0.037298
60500 -- (-348.728) (-352.760) [-353.624] (-353.103) * (-348.145) [-350.081] (-351.076) (-350.483) -- 0:01:02
61000 -- [-349.643] (-351.400) (-364.646) (-353.386) * (-351.136) (-350.611) [-349.093] (-353.906) -- 0:01:01
61500 -- (-347.959) (-353.085) [-362.463] (-353.208) * (-349.325) (-349.555) (-350.907) [-353.780] -- 0:01:01
62000 -- (-352.538) (-353.628) (-362.910) [-350.126] * (-349.586) (-348.774) (-349.851) [-349.024] -- 0:01:00
62500 -- [-351.221] (-350.631) (-359.196) (-349.548) * (-350.100) (-354.457) [-349.044] (-348.373) -- 0:01:00
63000 -- (-351.392) [-349.327] (-359.663) (-349.944) * (-350.487) (-350.350) (-352.067) [-348.321] -- 0:00:59
63500 -- (-350.593) [-349.236] (-364.621) (-350.152) * (-353.012) [-349.129] (-352.060) (-350.061) -- 0:00:58
64000 -- [-349.780] (-348.302) (-356.539) (-350.113) * (-348.640) (-348.031) [-350.180] (-348.703) -- 0:00:58
64500 -- [-348.279] (-351.747) (-364.651) (-349.336) * [-348.796] (-349.368) (-351.253) (-349.585) -- 0:00:58
65000 -- [-350.414] (-355.987) (-361.821) (-348.981) * [-348.582] (-350.091) (-350.984) (-351.720) -- 0:01:11
Average standard deviation of split frequencies: 0.034012
65500 -- [-353.794] (-350.276) (-355.370) (-348.691) * [-349.541] (-354.161) (-353.841) (-349.307) -- 0:01:11
66000 -- (-353.442) [-350.967] (-360.572) (-350.479) * [-350.503] (-351.720) (-350.767) (-351.767) -- 0:01:10
66500 -- (-350.218) [-351.239] (-357.465) (-350.431) * (-351.048) (-350.535) (-352.592) [-349.218] -- 0:01:10
67000 -- (-348.455) [-352.612] (-363.362) (-353.760) * [-352.440] (-349.076) (-351.500) (-351.081) -- 0:01:09
67500 -- (-349.696) [-351.199] (-359.467) (-357.216) * (-349.694) [-352.217] (-349.071) (-349.989) -- 0:01:09
68000 -- [-350.449] (-348.673) (-365.248) (-351.542) * (-349.141) (-350.961) (-349.450) [-354.684] -- 0:01:08
68500 -- (-349.475) (-350.379) [-357.378] (-349.428) * (-348.978) (-348.885) (-350.636) [-348.937] -- 0:01:07
69000 -- (-350.845) (-348.533) [-354.590] (-350.185) * (-351.566) (-352.228) (-350.972) [-349.194] -- 0:01:07
69500 -- (-348.118) (-349.759) (-363.384) [-347.951] * (-350.234) (-350.360) (-349.319) [-349.552] -- 0:01:06
70000 -- (-348.730) (-350.848) (-363.670) [-349.664] * (-350.911) (-350.511) (-350.124) [-349.623] -- 0:01:06
Average standard deviation of split frequencies: 0.034355
70500 -- [-349.607] (-351.901) (-369.918) (-349.462) * (-349.781) (-349.060) (-351.337) [-349.662] -- 0:01:05
71000 -- [-351.800] (-348.358) (-361.451) (-353.652) * [-350.218] (-353.027) (-351.434) (-349.982) -- 0:01:05
71500 -- (-350.222) (-352.822) [-358.373] (-349.651) * [-348.920] (-351.978) (-351.341) (-351.218) -- 0:01:04
72000 -- [-351.308] (-351.552) (-359.779) (-349.265) * (-349.800) (-350.481) [-349.513] (-348.540) -- 0:01:04
72500 -- (-349.850) (-349.504) [-363.156] (-349.858) * [-349.318] (-351.268) (-352.108) (-351.140) -- 0:01:03
73000 -- (-349.222) (-349.246) (-362.423) [-351.093] * (-353.291) (-351.631) [-349.440] (-349.888) -- 0:01:03
73500 -- (-349.935) [-350.891] (-357.951) (-350.574) * [-350.871] (-348.776) (-348.525) (-352.746) -- 0:01:03
74000 -- [-349.800] (-349.169) (-365.714) (-350.258) * (-351.345) (-352.794) [-349.619] (-350.426) -- 0:01:02
74500 -- (-351.871) (-353.383) [-355.644] (-352.506) * [-349.829] (-354.074) (-351.764) (-349.243) -- 0:01:02
75000 -- [-349.334] (-350.695) (-357.252) (-349.034) * (-351.676) (-353.945) [-350.983] (-350.509) -- 0:01:01
Average standard deviation of split frequencies: 0.031013
75500 -- (-354.064) [-348.154] (-360.671) (-347.956) * (-352.112) (-351.301) [-354.772] (-348.498) -- 0:01:01
76000 -- (-355.122) [-349.984] (-358.768) (-349.274) * (-351.906) [-353.372] (-349.726) (-350.808) -- 0:01:00
76500 -- (-348.850) [-352.404] (-355.615) (-349.272) * (-353.941) (-350.667) [-349.456] (-350.796) -- 0:01:00
77000 -- (-350.069) [-351.921] (-357.361) (-356.578) * (-351.648) (-350.919) (-348.465) [-348.683] -- 0:00:59
77500 -- (-353.582) (-351.790) (-362.139) [-349.488] * (-349.656) (-351.618) (-349.165) [-348.257] -- 0:00:59
78000 -- (-352.291) [-352.112] (-359.326) (-352.161) * [-350.084] (-351.106) (-352.181) (-348.326) -- 0:00:59
78500 -- (-350.226) (-350.455) [-357.298] (-350.755) * (-348.875) (-349.931) [-351.383] (-348.936) -- 0:00:58
79000 -- [-348.988] (-352.408) (-361.216) (-352.328) * [-350.424] (-353.370) (-349.116) (-350.372) -- 0:00:58
79500 -- (-353.940) (-349.390) [-359.150] (-350.191) * (-349.229) (-352.045) [-348.498] (-349.394) -- 0:00:57
80000 -- [-353.252] (-348.100) (-359.654) (-351.376) * (-350.452) (-349.466) (-348.985) [-349.918] -- 0:00:57
Average standard deviation of split frequencies: 0.031167
80500 -- (-348.981) [-348.862] (-362.581) (-356.546) * (-349.089) (-349.534) [-349.145] (-349.827) -- 0:00:57
81000 -- (-349.018) [-349.285] (-361.214) (-351.635) * (-348.570) [-352.591] (-350.022) (-348.055) -- 0:00:56
81500 -- (-349.538) [-352.718] (-360.101) (-349.676) * (-349.789) (-348.102) (-351.647) [-349.785] -- 0:00:56
82000 -- (-348.602) (-350.947) [-352.960] (-348.786) * [-349.641] (-350.101) (-351.519) (-351.317) -- 0:00:55
82500 -- (-353.840) (-349.481) (-357.566) [-349.520] * [-351.020] (-349.054) (-351.033) (-349.773) -- 0:01:06
83000 -- (-349.439) (-351.079) (-356.981) [-351.183] * (-351.253) [-348.351] (-353.219) (-349.988) -- 0:01:06
83500 -- (-350.040) [-351.265] (-365.569) (-354.811) * (-348.745) (-350.514) (-349.762) [-350.264] -- 0:01:05
84000 -- (-349.544) (-349.835) (-367.191) [-349.946] * (-349.492) (-351.816) [-349.843] (-352.069) -- 0:01:05
84500 -- [-350.873] (-350.741) (-366.720) (-348.340) * (-352.386) (-353.742) [-351.987] (-353.615) -- 0:01:05
85000 -- (-349.338) [-350.411] (-359.175) (-357.141) * [-349.536] (-354.150) (-348.980) (-349.941) -- 0:01:04
Average standard deviation of split frequencies: 0.031518
85500 -- (-348.461) (-350.208) (-364.317) [-350.291] * (-353.407) (-349.759) [-348.055] (-348.902) -- 0:01:04
86000 -- (-351.160) [-350.230] (-358.755) (-351.091) * (-349.470) (-354.535) (-350.259) [-350.596] -- 0:01:03
86500 -- (-352.408) [-349.951] (-348.191) (-348.461) * (-349.490) (-351.186) (-349.522) [-349.036] -- 0:01:03
87000 -- (-350.454) (-348.250) [-348.871] (-349.671) * (-352.819) [-348.772] (-350.028) (-349.332) -- 0:01:02
87500 -- (-351.318) (-349.513) [-349.122] (-351.089) * [-350.640] (-351.675) (-349.009) (-350.236) -- 0:01:02
88000 -- (-349.360) (-349.579) (-349.593) [-350.542] * (-352.474) (-350.093) [-347.878] (-350.184) -- 0:01:02
88500 -- (-350.964) [-348.263] (-352.241) (-349.647) * (-359.459) (-354.277) (-351.454) [-350.818] -- 0:01:01
89000 -- (-349.813) (-349.534) [-350.946] (-349.400) * [-353.254] (-349.359) (-351.118) (-352.589) -- 0:01:01
89500 -- (-352.023) (-348.458) (-349.349) [-349.756] * (-351.191) [-348.847] (-349.857) (-350.115) -- 0:01:01
90000 -- (-351.227) [-349.906] (-351.932) (-350.242) * (-350.248) (-352.116) (-349.232) [-349.707] -- 0:01:00
Average standard deviation of split frequencies: 0.029215
90500 -- (-350.275) (-348.819) [-351.886] (-353.003) * (-349.510) (-350.562) [-350.887] (-348.585) -- 0:01:00
91000 -- [-350.520] (-353.155) (-352.617) (-349.807) * [-353.753] (-350.228) (-350.885) (-350.884) -- 0:00:59
91500 -- [-349.369] (-349.819) (-350.670) (-356.052) * (-348.701) (-348.416) [-348.832] (-350.013) -- 0:00:59
92000 -- (-355.030) (-349.549) (-349.217) [-348.476] * (-348.196) (-348.440) (-348.996) [-351.890] -- 0:00:59
92500 -- (-350.404) (-349.081) (-350.136) [-351.575] * (-348.642) (-349.233) [-348.821] (-351.504) -- 0:00:58
93000 -- (-353.032) (-351.585) (-349.868) [-351.259] * (-349.070) [-349.889] (-350.916) (-350.978) -- 0:00:58
93500 -- (-350.254) (-351.143) (-349.819) [-352.271] * (-352.589) (-353.360) (-348.827) [-348.903] -- 0:00:58
94000 -- (-352.110) (-351.501) [-349.593] (-348.517) * (-353.132) (-349.466) [-354.908] (-355.201) -- 0:00:57
94500 -- (-353.152) (-351.819) (-348.481) [-350.275] * (-349.667) (-350.183) (-350.539) [-349.702] -- 0:00:57
95000 -- (-350.908) [-351.011] (-349.365) (-351.366) * [-348.802] (-352.239) (-349.030) (-351.851) -- 0:00:57
Average standard deviation of split frequencies: 0.032900
95500 -- (-348.343) (-351.951) (-349.338) [-349.662] * (-348.712) (-348.348) (-349.165) [-352.244] -- 0:00:56
96000 -- (-350.845) (-348.705) (-354.703) [-348.437] * (-356.994) (-350.714) (-349.186) [-349.221] -- 0:00:56
96500 -- (-350.355) [-349.274] (-355.633) (-349.677) * (-354.300) (-351.658) (-351.186) [-351.151] -- 0:00:56
97000 -- (-355.844) (-351.230) (-350.482) [-349.722] * (-353.197) [-349.957] (-348.587) (-349.332) -- 0:00:55
97500 -- (-351.980) (-349.754) (-349.446) [-348.457] * (-351.016) (-348.596) [-351.105] (-352.094) -- 0:00:55
98000 -- (-349.392) (-358.258) [-349.318] (-348.879) * (-356.278) (-349.981) (-351.441) [-351.542] -- 0:00:55
98500 -- (-350.745) (-350.852) (-349.180) [-350.663] * [-358.970] (-353.591) (-357.154) (-349.293) -- 0:00:54
99000 -- (-349.984) [-349.708] (-349.914) (-352.247) * (-358.603) (-354.108) [-354.834] (-352.718) -- 0:00:54
99500 -- [-351.423] (-349.244) (-348.478) (-352.913) * (-349.816) (-356.803) [-348.783] (-350.557) -- 0:01:03
100000 -- (-349.127) [-349.952] (-348.941) (-352.357) * (-349.282) (-353.434) (-352.702) [-350.356] -- 0:01:02
Average standard deviation of split frequencies: 0.030808
100500 -- (-349.009) [-350.258] (-350.435) (-353.080) * [-349.398] (-353.209) (-350.055) (-350.151) -- 0:01:02
101000 -- (-348.822) (-350.722) [-349.230] (-350.315) * [-349.312] (-351.708) (-354.527) (-353.137) -- 0:01:02
101500 -- (-354.418) [-349.171] (-358.017) (-352.751) * (-351.199) (-351.931) (-349.749) [-351.202] -- 0:01:01
102000 -- (-350.911) (-348.791) (-350.603) [-351.577] * (-348.271) (-349.886) [-350.845] (-349.007) -- 0:01:01
102500 -- [-350.095] (-350.631) (-349.942) (-352.135) * (-351.980) (-348.821) [-350.797] (-352.876) -- 0:01:01
103000 -- (-348.489) (-349.418) (-350.036) [-353.226] * [-350.775] (-350.963) (-352.229) (-349.600) -- 0:01:00
103500 -- (-348.630) [-351.882] (-349.920) (-350.780) * (-350.607) [-350.051] (-351.249) (-348.323) -- 0:01:00
104000 -- (-352.102) [-350.360] (-351.223) (-350.294) * (-350.496) [-348.754] (-353.223) (-348.542) -- 0:01:00
104500 -- [-353.023] (-349.144) (-350.800) (-349.255) * [-351.105] (-350.879) (-349.923) (-351.695) -- 0:00:59
105000 -- (-350.182) [-351.512] (-351.020) (-349.194) * (-348.849) (-351.124) [-350.768] (-357.127) -- 0:00:59
Average standard deviation of split frequencies: 0.026260
105500 -- (-349.716) (-355.782) (-351.780) [-348.710] * [-349.523] (-354.276) (-353.715) (-351.679) -- 0:00:59
106000 -- [-349.699] (-356.035) (-349.758) (-349.793) * (-353.891) [-352.258] (-356.781) (-349.700) -- 0:00:59
106500 -- [-349.251] (-351.207) (-349.302) (-352.617) * [-348.200] (-351.434) (-353.541) (-351.391) -- 0:00:58
107000 -- (-348.472) (-353.389) (-350.569) [-350.388] * [-350.272] (-350.399) (-349.931) (-354.179) -- 0:00:58
107500 -- (-348.439) (-351.339) [-353.415] (-348.556) * (-349.273) (-349.926) [-351.721] (-352.722) -- 0:00:58
108000 -- (-349.100) [-349.823] (-351.647) (-348.065) * (-353.618) [-349.519] (-349.126) (-351.060) -- 0:00:57
108500 -- [-350.838] (-350.093) (-348.358) (-348.537) * (-356.128) (-350.144) [-349.686] (-349.606) -- 0:00:57
109000 -- [-353.720] (-351.338) (-348.236) (-350.340) * [-350.138] (-352.226) (-351.611) (-349.514) -- 0:00:57
109500 -- (-349.758) [-350.273] (-349.276) (-349.076) * (-355.089) [-348.349] (-350.470) (-350.218) -- 0:00:56
110000 -- (-352.965) (-351.511) [-348.460] (-350.078) * [-350.977] (-350.659) (-350.277) (-350.264) -- 0:00:56
Average standard deviation of split frequencies: 0.027992
110500 -- (-350.944) (-350.138) (-348.384) [-350.179] * (-350.500) (-349.475) [-349.362] (-349.464) -- 0:00:56
111000 -- (-348.450) (-348.835) [-350.075] (-348.897) * (-352.168) [-348.716] (-349.893) (-348.618) -- 0:00:56
111500 -- (-350.069) [-348.520] (-348.963) (-351.635) * (-351.496) [-348.745] (-354.901) (-351.034) -- 0:00:55
112000 -- (-348.287) [-349.179] (-348.778) (-348.174) * (-352.198) [-351.037] (-350.031) (-350.879) -- 0:00:55
112500 -- [-348.402] (-348.865) (-350.376) (-348.378) * (-350.331) (-352.021) [-349.298] (-351.842) -- 0:00:55
113000 -- (-348.106) (-349.552) (-349.413) [-350.718] * (-350.865) (-348.933) [-351.323] (-350.223) -- 0:00:54
113500 -- (-349.626) (-348.573) [-349.514] (-353.726) * (-350.770) (-352.843) (-352.406) [-350.103] -- 0:00:54
114000 -- (-352.333) (-354.648) [-348.676] (-349.730) * (-349.743) (-351.198) (-350.552) [-349.796] -- 0:00:54
114500 -- (-354.392) (-355.882) (-349.070) [-349.755] * (-349.044) (-350.060) [-352.778] (-349.430) -- 0:00:54
115000 -- (-349.575) (-350.885) [-350.969] (-350.589) * (-349.544) (-350.232) [-349.106] (-350.941) -- 0:00:53
Average standard deviation of split frequencies: 0.028661
115500 -- [-349.428] (-352.123) (-350.555) (-349.413) * (-352.033) (-352.117) [-349.853] (-351.638) -- 0:00:53
116000 -- (-349.732) [-350.253] (-351.815) (-350.274) * (-351.247) [-352.938] (-350.532) (-348.868) -- 0:00:53
116500 -- (-349.104) (-350.375) (-350.443) [-350.145] * (-350.157) (-350.493) (-348.315) [-348.720] -- 0:01:00
117000 -- (-349.147) (-349.885) [-349.361] (-349.849) * (-353.132) (-348.816) (-349.883) [-349.920] -- 0:01:00
117500 -- [-348.232] (-348.605) (-352.221) (-350.519) * (-352.752) (-355.342) [-352.358] (-351.618) -- 0:01:00
118000 -- (-349.123) (-349.561) [-350.577] (-347.896) * [-351.988] (-349.402) (-349.214) (-350.913) -- 0:00:59
118500 -- (-348.244) (-350.180) (-348.436) [-351.516] * (-350.774) (-349.961) [-351.553] (-349.333) -- 0:00:59
119000 -- (-349.121) [-348.199] (-350.396) (-352.626) * (-349.137) (-349.153) [-352.509] (-350.604) -- 0:00:59
119500 -- (-348.910) (-349.114) (-352.263) [-348.337] * [-349.130] (-348.405) (-349.609) (-356.251) -- 0:00:58
120000 -- (-352.401) (-348.275) (-349.642) [-350.189] * (-348.558) (-349.659) (-349.612) [-351.484] -- 0:00:58
Average standard deviation of split frequencies: 0.027552
120500 -- (-350.064) (-350.588) (-351.946) [-351.278] * (-350.093) [-348.402] (-354.213) (-350.864) -- 0:00:58
121000 -- (-348.391) (-351.725) [-349.885] (-349.708) * (-350.567) (-349.718) [-350.907] (-350.364) -- 0:00:58
121500 -- (-348.801) [-352.377] (-350.927) (-349.499) * (-350.352) (-351.017) (-353.038) [-348.701] -- 0:00:57
122000 -- [-348.919] (-354.932) (-349.517) (-352.201) * [-349.863] (-351.120) (-351.896) (-349.364) -- 0:00:57
122500 -- (-355.427) (-355.356) (-350.239) [-350.088] * (-350.398) (-350.023) (-349.840) [-350.352] -- 0:00:57
123000 -- (-353.140) (-351.069) (-349.555) [-352.092] * (-351.185) (-348.939) [-349.045] (-349.458) -- 0:00:57
123500 -- [-350.909] (-349.665) (-350.758) (-349.846) * (-350.397) [-348.568] (-349.509) (-356.107) -- 0:00:56
124000 -- (-350.423) (-353.466) (-357.241) [-350.905] * (-348.752) (-349.589) [-350.609] (-349.960) -- 0:00:56
124500 -- (-350.978) (-351.142) (-354.846) [-350.757] * (-349.949) [-348.261] (-350.336) (-350.641) -- 0:00:56
125000 -- [-352.381] (-352.723) (-348.349) (-350.662) * (-350.563) [-348.205] (-348.367) (-353.373) -- 0:00:56
Average standard deviation of split frequencies: 0.027174
125500 -- (-349.176) (-352.396) [-348.632] (-350.036) * (-352.395) (-351.675) (-348.169) [-356.009] -- 0:00:55
126000 -- (-349.929) [-349.202] (-349.348) (-349.109) * (-351.684) (-349.695) (-350.625) [-349.324] -- 0:00:55
126500 -- (-349.099) (-352.241) [-349.998] (-353.378) * [-349.637] (-348.835) (-349.586) (-348.978) -- 0:00:55
127000 -- [-353.118] (-357.207) (-353.759) (-351.778) * [-348.562] (-348.280) (-349.808) (-348.805) -- 0:00:54
127500 -- (-350.985) (-349.604) [-354.056] (-348.278) * [-348.785] (-349.798) (-351.470) (-350.043) -- 0:00:54
128000 -- [-350.714] (-348.878) (-351.248) (-349.890) * [-350.433] (-348.174) (-351.971) (-352.914) -- 0:00:54
128500 -- (-351.657) (-350.500) (-350.280) [-350.411] * (-349.430) (-349.998) [-348.435] (-353.024) -- 0:00:54
129000 -- [-349.843] (-350.077) (-357.234) (-350.757) * (-348.668) [-353.080] (-348.526) (-351.066) -- 0:00:54
129500 -- (-353.235) (-352.413) (-356.043) [-349.525] * [-348.395] (-353.996) (-350.612) (-350.034) -- 0:00:53
130000 -- (-351.595) (-350.603) (-349.382) [-349.410] * [-354.114] (-351.734) (-351.396) (-358.323) -- 0:00:53
Average standard deviation of split frequencies: 0.025855
130500 -- (-350.477) (-354.776) (-351.716) [-348.766] * [-349.994] (-355.858) (-350.364) (-350.521) -- 0:00:53
131000 -- [-348.313] (-349.130) (-347.964) (-351.812) * (-349.120) (-351.523) (-348.319) [-349.357] -- 0:00:53
131500 -- (-349.485) (-354.851) (-350.746) [-353.202] * [-350.653] (-348.966) (-354.378) (-352.678) -- 0:00:52
132000 -- [-353.207] (-349.012) (-350.022) (-349.249) * (-352.813) (-348.732) (-357.036) [-349.687] -- 0:00:52
132500 -- (-351.792) (-352.035) (-352.924) [-349.411] * (-349.993) (-353.502) [-348.501] (-351.685) -- 0:00:52
133000 -- (-349.565) (-349.991) [-350.329] (-351.320) * (-352.336) (-349.341) [-348.942] (-348.878) -- 0:00:52
133500 -- (-357.570) [-356.097] (-350.226) (-352.018) * (-350.177) (-347.982) (-348.915) [-350.452] -- 0:00:58
134000 -- (-351.243) (-352.537) [-348.951] (-350.362) * (-352.718) (-349.599) (-348.221) [-352.888] -- 0:00:58
134500 -- (-350.561) [-348.293] (-349.552) (-349.358) * (-351.784) (-350.255) (-351.774) [-349.647] -- 0:00:57
135000 -- (-350.972) [-350.359] (-349.738) (-349.830) * [-351.682] (-349.826) (-353.942) (-349.960) -- 0:00:57
Average standard deviation of split frequencies: 0.025997
135500 -- (-350.953) (-348.164) [-349.077] (-350.144) * (-354.312) (-349.552) [-352.407] (-351.171) -- 0:00:57
136000 -- [-351.115] (-349.025) (-352.155) (-351.045) * (-352.110) (-350.611) [-349.108] (-349.298) -- 0:00:57
136500 -- (-351.354) [-353.008] (-351.301) (-354.697) * (-351.154) [-350.671] (-349.698) (-349.855) -- 0:00:56
137000 -- (-350.005) (-353.748) [-351.274] (-348.924) * (-352.117) [-348.477] (-349.173) (-350.140) -- 0:00:56
137500 -- (-352.150) [-351.532] (-351.018) (-348.407) * (-350.554) (-350.563) (-353.345) [-349.961] -- 0:00:56
138000 -- (-356.194) (-351.916) (-349.335) [-348.427] * (-353.777) [-348.704] (-351.186) (-351.993) -- 0:00:56
138500 -- [-349.510] (-351.898) (-348.614) (-349.585) * (-354.356) [-352.354] (-350.299) (-350.216) -- 0:00:55
139000 -- [-350.056] (-352.013) (-348.325) (-352.035) * (-348.199) (-350.853) [-349.059] (-350.671) -- 0:00:55
139500 -- (-350.821) (-350.492) [-348.245] (-352.051) * [-348.939] (-349.011) (-353.172) (-350.735) -- 0:00:55
140000 -- [-349.313] (-354.854) (-349.431) (-354.430) * [-350.871] (-353.626) (-354.636) (-348.508) -- 0:00:55
Average standard deviation of split frequencies: 0.023831
140500 -- (-350.064) [-349.124] (-348.159) (-351.030) * (-348.758) (-351.554) [-350.664] (-350.329) -- 0:00:55
141000 -- (-348.545) (-351.830) [-348.690] (-349.539) * (-349.713) (-350.373) [-350.515] (-354.573) -- 0:00:54
141500 -- (-349.285) (-349.490) [-349.597] (-349.563) * (-352.000) (-352.168) (-350.493) [-350.639] -- 0:00:54
142000 -- [-351.474] (-351.269) (-348.715) (-348.563) * (-350.667) [-351.254] (-348.269) (-350.187) -- 0:00:54
142500 -- (-349.594) (-348.900) (-352.330) [-349.070] * [-352.940] (-348.318) (-348.911) (-352.547) -- 0:00:54
143000 -- (-349.500) (-350.761) [-349.991] (-352.022) * [-350.256] (-348.532) (-350.734) (-352.683) -- 0:00:53
143500 -- (-351.824) [-351.073] (-350.395) (-351.352) * (-348.972) (-350.698) (-349.572) [-350.866] -- 0:00:53
144000 -- [-349.611] (-350.400) (-350.729) (-351.120) * [-350.765] (-350.833) (-351.459) (-350.668) -- 0:00:53
144500 -- (-351.047) [-352.400] (-352.606) (-352.890) * (-351.217) [-348.812] (-349.490) (-352.974) -- 0:00:53
145000 -- (-349.746) (-350.024) [-352.693] (-348.627) * (-351.393) (-352.341) (-350.068) [-351.831] -- 0:00:53
Average standard deviation of split frequencies: 0.023140
145500 -- (-352.246) (-349.695) [-348.449] (-348.966) * (-349.705) (-349.339) [-350.034] (-350.358) -- 0:00:52
146000 -- (-350.552) [-349.012] (-348.210) (-349.486) * (-350.393) [-351.365] (-352.632) (-352.621) -- 0:00:52
146500 -- (-351.708) (-351.976) (-349.792) [-348.702] * (-349.019) (-350.616) (-356.361) [-348.262] -- 0:00:52
147000 -- (-352.057) [-350.960] (-350.438) (-350.269) * (-351.973) [-348.690] (-355.960) (-348.963) -- 0:00:52
147500 -- (-351.970) (-349.114) [-350.239] (-349.559) * (-350.287) [-348.892] (-351.226) (-351.243) -- 0:00:52
148000 -- (-350.328) [-349.522] (-354.416) (-348.470) * [-351.262] (-348.544) (-350.889) (-350.121) -- 0:00:51
148500 -- (-352.981) (-352.487) (-353.975) [-352.151] * (-351.652) (-352.400) (-349.769) [-348.157] -- 0:00:51
149000 -- [-349.087] (-348.501) (-355.760) (-353.881) * [-352.520] (-349.870) (-349.555) (-350.177) -- 0:00:51
149500 -- [-348.621] (-348.797) (-349.182) (-349.924) * (-352.421) (-350.702) [-350.201] (-352.478) -- 0:00:51
150000 -- [-350.612] (-349.516) (-349.987) (-349.593) * (-348.256) [-348.797] (-350.589) (-355.287) -- 0:00:51
Average standard deviation of split frequencies: 0.023006
150500 -- (-352.832) [-350.879] (-348.136) (-351.222) * [-350.886] (-349.434) (-352.074) (-355.741) -- 0:00:50
151000 -- (-351.603) (-349.265) [-349.562] (-351.897) * (-352.262) [-349.950] (-349.837) (-356.153) -- 0:00:56
151500 -- (-349.570) (-351.538) (-351.770) [-350.018] * (-352.011) (-350.397) [-348.104] (-350.552) -- 0:00:56
152000 -- (-350.720) (-349.092) (-348.544) [-349.937] * (-351.982) (-351.095) [-350.203] (-353.404) -- 0:00:55
152500 -- (-348.760) [-349.845] (-349.460) (-351.465) * (-351.160) (-349.630) [-349.112] (-353.294) -- 0:00:55
153000 -- [-348.653] (-351.923) (-352.015) (-348.472) * (-350.534) (-349.634) (-349.112) [-350.400] -- 0:00:55
153500 -- (-350.099) (-353.454) [-351.412] (-350.128) * [-352.344] (-350.365) (-349.011) (-354.019) -- 0:00:55
154000 -- [-348.396] (-351.485) (-349.898) (-350.395) * [-349.816] (-350.001) (-348.366) (-352.831) -- 0:00:54
154500 -- (-348.270) [-350.635] (-349.038) (-350.487) * [-348.649] (-351.511) (-350.015) (-350.007) -- 0:00:54
155000 -- [-350.132] (-352.479) (-348.909) (-350.279) * (-349.843) (-350.654) (-348.631) [-350.657] -- 0:00:54
Average standard deviation of split frequencies: 0.023335
155500 -- (-348.568) (-349.007) [-350.167] (-350.593) * [-351.378] (-348.151) (-351.094) (-350.050) -- 0:00:54
156000 -- (-349.845) (-350.570) (-349.341) [-350.243] * (-351.229) (-351.995) (-352.089) [-353.688] -- 0:00:54
156500 -- (-348.901) (-349.050) [-350.952] (-350.827) * (-349.811) (-351.541) [-349.596] (-351.951) -- 0:00:53
157000 -- (-348.326) (-352.302) [-354.167] (-350.458) * (-350.983) (-353.044) (-350.222) [-350.142] -- 0:00:53
157500 -- [-349.535] (-349.143) (-351.351) (-350.150) * (-350.762) [-350.439] (-348.825) (-349.052) -- 0:00:53
158000 -- [-352.031] (-355.509) (-348.953) (-350.069) * (-353.250) [-348.374] (-352.988) (-351.434) -- 0:00:53
158500 -- (-348.901) (-351.577) (-350.637) [-348.949] * (-349.987) (-351.466) [-353.733] (-349.276) -- 0:00:53
159000 -- (-348.479) (-351.014) [-353.378] (-353.612) * (-348.894) (-352.646) [-351.837] (-349.308) -- 0:00:52
159500 -- (-352.554) (-349.130) [-349.915] (-350.863) * (-349.595) (-350.722) (-351.085) [-349.586] -- 0:00:52
160000 -- (-349.610) (-349.128) [-351.294] (-353.243) * (-352.254) [-353.172] (-350.594) (-348.218) -- 0:00:52
Average standard deviation of split frequencies: 0.024287
160500 -- [-354.255] (-349.763) (-351.211) (-348.907) * (-354.370) [-350.151] (-351.450) (-348.849) -- 0:00:52
161000 -- (-349.759) (-350.865) [-350.968] (-349.952) * (-351.224) [-350.513] (-350.118) (-348.359) -- 0:00:52
161500 -- (-349.945) (-348.259) (-351.485) [-349.027] * [-348.142] (-351.886) (-353.154) (-354.048) -- 0:00:51
162000 -- (-351.413) (-348.360) (-351.488) [-349.694] * [-349.597] (-350.398) (-350.395) (-351.418) -- 0:00:51
162500 -- (-353.307) (-348.670) (-357.116) [-349.746] * [-349.562] (-353.033) (-349.067) (-348.939) -- 0:00:51
163000 -- (-354.895) (-350.457) (-351.030) [-350.613] * (-350.135) [-352.612] (-353.059) (-348.309) -- 0:00:51
163500 -- (-352.181) (-350.052) [-351.870] (-350.446) * (-352.326) (-351.716) (-350.092) [-354.002] -- 0:00:51
164000 -- (-352.035) [-351.590] (-350.835) (-350.473) * (-352.878) [-348.287] (-350.033) (-350.831) -- 0:00:50
164500 -- [-349.950] (-349.650) (-350.804) (-348.702) * (-351.031) [-348.903] (-350.297) (-352.830) -- 0:00:50
165000 -- (-351.250) [-353.025] (-349.768) (-351.347) * (-349.696) (-349.594) [-350.801] (-350.725) -- 0:00:50
Average standard deviation of split frequencies: 0.021298
165500 -- (-352.257) (-352.394) (-352.784) [-350.013] * (-350.148) (-350.667) [-349.672] (-352.224) -- 0:00:50
166000 -- (-349.237) (-349.423) (-352.973) [-349.676] * (-349.763) (-350.267) [-350.212] (-350.641) -- 0:00:50
166500 -- (-348.676) (-351.562) [-350.929] (-348.936) * (-353.060) (-353.606) (-350.728) [-350.355] -- 0:00:50
167000 -- (-350.259) [-351.114] (-350.979) (-349.247) * [-351.607] (-349.568) (-348.752) (-354.658) -- 0:00:49
167500 -- (-349.773) (-349.880) (-351.185) [-350.670] * (-350.321) (-352.452) (-350.019) [-351.699] -- 0:00:49
168000 -- [-349.060] (-349.876) (-350.122) (-350.246) * (-349.947) (-351.082) (-348.515) [-349.758] -- 0:00:54
168500 -- (-351.541) (-350.482) (-348.440) [-351.955] * (-349.529) (-353.107) (-350.300) [-349.846] -- 0:00:54
169000 -- (-353.752) [-348.660] (-348.681) (-349.609) * [-348.001] (-351.005) (-352.045) (-352.645) -- 0:00:54
169500 -- [-354.961] (-350.784) (-354.495) (-350.328) * (-350.270) [-349.984] (-349.336) (-349.138) -- 0:00:53
170000 -- [-348.226] (-355.675) (-353.080) (-354.458) * (-351.695) (-350.274) [-350.225] (-350.646) -- 0:00:53
Average standard deviation of split frequencies: 0.019916
170500 -- (-349.370) (-350.061) [-350.434] (-351.198) * (-350.205) (-350.974) (-347.988) [-352.529] -- 0:00:53
171000 -- (-349.252) [-349.885] (-354.471) (-351.780) * [-349.727] (-352.305) (-352.138) (-355.311) -- 0:00:53
171500 -- (-350.436) [-350.326] (-352.239) (-352.651) * (-349.163) (-349.128) (-349.721) [-348.769] -- 0:00:53
172000 -- (-348.659) (-350.737) (-349.436) [-348.388] * (-349.220) (-349.723) [-350.553] (-349.732) -- 0:00:52
172500 -- [-349.301] (-350.620) (-351.566) (-348.933) * [-353.843] (-348.830) (-349.592) (-350.112) -- 0:00:52
173000 -- (-353.260) (-350.644) [-350.053] (-349.404) * (-354.271) (-355.319) (-351.504) [-349.188] -- 0:00:52
173500 -- (-348.913) (-352.860) (-349.668) [-350.034] * [-349.332] (-349.776) (-350.041) (-349.761) -- 0:00:52
174000 -- (-350.824) (-348.306) [-353.927] (-350.636) * (-348.788) (-347.893) (-350.129) [-348.530] -- 0:00:52
174500 -- (-348.998) [-350.040] (-350.258) (-352.548) * [-349.109] (-350.936) (-351.863) (-351.281) -- 0:00:52
175000 -- (-351.847) (-348.535) (-351.345) [-349.557] * (-351.974) (-354.640) (-351.977) [-350.088] -- 0:00:51
Average standard deviation of split frequencies: 0.020237
175500 -- [-350.383] (-351.018) (-351.403) (-354.090) * (-351.655) (-349.724) (-350.354) [-350.347] -- 0:00:51
176000 -- (-351.707) [-351.006] (-348.670) (-350.227) * [-349.912] (-351.618) (-351.812) (-351.348) -- 0:00:51
176500 -- [-349.904] (-348.787) (-349.117) (-351.874) * (-350.464) [-350.617] (-350.932) (-359.160) -- 0:00:51
177000 -- (-351.802) (-350.745) (-352.437) [-352.573] * (-353.711) (-348.784) (-351.696) [-351.120] -- 0:00:51
177500 -- (-348.038) [-350.077] (-351.683) (-352.497) * [-352.415] (-349.851) (-348.661) (-350.673) -- 0:00:50
178000 -- [-351.349] (-348.876) (-352.242) (-349.723) * [-353.209] (-350.084) (-350.729) (-349.438) -- 0:00:50
178500 -- (-352.244) [-349.120] (-348.720) (-350.114) * [-350.365] (-349.526) (-349.988) (-349.408) -- 0:00:50
179000 -- (-352.570) [-350.700] (-350.356) (-349.153) * (-350.729) [-349.771] (-353.474) (-349.512) -- 0:00:50
179500 -- (-352.717) [-350.856] (-350.436) (-351.459) * [-355.441] (-352.190) (-361.654) (-350.303) -- 0:00:50
180000 -- (-353.637) (-350.649) (-349.554) [-351.215] * [-350.366] (-351.472) (-350.460) (-349.992) -- 0:00:50
Average standard deviation of split frequencies: 0.020004
180500 -- (-350.362) (-353.957) [-349.132] (-350.308) * (-352.789) [-349.523] (-350.352) (-350.941) -- 0:00:49
181000 -- (-349.078) (-350.042) (-350.909) [-350.751] * (-354.267) [-350.084] (-350.444) (-350.012) -- 0:00:49
181500 -- (-353.019) (-349.855) [-352.909] (-348.530) * (-350.802) (-348.880) [-350.914] (-352.231) -- 0:00:49
182000 -- (-350.292) [-349.329] (-349.877) (-350.495) * [-350.832] (-348.479) (-353.895) (-347.902) -- 0:00:49
182500 -- (-349.541) [-348.826] (-351.174) (-349.718) * [-350.087] (-348.898) (-348.775) (-349.267) -- 0:00:49
183000 -- (-349.306) (-355.170) (-354.153) [-351.547] * (-351.402) (-350.282) [-348.567] (-348.422) -- 0:00:49
183500 -- [-350.080] (-352.510) (-352.623) (-350.090) * (-348.016) [-352.500] (-349.228) (-348.464) -- 0:00:48
184000 -- (-350.127) (-353.521) [-348.431] (-350.848) * (-348.247) [-350.230] (-349.763) (-349.512) -- 0:00:48
184500 -- [-348.612] (-349.457) (-350.012) (-349.492) * (-350.032) (-352.658) (-350.224) [-350.509] -- 0:00:48
185000 -- [-351.858] (-350.674) (-348.026) (-349.454) * (-350.487) (-348.557) [-349.935] (-350.491) -- 0:00:52
Average standard deviation of split frequencies: 0.020529
185500 -- (-351.861) [-351.515] (-349.135) (-348.462) * (-350.505) (-349.395) [-349.172] (-351.096) -- 0:00:52
186000 -- [-350.161] (-349.292) (-349.812) (-348.480) * (-354.651) (-349.919) [-350.181] (-349.850) -- 0:00:52
186500 -- [-353.305] (-353.956) (-349.235) (-348.264) * (-349.303) [-351.418] (-349.466) (-349.895) -- 0:00:52
187000 -- (-353.582) (-351.817) (-349.613) [-348.640] * (-349.571) (-351.417) [-351.042] (-350.094) -- 0:00:52
187500 -- (-350.144) (-349.313) (-348.788) [-351.078] * (-349.494) (-349.082) [-348.504] (-350.462) -- 0:00:52
188000 -- (-349.330) (-350.271) (-351.200) [-350.450] * [-355.264] (-354.171) (-349.698) (-348.859) -- 0:00:51
188500 -- (-349.295) (-355.965) (-350.245) [-349.249] * (-353.342) [-349.948] (-352.216) (-348.500) -- 0:00:51
189000 -- [-348.976] (-353.588) (-350.071) (-349.591) * (-349.617) [-349.135] (-350.824) (-349.356) -- 0:00:51
189500 -- (-349.551) (-357.658) (-349.724) [-348.964] * (-350.287) (-348.214) [-349.512] (-350.489) -- 0:00:51
190000 -- (-351.467) [-355.285] (-352.284) (-349.136) * (-350.145) [-349.682] (-351.569) (-349.067) -- 0:00:51
Average standard deviation of split frequencies: 0.020170
190500 -- (-351.789) (-355.305) [-353.089] (-349.010) * (-351.656) (-349.527) (-350.342) [-350.306] -- 0:00:50
191000 -- (-349.016) [-351.288] (-350.843) (-348.537) * (-350.066) (-351.197) [-349.889] (-350.296) -- 0:00:50
191500 -- [-350.202] (-350.455) (-351.237) (-349.527) * (-351.832) (-352.091) [-352.136] (-348.646) -- 0:00:50
192000 -- (-348.623) (-350.034) [-348.928] (-353.107) * (-352.681) (-353.809) (-351.727) [-348.592] -- 0:00:50
192500 -- [-350.103] (-350.879) (-351.616) (-350.863) * [-352.798] (-351.172) (-348.596) (-351.086) -- 0:00:50
193000 -- (-350.590) (-349.488) (-352.219) [-349.159] * (-351.361) (-350.247) (-350.440) [-348.142] -- 0:00:50
193500 -- (-350.095) [-349.736] (-350.759) (-349.194) * (-351.127) [-350.836] (-350.568) (-347.893) -- 0:00:50
194000 -- (-349.978) [-349.175] (-350.079) (-348.419) * (-349.027) (-348.737) [-349.926] (-348.947) -- 0:00:49
194500 -- (-350.551) [-350.163] (-351.582) (-350.800) * (-355.647) [-350.018] (-349.066) (-349.395) -- 0:00:49
195000 -- (-350.244) (-349.655) (-350.864) [-349.628] * (-350.530) (-352.788) (-351.307) [-350.691] -- 0:00:49
Average standard deviation of split frequencies: 0.019602
195500 -- (-350.037) (-349.579) [-350.144] (-348.723) * (-350.950) (-349.504) [-350.142] (-350.308) -- 0:00:49
196000 -- (-350.929) (-349.874) (-349.452) [-349.548] * (-350.206) [-350.457] (-350.002) (-348.343) -- 0:00:49
196500 -- (-355.809) [-349.704] (-352.156) (-352.431) * (-350.638) [-349.610] (-349.490) (-350.405) -- 0:00:49
197000 -- (-348.429) (-352.432) (-357.828) [-349.523] * [-348.417] (-351.129) (-350.803) (-348.388) -- 0:00:48
197500 -- (-348.837) (-351.933) [-351.223] (-351.077) * (-350.939) (-351.257) [-350.523] (-352.252) -- 0:00:48
198000 -- [-348.458] (-351.102) (-349.638) (-351.451) * (-348.850) (-355.153) (-349.815) [-351.369] -- 0:00:48
198500 -- (-350.674) (-350.052) [-349.138] (-348.351) * (-349.103) (-348.885) (-354.726) [-352.384] -- 0:00:48
199000 -- [-349.604] (-349.630) (-348.280) (-350.760) * (-349.326) [-350.574] (-348.998) (-352.664) -- 0:00:48
199500 -- (-350.499) (-350.023) (-349.250) [-350.985] * (-350.196) [-350.037] (-348.241) (-351.424) -- 0:00:48
200000 -- (-353.638) (-351.509) (-350.528) [-349.667] * (-354.824) (-351.704) [-350.623] (-349.417) -- 0:00:48
Average standard deviation of split frequencies: 0.018175
200500 -- (-350.117) [-349.411] (-350.276) (-352.333) * [-349.173] (-353.954) (-348.958) (-348.947) -- 0:00:47
201000 -- [-349.173] (-352.163) (-349.805) (-349.439) * (-350.137) (-352.295) [-350.705] (-349.407) -- 0:00:47
201500 -- [-348.798] (-351.783) (-349.021) (-353.413) * [-352.456] (-349.069) (-352.015) (-350.786) -- 0:00:47
202000 -- (-351.550) (-354.039) [-349.721] (-349.368) * (-350.556) [-352.351] (-354.041) (-351.657) -- 0:00:51
202500 -- (-348.268) (-350.293) (-350.338) [-353.445] * (-350.405) [-353.550] (-348.786) (-349.324) -- 0:00:51
203000 -- (-350.920) (-351.257) (-350.995) [-350.020] * (-349.615) [-350.993] (-348.749) (-350.014) -- 0:00:51
203500 -- (-349.876) (-352.185) (-350.249) [-348.234] * (-349.587) [-353.050] (-352.097) (-350.144) -- 0:00:50
204000 -- (-350.528) [-351.422] (-352.002) (-352.576) * [-350.420] (-350.315) (-350.636) (-349.103) -- 0:00:50
204500 -- [-349.775] (-353.958) (-350.013) (-350.457) * (-349.582) (-351.022) [-349.690] (-350.479) -- 0:00:50
205000 -- (-350.128) [-356.733] (-350.308) (-351.616) * (-352.332) (-350.300) [-350.102] (-350.469) -- 0:00:50
Average standard deviation of split frequencies: 0.017464
205500 -- (-352.469) [-352.248] (-349.477) (-352.064) * [-350.406] (-351.325) (-350.409) (-352.025) -- 0:00:50
206000 -- (-353.376) [-350.579] (-354.821) (-349.235) * (-348.581) (-351.488) [-351.246] (-352.497) -- 0:00:50
206500 -- [-350.678] (-350.916) (-352.544) (-350.058) * (-350.322) (-350.958) [-352.399] (-350.975) -- 0:00:49
207000 -- (-348.982) [-349.702] (-351.207) (-350.800) * [-351.063] (-350.046) (-348.061) (-355.127) -- 0:00:49
207500 -- [-349.874] (-349.051) (-349.321) (-348.143) * [-348.890] (-353.119) (-349.846) (-350.191) -- 0:00:49
208000 -- (-350.129) [-349.564] (-354.444) (-348.431) * (-348.927) [-351.469] (-354.634) (-350.433) -- 0:00:49
208500 -- (-350.491) (-350.698) (-351.006) [-348.720] * (-349.753) (-352.508) (-353.244) [-350.369] -- 0:00:49
209000 -- [-349.379] (-349.360) (-351.330) (-349.840) * (-355.212) [-353.487] (-353.443) (-350.778) -- 0:00:49
209500 -- (-350.545) (-350.186) [-350.244] (-349.890) * (-350.005) [-349.319] (-353.420) (-352.634) -- 0:00:49
210000 -- (-349.840) (-352.968) [-349.276] (-349.506) * (-348.446) [-348.419] (-352.884) (-349.940) -- 0:00:48
Average standard deviation of split frequencies: 0.019132
210500 -- (-352.812) (-352.513) (-348.015) [-349.351] * (-348.962) (-352.872) (-349.439) [-349.083] -- 0:00:48
211000 -- (-353.372) [-354.738] (-350.666) (-351.342) * [-349.818] (-350.599) (-349.211) (-349.382) -- 0:00:48
211500 -- (-349.480) (-352.547) [-348.263] (-350.660) * (-352.404) (-350.941) [-350.679] (-349.197) -- 0:00:48
212000 -- (-353.300) [-350.545] (-349.998) (-348.241) * (-350.829) (-353.034) [-349.386] (-349.275) -- 0:00:48
212500 -- (-350.520) (-350.716) [-349.280] (-348.956) * (-349.167) [-352.970] (-348.467) (-354.377) -- 0:00:48
213000 -- [-349.000] (-348.281) (-350.399) (-349.070) * (-349.437) (-350.306) [-349.452] (-354.339) -- 0:00:48
213500 -- (-348.797) (-355.696) (-348.332) [-352.616] * (-350.444) [-349.205] (-349.346) (-351.060) -- 0:00:47
214000 -- (-350.797) (-352.554) [-348.634] (-353.319) * (-351.159) [-349.270] (-348.285) (-349.510) -- 0:00:47
214500 -- (-351.199) (-350.788) [-350.890] (-350.318) * (-351.753) (-350.012) [-348.538] (-348.556) -- 0:00:47
215000 -- (-351.461) [-351.366] (-349.436) (-349.908) * [-353.815] (-348.787) (-350.935) (-350.849) -- 0:00:47
Average standard deviation of split frequencies: 0.019314
215500 -- [-351.897] (-353.573) (-350.103) (-349.402) * [-350.538] (-352.171) (-350.665) (-349.266) -- 0:00:47
216000 -- (-350.153) [-349.719] (-349.428) (-355.827) * (-350.793) [-350.648] (-350.883) (-353.210) -- 0:00:47
216500 -- (-352.013) (-354.316) (-351.295) [-348.489] * [-351.816] (-354.370) (-350.468) (-349.805) -- 0:00:47
217000 -- (-351.188) (-350.622) [-350.479] (-349.112) * (-349.869) [-351.188] (-350.746) (-348.404) -- 0:00:46
217500 -- (-352.542) (-354.100) (-349.679) [-348.390] * (-352.451) (-348.644) [-352.171] (-350.242) -- 0:00:46
218000 -- [-350.003] (-351.930) (-352.283) (-351.755) * (-350.515) [-350.264] (-349.592) (-349.550) -- 0:00:46
218500 -- [-350.418] (-351.140) (-354.706) (-354.072) * (-349.686) (-348.584) [-348.611] (-348.409) -- 0:00:46
219000 -- [-349.904] (-350.129) (-352.241) (-349.246) * (-349.540) (-351.422) (-347.999) [-351.971] -- 0:00:46
219500 -- (-353.001) (-351.686) [-352.815] (-347.905) * (-349.168) (-348.934) (-351.526) [-348.431] -- 0:00:49
220000 -- (-352.116) (-350.259) (-349.477) [-347.905] * (-350.072) (-350.889) (-351.450) [-348.486] -- 0:00:49
Average standard deviation of split frequencies: 0.020295
220500 -- (-351.647) [-350.593] (-348.454) (-349.534) * (-349.608) [-350.233] (-349.782) (-348.577) -- 0:00:49
221000 -- (-349.197) [-351.608] (-353.062) (-350.601) * (-351.801) [-348.273] (-349.033) (-349.772) -- 0:00:49
221500 -- (-350.421) (-349.849) [-350.323] (-350.999) * [-349.588] (-356.133) (-351.409) (-355.216) -- 0:00:49
222000 -- (-353.219) [-349.309] (-352.028) (-349.985) * (-348.292) [-351.581] (-351.237) (-349.267) -- 0:00:49
222500 -- (-350.836) [-348.152] (-353.134) (-354.153) * (-351.062) (-350.725) [-348.550] (-349.706) -- 0:00:48
223000 -- [-350.811] (-349.315) (-348.359) (-350.823) * [-350.459] (-352.487) (-349.543) (-349.600) -- 0:00:48
223500 -- (-348.695) [-348.604] (-351.156) (-350.170) * (-349.225) (-352.127) (-350.339) [-349.251] -- 0:00:48
224000 -- (-351.164) (-350.764) (-349.099) [-349.553] * (-349.913) (-350.332) [-349.447] (-351.104) -- 0:00:48
224500 -- (-350.158) (-352.222) (-349.129) [-349.855] * (-354.386) (-350.453) [-353.058] (-351.556) -- 0:00:48
225000 -- (-353.311) (-351.276) [-349.834] (-350.274) * (-348.862) (-351.562) [-352.769] (-351.633) -- 0:00:48
Average standard deviation of split frequencies: 0.021171
225500 -- (-348.064) (-350.512) [-350.796] (-349.919) * (-350.054) (-350.649) (-350.755) [-350.165] -- 0:00:48
226000 -- [-348.530] (-349.477) (-349.426) (-351.775) * (-348.750) (-350.531) [-348.681] (-349.952) -- 0:00:47
226500 -- [-352.511] (-350.329) (-350.691) (-350.268) * (-351.495) (-349.034) (-348.181) [-354.235] -- 0:00:47
227000 -- (-348.539) (-347.991) [-350.475] (-350.986) * [-349.261] (-354.973) (-350.910) (-351.652) -- 0:00:47
227500 -- [-349.290] (-349.124) (-349.022) (-350.559) * (-353.589) (-352.147) [-351.977] (-348.706) -- 0:00:47
228000 -- (-348.849) (-349.350) (-350.207) [-348.565] * (-352.157) [-352.450] (-352.194) (-348.781) -- 0:00:47
228500 -- (-349.399) (-351.593) (-350.945) [-348.841] * (-349.197) (-349.059) [-349.388] (-351.349) -- 0:00:47
229000 -- (-355.166) (-351.351) (-349.457) [-350.040] * (-348.316) [-353.656] (-355.470) (-348.982) -- 0:00:47
229500 -- (-351.127) (-350.795) (-350.689) [-348.401] * (-352.599) (-351.259) (-351.230) [-348.515] -- 0:00:47
230000 -- (-353.049) (-350.151) [-351.397] (-350.460) * (-349.109) (-352.680) [-352.104] (-350.710) -- 0:00:46
Average standard deviation of split frequencies: 0.021405
230500 -- [-350.481] (-349.651) (-350.620) (-354.505) * [-349.679] (-352.000) (-350.216) (-352.953) -- 0:00:46
231000 -- (-348.711) (-352.349) (-353.932) [-353.446] * (-351.372) (-348.655) (-351.355) [-352.028] -- 0:00:46
231500 -- (-353.917) [-350.621] (-349.462) (-350.363) * (-349.086) [-350.062] (-349.232) (-348.846) -- 0:00:46
232000 -- (-354.204) [-352.873] (-348.290) (-351.886) * (-349.490) (-351.319) [-349.165] (-350.839) -- 0:00:46
232500 -- (-355.820) [-348.944] (-349.019) (-349.732) * (-350.600) [-349.652] (-353.379) (-351.417) -- 0:00:46
233000 -- (-349.002) (-352.007) (-348.982) [-349.056] * (-350.444) (-353.107) [-348.163] (-350.123) -- 0:00:46
233500 -- (-348.096) (-350.739) (-349.826) [-350.730] * (-352.060) (-349.824) [-351.869] (-350.784) -- 0:00:45
234000 -- [-349.582] (-354.498) (-351.701) (-350.944) * [-350.066] (-352.748) (-349.714) (-349.074) -- 0:00:45
234500 -- (-350.822) (-352.676) (-348.505) [-350.932] * (-350.926) [-354.053] (-349.485) (-349.187) -- 0:00:45
235000 -- (-351.027) (-350.973) [-350.696] (-354.495) * (-348.321) (-353.531) [-351.631] (-353.543) -- 0:00:45
Average standard deviation of split frequencies: 0.018754
235500 -- (-353.979) [-351.396] (-350.550) (-351.751) * (-349.792) (-351.926) [-351.457] (-353.047) -- 0:00:45
236000 -- (-351.960) (-355.921) [-349.963] (-349.894) * (-351.863) (-353.928) (-349.419) [-349.634] -- 0:00:45
236500 -- (-350.963) (-349.649) [-350.692] (-348.221) * (-351.731) (-350.231) [-348.533] (-349.963) -- 0:00:48
237000 -- (-349.452) (-350.672) (-349.838) [-351.629] * [-348.741] (-351.243) (-349.861) (-350.627) -- 0:00:48
237500 -- (-351.528) [-351.002] (-353.279) (-352.805) * (-351.448) [-350.022] (-352.106) (-348.448) -- 0:00:48
238000 -- [-348.747] (-354.049) (-350.372) (-354.946) * (-349.918) (-353.729) (-350.814) [-350.399] -- 0:00:48
238500 -- (-352.790) [-349.539] (-349.175) (-350.971) * [-350.988] (-351.888) (-349.734) (-350.881) -- 0:00:47
239000 -- [-349.055] (-354.819) (-351.551) (-351.512) * (-349.946) [-355.895] (-349.423) (-354.408) -- 0:00:47
239500 -- (-348.846) (-354.138) [-348.634] (-348.565) * (-349.733) (-350.252) [-350.362] (-351.753) -- 0:00:47
240000 -- (-349.914) (-349.299) (-351.692) [-350.215] * (-352.546) (-349.830) [-349.220] (-351.694) -- 0:00:47
Average standard deviation of split frequencies: 0.017744
240500 -- (-350.807) [-350.342] (-350.365) (-349.514) * [-352.088] (-350.292) (-353.652) (-351.543) -- 0:00:47
241000 -- (-351.722) (-348.929) (-350.020) [-351.086] * (-353.187) (-352.174) [-351.672] (-348.540) -- 0:00:47
241500 -- (-355.756) [-348.952] (-352.979) (-350.731) * (-348.544) [-347.842] (-349.625) (-349.543) -- 0:00:47
242000 -- (-354.164) (-352.832) (-353.639) [-350.790] * (-349.146) [-350.148] (-348.680) (-351.554) -- 0:00:46
242500 -- (-348.548) (-350.397) [-352.141] (-350.883) * (-349.237) [-350.387] (-349.855) (-349.029) -- 0:00:46
243000 -- (-350.058) (-350.447) (-354.351) [-348.653] * (-351.723) [-350.387] (-352.698) (-351.369) -- 0:00:46
243500 -- (-349.077) (-352.990) (-352.485) [-349.697] * [-348.302] (-348.665) (-352.835) (-349.097) -- 0:00:46
244000 -- (-348.874) (-348.948) (-350.202) [-353.246] * (-348.500) [-349.585] (-350.214) (-351.159) -- 0:00:46
244500 -- (-349.432) [-350.919] (-351.796) (-350.734) * (-349.053) [-352.412] (-350.704) (-350.731) -- 0:00:46
245000 -- [-354.657] (-348.809) (-352.480) (-348.851) * (-349.545) (-350.252) [-349.459] (-349.428) -- 0:00:46
Average standard deviation of split frequencies: 0.017034
245500 -- (-348.848) (-348.445) (-348.575) [-349.485] * (-349.192) (-347.938) (-350.129) [-349.113] -- 0:00:46
246000 -- (-348.881) (-348.221) [-351.445] (-348.737) * (-348.747) (-354.769) (-351.355) [-349.786] -- 0:00:45
246500 -- (-347.983) (-349.223) [-350.007] (-353.777) * (-349.141) (-354.765) [-349.864] (-350.274) -- 0:00:45
247000 -- (-359.023) [-349.191] (-351.354) (-354.171) * [-348.926] (-349.018) (-350.575) (-351.780) -- 0:00:45
247500 -- (-353.393) (-349.857) (-353.670) [-350.129] * [-349.304] (-350.421) (-348.050) (-351.746) -- 0:00:45
248000 -- (-350.632) [-350.042] (-349.766) (-353.210) * (-349.925) [-350.174] (-348.354) (-353.291) -- 0:00:45
248500 -- (-352.052) (-352.930) (-349.398) [-348.200] * (-351.070) [-349.884] (-352.093) (-354.300) -- 0:00:45
249000 -- (-348.362) (-354.742) (-348.748) [-349.023] * [-350.349] (-349.682) (-348.450) (-355.617) -- 0:00:45
249500 -- [-350.779] (-352.561) (-348.123) (-348.968) * (-349.121) [-348.705] (-351.008) (-349.346) -- 0:00:45
250000 -- (-349.996) (-349.559) [-348.454] (-348.428) * (-349.909) (-349.108) (-350.503) [-349.714] -- 0:00:45
Average standard deviation of split frequencies: 0.017239
250500 -- (-349.547) [-351.009] (-348.841) (-352.242) * [-349.192] (-351.672) (-348.785) (-349.427) -- 0:00:44
251000 -- (-349.311) [-349.590] (-349.997) (-350.254) * (-350.540) (-352.023) [-351.660] (-352.119) -- 0:00:44
251500 -- (-348.663) (-348.377) (-353.205) [-349.699] * [-349.599] (-350.731) (-348.794) (-349.833) -- 0:00:44
252000 -- [-348.397] (-352.218) (-352.069) (-349.531) * [-349.211] (-351.369) (-353.633) (-352.944) -- 0:00:44
252500 -- [-348.609] (-348.956) (-351.318) (-355.802) * [-350.367] (-350.103) (-354.552) (-350.047) -- 0:00:44
253000 -- (-351.141) (-352.784) (-350.252) [-348.894] * [-349.409] (-351.316) (-351.389) (-349.694) -- 0:00:44
253500 -- [-350.068] (-354.223) (-351.876) (-354.270) * [-349.546] (-351.913) (-352.480) (-349.699) -- 0:00:47
254000 -- (-351.542) [-353.670] (-349.920) (-350.469) * (-351.549) (-348.723) (-348.494) [-350.138] -- 0:00:46
254500 -- [-349.507] (-352.955) (-348.534) (-350.997) * [-354.139] (-353.163) (-351.681) (-347.829) -- 0:00:46
255000 -- (-349.237) (-349.893) [-351.501] (-352.434) * (-351.255) (-350.901) (-352.514) [-350.092] -- 0:00:46
Average standard deviation of split frequencies: 0.017348
255500 -- (-348.773) (-349.769) [-351.577] (-352.640) * (-352.366) [-349.281] (-353.353) (-350.586) -- 0:00:46
256000 -- (-349.139) (-349.278) [-349.236] (-350.506) * (-351.722) [-353.135] (-351.101) (-350.158) -- 0:00:46
256500 -- [-350.256] (-349.293) (-349.118) (-349.867) * (-350.657) [-351.641] (-350.125) (-351.788) -- 0:00:46
257000 -- [-352.120] (-351.731) (-352.283) (-349.928) * (-352.405) (-353.643) [-349.035] (-349.946) -- 0:00:46
257500 -- (-350.025) (-349.696) (-349.333) [-348.515] * (-349.074) (-350.787) (-349.208) [-351.059] -- 0:00:46
258000 -- (-351.274) (-352.679) [-348.994] (-350.139) * [-350.815] (-349.463) (-351.401) (-350.527) -- 0:00:46
258500 -- (-352.074) (-352.872) (-349.558) [-349.265] * [-353.593] (-350.141) (-348.943) (-354.356) -- 0:00:45
259000 -- (-349.060) (-349.366) [-349.635] (-351.117) * [-349.906] (-348.925) (-349.267) (-352.977) -- 0:00:45
259500 -- [-349.376] (-352.153) (-348.910) (-349.319) * (-351.154) (-348.137) [-351.183] (-350.969) -- 0:00:45
260000 -- (-350.013) (-353.657) (-349.308) [-348.177] * (-350.180) (-351.444) [-349.284] (-348.366) -- 0:00:45
Average standard deviation of split frequencies: 0.016879
260500 -- (-348.828) (-350.576) (-349.362) [-350.741] * (-349.341) (-348.013) (-348.821) [-349.186] -- 0:00:45
261000 -- [-353.578] (-350.874) (-350.621) (-354.122) * (-350.794) (-349.734) [-350.746] (-349.042) -- 0:00:45
261500 -- (-350.213) (-351.812) (-350.051) [-348.576] * (-350.296) [-350.681] (-349.308) (-351.384) -- 0:00:45
262000 -- (-349.905) (-351.082) [-349.335] (-350.032) * (-351.050) (-352.509) (-348.822) [-349.359] -- 0:00:45
262500 -- [-348.498] (-348.225) (-349.459) (-351.949) * (-350.288) (-351.906) (-349.206) [-353.002] -- 0:00:44
263000 -- (-349.179) [-349.164] (-351.684) (-354.165) * (-348.689) [-349.191] (-348.724) (-354.003) -- 0:00:44
263500 -- (-350.017) [-348.740] (-349.939) (-350.682) * [-348.610] (-349.064) (-348.421) (-348.314) -- 0:00:44
264000 -- (-350.768) [-350.447] (-352.209) (-348.921) * (-351.128) (-348.378) (-350.494) [-349.689] -- 0:00:44
264500 -- (-351.249) [-352.193] (-349.194) (-353.932) * (-350.743) (-349.797) [-350.994] (-349.504) -- 0:00:44
265000 -- (-351.788) [-354.808] (-349.810) (-349.606) * (-348.428) (-352.265) (-350.401) [-350.483] -- 0:00:44
Average standard deviation of split frequencies: 0.016393
265500 -- (-353.329) [-350.681] (-352.296) (-350.630) * (-350.280) (-352.625) [-352.850] (-350.119) -- 0:00:44
266000 -- (-358.077) (-350.729) (-352.645) [-350.761] * (-350.667) [-349.863] (-350.776) (-353.932) -- 0:00:44
266500 -- [-348.381] (-350.003) (-350.248) (-349.110) * (-352.564) (-351.185) (-349.189) [-351.500] -- 0:00:44
267000 -- (-350.474) [-349.072] (-350.398) (-350.590) * (-348.409) (-354.702) [-350.994] (-348.808) -- 0:00:43
267500 -- (-349.099) (-350.671) (-351.392) [-353.220] * [-349.433] (-351.852) (-358.046) (-350.530) -- 0:00:43
268000 -- (-350.469) (-351.325) (-353.902) [-350.113] * (-350.953) [-348.212] (-352.706) (-353.942) -- 0:00:43
268500 -- (-349.923) (-349.186) (-350.674) [-350.221] * (-355.935) [-349.488] (-352.431) (-354.716) -- 0:00:43
269000 -- [-349.582] (-351.989) (-352.230) (-348.997) * (-349.714) [-349.312] (-355.673) (-350.460) -- 0:00:43
269500 -- (-348.672) (-350.580) [-350.135] (-348.749) * (-351.720) (-350.082) (-350.095) [-350.011] -- 0:00:43
270000 -- (-349.346) (-351.607) (-348.847) [-351.905] * (-347.892) (-353.416) (-349.563) [-350.877] -- 0:00:43
Average standard deviation of split frequencies: 0.016159
270500 -- (-350.083) (-349.310) (-349.228) [-350.169] * (-351.029) (-350.672) [-349.965] (-352.664) -- 0:00:45
271000 -- [-351.631] (-350.168) (-349.534) (-350.305) * (-352.477) (-350.811) [-350.928] (-352.448) -- 0:00:45
271500 -- (-353.052) [-349.433] (-349.399) (-351.321) * [-352.782] (-348.349) (-354.739) (-353.899) -- 0:00:45
272000 -- [-350.665] (-351.353) (-348.411) (-349.298) * (-350.497) [-349.519] (-354.722) (-352.855) -- 0:00:45
272500 -- (-351.267) (-350.325) (-357.146) [-350.035] * [-350.196] (-349.555) (-356.060) (-350.533) -- 0:00:45
273000 -- (-350.858) [-351.293] (-353.138) (-353.030) * (-348.440) (-350.748) [-351.713] (-352.288) -- 0:00:45
273500 -- (-351.281) [-350.031] (-354.721) (-353.892) * (-348.832) (-350.984) [-353.059] (-353.357) -- 0:00:45
274000 -- (-353.458) (-350.197) (-350.490) [-354.328] * (-351.974) [-348.745] (-349.626) (-350.381) -- 0:00:45
274500 -- (-352.440) (-349.077) [-352.247] (-355.828) * [-348.384] (-353.512) (-351.157) (-352.539) -- 0:00:44
275000 -- (-350.153) [-348.621] (-350.112) (-350.063) * (-348.674) (-348.227) (-353.545) [-351.127] -- 0:00:44
Average standard deviation of split frequencies: 0.016176
275500 -- (-351.454) [-348.175] (-349.833) (-349.439) * (-350.259) [-355.896] (-350.270) (-354.712) -- 0:00:44
276000 -- (-350.986) [-352.490] (-351.881) (-349.274) * (-348.768) (-348.563) [-350.618] (-350.663) -- 0:00:44
276500 -- [-348.631] (-356.083) (-351.125) (-350.187) * (-351.254) (-348.816) [-348.568] (-348.962) -- 0:00:44
277000 -- [-348.535] (-349.811) (-350.963) (-349.047) * (-348.908) (-349.972) (-349.839) [-348.941] -- 0:00:44
277500 -- [-348.426] (-354.452) (-353.093) (-350.605) * (-350.801) [-350.407] (-349.603) (-348.803) -- 0:00:44
278000 -- [-351.078] (-348.581) (-350.720) (-352.269) * [-350.736] (-352.343) (-351.898) (-349.261) -- 0:00:44
278500 -- (-352.306) (-347.977) [-348.214] (-350.803) * (-349.069) (-350.805) (-350.594) [-350.456] -- 0:00:44
279000 -- (-352.631) (-350.493) (-350.074) [-348.701] * (-349.343) [-350.586] (-354.967) (-350.174) -- 0:00:43
279500 -- (-357.748) [-351.547] (-352.148) (-349.097) * (-348.940) [-352.003] (-352.127) (-348.365) -- 0:00:43
280000 -- (-354.763) (-351.008) [-348.308] (-353.284) * (-350.286) (-351.356) [-349.979] (-352.559) -- 0:00:43
Average standard deviation of split frequencies: 0.015676
280500 -- (-349.664) (-349.311) (-352.342) [-352.196] * [-354.928] (-353.852) (-353.306) (-351.004) -- 0:00:43
281000 -- [-350.931] (-348.950) (-351.402) (-349.381) * (-355.393) (-353.162) (-353.208) [-350.175] -- 0:00:43
281500 -- (-351.332) (-354.231) (-350.564) [-348.759] * [-350.849] (-348.654) (-349.927) (-350.128) -- 0:00:43
282000 -- (-351.359) (-350.012) (-353.999) [-348.391] * (-350.119) [-350.546] (-351.265) (-350.620) -- 0:00:43
282500 -- [-349.179] (-350.309) (-350.723) (-353.191) * (-354.565) (-349.730) (-349.596) [-349.935] -- 0:00:43
283000 -- (-350.372) (-348.606) [-348.918] (-351.061) * (-349.716) [-349.798] (-350.750) (-350.084) -- 0:00:43
283500 -- (-348.809) (-349.195) [-348.695] (-348.542) * (-350.776) [-349.431] (-348.116) (-350.078) -- 0:00:42
284000 -- (-349.610) (-349.930) (-352.447) [-348.754] * (-352.382) (-351.365) (-351.038) [-349.215] -- 0:00:42
284500 -- (-351.407) (-354.304) (-354.369) [-350.576] * [-350.430] (-350.292) (-350.858) (-349.152) -- 0:00:42
285000 -- [-352.043] (-352.198) (-351.524) (-352.542) * (-349.301) (-352.186) [-349.561] (-350.228) -- 0:00:42
Average standard deviation of split frequencies: 0.014917
285500 -- (-351.564) [-351.398] (-356.607) (-352.554) * (-350.420) (-351.055) [-349.138] (-350.169) -- 0:00:42
286000 -- (-350.006) (-352.284) (-352.096) [-351.528] * (-350.060) (-348.940) [-351.954] (-354.165) -- 0:00:42
286500 -- [-349.365] (-351.656) (-348.347) (-350.198) * (-349.587) (-348.734) (-352.869) [-350.724] -- 0:00:42
287000 -- (-348.778) (-351.619) (-350.669) [-350.410] * (-349.652) (-352.841) (-348.871) [-350.690] -- 0:00:42
287500 -- (-349.361) [-350.665] (-349.662) (-351.444) * (-349.794) [-351.593] (-352.725) (-349.939) -- 0:00:44
288000 -- (-348.541) [-350.313] (-350.626) (-356.026) * (-351.873) (-351.726) (-350.660) [-353.220] -- 0:00:44
288500 -- [-351.974] (-349.787) (-350.331) (-349.943) * (-351.243) (-350.268) [-354.583] (-350.638) -- 0:00:44
289000 -- (-354.943) [-349.360] (-350.086) (-352.494) * (-352.060) (-351.193) [-351.075] (-352.535) -- 0:00:44
289500 -- (-351.262) (-352.143) (-351.024) [-349.707] * [-350.438] (-349.269) (-351.265) (-351.148) -- 0:00:44
290000 -- (-350.914) [-349.911] (-349.722) (-348.710) * (-350.182) (-353.410) [-350.218] (-349.199) -- 0:00:44
Average standard deviation of split frequencies: 0.016137
290500 -- (-350.411) (-349.655) (-348.584) [-350.198] * (-349.850) [-349.119] (-349.619) (-353.240) -- 0:00:43
291000 -- (-350.553) [-349.036] (-350.295) (-350.482) * (-348.968) (-351.634) (-354.140) [-350.374] -- 0:00:43
291500 -- (-348.298) [-348.116] (-349.425) (-352.265) * [-349.972] (-353.581) (-349.955) (-353.147) -- 0:00:43
292000 -- (-350.352) (-348.638) [-351.302] (-349.769) * (-351.441) [-356.915] (-348.888) (-348.517) -- 0:00:43
292500 -- [-351.089] (-349.446) (-355.842) (-349.053) * (-349.067) (-351.724) (-350.103) [-350.108] -- 0:00:43
293000 -- [-350.790] (-349.095) (-351.992) (-352.318) * [-350.718] (-349.887) (-351.645) (-352.489) -- 0:00:43
293500 -- [-348.860] (-351.570) (-353.954) (-348.673) * (-350.815) [-351.776] (-348.530) (-350.319) -- 0:00:43
294000 -- (-349.335) (-348.527) [-352.272] (-349.127) * (-349.551) (-348.664) (-351.272) [-351.265] -- 0:00:43
294500 -- (-350.337) (-348.999) [-348.455] (-348.509) * (-350.789) (-349.223) [-349.273] (-349.684) -- 0:00:43
295000 -- (-350.447) (-348.826) [-352.358] (-348.946) * (-350.340) (-349.105) [-348.494] (-347.967) -- 0:00:43
Average standard deviation of split frequencies: 0.014895
295500 -- (-349.310) [-348.775] (-353.935) (-350.428) * (-351.810) (-348.867) (-350.091) [-349.666] -- 0:00:42
296000 -- (-351.885) (-352.460) [-353.940] (-350.059) * [-350.695] (-349.692) (-350.645) (-350.801) -- 0:00:42
296500 -- [-349.628] (-349.069) (-352.041) (-351.104) * [-350.860] (-351.660) (-348.973) (-351.579) -- 0:00:42
297000 -- [-350.177] (-349.321) (-352.205) (-349.886) * (-348.971) (-350.170) [-350.113] (-350.423) -- 0:00:42
297500 -- (-350.174) (-350.002) (-350.914) [-350.692] * (-348.673) (-350.681) (-356.070) [-350.669] -- 0:00:42
298000 -- (-352.979) [-348.251] (-351.152) (-351.184) * [-347.971] (-350.706) (-353.221) (-353.123) -- 0:00:42
298500 -- (-349.798) (-351.208) (-350.835) [-351.023] * (-349.431) (-349.109) [-350.855] (-350.068) -- 0:00:42
299000 -- (-349.618) [-351.509] (-352.279) (-348.790) * [-348.364] (-353.584) (-348.384) (-349.821) -- 0:00:42
299500 -- [-348.816] (-351.124) (-350.777) (-351.240) * (-349.073) (-351.485) [-351.527] (-350.458) -- 0:00:42
300000 -- (-349.982) (-349.443) (-349.902) [-351.058] * (-354.683) [-349.488] (-349.867) (-353.061) -- 0:00:42
Average standard deviation of split frequencies: 0.013834
300500 -- (-351.970) (-353.654) [-349.580] (-349.803) * (-351.458) (-350.133) [-350.500] (-348.642) -- 0:00:41
301000 -- (-349.056) (-352.338) (-348.747) [-349.544] * (-353.185) (-352.994) [-349.862] (-348.599) -- 0:00:41
301500 -- (-349.359) (-350.518) (-351.794) [-350.712] * (-349.914) (-351.765) (-349.825) [-348.091] -- 0:00:41
302000 -- (-349.752) (-349.660) [-351.714] (-351.810) * (-350.407) (-349.183) (-349.578) [-349.517] -- 0:00:41
302500 -- (-352.527) (-349.727) [-348.677] (-350.355) * (-349.485) [-349.242] (-354.983) (-350.114) -- 0:00:41
303000 -- (-349.845) [-350.324] (-350.684) (-349.019) * [-350.290] (-351.549) (-350.885) (-350.852) -- 0:00:41
303500 -- (-353.052) (-350.523) [-349.471] (-349.628) * (-353.980) (-350.336) (-351.176) [-357.223] -- 0:00:41
304000 -- (-348.893) [-350.076] (-349.659) (-350.356) * [-353.046] (-349.073) (-350.732) (-352.572) -- 0:00:41
304500 -- (-349.809) (-351.465) (-351.479) [-351.228] * (-350.894) (-349.497) (-350.207) [-352.557] -- 0:00:43
305000 -- [-349.727] (-350.150) (-351.442) (-351.126) * [-355.558] (-351.182) (-350.250) (-351.637) -- 0:00:43
Average standard deviation of split frequencies: 0.014137
305500 -- (-351.055) [-350.583] (-350.999) (-349.791) * [-352.298] (-354.823) (-350.515) (-352.010) -- 0:00:43
306000 -- (-348.934) (-350.436) [-348.745] (-350.711) * (-353.666) (-352.568) [-348.244] (-352.581) -- 0:00:43
306500 -- (-351.189) (-350.604) [-349.988] (-351.610) * (-354.457) [-350.531] (-347.921) (-348.869) -- 0:00:42
307000 -- (-348.720) [-350.084] (-349.024) (-350.280) * (-355.477) [-350.878] (-348.611) (-351.681) -- 0:00:42
307500 -- (-352.142) (-350.852) [-350.222] (-350.795) * [-352.870] (-350.124) (-350.223) (-363.283) -- 0:00:42
308000 -- [-351.146] (-348.610) (-349.146) (-350.599) * (-349.423) (-349.078) (-348.740) [-348.644] -- 0:00:42
308500 -- (-350.808) (-349.710) [-353.908] (-350.460) * (-350.216) (-351.146) [-348.787] (-349.843) -- 0:00:42
309000 -- (-351.868) (-348.197) (-349.277) [-350.160] * (-351.731) (-350.262) [-352.195] (-354.516) -- 0:00:42
309500 -- (-349.504) [-349.139] (-348.896) (-352.218) * [-350.358] (-349.356) (-351.191) (-348.760) -- 0:00:42
310000 -- (-352.643) [-350.105] (-349.314) (-351.845) * (-348.351) (-350.145) [-350.264] (-351.554) -- 0:00:42
Average standard deviation of split frequencies: 0.013835
310500 -- (-351.950) [-348.669] (-349.060) (-351.870) * (-348.422) (-349.202) [-351.336] (-353.717) -- 0:00:42
311000 -- (-351.587) (-348.513) (-351.310) [-349.815] * [-349.462] (-349.942) (-355.967) (-350.144) -- 0:00:42
311500 -- (-348.182) [-351.537] (-351.342) (-350.352) * (-349.360) (-348.925) [-348.936] (-351.027) -- 0:00:41
312000 -- (-349.592) (-353.888) (-349.506) [-350.452] * [-349.688] (-348.877) (-353.820) (-351.055) -- 0:00:41
312500 -- (-348.629) (-352.782) [-348.657] (-349.084) * [-349.250] (-351.669) (-350.236) (-357.989) -- 0:00:41
313000 -- (-351.649) (-355.181) (-351.732) [-348.783] * (-350.674) (-353.111) [-351.245] (-354.814) -- 0:00:41
313500 -- [-352.732] (-352.229) (-353.970) (-349.901) * [-349.684] (-351.927) (-350.327) (-352.987) -- 0:00:41
314000 -- (-358.128) (-354.730) (-348.349) [-350.236] * [-351.698] (-350.995) (-350.125) (-347.934) -- 0:00:41
314500 -- (-350.432) (-351.606) [-348.809] (-349.329) * (-354.546) [-351.567] (-349.887) (-349.920) -- 0:00:41
315000 -- [-349.921] (-353.970) (-348.205) (-348.748) * (-351.781) (-351.014) [-350.452] (-353.803) -- 0:00:41
Average standard deviation of split frequencies: 0.012724
315500 -- (-350.895) (-355.117) [-349.419] (-350.758) * (-351.649) [-349.272] (-352.233) (-355.601) -- 0:00:41
316000 -- (-350.998) (-351.131) [-351.278] (-353.362) * (-348.364) (-351.043) [-348.851] (-349.329) -- 0:00:41
316500 -- [-349.454] (-348.798) (-348.630) (-354.063) * (-349.449) (-349.037) (-348.703) [-350.816] -- 0:00:41
317000 -- [-350.604] (-351.074) (-349.231) (-351.696) * (-350.201) (-353.501) (-348.473) [-350.974] -- 0:00:40
317500 -- (-354.489) [-351.032] (-350.057) (-351.694) * (-351.216) [-351.330] (-349.574) (-354.490) -- 0:00:40
318000 -- (-352.189) (-352.231) [-349.494] (-348.731) * [-349.937] (-353.645) (-349.404) (-349.902) -- 0:00:40
318500 -- (-348.678) [-350.271] (-348.449) (-349.042) * (-348.750) (-349.828) [-350.219] (-352.699) -- 0:00:40
319000 -- (-350.573) (-348.364) (-348.264) [-348.812] * (-348.724) (-348.014) (-350.822) [-354.322] -- 0:00:40
319500 -- (-351.487) (-349.621) [-350.344] (-352.072) * (-352.441) [-351.148] (-351.365) (-349.376) -- 0:00:40
320000 -- (-352.043) [-350.519] (-354.094) (-350.998) * (-354.781) (-351.691) (-350.562) [-350.048] -- 0:00:40
Average standard deviation of split frequencies: 0.013144
320500 -- (-349.949) [-349.258] (-349.943) (-351.694) * [-350.959] (-352.808) (-351.496) (-350.428) -- 0:00:40
321000 -- (-350.980) [-348.608] (-354.384) (-349.878) * (-349.696) [-351.338] (-350.083) (-351.402) -- 0:00:40
321500 -- (-349.488) (-351.403) [-351.352] (-349.300) * (-349.881) (-350.588) (-354.099) [-351.374] -- 0:00:40
322000 -- (-354.163) (-349.000) [-353.786] (-349.073) * (-351.320) (-348.901) (-352.031) [-349.846] -- 0:00:42
322500 -- (-355.568) [-349.366] (-349.641) (-353.147) * [-349.558] (-349.609) (-350.047) (-349.375) -- 0:00:42
323000 -- [-354.850] (-350.236) (-354.563) (-351.391) * [-354.483] (-351.108) (-352.238) (-350.730) -- 0:00:41
323500 -- (-351.385) (-349.159) (-351.164) [-348.992] * (-354.304) [-351.524] (-351.258) (-348.498) -- 0:00:41
324000 -- (-351.767) (-350.127) [-348.577] (-353.305) * [-347.983] (-349.913) (-351.075) (-348.705) -- 0:00:41
324500 -- (-350.148) [-350.312] (-348.399) (-349.165) * (-350.380) (-350.489) [-353.705] (-350.182) -- 0:00:41
325000 -- [-349.839] (-353.038) (-348.937) (-352.650) * (-355.780) (-349.921) (-349.650) [-350.781] -- 0:00:41
Average standard deviation of split frequencies: 0.012249
325500 -- (-351.766) (-352.155) (-352.145) [-351.854] * [-352.724] (-350.926) (-349.097) (-349.618) -- 0:00:41
326000 -- [-348.308] (-354.473) (-349.473) (-353.396) * [-349.918] (-348.782) (-349.298) (-351.730) -- 0:00:41
326500 -- (-351.707) (-350.841) [-350.832] (-351.884) * (-350.789) (-351.836) [-351.668] (-348.782) -- 0:00:41
327000 -- [-349.918] (-350.065) (-350.538) (-351.287) * [-350.004] (-352.417) (-350.581) (-349.916) -- 0:00:41
327500 -- (-351.519) [-353.406] (-349.754) (-350.960) * (-349.849) (-349.426) [-349.372] (-350.415) -- 0:00:41
328000 -- [-348.790] (-352.073) (-353.499) (-349.801) * (-349.512) (-351.119) [-350.934] (-350.696) -- 0:00:40
328500 -- (-350.317) [-348.677] (-350.886) (-350.358) * (-350.264) [-352.004] (-349.972) (-349.746) -- 0:00:40
329000 -- (-352.337) (-352.304) (-351.403) [-350.371] * (-351.391) (-351.331) (-348.894) [-349.098] -- 0:00:40
329500 -- (-351.567) (-350.876) [-351.520] (-349.709) * (-354.613) (-352.224) [-352.754] (-356.835) -- 0:00:40
330000 -- (-349.981) (-348.888) (-351.908) [-349.961] * (-355.898) [-350.242] (-351.378) (-354.077) -- 0:00:40
Average standard deviation of split frequencies: 0.012579
330500 -- [-349.493] (-351.646) (-351.549) (-352.431) * (-349.341) (-354.194) (-348.677) [-349.607] -- 0:00:40
331000 -- (-349.658) (-351.233) (-351.740) [-349.714] * (-349.117) (-349.873) (-348.330) [-354.494] -- 0:00:40
331500 -- (-354.097) [-352.238] (-350.569) (-351.082) * [-349.489] (-352.668) (-348.406) (-350.580) -- 0:00:40
332000 -- (-354.818) (-349.119) [-348.002] (-349.791) * (-349.475) (-349.750) (-355.065) [-349.463] -- 0:00:40
332500 -- [-351.759] (-349.349) (-349.087) (-349.707) * (-352.789) (-349.037) [-347.995] (-350.210) -- 0:00:40
333000 -- (-347.963) (-352.206) [-350.388] (-352.417) * (-349.500) (-350.278) [-348.666] (-351.492) -- 0:00:40
333500 -- [-348.088] (-353.126) (-350.480) (-351.324) * (-351.615) (-348.882) (-349.801) [-351.300] -- 0:00:39
334000 -- (-348.865) [-350.801] (-352.397) (-349.847) * (-348.037) [-348.542] (-352.052) (-352.694) -- 0:00:39
334500 -- [-349.597] (-349.344) (-349.566) (-348.365) * (-348.821) (-350.946) (-348.419) [-351.063] -- 0:00:39
335000 -- (-351.908) (-349.566) (-349.829) [-352.900] * (-354.402) [-351.741] (-349.634) (-350.096) -- 0:00:39
Average standard deviation of split frequencies: 0.012462
335500 -- (-350.478) (-351.275) [-349.522] (-350.956) * [-350.167] (-352.893) (-351.300) (-349.599) -- 0:00:39
336000 -- (-356.121) [-348.394] (-349.979) (-352.004) * (-350.934) (-354.377) (-350.856) [-352.267] -- 0:00:39
336500 -- (-353.129) [-348.431] (-348.739) (-348.970) * (-350.359) (-351.311) [-348.682] (-349.933) -- 0:00:39
337000 -- (-350.758) [-349.679] (-350.628) (-349.612) * (-350.235) [-348.871] (-350.948) (-350.248) -- 0:00:39
337500 -- (-353.254) (-353.791) (-353.186) [-349.830] * [-348.832] (-348.659) (-351.956) (-350.398) -- 0:00:39
338000 -- (-349.604) (-349.654) [-350.969] (-350.092) * (-351.258) (-349.717) (-352.093) [-349.891] -- 0:00:39
338500 -- (-352.270) [-348.518] (-350.372) (-350.782) * (-350.792) [-352.100] (-357.243) (-351.954) -- 0:00:39
339000 -- (-350.228) (-349.346) (-351.515) [-349.120] * (-349.639) (-350.057) (-353.818) [-350.290] -- 0:00:40
339500 -- [-350.637] (-353.938) (-348.909) (-350.442) * (-351.588) (-350.887) [-351.891] (-351.238) -- 0:00:40
340000 -- (-349.505) [-348.941] (-350.690) (-355.214) * (-349.871) (-350.601) [-349.040] (-351.751) -- 0:00:40
Average standard deviation of split frequencies: 0.012454
340500 -- (-349.570) [-349.374] (-354.633) (-352.691) * (-349.154) [-348.109] (-350.236) (-350.690) -- 0:00:40
341000 -- (-348.586) [-348.980] (-354.949) (-350.023) * [-348.725] (-349.187) (-350.316) (-351.431) -- 0:00:40
341500 -- (-354.561) (-354.587) [-351.794] (-347.986) * (-351.790) (-350.274) [-351.265] (-354.838) -- 0:00:40
342000 -- [-348.471] (-353.501) (-352.626) (-352.946) * [-349.597] (-354.140) (-354.195) (-350.849) -- 0:00:40
342500 -- (-354.750) (-350.465) [-352.276] (-349.492) * [-348.266] (-348.008) (-354.300) (-349.992) -- 0:00:40
343000 -- (-349.530) [-348.546] (-348.940) (-349.361) * (-353.622) (-357.688) (-348.453) [-350.005] -- 0:00:40
343500 -- (-348.411) [-353.493] (-351.353) (-348.457) * (-348.863) [-350.414] (-349.956) (-348.266) -- 0:00:40
344000 -- (-348.923) [-352.607] (-349.201) (-349.220) * (-349.341) (-351.558) [-351.184] (-350.586) -- 0:00:40
344500 -- (-351.947) (-351.394) [-349.901] (-352.614) * (-348.725) (-350.220) [-352.758] (-349.537) -- 0:00:39
345000 -- (-350.806) (-349.371) (-348.908) [-349.832] * (-351.549) (-350.296) (-349.423) [-351.308] -- 0:00:39
Average standard deviation of split frequencies: 0.012262
345500 -- (-348.082) (-352.492) [-348.186] (-353.246) * (-351.646) (-349.519) [-350.498] (-350.940) -- 0:00:39
346000 -- (-350.346) (-350.464) [-348.733] (-356.774) * (-349.554) (-351.361) (-350.247) [-351.541] -- 0:00:39
346500 -- (-351.442) (-349.880) [-350.983] (-353.434) * [-348.507] (-348.644) (-350.775) (-349.872) -- 0:00:39
347000 -- [-350.760] (-350.118) (-352.332) (-350.512) * (-355.409) [-348.400] (-355.109) (-350.495) -- 0:00:39
347500 -- (-352.397) [-351.036] (-348.967) (-348.843) * [-354.873] (-356.493) (-353.121) (-350.604) -- 0:00:39
348000 -- (-350.763) (-350.274) [-351.374] (-348.934) * (-352.066) [-349.282] (-348.365) (-348.968) -- 0:00:39
348500 -- (-348.943) [-348.862] (-351.670) (-349.221) * (-348.910) (-351.042) (-353.205) [-354.722] -- 0:00:39
349000 -- (-349.973) (-349.689) [-348.178] (-349.564) * (-353.660) [-351.957] (-349.125) (-356.716) -- 0:00:39
349500 -- (-349.390) (-349.546) [-352.425] (-352.709) * [-350.028] (-350.894) (-355.496) (-351.083) -- 0:00:39
350000 -- [-347.900] (-351.194) (-350.105) (-349.524) * [-349.330] (-351.024) (-351.425) (-350.286) -- 0:00:39
Average standard deviation of split frequencies: 0.012494
350500 -- [-349.049] (-351.448) (-349.203) (-349.479) * (-353.045) (-348.475) [-351.097] (-350.350) -- 0:00:38
351000 -- (-349.442) [-350.161] (-352.141) (-350.787) * (-348.590) (-350.552) [-354.039] (-349.176) -- 0:00:38
351500 -- [-348.871] (-352.172) (-348.173) (-350.481) * (-348.830) (-350.116) (-355.014) [-352.175] -- 0:00:38
352000 -- (-349.923) (-351.980) [-349.968] (-352.466) * (-348.893) [-350.691] (-349.715) (-353.217) -- 0:00:38
352500 -- (-350.915) (-352.038) (-351.937) [-348.608] * [-348.556] (-350.541) (-350.142) (-352.267) -- 0:00:38
353000 -- (-352.259) (-348.920) [-349.195] (-350.472) * (-349.365) [-348.359] (-353.703) (-349.447) -- 0:00:38
353500 -- (-350.675) [-353.134] (-349.046) (-351.654) * (-349.390) (-350.277) [-353.181] (-349.038) -- 0:00:38
354000 -- [-352.917] (-351.939) (-353.367) (-349.498) * (-350.534) (-350.663) [-351.983] (-349.795) -- 0:00:38
354500 -- [-348.608] (-350.657) (-351.607) (-350.504) * (-349.262) (-353.911) (-354.187) [-348.360] -- 0:00:38
355000 -- (-348.196) (-352.413) [-352.067] (-353.140) * (-349.803) [-353.299] (-349.647) (-350.900) -- 0:00:38
Average standard deviation of split frequencies: 0.012229
355500 -- [-349.565] (-358.012) (-352.794) (-356.013) * (-350.048) (-352.497) [-350.122] (-349.693) -- 0:00:38
356000 -- (-349.299) [-350.410] (-350.306) (-350.174) * [-348.603] (-350.469) (-348.593) (-351.181) -- 0:00:39
356500 -- (-351.812) (-353.000) (-352.675) [-351.675] * [-349.341] (-349.175) (-350.549) (-352.019) -- 0:00:39
357000 -- (-350.145) (-352.123) (-354.842) [-352.385] * (-349.509) (-349.995) [-349.367] (-352.756) -- 0:00:39
357500 -- (-348.268) (-353.997) [-351.813] (-350.387) * [-349.025] (-354.810) (-349.529) (-349.065) -- 0:00:39
358000 -- [-349.846] (-348.393) (-352.015) (-352.455) * (-349.272) (-351.526) [-351.908] (-350.552) -- 0:00:39
358500 -- [-350.865] (-348.453) (-350.107) (-350.266) * (-350.255) (-350.861) (-352.378) [-348.486] -- 0:00:39
359000 -- [-356.012] (-350.011) (-349.186) (-349.254) * [-350.003] (-349.333) (-350.754) (-349.699) -- 0:00:39
359500 -- (-351.444) (-348.690) (-348.269) [-350.093] * (-349.150) (-356.734) (-349.085) [-348.967] -- 0:00:39
360000 -- (-349.135) (-348.370) [-348.664] (-349.134) * [-349.285] (-353.077) (-348.857) (-351.538) -- 0:00:39
Average standard deviation of split frequencies: 0.012148
360500 -- [-348.669] (-351.407) (-349.819) (-349.935) * [-349.827] (-351.211) (-352.159) (-351.984) -- 0:00:39
361000 -- (-351.740) (-348.574) [-348.574] (-349.842) * (-348.999) [-350.042] (-348.686) (-349.861) -- 0:00:38
361500 -- (-351.491) [-349.739] (-348.441) (-350.442) * [-348.722] (-350.615) (-348.570) (-352.059) -- 0:00:38
362000 -- [-350.144] (-349.935) (-355.005) (-351.221) * [-353.019] (-349.174) (-348.707) (-353.826) -- 0:00:38
362500 -- (-352.537) [-349.929] (-351.328) (-348.452) * [-349.878] (-355.357) (-348.980) (-351.637) -- 0:00:38
363000 -- (-350.799) [-355.097] (-351.836) (-350.977) * (-353.036) [-349.788] (-350.838) (-350.722) -- 0:00:38
363500 -- (-348.269) (-348.721) [-351.420] (-353.742) * (-351.929) (-351.681) (-348.554) [-351.017] -- 0:00:38
364000 -- (-348.939) (-350.332) [-350.642] (-351.052) * (-349.669) [-348.572] (-349.385) (-353.412) -- 0:00:38
364500 -- (-350.781) (-348.619) [-349.598] (-348.208) * [-352.299] (-351.148) (-349.115) (-349.025) -- 0:00:38
365000 -- (-350.525) [-349.544] (-350.911) (-349.502) * [-352.854] (-350.864) (-351.342) (-350.057) -- 0:00:38
Average standard deviation of split frequencies: 0.012236
365500 -- (-351.596) (-355.502) [-350.328] (-348.829) * [-349.874] (-348.614) (-350.404) (-348.781) -- 0:00:38
366000 -- [-350.537] (-351.554) (-349.192) (-349.139) * (-352.646) (-350.152) [-352.636] (-348.620) -- 0:00:38
366500 -- (-348.223) [-348.120] (-349.931) (-349.658) * (-352.125) [-349.910] (-351.240) (-348.107) -- 0:00:38
367000 -- (-349.727) (-351.235) [-351.530] (-348.633) * (-356.923) [-349.873] (-351.372) (-348.012) -- 0:00:37
367500 -- (-351.949) [-354.593] (-349.443) (-354.558) * [-349.169] (-349.687) (-351.086) (-350.500) -- 0:00:37
368000 -- (-352.836) (-351.622) [-350.010] (-350.487) * (-349.116) [-349.158] (-351.082) (-349.724) -- 0:00:37
368500 -- (-349.851) (-349.937) [-349.836] (-349.214) * (-348.665) (-352.643) (-352.343) [-351.515] -- 0:00:37
369000 -- (-349.540) (-350.775) (-352.268) [-349.986] * (-352.023) (-349.200) [-350.522] (-348.985) -- 0:00:37
369500 -- [-348.307] (-351.537) (-349.758) (-348.681) * (-352.724) (-349.061) (-353.543) [-352.298] -- 0:00:37
370000 -- (-349.758) (-353.256) (-348.433) [-350.450] * (-350.357) [-351.925] (-352.616) (-351.975) -- 0:00:37
Average standard deviation of split frequencies: 0.011941
370500 -- (-353.869) (-348.825) [-351.687] (-348.994) * [-350.294] (-349.900) (-354.201) (-348.842) -- 0:00:37
371000 -- [-350.018] (-350.457) (-348.837) (-356.277) * (-352.579) [-348.167] (-352.160) (-350.584) -- 0:00:37
371500 -- (-349.204) [-351.243] (-349.774) (-357.590) * (-349.478) [-349.863] (-351.196) (-350.894) -- 0:00:37
372000 -- (-350.422) [-352.174] (-348.165) (-352.520) * (-351.821) (-352.408) (-351.052) [-349.747] -- 0:00:37
372500 -- [-350.084] (-349.032) (-350.705) (-349.145) * (-349.060) [-349.385] (-352.186) (-351.606) -- 0:00:37
373000 -- (-348.389) [-348.152] (-356.363) (-348.817) * [-349.066] (-350.591) (-353.963) (-349.651) -- 0:00:38
373500 -- (-349.198) (-348.940) (-352.363) [-350.494] * [-350.252] (-348.575) (-350.449) (-350.623) -- 0:00:38
374000 -- [-352.386] (-354.425) (-353.503) (-349.662) * [-350.398] (-348.950) (-349.230) (-349.292) -- 0:00:38
374500 -- (-352.165) (-357.988) [-353.529] (-351.182) * [-350.250] (-351.643) (-354.862) (-348.587) -- 0:00:38
375000 -- (-352.450) [-350.021] (-349.408) (-350.871) * (-350.122) [-348.534] (-350.592) (-350.491) -- 0:00:38
Average standard deviation of split frequencies: 0.012050
375500 -- (-349.897) (-349.534) (-352.996) [-349.433] * (-350.114) (-347.915) [-349.756] (-349.415) -- 0:00:38
376000 -- (-349.812) (-350.330) (-354.757) [-350.717] * (-349.779) (-348.790) [-349.181] (-349.401) -- 0:00:38
376500 -- (-349.228) (-348.985) (-349.277) [-349.066] * (-350.098) (-351.111) [-350.067] (-351.233) -- 0:00:38
377000 -- [-350.245] (-350.686) (-351.485) (-352.238) * (-348.400) (-352.656) [-353.261] (-351.387) -- 0:00:38
377500 -- (-351.827) (-352.914) [-356.724] (-352.259) * (-348.468) (-349.128) [-349.673] (-353.749) -- 0:00:37
378000 -- [-350.872] (-348.552) (-351.059) (-355.778) * (-350.247) (-353.889) [-348.917] (-351.768) -- 0:00:37
378500 -- (-352.285) (-350.873) [-350.853] (-348.965) * (-350.735) [-348.734] (-349.457) (-348.976) -- 0:00:37
379000 -- (-350.249) (-348.306) (-349.196) [-349.034] * (-349.205) (-353.434) [-352.550] (-349.761) -- 0:00:37
379500 -- (-350.483) (-355.072) [-350.473] (-349.266) * (-349.979) (-350.094) [-349.584] (-352.677) -- 0:00:37
380000 -- (-350.033) [-347.958] (-351.328) (-359.335) * (-351.007) (-351.944) (-357.062) [-350.076] -- 0:00:37
Average standard deviation of split frequencies: 0.010870
380500 -- [-351.692] (-349.118) (-352.446) (-352.929) * (-350.883) [-348.960] (-354.381) (-351.409) -- 0:00:37
381000 -- (-349.104) [-350.033] (-350.654) (-348.495) * (-349.323) (-349.317) (-350.077) [-349.879] -- 0:00:37
381500 -- (-352.951) (-351.836) [-351.519] (-350.984) * (-351.538) (-350.089) (-349.859) [-348.798] -- 0:00:37
382000 -- (-350.242) [-350.813] (-351.716) (-352.376) * (-351.968) (-350.035) (-348.820) [-352.764] -- 0:00:37
382500 -- (-348.860) [-351.525] (-354.953) (-349.727) * (-350.116) (-349.138) (-350.585) [-349.544] -- 0:00:37
383000 -- (-350.694) (-349.164) (-350.561) [-348.430] * (-350.645) (-349.103) [-351.137] (-348.902) -- 0:00:37
383500 -- [-349.447] (-349.367) (-350.280) (-350.695) * [-352.204] (-351.472) (-355.642) (-349.339) -- 0:00:36
384000 -- (-349.333) (-349.747) (-351.137) [-349.110] * (-351.577) [-350.116] (-350.461) (-348.910) -- 0:00:36
384500 -- (-349.448) (-350.177) [-349.588] (-350.119) * (-349.698) (-351.503) [-350.921] (-351.844) -- 0:00:36
385000 -- (-351.636) (-351.757) [-349.354] (-348.349) * [-348.897] (-348.482) (-350.740) (-351.574) -- 0:00:36
Average standard deviation of split frequencies: 0.010720
385500 -- (-355.298) (-350.967) [-348.753] (-349.230) * [-349.702] (-350.242) (-354.349) (-349.038) -- 0:00:36
386000 -- (-355.947) (-352.008) (-350.518) [-350.578] * (-350.097) [-350.519] (-348.146) (-348.168) -- 0:00:36
386500 -- [-351.744] (-350.162) (-349.507) (-349.292) * (-348.843) (-351.424) [-348.294] (-348.536) -- 0:00:36
387000 -- (-353.969) [-350.571] (-349.451) (-350.984) * (-349.742) (-348.891) [-351.374] (-350.279) -- 0:00:36
387500 -- (-349.444) [-352.064] (-348.773) (-351.207) * (-348.362) (-349.663) (-349.236) [-348.535] -- 0:00:36
388000 -- [-353.810] (-348.539) (-348.541) (-352.081) * (-349.253) [-350.659] (-348.993) (-349.667) -- 0:00:36
388500 -- (-350.700) (-350.113) [-348.738] (-350.674) * (-350.474) (-348.245) [-349.088] (-353.896) -- 0:00:36
389000 -- (-350.724) (-354.519) [-349.004] (-350.266) * (-354.309) [-350.369] (-354.223) (-351.504) -- 0:00:36
389500 -- (-348.893) (-348.667) [-348.476] (-349.804) * (-348.383) [-349.788] (-355.154) (-350.975) -- 0:00:36
390000 -- (-348.281) [-349.265] (-350.977) (-349.364) * (-348.892) [-349.465] (-350.473) (-350.893) -- 0:00:37
Average standard deviation of split frequencies: 0.010994
390500 -- [-349.927] (-348.845) (-349.600) (-348.166) * (-349.548) [-349.253] (-351.027) (-350.408) -- 0:00:37
391000 -- (-348.834) [-349.690] (-350.321) (-349.693) * (-354.787) (-349.533) [-350.387] (-349.498) -- 0:00:37
391500 -- (-348.268) (-349.871) (-350.086) [-350.866] * (-353.350) (-349.616) [-349.585] (-349.344) -- 0:00:37
392000 -- (-348.467) [-348.148] (-350.188) (-351.133) * (-353.885) [-350.039] (-350.430) (-348.016) -- 0:00:37
392500 -- (-349.949) (-348.341) (-351.194) [-351.534] * (-348.967) (-350.082) (-349.116) [-348.830] -- 0:00:37
393000 -- (-350.698) (-349.685) [-353.666] (-348.858) * [-352.534] (-350.378) (-350.503) (-348.411) -- 0:00:37
393500 -- (-348.855) [-351.340] (-349.828) (-348.951) * [-352.540] (-350.799) (-350.410) (-350.324) -- 0:00:36
394000 -- [-349.605] (-349.103) (-349.788) (-351.605) * (-351.355) [-348.931] (-349.349) (-350.582) -- 0:00:36
394500 -- [-350.292] (-350.118) (-353.341) (-349.746) * [-352.497] (-349.644) (-351.146) (-348.992) -- 0:00:36
395000 -- [-348.671] (-350.475) (-351.354) (-350.210) * (-348.834) (-349.896) [-350.002] (-349.309) -- 0:00:36
Average standard deviation of split frequencies: 0.010978
395500 -- (-349.070) [-348.937] (-352.666) (-355.873) * (-354.142) (-353.604) (-351.915) [-353.030] -- 0:00:36
396000 -- [-349.302] (-349.075) (-352.298) (-351.440) * (-348.716) [-349.073] (-350.804) (-354.648) -- 0:00:36
396500 -- (-350.200) (-349.804) [-349.104] (-348.624) * (-348.516) (-349.338) (-349.827) [-348.903] -- 0:00:36
397000 -- [-351.529] (-349.582) (-348.450) (-351.856) * (-354.806) (-351.396) (-348.630) [-352.712] -- 0:00:36
397500 -- [-348.253] (-349.773) (-350.241) (-349.000) * (-351.681) (-349.594) (-348.482) [-351.868] -- 0:00:36
398000 -- (-349.127) (-350.628) [-349.896] (-354.524) * (-348.766) (-357.576) [-348.966] (-351.805) -- 0:00:36
398500 -- (-350.445) [-349.230] (-349.622) (-348.064) * (-348.743) [-349.483] (-353.361) (-350.603) -- 0:00:36
399000 -- (-349.807) (-349.885) (-348.854) [-348.540] * (-349.535) (-351.651) (-348.682) [-351.911] -- 0:00:36
399500 -- [-349.354] (-352.893) (-352.347) (-351.240) * (-353.224) [-349.700] (-350.153) (-352.699) -- 0:00:36
400000 -- (-349.996) (-348.916) (-351.983) [-348.757] * (-352.849) (-349.899) [-348.632] (-352.489) -- 0:00:36
Average standard deviation of split frequencies: 0.010785
400500 -- [-349.485] (-352.870) (-350.329) (-347.987) * (-350.643) (-354.129) [-348.267] (-352.937) -- 0:00:35
401000 -- (-355.796) [-350.714] (-351.054) (-350.585) * (-350.452) (-350.409) [-349.113] (-351.770) -- 0:00:35
401500 -- (-352.227) (-349.819) (-353.931) [-349.362] * [-349.053] (-349.303) (-353.100) (-351.961) -- 0:00:35
402000 -- (-352.181) (-350.100) (-354.119) [-349.941] * [-348.853] (-351.413) (-349.883) (-350.347) -- 0:00:35
402500 -- (-351.263) (-351.061) [-350.963] (-350.382) * [-349.105] (-351.293) (-348.738) (-351.554) -- 0:00:35
403000 -- (-352.029) (-351.144) [-349.564] (-349.213) * (-351.889) [-351.479] (-355.110) (-353.967) -- 0:00:35
403500 -- (-351.469) (-350.776) [-348.753] (-349.045) * (-350.787) (-350.487) [-351.063] (-353.550) -- 0:00:35
404000 -- (-349.223) (-349.488) (-351.297) [-349.759] * (-349.526) (-352.768) [-350.294] (-349.518) -- 0:00:35
404500 -- (-349.945) (-353.381) (-350.411) [-350.333] * (-349.160) (-350.870) [-348.805] (-348.756) -- 0:00:35
405000 -- (-350.162) (-348.430) (-348.511) [-351.645] * (-349.292) (-348.915) [-349.370] (-350.056) -- 0:00:35
Average standard deviation of split frequencies: 0.011288
405500 -- (-350.907) [-349.196] (-350.367) (-349.726) * (-348.956) [-348.683] (-348.334) (-349.261) -- 0:00:35
406000 -- (-350.263) [-350.921] (-349.771) (-349.747) * (-349.647) (-349.064) (-349.110) [-352.256] -- 0:00:35
406500 -- (-350.268) (-353.505) (-348.712) [-351.230] * (-353.618) (-348.546) [-349.995] (-349.379) -- 0:00:35
407000 -- (-349.227) (-349.180) [-356.029] (-349.079) * (-356.409) [-350.208] (-352.002) (-352.588) -- 0:00:34
407500 -- (-348.083) [-348.243] (-354.051) (-349.654) * (-351.643) (-350.393) (-351.924) [-350.017] -- 0:00:36
408000 -- (-350.039) [-348.148] (-352.085) (-352.647) * [-350.695] (-350.694) (-352.789) (-350.415) -- 0:00:36
408500 -- (-352.438) [-349.595] (-351.139) (-349.167) * (-350.695) [-348.654] (-351.018) (-350.727) -- 0:00:36
409000 -- (-349.597) (-352.133) [-349.597] (-349.354) * (-354.283) (-349.305) (-354.168) [-348.964] -- 0:00:36
409500 -- (-350.055) [-350.759] (-349.305) (-354.368) * (-353.567) [-352.474] (-352.318) (-350.725) -- 0:00:36
410000 -- [-347.959] (-350.681) (-348.862) (-350.223) * (-352.414) [-351.326] (-350.147) (-349.114) -- 0:00:35
Average standard deviation of split frequencies: 0.010395
410500 -- (-349.028) [-348.763] (-348.566) (-354.449) * (-351.024) (-352.068) (-350.206) [-352.364] -- 0:00:35
411000 -- (-351.767) [-351.578] (-349.580) (-351.069) * [-348.022] (-350.545) (-350.314) (-354.364) -- 0:00:35
411500 -- (-353.453) [-350.159] (-350.337) (-350.795) * (-350.139) (-353.339) (-349.282) [-349.295] -- 0:00:35
412000 -- [-348.300] (-354.285) (-353.010) (-352.188) * (-356.651) (-353.415) (-349.232) [-348.984] -- 0:00:35
412500 -- (-348.927) [-352.347] (-350.439) (-349.906) * (-350.910) (-353.150) [-348.166] (-348.675) -- 0:00:35
413000 -- [-352.450] (-351.143) (-351.517) (-348.117) * [-351.151] (-350.425) (-348.850) (-349.007) -- 0:00:35
413500 -- (-355.353) (-349.442) (-350.826) [-351.743] * (-349.124) (-350.338) (-349.014) [-350.424] -- 0:00:35
414000 -- (-352.167) (-349.592) (-351.378) [-350.950] * [-350.473] (-349.992) (-352.770) (-351.891) -- 0:00:35
414500 -- (-352.004) (-350.376) (-348.655) [-349.712] * [-350.637] (-349.405) (-349.792) (-354.329) -- 0:00:35
415000 -- [-349.615] (-351.638) (-348.875) (-353.760) * (-349.575) (-350.409) [-350.122] (-352.211) -- 0:00:35
Average standard deviation of split frequencies: 0.010450
415500 -- (-348.577) (-353.564) (-354.258) [-353.910] * [-348.322] (-348.669) (-350.043) (-350.392) -- 0:00:35
416000 -- (-351.911) (-352.121) [-349.352] (-355.807) * (-350.330) (-351.753) (-350.319) [-349.111] -- 0:00:35
416500 -- (-350.951) [-350.350] (-355.265) (-349.977) * (-351.307) (-349.959) [-349.441] (-348.033) -- 0:00:35
417000 -- [-348.058] (-355.211) (-349.587) (-349.041) * [-348.381] (-350.563) (-349.207) (-348.622) -- 0:00:34
417500 -- (-350.279) (-363.387) [-350.740] (-348.882) * (-350.118) [-349.338] (-350.499) (-351.735) -- 0:00:34
418000 -- (-349.091) (-348.587) [-348.447] (-350.359) * [-353.871] (-351.211) (-354.561) (-349.282) -- 0:00:34
418500 -- (-349.735) [-348.838] (-351.364) (-349.648) * (-350.958) (-350.203) [-348.753] (-348.765) -- 0:00:34
419000 -- (-352.108) [-352.046] (-348.678) (-351.069) * (-349.524) (-350.141) (-349.458) [-349.124] -- 0:00:34
419500 -- (-350.884) [-350.141] (-351.256) (-350.292) * (-352.362) [-349.436] (-352.181) (-350.881) -- 0:00:34
420000 -- (-355.780) (-353.385) (-351.108) [-349.694] * (-349.964) (-349.714) (-349.029) [-351.637] -- 0:00:34
Average standard deviation of split frequencies: 0.009463
420500 -- [-349.303] (-350.304) (-350.892) (-348.808) * [-351.193] (-349.070) (-349.711) (-352.707) -- 0:00:34
421000 -- (-349.960) (-349.393) [-348.956] (-350.173) * [-349.238] (-350.044) (-352.081) (-352.934) -- 0:00:34
421500 -- (-349.482) [-350.117] (-349.460) (-350.502) * [-352.308] (-351.428) (-353.253) (-348.302) -- 0:00:34
422000 -- (-351.294) (-352.757) (-351.335) [-350.805] * (-353.624) [-352.519] (-351.457) (-350.149) -- 0:00:34
422500 -- (-350.591) (-351.885) (-353.374) [-352.119] * (-351.874) [-349.513] (-348.972) (-352.448) -- 0:00:34
423000 -- (-350.449) (-349.123) (-351.170) [-350.282] * (-349.515) (-350.309) [-351.335] (-352.959) -- 0:00:34
423500 -- [-352.601] (-351.439) (-351.598) (-348.392) * (-351.633) (-353.165) [-350.861] (-348.687) -- 0:00:34
424000 -- (-351.996) (-354.007) (-352.392) [-350.729] * (-349.555) (-354.645) (-351.683) [-349.809] -- 0:00:33
424500 -- (-351.738) (-349.479) [-348.868] (-350.263) * (-349.044) [-349.689] (-350.762) (-352.625) -- 0:00:35
425000 -- [-350.091] (-350.582) (-349.244) (-352.289) * (-353.097) (-349.897) [-349.600] (-356.413) -- 0:00:35
Average standard deviation of split frequencies: 0.009160
425500 -- (-349.695) (-350.576) [-348.954] (-348.277) * (-349.162) (-350.757) (-349.229) [-352.142] -- 0:00:35
426000 -- [-351.738] (-350.753) (-348.371) (-354.545) * (-349.815) [-351.541] (-349.370) (-349.215) -- 0:00:35
426500 -- (-350.775) (-349.691) (-351.954) [-353.783] * (-351.393) (-350.498) (-354.182) [-348.823] -- 0:00:34
427000 -- (-350.353) [-349.303] (-348.536) (-353.650) * (-348.814) [-351.293] (-351.377) (-351.869) -- 0:00:34
427500 -- (-352.995) [-348.559] (-349.713) (-352.384) * (-349.899) (-350.287) (-351.042) [-351.605] -- 0:00:34
428000 -- (-349.568) (-351.295) [-349.418] (-348.743) * (-348.763) (-349.219) [-352.467] (-348.224) -- 0:00:34
428500 -- [-349.622] (-350.717) (-349.738) (-350.619) * (-353.482) (-349.255) (-352.111) [-352.747] -- 0:00:34
429000 -- (-350.563) (-351.805) [-350.709] (-352.527) * (-350.634) (-350.159) (-350.562) [-352.931] -- 0:00:34
429500 -- (-351.215) (-349.536) (-352.889) [-350.940] * [-351.302] (-349.320) (-351.484) (-355.714) -- 0:00:34
430000 -- (-350.459) [-350.373] (-353.994) (-350.148) * [-353.000] (-351.030) (-353.132) (-357.191) -- 0:00:34
Average standard deviation of split frequencies: 0.008939
430500 -- (-349.265) (-350.622) (-351.092) [-355.795] * [-348.789] (-352.857) (-350.184) (-356.951) -- 0:00:34
431000 -- (-352.952) [-349.526] (-353.542) (-352.190) * (-352.135) [-349.354] (-350.657) (-348.900) -- 0:00:34
431500 -- [-348.196] (-354.630) (-348.890) (-351.169) * [-349.276] (-351.624) (-350.192) (-350.059) -- 0:00:34
432000 -- (-350.377) [-352.670] (-350.129) (-350.297) * (-353.330) (-348.886) (-352.019) [-349.188] -- 0:00:34
432500 -- (-357.176) (-353.828) (-351.370) [-350.834] * (-349.040) (-352.914) [-351.042] (-349.198) -- 0:00:34
433000 -- [-349.584] (-350.927) (-353.117) (-351.174) * (-348.979) (-348.583) (-350.242) [-349.599] -- 0:00:34
433500 -- [-349.895] (-350.805) (-353.040) (-351.750) * [-352.743] (-350.022) (-349.632) (-349.586) -- 0:00:33
434000 -- (-351.637) (-350.686) [-349.933] (-350.052) * (-350.364) (-350.520) (-349.772) [-347.910] -- 0:00:33
434500 -- (-350.519) (-349.392) [-349.052] (-355.000) * (-348.576) (-349.442) [-348.274] (-349.965) -- 0:00:33
435000 -- [-351.293] (-349.520) (-349.131) (-349.870) * (-349.040) (-349.446) [-352.576] (-352.361) -- 0:00:33
Average standard deviation of split frequencies: 0.008713
435500 -- (-356.152) [-352.077] (-350.537) (-350.626) * (-350.084) [-348.812] (-354.988) (-350.289) -- 0:00:33
436000 -- (-352.719) (-348.953) [-349.704] (-352.034) * [-348.526] (-352.420) (-351.425) (-348.494) -- 0:00:33
436500 -- (-351.521) [-350.452] (-351.618) (-349.830) * (-348.711) (-353.649) [-348.155] (-353.060) -- 0:00:33
437000 -- (-348.565) [-351.306] (-349.116) (-349.973) * (-348.893) (-355.015) [-349.649] (-350.816) -- 0:00:33
437500 -- (-349.123) [-350.547] (-352.433) (-350.662) * (-349.641) (-350.903) (-349.679) [-350.910] -- 0:00:33
438000 -- (-349.805) (-351.973) [-351.874] (-349.891) * (-348.582) (-348.765) [-350.192] (-351.271) -- 0:00:33
438500 -- (-349.770) (-351.488) (-350.937) [-348.952] * (-351.813) (-350.934) (-352.852) [-349.404] -- 0:00:33
439000 -- [-351.176] (-351.497) (-349.944) (-349.306) * (-348.747) (-352.729) (-351.098) [-349.225] -- 0:00:33
439500 -- (-352.149) (-352.223) [-348.484] (-349.850) * (-349.092) (-349.033) [-348.100] (-349.885) -- 0:00:33
440000 -- (-356.109) (-350.896) (-348.493) [-348.571] * (-348.453) [-350.603] (-355.289) (-349.929) -- 0:00:33
Average standard deviation of split frequencies: 0.009124
440500 -- (-351.339) (-349.893) (-350.596) [-348.422] * (-349.787) (-356.345) [-349.458] (-352.178) -- 0:00:33
441000 -- (-355.291) (-348.941) (-349.506) [-348.445] * [-349.768] (-350.086) (-350.298) (-350.058) -- 0:00:32
441500 -- (-352.193) [-348.765] (-348.985) (-349.203) * (-351.565) (-349.484) (-349.414) [-349.532] -- 0:00:34
442000 -- (-349.789) (-355.771) (-349.232) [-349.354] * (-349.375) (-350.678) [-349.069] (-352.526) -- 0:00:34
442500 -- (-351.640) (-349.600) (-353.593) [-349.186] * (-349.795) (-350.107) (-350.062) [-350.071] -- 0:00:34
443000 -- (-353.614) (-351.801) (-351.989) [-357.454] * (-349.847) (-348.011) (-350.060) [-351.742] -- 0:00:33
443500 -- (-351.455) (-348.018) [-350.291] (-352.501) * (-350.398) [-348.916] (-351.609) (-349.778) -- 0:00:33
444000 -- (-352.796) [-350.660] (-349.838) (-351.534) * (-351.931) (-350.171) (-349.623) [-355.135] -- 0:00:33
444500 -- (-351.779) (-349.333) [-349.356] (-350.316) * (-350.321) [-348.709] (-349.155) (-352.566) -- 0:00:33
445000 -- [-349.509] (-350.193) (-353.720) (-350.141) * (-352.039) [-350.476] (-348.474) (-349.217) -- 0:00:33
Average standard deviation of split frequencies: 0.009140
445500 -- (-351.002) (-353.161) (-352.672) [-350.964] * (-349.731) (-352.296) [-348.655] (-352.535) -- 0:00:33
446000 -- [-348.641] (-353.131) (-349.166) (-351.876) * (-349.374) [-349.420] (-354.273) (-347.976) -- 0:00:33
446500 -- (-352.442) (-349.851) [-348.830] (-350.991) * (-350.137) [-350.551] (-352.526) (-354.043) -- 0:00:33
447000 -- [-353.984] (-348.625) (-350.015) (-351.850) * (-350.047) (-348.178) [-348.727] (-349.289) -- 0:00:33
447500 -- (-352.287) (-349.098) (-350.270) [-352.589] * (-350.842) [-350.049] (-349.489) (-351.256) -- 0:00:33
448000 -- (-348.844) (-348.440) (-350.796) [-350.263] * (-356.063) (-348.485) (-349.089) [-349.609] -- 0:00:33
448500 -- [-349.551] (-349.288) (-355.458) (-352.347) * (-353.917) (-349.226) (-349.378) [-348.893] -- 0:00:33
449000 -- (-349.610) (-352.312) [-353.325] (-349.452) * (-352.082) [-348.797] (-349.799) (-349.116) -- 0:00:33
449500 -- (-349.876) [-350.017] (-351.948) (-348.012) * (-352.285) (-349.879) (-350.235) [-354.341] -- 0:00:33
450000 -- (-351.325) (-349.602) [-349.595] (-351.679) * [-349.174] (-351.921) (-350.976) (-350.073) -- 0:00:33
Average standard deviation of split frequencies: 0.009906
450500 -- (-351.924) (-348.007) (-353.393) [-348.042] * (-351.117) (-351.096) (-349.780) [-349.077] -- 0:00:32
451000 -- (-349.929) (-348.887) [-351.605] (-349.238) * (-354.308) (-351.621) (-349.916) [-348.338] -- 0:00:32
451500 -- (-353.145) (-355.120) (-348.891) [-352.416] * (-355.671) (-351.070) [-350.300] (-350.140) -- 0:00:32
452000 -- (-349.789) [-348.723] (-353.450) (-348.597) * (-349.740) (-349.353) (-350.900) [-350.842] -- 0:00:32
452500 -- (-352.120) (-350.712) (-349.071) [-348.434] * [-352.257] (-348.484) (-352.522) (-350.515) -- 0:00:32
453000 -- (-351.720) [-350.624] (-349.086) (-350.734) * [-350.789] (-347.943) (-350.278) (-352.833) -- 0:00:32
453500 -- (-350.167) (-351.619) [-351.357] (-349.846) * (-351.379) [-352.811] (-348.535) (-354.348) -- 0:00:32
454000 -- (-352.206) (-348.837) [-349.180] (-350.888) * (-349.843) [-355.295] (-350.522) (-354.445) -- 0:00:32
454500 -- (-355.614) (-348.028) (-353.586) [-349.771] * (-349.635) [-356.045] (-350.383) (-351.512) -- 0:00:32
455000 -- (-351.321) (-348.328) [-352.107] (-349.768) * (-354.212) [-351.317] (-349.842) (-351.390) -- 0:00:32
Average standard deviation of split frequencies: 0.009851
455500 -- [-349.014] (-351.930) (-349.052) (-350.341) * (-349.554) (-351.993) [-348.697] (-351.814) -- 0:00:32
456000 -- (-349.334) (-352.010) (-349.884) [-349.074] * (-348.828) (-353.254) (-352.268) [-349.969] -- 0:00:32
456500 -- (-349.172) (-350.624) (-348.340) [-352.298] * (-351.980) (-349.266) [-351.305] (-355.120) -- 0:00:32
457000 -- (-348.368) (-353.798) [-348.783] (-355.394) * (-350.341) (-349.140) [-351.909] (-350.763) -- 0:00:32
457500 -- (-350.693) (-350.232) [-348.588] (-353.148) * (-349.414) (-351.523) (-349.802) [-349.958] -- 0:00:32
458000 -- (-351.285) (-350.650) (-348.858) [-353.205] * (-348.913) (-354.242) (-355.248) [-350.353] -- 0:00:31
458500 -- (-353.957) [-348.356] (-351.940) (-348.877) * (-350.985) (-355.021) (-350.292) [-350.311] -- 0:00:33
459000 -- (-349.610) [-351.048] (-352.251) (-351.178) * (-349.311) [-357.800] (-349.566) (-349.989) -- 0:00:33
459500 -- (-351.088) (-350.633) [-355.040] (-349.383) * (-349.236) (-349.986) [-351.620] (-349.324) -- 0:00:32
460000 -- (-355.104) [-352.389] (-350.769) (-353.578) * [-349.793] (-349.006) (-350.644) (-352.101) -- 0:00:32
Average standard deviation of split frequencies: 0.010414
460500 -- [-350.117] (-348.315) (-351.388) (-350.264) * (-349.406) (-354.214) (-354.554) [-348.433] -- 0:00:32
461000 -- (-352.198) (-349.442) (-354.598) [-351.328] * (-349.339) (-350.832) (-352.985) [-349.682] -- 0:00:32
461500 -- (-351.905) (-349.673) [-348.674] (-349.569) * (-348.943) (-350.509) [-348.169] (-349.785) -- 0:00:32
462000 -- [-351.029] (-353.080) (-353.271) (-349.589) * (-350.589) (-352.651) [-350.038] (-348.761) -- 0:00:32
462500 -- (-353.405) [-349.692] (-355.341) (-352.737) * (-350.301) (-352.740) (-349.847) [-349.794] -- 0:00:32
463000 -- (-351.351) (-350.440) (-352.032) [-350.760] * (-357.060) (-349.357) (-349.323) [-350.294] -- 0:00:32
463500 -- (-351.384) (-350.664) [-348.909] (-351.512) * [-350.683] (-350.487) (-348.470) (-349.599) -- 0:00:32
464000 -- (-349.597) [-348.158] (-349.532) (-350.812) * (-349.850) (-349.404) (-350.732) [-349.855] -- 0:00:32
464500 -- (-350.950) (-348.568) [-349.576] (-350.614) * (-351.042) (-349.474) (-349.695) [-351.195] -- 0:00:32
465000 -- [-349.370] (-348.962) (-352.927) (-348.377) * [-349.169] (-349.574) (-350.488) (-350.016) -- 0:00:32
Average standard deviation of split frequencies: 0.009759
465500 -- (-350.153) (-353.409) [-348.113] (-352.165) * [-348.870] (-352.253) (-350.912) (-353.879) -- 0:00:32
466000 -- (-351.502) (-353.767) [-349.119] (-352.422) * [-349.928] (-349.256) (-350.126) (-348.819) -- 0:00:32
466500 -- (-349.393) (-350.253) [-350.240] (-348.826) * (-349.361) (-349.605) (-349.665) [-350.982] -- 0:00:32
467000 -- (-350.085) [-349.851] (-350.699) (-349.754) * (-353.271) [-350.481] (-349.587) (-355.106) -- 0:00:31
467500 -- (-348.473) (-353.213) [-349.292] (-349.867) * [-349.200] (-350.123) (-349.179) (-351.937) -- 0:00:31
468000 -- (-349.038) [-350.947] (-349.045) (-351.046) * (-351.664) [-350.185] (-349.129) (-354.404) -- 0:00:31
468500 -- [-348.810] (-348.052) (-348.426) (-350.521) * [-350.538] (-348.679) (-350.136) (-353.668) -- 0:00:31
469000 -- (-349.045) (-349.824) [-349.672] (-354.340) * [-352.567] (-350.150) (-349.385) (-352.673) -- 0:00:31
469500 -- (-348.066) (-349.328) (-350.171) [-351.606] * (-349.564) [-350.755] (-350.675) (-355.798) -- 0:00:31
470000 -- [-350.352] (-348.664) (-348.766) (-351.859) * [-349.474] (-351.494) (-352.815) (-351.277) -- 0:00:31
Average standard deviation of split frequencies: 0.009544
470500 -- (-352.936) (-350.298) [-353.394] (-352.426) * [-349.293] (-351.247) (-352.947) (-350.186) -- 0:00:31
471000 -- (-356.386) [-349.599] (-349.135) (-350.493) * (-351.929) [-350.681] (-349.827) (-347.899) -- 0:00:31
471500 -- (-349.963) (-350.460) [-352.107] (-351.201) * (-350.963) (-355.877) [-348.836] (-349.029) -- 0:00:31
472000 -- (-354.275) [-355.226] (-349.695) (-348.166) * [-351.096] (-350.897) (-350.399) (-348.354) -- 0:00:31
472500 -- (-348.261) [-349.315] (-347.999) (-351.006) * (-354.263) [-350.516] (-350.523) (-349.923) -- 0:00:31
473000 -- [-350.734] (-350.282) (-351.958) (-351.417) * (-350.621) [-349.883] (-351.451) (-350.829) -- 0:00:31
473500 -- [-348.767] (-350.368) (-349.767) (-349.367) * [-350.386] (-349.787) (-354.199) (-350.946) -- 0:00:31
474000 -- [-348.104] (-355.706) (-348.863) (-347.854) * (-353.089) (-354.441) (-353.800) [-349.506] -- 0:00:31
474500 -- (-349.618) [-351.667] (-352.214) (-349.277) * (-349.258) [-349.592] (-348.739) (-350.690) -- 0:00:31
475000 -- (-349.199) (-349.943) (-349.266) [-349.488] * (-351.326) (-349.287) (-351.650) [-348.116] -- 0:00:30
Average standard deviation of split frequencies: 0.009612
475500 -- [-349.562] (-353.348) (-348.743) (-351.770) * [-350.225] (-348.512) (-347.886) (-349.664) -- 0:00:30
476000 -- (-351.974) [-351.441] (-349.934) (-349.675) * (-351.871) (-348.775) (-349.918) [-351.635] -- 0:00:31
476500 -- (-353.104) [-347.862] (-349.154) (-350.743) * [-349.642] (-349.169) (-352.348) (-348.378) -- 0:00:31
477000 -- (-349.320) [-349.008] (-354.866) (-348.222) * (-350.095) [-350.145] (-351.558) (-348.221) -- 0:00:31
477500 -- (-348.696) (-352.816) (-350.618) [-351.403] * [-350.132] (-350.010) (-349.055) (-350.983) -- 0:00:31
478000 -- [-350.106] (-348.972) (-349.508) (-353.554) * (-352.250) (-350.170) [-349.287] (-348.681) -- 0:00:31
478500 -- [-349.738] (-351.261) (-349.893) (-351.508) * (-350.697) (-348.002) [-350.549] (-348.619) -- 0:00:31
479000 -- (-351.979) (-354.200) (-349.064) [-351.568] * (-348.046) (-350.989) [-350.124] (-348.967) -- 0:00:31
479500 -- (-352.481) (-359.619) (-349.102) [-349.556] * (-349.523) (-350.013) [-349.992] (-348.994) -- 0:00:31
480000 -- (-354.664) (-351.092) (-351.530) [-352.873] * (-350.810) (-351.420) [-349.655] (-354.012) -- 0:00:31
Average standard deviation of split frequencies: 0.009634
480500 -- (-350.807) [-349.057] (-350.990) (-350.312) * (-348.358) [-348.917] (-351.753) (-349.541) -- 0:00:31
481000 -- (-349.749) (-350.901) (-351.461) [-349.171] * (-350.991) (-351.858) [-350.025] (-349.415) -- 0:00:31
481500 -- [-349.013] (-351.241) (-349.841) (-350.213) * [-348.069] (-351.697) (-350.526) (-354.279) -- 0:00:31
482000 -- (-350.963) (-351.921) (-349.636) [-351.522] * [-348.872] (-351.349) (-353.597) (-350.576) -- 0:00:31
482500 -- (-349.244) [-352.225] (-348.089) (-349.177) * (-348.849) (-349.908) (-349.850) [-352.258] -- 0:00:31
483000 -- [-349.396] (-350.541) (-351.101) (-347.993) * (-349.658) (-353.139) [-348.363] (-350.077) -- 0:00:31
483500 -- [-349.378] (-352.384) (-351.068) (-349.973) * (-354.309) (-348.664) (-351.349) [-349.693] -- 0:00:30
484000 -- (-351.679) [-349.566] (-352.361) (-349.880) * (-352.781) [-349.935] (-351.244) (-349.929) -- 0:00:30
484500 -- (-348.942) [-350.587] (-351.503) (-349.678) * (-350.840) (-350.971) [-350.913] (-353.021) -- 0:00:30
485000 -- (-349.727) (-349.902) (-352.172) [-348.395] * (-349.395) (-351.286) [-350.390] (-351.953) -- 0:00:30
Average standard deviation of split frequencies: 0.009357
485500 -- (-353.757) (-349.057) [-349.627] (-348.333) * (-349.151) (-350.253) [-348.330] (-351.313) -- 0:00:30
486000 -- [-352.347] (-351.580) (-350.573) (-351.701) * [-351.819] (-352.782) (-348.479) (-349.675) -- 0:00:30
486500 -- [-354.783] (-351.449) (-353.809) (-351.411) * [-353.160] (-351.318) (-351.073) (-349.777) -- 0:00:30
487000 -- (-358.418) (-348.850) (-350.613) [-351.679] * (-351.537) (-350.636) (-353.858) [-353.320] -- 0:00:30
487500 -- (-361.892) (-348.314) (-351.847) [-350.448] * (-353.898) (-353.398) [-350.758] (-349.504) -- 0:00:30
488000 -- (-354.844) (-348.440) (-353.729) [-350.075] * (-349.184) [-350.932] (-351.644) (-351.902) -- 0:00:30
488500 -- (-353.150) (-349.880) [-357.802] (-350.386) * (-356.458) (-350.421) (-349.834) [-350.697] -- 0:00:30
489000 -- [-349.184] (-354.352) (-350.258) (-350.945) * (-356.463) (-351.515) [-348.829] (-350.839) -- 0:00:30
489500 -- (-352.264) [-349.937] (-350.092) (-350.327) * (-350.083) (-351.257) (-349.771) [-348.961] -- 0:00:30
490000 -- (-353.448) [-348.465] (-350.415) (-351.983) * (-356.369) (-350.531) (-348.708) [-349.686] -- 0:00:30
Average standard deviation of split frequencies: 0.009438
490500 -- [-349.292] (-351.051) (-349.928) (-352.330) * [-349.824] (-350.406) (-351.122) (-349.189) -- 0:00:30
491000 -- (-351.337) (-350.623) (-352.606) [-349.657] * (-353.237) [-351.478] (-350.485) (-349.466) -- 0:00:30
491500 -- (-348.053) (-353.575) (-349.495) [-350.107] * (-349.620) [-348.958] (-349.204) (-350.944) -- 0:00:30
492000 -- (-348.592) (-348.909) (-348.841) [-349.041] * [-349.596] (-350.730) (-358.310) (-352.189) -- 0:00:29
492500 -- (-349.867) (-352.376) (-349.216) [-352.487] * [-350.164] (-353.292) (-348.869) (-350.508) -- 0:00:29
493000 -- [-351.623] (-350.008) (-351.067) (-351.144) * [-349.774] (-349.728) (-349.236) (-354.061) -- 0:00:30
493500 -- [-348.486] (-351.109) (-350.272) (-348.916) * (-349.967) (-349.434) (-349.280) [-348.978] -- 0:00:30
494000 -- [-351.601] (-351.848) (-348.436) (-348.384) * (-349.818) (-350.517) [-350.278] (-349.074) -- 0:00:30
494500 -- (-348.672) [-349.204] (-350.460) (-350.156) * (-350.179) (-353.939) [-349.409] (-349.264) -- 0:00:30
495000 -- (-348.178) [-348.705] (-348.505) (-348.896) * (-350.390) [-351.946] (-348.421) (-348.473) -- 0:00:30
Average standard deviation of split frequencies: 0.009336
495500 -- (-348.155) [-353.562] (-350.628) (-349.228) * (-350.972) [-350.906] (-350.645) (-349.535) -- 0:00:30
496000 -- (-348.478) [-351.356] (-351.797) (-350.292) * (-351.397) [-350.131] (-351.133) (-348.734) -- 0:00:30
496500 -- (-350.122) (-350.400) (-349.404) [-348.500] * (-354.835) (-349.434) (-350.563) [-349.666] -- 0:00:30
497000 -- (-349.924) (-356.839) [-348.152] (-353.151) * (-350.480) (-350.197) (-349.466) [-349.466] -- 0:00:30
497500 -- (-355.455) [-348.753] (-349.199) (-355.086) * [-349.794] (-347.890) (-352.568) (-349.571) -- 0:00:30
498000 -- (-356.024) (-348.497) (-349.041) [-348.853] * (-351.170) [-349.248] (-349.066) (-349.832) -- 0:00:30
498500 -- (-351.450) (-352.495) (-350.733) [-350.028] * (-350.260) (-349.289) (-349.236) [-348.464] -- 0:00:30
499000 -- (-349.957) [-348.386] (-352.377) (-351.423) * (-351.877) [-349.568] (-352.438) (-348.402) -- 0:00:30
499500 -- (-352.542) (-348.698) (-348.853) [-349.757] * (-350.439) [-349.789] (-353.376) (-353.329) -- 0:00:30
500000 -- (-349.859) (-351.282) [-349.022] (-349.720) * (-350.481) (-351.840) (-349.472) [-350.555] -- 0:00:30
Average standard deviation of split frequencies: 0.010191
500500 -- [-349.556] (-349.286) (-349.471) (-351.822) * (-354.413) (-348.423) [-351.113] (-351.295) -- 0:00:29
501000 -- (-349.046) (-354.556) [-351.363] (-350.783) * (-354.697) [-349.179] (-349.645) (-350.306) -- 0:00:29
501500 -- (-351.564) (-358.273) [-350.860] (-351.460) * [-352.671] (-350.063) (-348.926) (-351.430) -- 0:00:29
502000 -- (-357.969) (-351.390) (-350.671) [-350.483] * (-351.395) (-349.069) (-355.106) [-351.874] -- 0:00:29
502500 -- (-348.581) (-349.685) (-350.220) [-350.306] * (-349.074) (-354.894) [-353.478] (-349.424) -- 0:00:29
503000 -- (-351.796) [-350.060] (-349.667) (-349.407) * [-350.516] (-350.315) (-350.296) (-349.488) -- 0:00:29
503500 -- (-351.430) (-349.725) [-354.078] (-349.914) * [-351.740] (-350.740) (-351.819) (-354.169) -- 0:00:29
504000 -- [-352.757] (-351.512) (-350.814) (-349.228) * (-351.693) (-350.122) (-350.542) [-348.612] -- 0:00:29
504500 -- (-351.008) [-351.157] (-351.517) (-349.041) * (-348.682) (-349.926) [-349.794] (-353.833) -- 0:00:29
505000 -- [-349.667] (-350.046) (-350.058) (-351.373) * (-349.057) [-350.604] (-351.356) (-352.797) -- 0:00:29
Average standard deviation of split frequencies: 0.010193
505500 -- (-350.468) [-350.797] (-349.773) (-354.663) * (-350.845) (-348.752) (-349.542) [-349.695] -- 0:00:29
506000 -- [-348.380] (-354.561) (-349.453) (-349.331) * (-348.930) (-350.068) (-349.142) [-350.860] -- 0:00:29
506500 -- [-350.449] (-348.265) (-349.661) (-349.555) * (-350.079) (-349.084) [-349.018] (-351.724) -- 0:00:29
507000 -- (-350.074) (-349.356) [-350.622] (-350.200) * (-349.649) [-349.964] (-348.893) (-352.616) -- 0:00:29
507500 -- [-348.001] (-349.623) (-348.572) (-351.256) * [-349.366] (-349.236) (-349.224) (-349.533) -- 0:00:29
508000 -- [-349.596] (-349.370) (-349.267) (-350.572) * (-350.725) [-348.571] (-350.677) (-348.588) -- 0:00:29
508500 -- (-350.619) [-352.827] (-347.972) (-348.990) * (-349.997) [-351.457] (-349.954) (-348.899) -- 0:00:28
509000 -- [-351.386] (-349.353) (-350.368) (-349.431) * [-352.321] (-348.671) (-350.104) (-349.170) -- 0:00:28
509500 -- (-350.131) (-351.040) [-350.966] (-351.003) * (-353.939) [-349.049] (-350.627) (-350.323) -- 0:00:28
510000 -- (-349.089) (-351.549) [-351.607] (-349.421) * (-349.752) (-350.463) [-350.344] (-350.222) -- 0:00:28
Average standard deviation of split frequencies: 0.010643
510500 -- (-348.547) [-351.060] (-352.033) (-351.835) * (-353.304) (-351.094) (-350.790) [-348.450] -- 0:00:29
511000 -- (-350.619) (-350.955) (-348.536) [-348.511] * [-349.220] (-356.607) (-349.786) (-349.473) -- 0:00:29
511500 -- [-348.454] (-349.996) (-349.790) (-349.085) * [-348.158] (-353.726) (-350.886) (-354.462) -- 0:00:29
512000 -- (-349.332) [-351.056] (-351.744) (-349.827) * (-349.724) (-354.408) (-350.349) [-349.543] -- 0:00:29
512500 -- (-350.378) (-353.416) (-349.166) [-348.849] * (-348.888) (-348.870) (-348.653) [-350.797] -- 0:00:29
513000 -- [-348.705] (-355.044) (-350.020) (-352.448) * (-355.534) [-348.121] (-348.963) (-351.597) -- 0:00:29
513500 -- (-351.615) (-350.663) (-352.963) [-350.338] * (-349.120) (-349.588) (-349.668) [-352.001] -- 0:00:29
514000 -- (-350.019) (-351.734) (-349.750) [-349.819] * [-353.402] (-353.331) (-350.792) (-351.618) -- 0:00:29
514500 -- (-349.384) (-350.101) (-352.551) [-349.035] * (-353.090) (-349.809) (-349.429) [-349.542] -- 0:00:29
515000 -- (-351.183) (-349.944) [-349.879] (-348.710) * (-349.238) (-352.235) (-350.496) [-348.730] -- 0:00:29
Average standard deviation of split frequencies: 0.009727
515500 -- (-350.270) (-352.488) [-349.692] (-352.495) * (-348.290) [-350.725] (-351.943) (-348.652) -- 0:00:29
516000 -- (-352.479) (-350.554) [-350.493] (-350.931) * [-350.921] (-351.670) (-350.568) (-348.407) -- 0:00:29
516500 -- [-349.901] (-349.177) (-349.887) (-353.094) * [-348.640] (-351.673) (-349.337) (-348.711) -- 0:00:29
517000 -- [-349.731] (-348.021) (-350.948) (-350.953) * [-350.604] (-351.485) (-355.121) (-349.463) -- 0:00:28
517500 -- (-350.569) (-349.620) [-351.731] (-350.971) * [-348.976] (-350.741) (-353.455) (-349.382) -- 0:00:28
518000 -- [-348.937] (-349.943) (-351.946) (-349.963) * (-348.776) [-348.742] (-351.183) (-350.881) -- 0:00:28
518500 -- (-348.997) [-349.272] (-350.496) (-348.465) * (-350.611) (-349.718) [-353.222] (-354.026) -- 0:00:28
519000 -- (-352.324) [-348.276] (-350.414) (-349.774) * (-351.962) (-349.192) [-349.891] (-349.948) -- 0:00:28
519500 -- (-349.147) (-350.063) [-350.971] (-351.446) * [-350.016] (-351.084) (-350.485) (-349.251) -- 0:00:28
520000 -- [-348.637] (-351.252) (-349.746) (-353.074) * (-350.441) [-350.356] (-351.927) (-350.538) -- 0:00:28
Average standard deviation of split frequencies: 0.010545
520500 -- (-348.371) [-350.264] (-348.956) (-351.078) * [-350.536] (-353.416) (-352.199) (-351.303) -- 0:00:28
521000 -- (-348.706) (-351.572) [-351.576] (-350.746) * (-348.817) (-349.188) [-349.814] (-350.856) -- 0:00:28
521500 -- (-349.996) (-351.702) [-351.322] (-354.878) * [-348.034] (-351.184) (-349.894) (-348.469) -- 0:00:28
522000 -- (-350.314) [-348.387] (-350.221) (-348.886) * (-350.374) (-350.313) [-348.708] (-351.960) -- 0:00:28
522500 -- [-350.034] (-348.131) (-348.609) (-350.333) * (-350.809) (-350.430) (-350.614) [-349.318] -- 0:00:28
523000 -- (-350.454) [-351.410] (-348.582) (-348.804) * (-348.199) (-350.802) (-351.155) [-349.037] -- 0:00:28
523500 -- (-353.817) (-350.212) [-350.305] (-350.571) * (-351.342) (-349.105) [-348.861] (-352.236) -- 0:00:28
524000 -- (-349.906) (-348.271) [-350.093] (-349.290) * (-350.890) [-349.143] (-348.803) (-349.551) -- 0:00:28
524500 -- [-351.235] (-353.066) (-349.713) (-349.197) * (-350.920) (-351.152) (-350.258) [-348.820] -- 0:00:28
525000 -- [-350.182] (-350.902) (-350.286) (-349.882) * (-355.043) [-349.790] (-352.446) (-349.525) -- 0:00:28
Average standard deviation of split frequencies: 0.010438
525500 -- (-350.336) [-348.606] (-351.001) (-350.562) * (-354.411) (-351.224) (-350.605) [-349.990] -- 0:00:27
526000 -- [-350.895] (-349.431) (-353.173) (-348.212) * [-352.145] (-350.596) (-353.131) (-348.935) -- 0:00:27
526500 -- (-355.933) (-349.012) [-353.522] (-348.520) * (-351.010) (-348.984) [-353.395] (-352.094) -- 0:00:27
527000 -- (-350.271) [-352.047] (-354.932) (-356.349) * (-354.801) [-349.738] (-352.514) (-349.026) -- 0:00:27
527500 -- (-349.085) (-350.674) [-349.604] (-352.032) * (-351.382) (-348.292) [-350.062] (-351.037) -- 0:00:28
528000 -- (-353.394) (-351.133) [-349.242] (-348.425) * (-352.693) [-349.270] (-349.920) (-349.926) -- 0:00:28
528500 -- (-348.127) [-349.246] (-356.545) (-350.281) * (-350.677) (-351.149) [-348.984] (-356.324) -- 0:00:28
529000 -- (-349.181) (-352.326) [-349.318] (-349.565) * (-350.285) (-351.221) (-354.988) [-351.047] -- 0:00:28
529500 -- [-350.887] (-356.142) (-352.708) (-349.063) * (-351.755) (-350.076) (-349.278) [-351.045] -- 0:00:28
530000 -- [-349.396] (-351.370) (-348.873) (-349.790) * [-351.342] (-349.636) (-348.839) (-351.812) -- 0:00:28
Average standard deviation of split frequencies: 0.010503
530500 -- (-349.606) (-355.015) (-350.547) [-349.518] * [-348.508] (-354.997) (-350.644) (-348.755) -- 0:00:28
531000 -- (-348.776) (-350.119) (-349.784) [-349.122] * (-348.627) [-350.138] (-351.586) (-350.296) -- 0:00:28
531500 -- (-349.566) [-349.377] (-350.440) (-350.914) * (-350.119) (-350.773) (-353.366) [-349.705] -- 0:00:28
532000 -- [-352.259] (-349.236) (-349.210) (-348.814) * [-349.549] (-358.029) (-349.570) (-352.187) -- 0:00:28
532500 -- (-348.641) (-350.850) [-349.130] (-349.610) * (-351.325) [-347.882] (-349.025) (-353.409) -- 0:00:28
533000 -- (-353.426) (-351.354) [-349.650] (-350.222) * (-350.796) (-352.569) (-355.435) [-351.983] -- 0:00:28
533500 -- (-352.126) (-352.926) (-351.800) [-349.097] * (-350.278) (-354.141) [-349.423] (-351.346) -- 0:00:27
534000 -- (-354.425) (-349.560) (-349.716) [-350.042] * (-348.123) [-350.009] (-349.857) (-350.158) -- 0:00:27
534500 -- (-352.140) (-349.364) [-349.099] (-349.106) * (-348.434) (-351.506) (-348.711) [-349.363] -- 0:00:27
535000 -- (-350.856) (-350.003) [-349.589] (-350.310) * (-350.910) (-350.689) [-350.670] (-350.546) -- 0:00:27
Average standard deviation of split frequencies: 0.010192
535500 -- (-348.916) (-353.296) (-350.341) [-349.714] * (-349.788) [-348.570] (-353.705) (-349.890) -- 0:00:27
536000 -- [-351.138] (-349.391) (-350.287) (-351.020) * (-349.813) (-351.781) (-351.153) [-348.404] -- 0:00:27
536500 -- (-349.509) [-353.501] (-349.199) (-350.707) * [-351.180] (-349.912) (-352.131) (-351.723) -- 0:00:27
537000 -- (-349.154) (-353.645) (-352.171) [-348.965] * (-349.650) (-350.480) [-350.755] (-350.112) -- 0:00:27
537500 -- (-350.054) (-354.317) [-356.326] (-353.694) * [-349.472] (-349.169) (-352.120) (-348.085) -- 0:00:27
538000 -- (-348.061) (-349.897) [-349.216] (-350.033) * (-351.669) (-349.279) [-350.455] (-348.610) -- 0:00:27
538500 -- (-352.817) [-349.176] (-353.838) (-351.521) * (-350.490) [-348.527] (-349.136) (-348.928) -- 0:00:27
539000 -- (-352.215) (-348.655) [-348.429] (-351.108) * (-350.274) (-349.718) (-352.288) [-350.751] -- 0:00:27
539500 -- [-349.995] (-347.940) (-348.871) (-352.450) * [-349.922] (-350.956) (-350.028) (-349.284) -- 0:00:27
540000 -- [-349.967] (-348.989) (-351.547) (-349.785) * (-349.856) (-352.289) (-350.170) [-349.260] -- 0:00:27
Average standard deviation of split frequencies: 0.009918
540500 -- (-348.805) [-350.535] (-353.256) (-350.008) * (-350.883) (-351.858) [-349.042] (-349.990) -- 0:00:27
541000 -- [-352.384] (-353.545) (-349.128) (-350.217) * (-351.046) [-349.742] (-348.512) (-352.445) -- 0:00:27
541500 -- (-355.838) [-351.161] (-348.972) (-350.505) * (-352.201) (-351.700) (-349.430) [-349.166] -- 0:00:27
542000 -- (-350.470) (-349.337) [-349.529] (-348.137) * (-349.161) [-348.786] (-348.745) (-353.503) -- 0:00:27
542500 -- (-349.052) (-350.383) (-349.115) [-350.899] * [-351.820] (-350.101) (-348.101) (-349.518) -- 0:00:26
543000 -- [-350.953] (-350.369) (-351.029) (-354.975) * (-350.166) (-351.297) [-352.773] (-352.224) -- 0:00:26
543500 -- (-349.726) (-350.472) [-348.682] (-354.906) * (-351.750) (-352.898) [-349.569] (-349.558) -- 0:00:26
544000 -- (-351.108) (-349.242) [-352.634] (-352.666) * [-348.468] (-350.767) (-350.550) (-351.121) -- 0:00:26
544500 -- (-351.689) (-349.495) [-348.282] (-352.221) * [-351.801] (-349.912) (-351.120) (-353.144) -- 0:00:27
545000 -- (-350.175) (-349.446) [-348.979] (-352.173) * (-350.022) (-351.218) [-349.609] (-352.751) -- 0:00:27
Average standard deviation of split frequencies: 0.010056
545500 -- [-350.486] (-348.281) (-349.177) (-354.688) * (-349.876) (-351.480) (-351.143) [-349.100] -- 0:00:27
546000 -- (-349.243) (-351.927) (-352.270) [-354.360] * (-352.677) (-351.070) (-349.732) [-353.494] -- 0:00:27
546500 -- [-348.661] (-352.695) (-348.504) (-353.687) * (-350.645) (-350.559) (-349.004) [-350.938] -- 0:00:27
547000 -- (-353.347) (-350.728) (-348.256) [-351.018] * (-351.590) [-349.810] (-351.317) (-350.902) -- 0:00:27
547500 -- (-348.347) (-352.489) (-352.586) [-352.702] * (-349.520) (-351.455) [-349.420] (-353.052) -- 0:00:27
548000 -- (-349.722) (-354.086) [-347.888] (-351.676) * (-349.152) [-352.559] (-351.234) (-349.833) -- 0:00:27
548500 -- (-348.795) (-350.338) (-347.861) [-349.336] * (-350.161) (-351.067) (-352.263) [-348.783] -- 0:00:27
549000 -- [-350.750] (-350.118) (-352.030) (-350.576) * (-349.504) (-350.174) [-350.965] (-349.840) -- 0:00:27
549500 -- [-348.482] (-349.668) (-349.215) (-352.542) * (-349.676) [-352.051] (-348.677) (-349.789) -- 0:00:27
550000 -- (-348.317) (-351.813) [-349.129] (-355.863) * (-357.031) (-350.904) [-351.187] (-349.597) -- 0:00:27
Average standard deviation of split frequencies: 0.009203
550500 -- (-352.127) [-349.222] (-349.425) (-350.233) * (-353.436) [-350.976] (-351.439) (-349.499) -- 0:00:26
551000 -- (-349.771) (-350.011) [-348.376] (-351.789) * (-348.944) [-351.955] (-349.758) (-352.505) -- 0:00:26
551500 -- (-349.886) [-350.035] (-349.468) (-349.771) * (-351.119) [-349.038] (-351.503) (-348.850) -- 0:00:26
552000 -- (-350.378) (-353.101) (-351.252) [-349.920] * (-351.600) [-350.052] (-349.896) (-349.531) -- 0:00:26
552500 -- (-348.864) (-349.085) (-352.688) [-352.496] * (-349.123) [-349.271] (-348.856) (-353.248) -- 0:00:26
553000 -- [-350.253] (-348.865) (-351.793) (-349.241) * (-348.508) (-353.297) [-348.842] (-350.767) -- 0:00:26
553500 -- (-351.421) [-355.302] (-350.731) (-351.792) * (-350.488) [-352.524] (-350.908) (-350.999) -- 0:00:26
554000 -- (-348.949) (-350.519) [-349.939] (-351.215) * [-351.764] (-349.273) (-350.100) (-349.273) -- 0:00:26
554500 -- [-349.901] (-351.637) (-350.604) (-348.193) * (-352.284) [-351.092] (-351.340) (-348.700) -- 0:00:26
555000 -- [-349.524] (-349.419) (-348.486) (-350.029) * (-350.295) [-350.725] (-351.256) (-349.139) -- 0:00:26
Average standard deviation of split frequencies: 0.008955
555500 -- (-351.593) (-349.075) [-354.888] (-349.522) * (-350.560) (-348.968) (-354.129) [-351.181] -- 0:00:26
556000 -- (-350.480) (-348.947) [-356.284] (-350.419) * (-350.571) (-349.125) (-356.051) [-348.999] -- 0:00:26
556500 -- (-351.396) (-349.206) [-351.734] (-351.115) * [-350.020] (-349.024) (-350.926) (-350.490) -- 0:00:26
557000 -- [-351.690] (-352.408) (-351.735) (-351.020) * (-349.522) (-348.962) [-349.557] (-350.828) -- 0:00:26
557500 -- (-349.799) (-350.613) (-349.702) [-349.942] * [-350.840] (-352.340) (-357.008) (-352.713) -- 0:00:26
558000 -- (-349.338) (-350.009) (-349.845) [-349.134] * (-350.886) (-349.249) (-359.105) [-350.496] -- 0:00:26
558500 -- (-350.470) (-348.902) (-353.550) [-348.910] * (-349.412) (-350.200) (-354.373) [-348.320] -- 0:00:26
559000 -- [-349.330] (-350.723) (-353.059) (-349.794) * (-351.434) (-351.194) (-354.034) [-350.476] -- 0:00:26
559500 -- [-356.182] (-354.595) (-351.278) (-349.603) * (-352.487) (-355.727) (-351.490) [-348.472] -- 0:00:25
560000 -- (-352.341) [-349.374] (-348.619) (-348.620) * [-350.226] (-351.527) (-349.723) (-353.384) -- 0:00:25
Average standard deviation of split frequencies: 0.008303
560500 -- (-350.107) (-350.055) (-349.776) [-349.222] * (-351.934) (-352.144) [-351.528] (-349.726) -- 0:00:25
561000 -- (-348.989) [-348.872] (-350.339) (-349.864) * [-351.576] (-351.572) (-350.366) (-349.973) -- 0:00:25
561500 -- [-349.119] (-348.898) (-348.438) (-351.293) * (-350.145) [-352.802] (-351.980) (-348.974) -- 0:00:26
562000 -- [-353.577] (-349.652) (-350.313) (-355.728) * (-350.257) (-356.878) [-353.353] (-349.618) -- 0:00:26
562500 -- (-350.621) (-350.164) [-350.582] (-350.577) * [-352.449] (-350.210) (-351.536) (-350.157) -- 0:00:26
563000 -- (-349.811) (-350.847) (-352.007) [-353.882] * (-348.859) [-348.902] (-349.920) (-350.106) -- 0:00:26
563500 -- (-355.323) [-352.793] (-351.610) (-352.820) * (-351.268) (-350.136) (-354.564) [-350.087] -- 0:00:26
564000 -- [-349.112] (-354.251) (-348.858) (-350.141) * (-351.347) (-350.136) (-350.367) [-349.599] -- 0:00:26
564500 -- (-351.835) [-349.618] (-349.324) (-349.150) * (-349.258) (-349.962) [-348.989] (-349.675) -- 0:00:26
565000 -- (-350.239) (-352.033) [-352.412] (-350.813) * (-348.887) (-354.566) (-353.264) [-351.642] -- 0:00:26
Average standard deviation of split frequencies: 0.007704
565500 -- (-348.915) (-351.401) [-348.720] (-351.281) * (-349.775) (-351.131) [-348.134] (-351.980) -- 0:00:26
566000 -- (-348.204) (-348.834) [-348.592] (-348.239) * (-348.849) (-350.300) [-349.504] (-349.884) -- 0:00:26
566500 -- (-349.188) (-350.131) [-349.013] (-350.990) * (-350.539) (-349.961) (-347.968) [-351.823] -- 0:00:26
567000 -- (-349.349) (-349.855) [-351.115] (-350.013) * [-349.273] (-349.647) (-348.026) (-349.282) -- 0:00:25
567500 -- (-352.359) [-350.339] (-353.282) (-353.759) * (-350.699) (-349.712) [-349.798] (-348.463) -- 0:00:25
568000 -- (-350.101) (-349.085) (-349.937) [-348.859] * (-349.978) (-348.801) (-353.512) [-349.880] -- 0:00:25
568500 -- (-349.349) (-348.648) [-350.436] (-350.014) * [-352.542] (-354.949) (-350.117) (-352.574) -- 0:00:25
569000 -- (-349.563) (-348.758) (-350.739) [-351.773] * [-349.232] (-353.562) (-350.017) (-351.338) -- 0:00:25
569500 -- [-349.069] (-349.790) (-348.275) (-352.327) * [-349.182] (-351.151) (-350.047) (-350.158) -- 0:00:25
570000 -- [-351.278] (-349.323) (-349.921) (-352.571) * (-349.183) (-351.735) (-350.275) [-349.007] -- 0:00:25
Average standard deviation of split frequencies: 0.008002
570500 -- (-354.002) (-350.065) (-348.699) [-348.311] * (-351.019) (-350.928) (-351.024) [-349.753] -- 0:00:25
571000 -- (-353.913) (-351.247) [-348.546] (-350.609) * (-349.687) [-348.575] (-349.589) (-350.411) -- 0:00:25
571500 -- (-349.813) (-348.407) [-348.535] (-353.929) * (-350.544) (-349.483) (-350.494) [-348.862] -- 0:00:25
572000 -- [-348.133] (-349.288) (-353.400) (-348.519) * (-354.264) [-349.195] (-350.308) (-348.632) -- 0:00:25
572500 -- (-349.731) [-351.834] (-350.170) (-352.143) * (-352.447) (-350.735) [-350.009] (-349.320) -- 0:00:25
573000 -- [-348.804] (-349.000) (-348.985) (-353.842) * (-352.334) [-350.651] (-351.002) (-349.766) -- 0:00:25
573500 -- (-348.670) (-358.810) (-348.818) [-350.540] * (-353.767) [-347.968] (-349.867) (-349.413) -- 0:00:25
574000 -- (-350.889) (-352.280) (-348.192) [-351.717] * (-352.860) (-349.594) (-351.267) [-349.208] -- 0:00:25
574500 -- (-354.131) (-352.550) (-348.437) [-350.347] * [-352.346] (-350.756) (-353.816) (-349.331) -- 0:00:25
575000 -- (-352.327) (-350.384) (-348.752) [-348.691] * (-351.190) (-348.429) (-353.025) [-351.015] -- 0:00:25
Average standard deviation of split frequencies: 0.008644
575500 -- [-349.884] (-355.059) (-351.354) (-350.173) * (-349.614) (-354.914) [-351.171] (-348.972) -- 0:00:25
576000 -- (-349.911) (-352.006) (-348.370) [-349.040] * [-351.594] (-349.980) (-350.447) (-349.521) -- 0:00:25
576500 -- (-349.337) (-349.864) (-349.564) [-349.731] * (-348.498) (-349.029) (-350.562) [-351.573] -- 0:00:24
577000 -- [-349.041] (-351.152) (-350.664) (-349.725) * (-348.974) (-350.129) [-348.189] (-348.805) -- 0:00:24
577500 -- (-353.054) (-351.188) (-349.018) [-348.701] * [-350.090] (-350.817) (-350.032) (-352.511) -- 0:00:24
578000 -- (-349.686) [-349.142] (-350.488) (-349.504) * (-352.973) [-350.065] (-348.955) (-351.289) -- 0:00:24
578500 -- (-350.699) (-348.135) (-350.367) [-352.923] * (-349.348) [-353.031] (-348.764) (-349.678) -- 0:00:24
579000 -- (-348.769) (-351.016) (-350.965) [-351.614] * (-350.166) (-351.453) [-349.016] (-348.719) -- 0:00:25
579500 -- (-348.165) (-349.605) [-349.191] (-353.195) * (-350.148) (-350.860) (-348.964) [-350.850] -- 0:00:25
580000 -- (-349.247) (-351.244) (-349.196) [-352.304] * (-353.215) [-350.573] (-348.488) (-350.367) -- 0:00:25
Average standard deviation of split frequencies: 0.009503
580500 -- (-349.300) [-353.580] (-349.885) (-350.155) * (-348.733) (-351.446) (-352.490) [-351.286] -- 0:00:25
581000 -- (-351.513) [-349.048] (-349.749) (-350.059) * (-349.395) (-351.514) [-349.672] (-351.054) -- 0:00:25
581500 -- [-352.369] (-351.720) (-348.615) (-348.675) * (-348.830) (-352.715) [-352.098] (-349.807) -- 0:00:25
582000 -- (-351.561) [-351.194] (-350.481) (-350.171) * (-348.910) (-353.540) [-350.624] (-349.471) -- 0:00:25
582500 -- (-352.318) (-349.671) (-350.578) [-349.985] * (-348.835) (-351.469) [-351.871] (-349.333) -- 0:00:25
583000 -- (-354.664) (-349.440) [-353.951] (-350.019) * [-349.519] (-351.019) (-350.543) (-349.731) -- 0:00:25
583500 -- (-352.612) (-349.469) [-349.808] (-349.712) * [-349.768] (-352.361) (-348.706) (-348.932) -- 0:00:24
584000 -- [-352.080] (-349.784) (-350.354) (-351.280) * (-349.292) [-352.861] (-348.971) (-348.567) -- 0:00:24
584500 -- (-351.559) (-349.291) [-351.160] (-350.177) * (-350.744) (-350.100) (-348.979) [-350.488] -- 0:00:24
585000 -- (-348.974) [-348.784] (-351.530) (-349.744) * (-351.819) [-350.471] (-348.979) (-354.041) -- 0:00:24
Average standard deviation of split frequencies: 0.009464
585500 -- (-348.117) [-352.260] (-350.614) (-348.899) * (-348.846) (-349.679) (-349.038) [-348.895] -- 0:00:24
586000 -- (-351.001) [-353.400] (-351.172) (-350.672) * (-350.667) (-350.766) [-351.148] (-350.741) -- 0:00:24
586500 -- (-350.891) (-351.117) (-350.874) [-350.195] * [-349.237] (-349.738) (-350.568) (-350.486) -- 0:00:24
587000 -- (-350.093) [-349.802] (-350.481) (-351.907) * (-352.731) (-351.244) (-350.573) [-350.978] -- 0:00:24
587500 -- (-349.896) (-349.405) (-353.092) [-351.051] * (-348.868) (-350.764) [-350.154] (-350.491) -- 0:00:24
588000 -- (-349.452) (-352.700) (-349.583) [-349.155] * [-348.920] (-350.996) (-348.466) (-351.419) -- 0:00:24
588500 -- (-350.217) (-354.593) [-352.057] (-349.804) * (-349.915) [-351.138] (-350.785) (-351.469) -- 0:00:24
589000 -- (-348.637) [-348.378] (-353.860) (-353.893) * (-350.953) (-349.977) (-352.643) [-349.572] -- 0:00:24
589500 -- (-349.727) (-349.059) [-350.014] (-350.623) * [-349.716] (-348.981) (-351.097) (-350.254) -- 0:00:24
590000 -- [-349.690] (-349.125) (-349.765) (-350.866) * [-349.683] (-348.546) (-352.305) (-350.874) -- 0:00:24
Average standard deviation of split frequencies: 0.009342
590500 -- (-353.930) [-348.818] (-353.292) (-356.890) * [-352.022] (-349.900) (-350.174) (-350.399) -- 0:00:24
591000 -- (-351.817) (-350.478) (-350.522) [-352.094] * [-348.137] (-350.866) (-354.164) (-353.759) -- 0:00:24
591500 -- (-357.061) [-350.743] (-350.015) (-349.852) * [-350.498] (-351.213) (-355.786) (-354.491) -- 0:00:24
592000 -- [-355.337] (-348.838) (-349.965) (-348.628) * [-350.115] (-351.485) (-350.687) (-348.873) -- 0:00:24
592500 -- (-351.923) [-349.044] (-350.306) (-348.503) * (-351.982) (-352.781) (-348.592) [-349.231] -- 0:00:24
593000 -- (-352.711) [-350.542] (-354.002) (-348.805) * (-348.900) [-350.650] (-351.686) (-349.090) -- 0:00:24
593500 -- (-348.155) [-350.879] (-350.940) (-351.316) * [-348.946] (-349.860) (-353.410) (-351.282) -- 0:00:23
594000 -- [-352.341] (-353.567) (-351.737) (-356.922) * (-350.908) (-350.135) [-349.258] (-352.736) -- 0:00:23
594500 -- (-352.421) (-348.326) (-351.432) [-350.310] * (-348.612) [-350.948] (-355.999) (-349.689) -- 0:00:23
595000 -- (-351.758) (-350.387) (-352.818) [-350.476] * (-350.338) (-349.371) [-351.661] (-350.791) -- 0:00:23
Average standard deviation of split frequencies: 0.008651
595500 -- [-348.679] (-349.867) (-349.450) (-349.052) * (-349.508) (-351.075) [-348.429] (-351.348) -- 0:00:23
596000 -- [-349.873] (-353.664) (-349.849) (-349.444) * (-348.898) (-351.205) [-350.750] (-349.499) -- 0:00:24
596500 -- [-349.715] (-354.483) (-349.482) (-350.232) * (-348.332) [-348.887] (-350.611) (-352.506) -- 0:00:24
597000 -- (-349.081) [-355.027] (-350.034) (-349.881) * [-350.379] (-354.268) (-348.418) (-348.520) -- 0:00:24
597500 -- [-348.870] (-351.443) (-349.752) (-353.368) * [-348.204] (-350.148) (-350.001) (-350.774) -- 0:00:24
598000 -- (-348.774) (-350.832) (-352.970) [-349.955] * [-348.089] (-350.093) (-349.997) (-348.788) -- 0:00:24
598500 -- (-351.689) [-348.170] (-352.507) (-349.536) * (-349.235) (-351.004) [-351.240] (-350.856) -- 0:00:24
599000 -- (-348.976) [-352.213] (-349.647) (-349.359) * [-349.034] (-351.924) (-350.351) (-348.811) -- 0:00:24
599500 -- (-350.019) [-349.261] (-348.324) (-351.582) * (-348.641) [-349.513] (-349.058) (-348.806) -- 0:00:24
600000 -- (-350.363) (-349.601) (-350.216) [-350.742] * (-349.951) (-349.068) [-349.460] (-348.191) -- 0:00:24
Average standard deviation of split frequencies: 0.008240
600500 -- (-348.593) (-351.632) [-352.884] (-350.608) * (-351.570) (-350.199) [-349.629] (-354.367) -- 0:00:23
601000 -- (-350.320) (-350.880) (-351.483) [-348.241] * [-348.679] (-348.595) (-356.638) (-350.233) -- 0:00:23
601500 -- (-348.535) (-351.664) [-349.639] (-348.783) * (-348.354) [-350.350] (-360.219) (-354.771) -- 0:00:23
602000 -- (-349.250) (-349.596) [-351.412] (-349.377) * [-348.880] (-351.738) (-350.872) (-354.255) -- 0:00:23
602500 -- (-348.807) (-351.535) (-350.112) [-350.691] * [-349.727] (-351.374) (-349.135) (-351.866) -- 0:00:23
603000 -- (-347.924) (-348.033) [-349.419] (-350.691) * [-349.910] (-350.509) (-352.350) (-349.945) -- 0:00:23
603500 -- (-348.640) (-350.725) [-349.274] (-349.936) * (-350.083) [-348.474] (-348.833) (-348.693) -- 0:00:23
604000 -- (-353.235) (-349.035) [-349.559] (-350.940) * (-348.607) (-349.436) (-350.102) [-350.913] -- 0:00:23
604500 -- (-349.516) (-351.029) (-348.972) [-350.891] * (-348.498) (-350.186) [-349.862] (-351.084) -- 0:00:23
605000 -- (-349.428) (-352.199) (-350.266) [-348.500] * (-349.942) (-349.812) (-352.223) [-348.751] -- 0:00:23
Average standard deviation of split frequencies: 0.009197
605500 -- [-350.450] (-352.938) (-352.334) (-349.766) * (-350.070) (-351.681) (-356.701) [-349.188] -- 0:00:23
606000 -- (-350.667) (-349.097) [-349.835] (-349.682) * (-350.190) (-349.635) (-350.276) [-349.089] -- 0:00:23
606500 -- (-348.849) (-354.285) (-350.115) [-349.754] * [-350.028] (-349.252) (-353.568) (-348.353) -- 0:00:23
607000 -- [-349.442] (-349.300) (-349.823) (-348.399) * (-349.183) (-348.864) [-348.658] (-348.800) -- 0:00:23
607500 -- (-351.611) [-349.921] (-351.592) (-352.364) * (-353.228) (-355.486) (-351.323) [-349.642] -- 0:00:23
608000 -- [-349.235] (-350.496) (-348.284) (-349.632) * (-349.759) (-351.568) (-350.433) [-349.095] -- 0:00:23
608500 -- (-349.346) [-349.574] (-348.728) (-348.133) * (-349.329) (-353.453) (-348.118) [-349.468] -- 0:00:23
609000 -- (-353.561) (-348.604) (-348.398) [-349.403] * (-350.473) (-350.725) (-349.779) [-349.518] -- 0:00:23
609500 -- (-348.735) (-350.345) [-349.097] (-354.468) * [-351.717] (-356.081) (-353.849) (-352.437) -- 0:00:23
610000 -- (-349.650) (-349.780) [-348.927] (-352.742) * (-356.255) [-351.421] (-350.544) (-354.985) -- 0:00:23
Average standard deviation of split frequencies: 0.008719
610500 -- [-348.922] (-352.730) (-349.318) (-348.504) * (-349.968) (-349.087) (-349.195) [-349.947] -- 0:00:22
611000 -- [-348.780] (-349.772) (-349.891) (-348.976) * (-352.030) (-352.637) (-348.089) [-353.276] -- 0:00:22
611500 -- (-348.904) (-352.862) [-349.018] (-350.545) * (-350.927) (-352.466) [-353.484] (-350.032) -- 0:00:22
612000 -- (-349.367) (-351.956) [-349.586] (-349.836) * (-352.543) (-350.035) (-352.132) [-350.873] -- 0:00:22
612500 -- (-351.194) (-350.298) [-349.497] (-349.597) * (-352.720) (-350.042) (-354.151) [-352.302] -- 0:00:22
613000 -- (-349.967) (-349.495) [-350.408] (-348.616) * [-350.601] (-350.105) (-356.524) (-351.999) -- 0:00:22
613500 -- (-352.770) (-348.793) [-348.460] (-350.439) * [-350.249] (-348.034) (-356.086) (-353.957) -- 0:00:23
614000 -- (-354.000) (-350.404) (-351.865) [-350.764] * (-354.027) [-349.507] (-348.262) (-348.973) -- 0:00:23
614500 -- (-350.750) [-349.688] (-348.646) (-348.811) * (-349.525) (-348.903) (-348.720) [-349.218] -- 0:00:23
615000 -- (-351.131) (-352.827) (-348.785) [-349.499] * (-354.911) (-349.846) (-350.014) [-350.504] -- 0:00:23
Average standard deviation of split frequencies: 0.008823
615500 -- (-350.894) [-350.069] (-350.690) (-348.444) * [-349.439] (-351.877) (-352.671) (-352.585) -- 0:00:23
616000 -- [-350.066] (-351.833) (-350.515) (-349.593) * [-348.294] (-351.502) (-349.141) (-350.795) -- 0:00:23
616500 -- (-349.108) [-349.793] (-349.049) (-350.431) * (-348.388) (-351.169) (-353.273) [-349.744] -- 0:00:23
617000 -- (-352.094) (-354.443) [-349.195] (-357.828) * [-349.128] (-350.526) (-351.074) (-350.821) -- 0:00:22
617500 -- (-349.535) [-351.809] (-350.784) (-349.868) * (-352.418) [-350.085] (-350.484) (-349.199) -- 0:00:22
618000 -- (-348.454) [-349.137] (-351.595) (-350.497) * (-351.128) (-358.805) (-348.821) [-349.429] -- 0:00:22
618500 -- [-349.464] (-349.085) (-350.755) (-349.280) * (-348.314) (-350.692) (-350.011) [-348.256] -- 0:00:22
619000 -- (-349.287) (-349.512) (-349.142) [-349.900] * (-348.866) [-353.227] (-352.149) (-350.493) -- 0:00:22
619500 -- (-350.854) (-350.896) [-348.007] (-349.893) * [-352.241] (-349.446) (-351.845) (-348.730) -- 0:00:22
620000 -- (-350.685) [-349.535] (-351.047) (-351.250) * [-350.344] (-352.450) (-350.427) (-348.306) -- 0:00:22
Average standard deviation of split frequencies: 0.008980
620500 -- (-350.609) (-348.754) [-348.706] (-352.195) * [-349.257] (-353.494) (-353.153) (-350.270) -- 0:00:22
621000 -- (-348.668) [-349.131] (-352.665) (-351.746) * (-351.668) [-350.788] (-351.780) (-351.854) -- 0:00:22
621500 -- (-351.269) (-349.173) (-350.837) [-351.473] * (-351.214) [-348.680] (-351.281) (-351.160) -- 0:00:22
622000 -- (-349.603) (-349.293) [-349.802] (-351.952) * (-350.347) (-354.961) (-350.391) [-348.681] -- 0:00:22
622500 -- [-350.174] (-350.620) (-354.974) (-349.797) * (-350.704) [-348.021] (-348.777) (-349.418) -- 0:00:22
623000 -- (-354.841) (-351.367) (-349.669) [-353.231] * [-349.430] (-350.357) (-353.627) (-352.889) -- 0:00:22
623500 -- (-353.041) (-351.627) [-348.982] (-353.073) * [-349.322] (-352.101) (-350.156) (-349.779) -- 0:00:22
624000 -- [-350.280] (-350.331) (-348.942) (-349.386) * (-351.615) [-349.053] (-351.016) (-350.907) -- 0:00:22
624500 -- (-351.993) (-348.189) [-349.514] (-348.944) * (-351.799) (-351.070) (-351.230) [-348.988] -- 0:00:22
625000 -- (-349.137) (-351.321) (-348.688) [-350.023] * [-351.538] (-350.305) (-350.638) (-356.211) -- 0:00:22
Average standard deviation of split frequencies: 0.008505
625500 -- (-351.078) (-350.887) [-350.354] (-351.160) * (-351.141) [-353.974] (-353.023) (-348.581) -- 0:00:22
626000 -- [-349.813] (-349.970) (-349.836) (-352.369) * (-351.784) (-349.167) [-351.742] (-349.430) -- 0:00:22
626500 -- (-349.038) (-348.867) (-348.715) [-348.219] * (-350.118) (-352.975) (-349.122) [-350.422] -- 0:00:22
627000 -- (-350.839) (-349.862) [-349.115] (-350.082) * (-350.261) (-348.880) (-350.621) [-350.401] -- 0:00:22
627500 -- [-351.389] (-349.967) (-350.974) (-349.367) * [-348.729] (-348.760) (-348.829) (-350.474) -- 0:00:21
628000 -- (-349.266) (-351.097) (-348.897) [-350.230] * (-348.575) (-354.654) (-352.530) [-349.968] -- 0:00:21
628500 -- [-349.217] (-350.075) (-348.488) (-351.579) * (-350.194) (-349.922) (-350.200) [-350.058] -- 0:00:21
629000 -- (-349.963) (-349.987) (-352.474) [-351.331] * (-350.268) (-348.955) [-350.628] (-349.470) -- 0:00:21
629500 -- (-350.414) [-349.641] (-352.682) (-349.424) * [-352.745] (-351.649) (-349.142) (-349.119) -- 0:00:21
630000 -- (-349.340) (-351.918) [-350.843] (-350.047) * (-349.904) [-348.813] (-352.086) (-350.304) -- 0:00:21
Average standard deviation of split frequencies: 0.008310
630500 -- [-348.428] (-350.411) (-350.060) (-350.602) * (-349.185) [-348.952] (-354.275) (-349.172) -- 0:00:22
631000 -- (-350.840) [-352.069] (-350.641) (-349.588) * [-351.748] (-354.580) (-349.820) (-351.797) -- 0:00:22
631500 -- (-351.909) (-352.084) (-352.088) [-348.421] * (-350.830) (-348.654) (-349.503) [-352.881] -- 0:00:22
632000 -- (-348.920) (-355.223) (-353.247) [-350.542] * (-351.841) [-353.362] (-353.537) (-350.832) -- 0:00:22
632500 -- (-351.479) (-351.079) [-351.846] (-349.856) * [-350.308] (-350.350) (-350.153) (-349.062) -- 0:00:22
633000 -- (-351.528) (-351.845) [-349.293] (-352.288) * [-350.126] (-349.132) (-352.307) (-350.542) -- 0:00:22
633500 -- (-350.825) (-354.494) (-349.087) [-349.034] * (-351.807) [-350.876] (-350.871) (-348.376) -- 0:00:21
634000 -- [-348.828] (-351.834) (-349.174) (-349.339) * (-349.374) [-352.896] (-352.438) (-350.019) -- 0:00:21
634500 -- [-350.504] (-352.956) (-351.928) (-349.409) * (-350.094) [-354.928] (-349.475) (-350.638) -- 0:00:21
635000 -- (-348.015) (-350.539) (-350.343) [-348.886] * (-351.395) (-351.018) (-350.916) [-349.889] -- 0:00:21
Average standard deviation of split frequencies: 0.007935
635500 -- (-349.446) (-354.188) [-348.695] (-349.647) * (-349.763) (-349.899) (-353.771) [-348.259] -- 0:00:21
636000 -- (-349.429) (-354.760) [-352.172] (-350.221) * [-350.508] (-352.246) (-349.301) (-349.395) -- 0:00:21
636500 -- (-348.885) (-351.120) (-350.998) [-349.439] * (-350.423) (-352.439) [-349.789] (-350.996) -- 0:00:21
637000 -- (-352.750) (-348.895) [-351.314] (-349.155) * (-352.074) (-356.333) [-349.103] (-349.393) -- 0:00:21
637500 -- (-349.732) [-352.510] (-348.671) (-350.164) * [-350.559] (-351.013) (-348.910) (-354.236) -- 0:00:21
638000 -- (-351.241) (-351.564) (-348.431) [-350.784] * (-349.701) (-352.184) (-356.292) [-354.448] -- 0:00:21
638500 -- (-351.741) (-353.568) (-349.804) [-353.950] * (-351.241) (-351.367) (-350.249) [-349.563] -- 0:00:21
639000 -- (-350.626) (-353.952) [-349.860] (-350.076) * (-349.818) (-350.043) (-348.459) [-349.978] -- 0:00:21
639500 -- (-351.340) (-352.034) (-352.235) [-351.770] * (-349.085) (-348.970) [-348.869] (-349.781) -- 0:00:21
640000 -- [-349.940] (-351.325) (-354.661) (-351.900) * [-350.084] (-348.154) (-349.734) (-349.569) -- 0:00:21
Average standard deviation of split frequencies: 0.007877
640500 -- (-352.953) [-350.544] (-351.663) (-349.286) * (-348.819) [-352.208] (-354.756) (-349.692) -- 0:00:21
641000 -- (-351.340) (-349.598) (-351.030) [-349.035] * [-347.976] (-348.784) (-351.924) (-350.826) -- 0:00:21
641500 -- (-352.104) [-349.401] (-354.498) (-348.846) * (-349.801) [-348.271] (-349.662) (-353.254) -- 0:00:21
642000 -- (-354.278) (-350.466) [-348.294] (-348.925) * (-352.739) (-348.346) (-351.101) [-350.113] -- 0:00:21
642500 -- (-353.660) (-352.329) (-350.065) [-348.826] * [-349.200] (-350.264) (-351.722) (-349.017) -- 0:00:21
643000 -- (-351.675) (-351.447) [-347.884] (-355.654) * (-350.919) [-348.896] (-353.377) (-349.304) -- 0:00:21
643500 -- (-353.194) (-349.451) (-351.738) [-349.712] * (-353.604) [-348.451] (-351.381) (-351.189) -- 0:00:21
644000 -- [-351.359] (-355.590) (-350.749) (-351.439) * (-348.717) (-357.800) [-349.530] (-350.721) -- 0:00:21
644500 -- (-350.075) [-352.176] (-353.732) (-349.563) * (-348.614) (-351.265) [-351.072] (-353.845) -- 0:00:20
645000 -- (-349.668) (-348.384) [-355.461] (-350.007) * [-348.589] (-350.047) (-351.688) (-350.778) -- 0:00:20
Average standard deviation of split frequencies: 0.007727
645500 -- (-350.782) (-350.879) (-352.116) [-350.095] * (-348.605) (-348.989) [-349.619] (-352.408) -- 0:00:20
646000 -- (-348.807) [-349.199] (-351.227) (-349.453) * (-349.091) [-351.000] (-349.907) (-353.425) -- 0:00:20
646500 -- [-351.450] (-351.941) (-350.643) (-350.116) * (-351.460) (-351.506) [-350.263] (-351.371) -- 0:00:20
647000 -- (-349.461) (-348.593) [-348.831] (-349.518) * [-349.018] (-350.531) (-350.321) (-349.059) -- 0:00:20
647500 -- [-349.661] (-348.990) (-351.833) (-351.883) * (-353.462) (-352.242) [-349.693] (-348.567) -- 0:00:20
648000 -- (-351.676) [-350.430] (-354.717) (-356.715) * (-350.535) [-350.438] (-350.826) (-349.887) -- 0:00:21
648500 -- (-349.087) (-350.021) [-350.392] (-356.668) * [-351.841] (-350.056) (-349.857) (-349.104) -- 0:00:21
649000 -- [-349.336] (-350.475) (-348.604) (-348.483) * [-352.562] (-351.059) (-349.868) (-349.142) -- 0:00:21
649500 -- (-353.186) (-348.511) [-348.431] (-350.850) * (-352.350) [-351.116] (-352.296) (-350.011) -- 0:00:21
650000 -- (-349.027) (-352.888) (-349.523) [-349.102] * (-349.928) (-350.237) [-350.167] (-353.695) -- 0:00:21
Average standard deviation of split frequencies: 0.007471
650500 -- (-349.339) (-350.550) [-349.249] (-348.453) * (-349.436) (-349.001) [-350.802] (-348.448) -- 0:00:20
651000 -- [-348.973] (-352.092) (-351.470) (-348.798) * (-351.910) (-351.693) (-350.196) [-351.851] -- 0:00:20
651500 -- (-348.467) (-349.764) [-354.485] (-351.646) * (-351.707) (-352.624) (-353.662) [-350.828] -- 0:00:20
652000 -- (-349.878) [-351.376] (-351.981) (-351.097) * (-350.136) (-351.177) (-352.050) [-350.686] -- 0:00:20
652500 -- [-349.421] (-350.373) (-350.615) (-349.643) * (-351.114) [-351.772] (-354.845) (-351.273) -- 0:00:20
653000 -- (-349.619) (-351.821) (-353.050) [-351.429] * [-351.390] (-350.683) (-354.151) (-347.978) -- 0:00:20
653500 -- (-352.165) (-349.120) [-349.594] (-351.053) * (-351.349) (-349.004) [-351.474] (-348.152) -- 0:00:20
654000 -- (-350.051) [-348.960] (-350.613) (-351.801) * (-349.820) [-348.913] (-349.825) (-348.959) -- 0:00:20
654500 -- [-350.327] (-351.862) (-357.366) (-351.156) * (-350.457) (-350.764) [-352.509] (-350.868) -- 0:00:20
655000 -- (-349.209) [-351.155] (-350.319) (-350.840) * (-350.407) (-348.708) (-350.757) [-350.289] -- 0:00:20
Average standard deviation of split frequencies: 0.007456
655500 -- (-351.463) (-361.161) (-349.294) [-349.522] * (-352.820) [-348.341] (-350.793) (-349.261) -- 0:00:20
656000 -- (-355.531) (-354.556) [-348.527] (-352.971) * [-351.053] (-349.282) (-348.136) (-348.078) -- 0:00:20
656500 -- (-351.552) [-350.107] (-350.552) (-351.786) * (-351.541) (-350.979) (-348.418) [-349.012] -- 0:00:20
657000 -- [-351.651] (-348.856) (-350.758) (-351.458) * (-349.056) [-349.982] (-351.770) (-350.184) -- 0:00:20
657500 -- (-350.263) [-349.513] (-350.062) (-357.187) * (-350.040) [-350.010] (-353.977) (-350.222) -- 0:00:20
658000 -- (-348.960) (-351.867) (-350.803) [-353.822] * (-350.909) [-349.927] (-350.096) (-349.194) -- 0:00:20
658500 -- [-348.634] (-350.233) (-354.947) (-353.914) * (-349.658) [-348.351] (-351.357) (-354.658) -- 0:00:20
659000 -- (-348.266) (-351.039) (-351.107) [-353.687] * (-348.915) [-348.761] (-350.163) (-351.200) -- 0:00:20
659500 -- (-356.576) (-351.480) (-350.804) [-348.439] * (-350.055) (-352.994) (-351.945) [-349.195] -- 0:00:20
660000 -- (-357.462) (-348.940) (-353.135) [-348.865] * [-349.590] (-349.800) (-349.606) (-351.575) -- 0:00:20
Average standard deviation of split frequencies: 0.007670
660500 -- (-356.653) (-353.040) [-350.037] (-352.073) * [-350.286] (-348.704) (-349.217) (-349.699) -- 0:00:20
661000 -- (-351.617) (-353.390) (-348.765) [-350.393] * [-349.985] (-349.606) (-349.856) (-349.366) -- 0:00:20
661500 -- (-350.616) (-349.451) (-353.370) [-348.832] * [-353.253] (-348.822) (-351.005) (-349.860) -- 0:00:19
662000 -- [-349.823] (-350.508) (-348.748) (-349.952) * (-350.765) [-349.302] (-349.168) (-350.411) -- 0:00:19
662500 -- (-351.214) (-352.997) [-348.832] (-348.719) * [-350.590] (-348.308) (-351.472) (-354.061) -- 0:00:19
663000 -- (-348.336) (-350.776) [-349.315] (-351.570) * (-349.612) [-349.647] (-348.718) (-357.303) -- 0:00:19
663500 -- [-349.534] (-349.030) (-351.982) (-352.441) * (-349.321) [-351.892] (-349.604) (-351.475) -- 0:00:19
664000 -- [-348.827] (-350.914) (-354.490) (-355.464) * (-349.945) (-348.760) [-349.254] (-348.164) -- 0:00:19
664500 -- (-353.450) (-350.094) [-352.272] (-350.621) * (-349.570) (-348.881) [-348.320] (-350.256) -- 0:00:19
665000 -- (-353.618) (-351.151) (-348.534) [-352.493] * (-353.210) (-350.412) (-348.422) [-350.537] -- 0:00:20
Average standard deviation of split frequencies: 0.007653
665500 -- [-351.739] (-350.716) (-351.493) (-348.326) * [-351.709] (-349.682) (-348.406) (-349.401) -- 0:00:20
666000 -- (-349.067) [-350.474] (-351.962) (-348.435) * (-352.935) [-350.261] (-349.216) (-349.245) -- 0:00:20
666500 -- (-348.109) (-349.244) (-349.871) [-348.658] * [-350.020] (-348.484) (-350.625) (-348.737) -- 0:00:20
667000 -- (-349.419) [-352.716] (-350.178) (-354.392) * (-350.414) (-352.639) [-348.706] (-348.448) -- 0:00:19
667500 -- (-348.581) (-350.315) (-348.942) [-352.864] * (-351.378) (-351.791) (-348.177) [-351.229] -- 0:00:19
668000 -- (-351.838) (-349.750) (-348.920) [-348.855] * (-351.364) [-350.076] (-350.143) (-352.855) -- 0:00:19
668500 -- (-351.688) (-349.044) [-350.767] (-349.753) * (-349.222) [-350.673] (-351.202) (-350.021) -- 0:00:19
669000 -- [-353.083] (-351.116) (-348.762) (-352.376) * [-350.741] (-352.261) (-352.890) (-350.415) -- 0:00:19
669500 -- (-349.487) (-349.340) (-350.003) [-348.590] * (-350.102) [-350.987] (-354.384) (-351.681) -- 0:00:19
670000 -- (-348.425) [-350.008] (-352.877) (-349.802) * [-349.425] (-357.198) (-348.592) (-351.015) -- 0:00:19
Average standard deviation of split frequencies: 0.007600
670500 -- (-348.636) [-349.591] (-350.344) (-350.878) * (-352.338) [-352.329] (-349.285) (-350.353) -- 0:00:19
671000 -- (-349.535) [-348.423] (-352.576) (-350.268) * (-350.162) [-349.609] (-354.677) (-349.142) -- 0:00:19
671500 -- (-348.409) (-347.936) [-350.415] (-352.376) * (-355.701) (-350.409) (-348.879) [-348.943] -- 0:00:19
672000 -- (-351.767) (-348.049) (-350.474) [-349.164] * (-350.960) (-350.981) (-349.294) [-350.684] -- 0:00:19
672500 -- [-351.285] (-349.875) (-349.238) (-351.513) * [-349.083] (-350.654) (-348.612) (-350.414) -- 0:00:19
673000 -- (-353.845) (-350.575) (-349.413) [-351.060] * (-350.284) (-351.187) (-348.945) [-349.811] -- 0:00:19
673500 -- (-350.180) [-349.452] (-350.063) (-350.059) * (-353.039) (-354.383) [-348.607] (-351.825) -- 0:00:19
674000 -- (-349.044) (-351.173) [-350.976] (-349.611) * [-349.954] (-351.615) (-348.431) (-353.078) -- 0:00:19
674500 -- [-356.341] (-349.376) (-353.067) (-348.524) * (-349.802) (-351.746) (-351.458) [-349.793] -- 0:00:19
675000 -- (-350.085) [-349.236] (-349.704) (-350.874) * (-349.949) (-352.456) [-351.963] (-352.271) -- 0:00:19
Average standard deviation of split frequencies: 0.007712
675500 -- (-348.409) (-351.659) [-349.031] (-350.740) * (-349.163) (-351.887) [-349.420] (-350.073) -- 0:00:19
676000 -- (-349.627) (-349.397) (-351.468) [-351.616] * (-348.698) [-349.182] (-350.679) (-349.890) -- 0:00:19
676500 -- [-353.782] (-349.590) (-352.262) (-349.604) * (-348.520) [-350.618] (-352.840) (-352.556) -- 0:00:19
677000 -- (-350.076) [-348.566] (-351.075) (-350.707) * (-348.019) [-348.027] (-351.241) (-351.868) -- 0:00:19
677500 -- (-349.499) (-349.038) [-350.398] (-353.878) * (-349.294) [-348.712] (-352.161) (-353.873) -- 0:00:19
678000 -- [-349.740] (-349.374) (-350.859) (-349.907) * (-352.688) (-348.874) [-351.264] (-349.540) -- 0:00:18
678500 -- (-349.234) (-352.265) (-350.784) [-352.347] * (-350.363) [-348.713] (-350.008) (-349.272) -- 0:00:18
679000 -- (-349.050) (-349.450) (-350.223) [-354.362] * (-354.250) (-350.778) [-349.353] (-349.755) -- 0:00:18
679500 -- (-350.374) (-351.060) [-348.568] (-351.261) * [-348.676] (-353.722) (-349.223) (-350.068) -- 0:00:18
680000 -- [-350.019] (-350.055) (-349.885) (-348.468) * (-352.104) [-351.193] (-349.017) (-353.603) -- 0:00:18
Average standard deviation of split frequencies: 0.007740
680500 -- [-350.818] (-352.782) (-350.459) (-356.502) * (-353.768) (-350.066) [-348.481] (-353.808) -- 0:00:18
681000 -- (-352.533) (-352.697) [-348.624] (-352.578) * (-349.396) (-350.197) (-349.240) [-352.537] -- 0:00:18
681500 -- (-350.805) [-351.220] (-350.125) (-350.136) * (-349.398) [-349.239] (-348.930) (-349.397) -- 0:00:18
682000 -- (-348.679) [-352.522] (-350.549) (-349.775) * (-356.564) (-351.146) (-348.987) [-351.333] -- 0:00:19
682500 -- (-352.973) [-351.190] (-350.923) (-350.538) * [-351.646] (-353.754) (-351.704) (-348.590) -- 0:00:19
683000 -- (-350.047) (-353.742) (-352.190) [-354.345] * (-354.383) [-349.660] (-348.795) (-351.665) -- 0:00:19
683500 -- [-350.256] (-350.079) (-349.143) (-352.287) * (-349.359) (-349.440) [-348.236] (-350.537) -- 0:00:18
684000 -- [-350.703] (-350.396) (-348.930) (-351.861) * (-349.660) [-349.668] (-348.387) (-348.359) -- 0:00:18
684500 -- (-351.538) [-349.403] (-349.791) (-353.141) * [-350.062] (-349.827) (-348.384) (-354.277) -- 0:00:18
685000 -- (-351.189) [-351.478] (-348.433) (-350.810) * (-349.286) (-351.499) [-351.875] (-351.444) -- 0:00:18
Average standard deviation of split frequencies: 0.007357
685500 -- (-350.958) [-350.973] (-350.627) (-349.337) * (-352.179) (-350.593) (-348.999) [-351.305] -- 0:00:18
686000 -- (-352.978) (-349.378) (-349.250) [-348.380] * (-356.127) [-349.227] (-349.881) (-349.029) -- 0:00:18
686500 -- [-348.301] (-350.701) (-350.542) (-351.539) * [-349.055] (-351.702) (-348.010) (-349.999) -- 0:00:18
687000 -- (-351.863) (-349.657) [-349.789] (-351.469) * (-349.142) (-349.294) [-349.522] (-350.639) -- 0:00:18
687500 -- [-351.297] (-349.690) (-351.350) (-351.775) * (-350.550) (-349.773) (-351.568) [-351.454] -- 0:00:18
688000 -- [-350.180] (-354.041) (-348.862) (-350.585) * (-354.610) [-350.139] (-349.464) (-350.648) -- 0:00:18
688500 -- (-354.619) (-350.026) (-351.430) [-349.687] * (-350.025) [-351.761] (-353.501) (-353.176) -- 0:00:18
689000 -- (-351.181) [-349.337] (-350.866) (-349.389) * (-348.428) [-353.216] (-349.668) (-348.740) -- 0:00:18
689500 -- [-352.356] (-349.186) (-350.612) (-353.048) * (-351.597) (-348.957) [-349.002] (-349.631) -- 0:00:18
690000 -- (-352.715) (-349.150) (-353.835) [-351.280] * (-348.757) (-349.240) (-348.492) [-349.411] -- 0:00:18
Average standard deviation of split frequencies: 0.007548
690500 -- [-350.223] (-351.057) (-353.197) (-354.833) * (-351.804) [-350.064] (-349.576) (-349.991) -- 0:00:18
691000 -- [-348.627] (-351.687) (-349.542) (-353.785) * (-354.249) (-349.118) (-351.102) [-349.640] -- 0:00:18
691500 -- (-351.131) (-349.834) [-350.791] (-349.459) * (-349.875) [-351.963] (-349.678) (-353.589) -- 0:00:18
692000 -- [-349.274] (-349.349) (-350.815) (-352.862) * (-351.219) (-350.230) [-349.117] (-350.846) -- 0:00:18
692500 -- (-349.933) (-350.045) [-349.135] (-353.059) * (-350.421) (-348.643) (-349.489) [-351.300] -- 0:00:18
693000 -- [-349.424] (-351.662) (-349.759) (-351.944) * (-348.954) [-349.511] (-349.899) (-349.620) -- 0:00:18
693500 -- (-352.320) (-349.858) (-349.430) [-349.415] * (-351.004) [-349.442] (-350.008) (-349.674) -- 0:00:18
694000 -- (-348.707) (-349.564) [-350.527] (-350.756) * (-349.726) (-349.977) [-348.966] (-351.292) -- 0:00:18
694500 -- (-349.035) [-352.762] (-350.813) (-350.336) * (-350.615) (-349.203) [-350.281] (-350.760) -- 0:00:18
695000 -- (-350.524) (-348.686) [-348.316] (-348.850) * [-348.920] (-348.923) (-350.830) (-350.033) -- 0:00:17
Average standard deviation of split frequencies: 0.007411
695500 -- (-349.915) [-349.264] (-348.598) (-350.933) * (-353.218) [-349.665] (-348.714) (-349.174) -- 0:00:17
696000 -- (-348.934) [-350.623] (-348.377) (-349.037) * (-355.476) (-349.014) (-349.084) [-354.677] -- 0:00:17
696500 -- [-349.341] (-350.036) (-348.881) (-353.728) * (-349.426) [-350.458] (-350.957) (-353.164) -- 0:00:17
697000 -- (-349.890) (-351.065) [-349.622] (-350.686) * (-350.208) (-349.136) [-349.802] (-348.799) -- 0:00:17
697500 -- (-352.588) (-351.718) [-350.757] (-353.201) * (-349.769) [-351.165] (-350.367) (-348.798) -- 0:00:17
698000 -- [-350.003] (-353.646) (-350.825) (-357.642) * (-349.757) (-351.346) (-356.275) [-357.037] -- 0:00:17
698500 -- (-350.251) [-351.745] (-349.873) (-350.140) * (-349.148) (-348.785) (-351.001) [-351.791] -- 0:00:17
699000 -- (-348.678) [-349.692] (-349.404) (-350.874) * (-350.298) (-348.865) [-353.314] (-353.081) -- 0:00:17
699500 -- [-349.746] (-352.574) (-349.071) (-349.896) * (-351.832) [-349.547] (-347.957) (-350.570) -- 0:00:18
700000 -- [-349.653] (-352.947) (-349.182) (-350.023) * [-349.453] (-349.059) (-348.733) (-350.115) -- 0:00:18
Average standard deviation of split frequencies: 0.006938
700500 -- (-349.002) [-349.579] (-351.992) (-348.312) * (-349.003) [-349.173] (-349.221) (-353.748) -- 0:00:17
701000 -- (-350.546) (-352.050) (-358.278) [-350.683] * (-349.036) [-349.846] (-352.577) (-349.268) -- 0:00:17
701500 -- (-351.809) [-350.837] (-350.391) (-351.417) * [-351.108] (-350.076) (-351.826) (-350.492) -- 0:00:17
702000 -- (-348.445) (-351.213) (-353.368) [-351.588] * (-349.160) (-350.791) [-350.510] (-351.669) -- 0:00:17
702500 -- (-349.450) (-350.382) (-350.655) [-350.487] * (-349.066) (-350.798) (-350.180) [-349.270] -- 0:00:17
703000 -- (-349.629) [-352.169] (-350.349) (-350.705) * (-348.503) [-349.926] (-350.628) (-348.114) -- 0:00:17
703500 -- (-356.187) (-348.964) (-356.698) [-350.336] * [-350.465] (-349.831) (-349.554) (-348.592) -- 0:00:17
704000 -- [-348.273] (-350.138) (-351.227) (-350.819) * (-351.333) (-349.382) (-350.542) [-348.146] -- 0:00:17
704500 -- (-348.244) [-351.924] (-354.936) (-350.360) * (-350.816) (-349.400) [-348.859] (-348.833) -- 0:00:17
705000 -- (-348.929) (-348.960) [-350.889] (-353.933) * (-350.669) (-349.699) (-349.651) [-349.761] -- 0:00:17
Average standard deviation of split frequencies: 0.007227
705500 -- [-349.557] (-349.524) (-350.126) (-348.534) * (-348.731) [-351.322] (-351.763) (-349.316) -- 0:00:17
706000 -- (-350.535) (-350.481) [-348.917] (-349.925) * [-350.649] (-349.739) (-349.677) (-348.998) -- 0:00:17
706500 -- [-351.006] (-351.893) (-351.432) (-351.480) * (-348.748) (-353.499) [-350.297] (-348.724) -- 0:00:17
707000 -- (-352.087) (-350.464) [-350.987] (-350.255) * (-348.219) (-351.009) (-349.520) [-349.760] -- 0:00:17
707500 -- (-354.163) (-349.202) [-349.181] (-348.104) * (-349.981) [-348.595] (-349.005) (-348.775) -- 0:00:17
708000 -- (-353.156) (-348.354) (-349.398) [-348.739] * (-349.817) (-349.065) [-350.601] (-350.438) -- 0:00:17
708500 -- (-348.287) (-350.569) (-351.639) [-348.874] * (-350.497) (-353.202) (-350.307) [-353.007] -- 0:00:17
709000 -- (-349.181) [-350.191] (-353.415) (-351.456) * (-350.642) [-351.435] (-350.117) (-351.436) -- 0:00:17
709500 -- (-350.442) (-349.505) (-363.144) [-349.564] * (-350.319) [-350.639] (-349.097) (-353.696) -- 0:00:17
710000 -- [-349.529] (-348.598) (-356.786) (-354.922) * (-354.108) [-353.185] (-350.243) (-351.330) -- 0:00:17
Average standard deviation of split frequencies: 0.007023
710500 -- (-350.237) (-349.599) (-350.558) [-348.905] * (-352.613) (-351.572) [-350.005] (-354.293) -- 0:00:17
711000 -- (-351.285) (-348.814) [-350.881] (-349.938) * [-350.213] (-349.986) (-349.214) (-348.899) -- 0:00:17
711500 -- (-350.679) (-350.668) (-350.252) [-349.654] * (-349.778) (-350.736) (-351.444) [-348.962] -- 0:00:17
712000 -- (-349.262) [-349.539] (-348.981) (-349.510) * (-351.445) [-352.972] (-353.093) (-349.025) -- 0:00:16
712500 -- [-351.129] (-352.126) (-351.174) (-348.854) * (-350.031) [-350.472] (-353.756) (-351.688) -- 0:00:16
713000 -- (-349.572) [-349.048] (-351.624) (-355.207) * (-352.313) (-353.739) (-353.016) [-350.231] -- 0:00:16
713500 -- (-356.875) (-350.597) [-350.828] (-351.731) * (-350.526) [-350.649] (-348.469) (-349.534) -- 0:00:16
714000 -- (-350.036) (-356.355) (-351.324) [-349.667] * (-351.069) (-351.856) [-348.806] (-352.180) -- 0:00:16
714500 -- [-350.175] (-352.277) (-351.017) (-351.113) * (-349.735) (-348.224) (-349.729) [-351.609] -- 0:00:16
715000 -- (-351.995) (-347.961) (-351.063) [-349.338] * [-350.384] (-350.061) (-348.651) (-348.880) -- 0:00:16
Average standard deviation of split frequencies: 0.006816
715500 -- (-353.095) [-350.828] (-352.792) (-351.094) * [-350.625] (-352.129) (-350.687) (-348.857) -- 0:00:16
716000 -- (-352.464) (-351.110) [-351.443] (-348.088) * [-347.888] (-351.440) (-351.582) (-350.298) -- 0:00:16
716500 -- [-348.715] (-354.768) (-353.165) (-351.726) * (-350.024) (-347.972) (-351.720) [-351.165] -- 0:00:17
717000 -- [-349.471] (-349.535) (-350.831) (-351.217) * (-353.674) (-351.851) (-352.184) [-348.441] -- 0:00:16
717500 -- (-350.909) (-350.473) (-350.958) [-351.377] * (-354.522) (-351.179) (-349.473) [-351.092] -- 0:00:16
718000 -- (-350.326) [-352.352] (-349.656) (-352.882) * (-353.765) [-352.948] (-352.927) (-352.777) -- 0:00:16
718500 -- [-350.947] (-355.618) (-351.773) (-348.613) * (-350.195) [-348.874] (-350.337) (-351.052) -- 0:00:16
719000 -- (-348.981) [-350.500] (-354.358) (-349.663) * [-348.635] (-349.321) (-355.887) (-353.541) -- 0:00:16
719500 -- (-352.430) (-349.295) [-350.632] (-350.858) * [-351.685] (-349.370) (-353.494) (-353.013) -- 0:00:16
720000 -- (-350.849) (-352.692) (-351.143) [-351.018] * [-350.586] (-349.005) (-350.355) (-350.047) -- 0:00:16
Average standard deviation of split frequencies: 0.007234
720500 -- (-349.809) (-351.058) (-349.537) [-352.168] * [-349.459] (-349.420) (-351.571) (-354.466) -- 0:00:16
721000 -- (-349.875) [-351.685] (-352.859) (-352.545) * (-352.463) (-352.046) [-351.540] (-350.928) -- 0:00:16
721500 -- (-349.390) (-350.446) (-349.597) [-351.094] * (-350.980) (-354.410) (-350.695) [-351.013] -- 0:00:16
722000 -- (-351.898) (-349.393) [-352.217] (-350.740) * (-349.697) (-354.917) [-351.029] (-349.266) -- 0:00:16
722500 -- [-348.534] (-348.859) (-350.906) (-358.289) * [-349.119] (-349.951) (-351.380) (-350.469) -- 0:00:16
723000 -- (-349.978) [-348.108] (-348.629) (-350.287) * (-355.071) (-350.397) (-349.922) [-348.929] -- 0:00:16
723500 -- [-350.587] (-349.720) (-350.738) (-352.494) * (-351.165) (-351.302) [-350.265] (-350.213) -- 0:00:16
724000 -- (-348.620) (-352.981) [-352.524] (-349.738) * (-349.796) (-350.310) [-350.260] (-349.807) -- 0:00:16
724500 -- (-350.096) (-351.527) (-350.107) [-349.123] * (-350.155) (-349.020) (-349.230) [-353.229] -- 0:00:16
725000 -- (-353.129) [-351.433] (-349.005) (-349.758) * (-350.762) (-352.369) (-350.467) [-349.684] -- 0:00:16
Average standard deviation of split frequencies: 0.007028
725500 -- [-348.512] (-351.606) (-351.205) (-352.121) * [-352.159] (-351.553) (-352.862) (-352.431) -- 0:00:16
726000 -- (-348.775) [-349.388] (-353.468) (-355.625) * (-354.207) (-348.851) (-354.049) [-353.577] -- 0:00:16
726500 -- (-348.616) [-348.387] (-350.332) (-350.382) * (-350.463) [-349.946] (-350.979) (-352.064) -- 0:00:16
727000 -- [-348.572] (-351.315) (-352.221) (-348.313) * [-350.167] (-350.589) (-355.401) (-350.436) -- 0:00:16
727500 -- (-349.778) (-355.569) [-350.127] (-349.585) * [-351.607] (-352.305) (-350.490) (-350.172) -- 0:00:16
728000 -- (-350.020) (-348.982) [-348.855] (-350.342) * (-350.560) (-352.593) (-349.964) [-351.277] -- 0:00:16
728500 -- [-352.184] (-351.207) (-348.537) (-351.662) * (-349.201) [-350.926] (-349.576) (-349.104) -- 0:00:16
729000 -- (-349.534) (-351.124) (-350.607) [-350.686] * (-352.120) (-351.251) [-351.246] (-349.392) -- 0:00:15
729500 -- (-350.003) [-350.138] (-352.227) (-351.659) * [-354.489] (-352.915) (-353.343) (-348.550) -- 0:00:15
730000 -- (-350.161) [-350.489] (-350.609) (-348.758) * (-351.577) [-352.813] (-349.111) (-348.248) -- 0:00:15
Average standard deviation of split frequencies: 0.006452
730500 -- (-349.317) (-350.037) [-348.249] (-348.523) * (-350.140) (-350.966) [-349.812] (-348.925) -- 0:00:15
731000 -- (-348.641) (-349.715) (-348.317) [-349.141] * (-349.246) (-353.882) [-352.023] (-349.181) -- 0:00:15
731500 -- (-350.972) [-349.846] (-349.398) (-349.823) * (-353.772) (-349.936) (-350.482) [-348.733] -- 0:00:15
732000 -- (-354.288) (-349.456) [-351.239] (-349.945) * (-349.061) (-349.782) [-352.714] (-348.712) -- 0:00:15
732500 -- (-351.939) [-349.798] (-348.783) (-350.267) * (-348.592) (-350.108) (-351.473) [-348.411] -- 0:00:15
733000 -- (-351.454) (-350.159) [-348.540] (-355.467) * (-349.911) (-349.841) [-349.806] (-349.883) -- 0:00:15
733500 -- (-352.254) (-353.246) (-350.049) [-350.749] * (-350.441) (-349.491) (-352.058) [-351.706] -- 0:00:15
734000 -- [-348.888] (-350.532) (-350.941) (-349.578) * (-360.183) [-349.954] (-351.979) (-350.735) -- 0:00:15
734500 -- (-350.008) [-348.577] (-350.446) (-354.817) * (-354.580) (-350.040) [-352.333] (-353.961) -- 0:00:15
735000 -- (-352.923) (-349.919) (-349.568) [-352.267] * (-356.439) (-350.553) [-352.196] (-352.742) -- 0:00:15
Average standard deviation of split frequencies: 0.006932
735500 -- [-349.037] (-350.256) (-352.555) (-349.326) * [-358.530] (-351.273) (-351.841) (-350.698) -- 0:00:15
736000 -- (-348.328) (-349.845) [-351.433] (-352.744) * (-357.979) (-351.137) [-348.305] (-349.892) -- 0:00:15
736500 -- (-348.427) (-350.269) (-358.457) [-349.665] * (-354.536) (-349.925) (-349.316) [-349.300] -- 0:00:15
737000 -- (-348.046) (-349.919) [-350.211] (-350.191) * (-349.480) (-350.985) (-352.716) [-351.190] -- 0:00:15
737500 -- (-350.294) (-350.943) [-349.110] (-350.306) * [-353.215] (-353.015) (-350.985) (-348.909) -- 0:00:15
738000 -- (-353.807) [-349.478] (-349.716) (-353.304) * [-350.439] (-355.751) (-355.360) (-349.999) -- 0:00:15
738500 -- (-350.206) (-351.335) [-349.281] (-352.149) * [-349.925] (-351.230) (-358.168) (-350.111) -- 0:00:15
739000 -- [-349.544] (-353.732) (-349.058) (-351.806) * (-352.006) (-351.196) (-355.264) [-349.181] -- 0:00:15
739500 -- (-350.461) (-354.616) [-352.718] (-351.462) * (-356.503) [-349.705] (-351.302) (-351.358) -- 0:00:15
740000 -- (-348.290) (-354.601) (-351.332) [-350.206] * (-353.063) [-349.223] (-352.217) (-350.318) -- 0:00:15
Average standard deviation of split frequencies: 0.006702
740500 -- [-349.496] (-349.124) (-349.648) (-352.807) * (-350.938) [-350.446] (-353.837) (-348.771) -- 0:00:15
741000 -- (-349.413) (-349.282) [-350.362] (-350.259) * (-348.701) [-349.140] (-351.769) (-349.333) -- 0:00:15
741500 -- [-350.111] (-348.705) (-350.368) (-350.460) * [-348.492] (-353.172) (-349.600) (-348.454) -- 0:00:15
742000 -- (-348.882) (-349.755) [-350.492] (-349.499) * (-352.840) (-349.254) [-349.988] (-348.750) -- 0:00:15
742500 -- [-348.647] (-348.682) (-352.382) (-352.835) * (-351.980) (-352.386) (-349.651) [-350.127] -- 0:00:15
743000 -- (-350.796) (-352.988) (-357.821) [-349.978] * (-348.734) (-350.969) (-348.673) [-352.485] -- 0:00:15
743500 -- (-353.316) [-353.150] (-349.713) (-353.308) * (-351.230) [-350.888] (-349.599) (-350.588) -- 0:00:15
744000 -- (-352.863) (-352.664) (-348.130) [-351.457] * (-350.572) (-349.141) [-348.380] (-350.254) -- 0:00:15
744500 -- (-350.306) [-353.442] (-348.501) (-350.702) * (-351.090) (-349.169) [-349.867] (-355.940) -- 0:00:15
745000 -- (-348.983) (-351.571) (-348.551) [-352.452] * [-350.967] (-351.547) (-350.554) (-353.130) -- 0:00:15
Average standard deviation of split frequencies: 0.006616
745500 -- (-350.097) (-350.213) [-352.168] (-350.696) * (-348.273) (-349.409) (-349.274) [-351.841] -- 0:00:15
746000 -- (-351.794) (-352.048) (-351.600) [-351.704] * (-348.406) (-348.367) (-350.476) [-349.404] -- 0:00:14
746500 -- (-350.113) [-348.879] (-349.892) (-349.628) * [-348.371] (-348.265) (-352.473) (-348.947) -- 0:00:14
747000 -- (-349.511) (-353.551) (-350.817) [-348.845] * (-349.114) [-352.348] (-351.606) (-348.748) -- 0:00:14
747500 -- (-351.420) (-352.107) [-351.894] (-350.470) * [-348.745] (-355.680) (-353.301) (-351.808) -- 0:00:14
748000 -- (-352.075) (-352.387) [-349.494] (-351.770) * [-351.314] (-351.620) (-351.506) (-350.367) -- 0:00:14
748500 -- (-351.670) (-348.846) [-351.891] (-348.601) * (-351.882) [-349.276] (-352.407) (-354.674) -- 0:00:14
749000 -- [-350.720] (-348.686) (-349.075) (-349.919) * [-350.004] (-349.025) (-351.023) (-351.397) -- 0:00:14
749500 -- (-357.633) [-349.774] (-350.088) (-350.522) * (-349.931) (-350.839) [-349.433] (-352.093) -- 0:00:14
750000 -- (-350.858) (-350.249) [-350.231] (-348.940) * (-348.681) (-349.945) (-349.151) [-355.408] -- 0:00:14
Average standard deviation of split frequencies: 0.006280
750500 -- [-352.194] (-349.965) (-351.102) (-349.399) * [-348.482] (-349.260) (-353.272) (-350.354) -- 0:00:14
751000 -- (-348.063) (-348.809) [-351.662] (-348.489) * (-353.624) (-348.601) (-350.204) [-348.850] -- 0:00:14
751500 -- (-348.137) (-349.551) [-351.690] (-350.674) * (-351.012) (-349.685) [-349.291] (-350.557) -- 0:00:14
752000 -- [-348.227] (-350.709) (-355.479) (-351.064) * (-352.510) (-349.981) [-351.910] (-352.491) -- 0:00:14
752500 -- (-350.011) [-352.274] (-352.294) (-349.155) * (-351.514) [-354.004] (-350.003) (-349.066) -- 0:00:14
753000 -- (-348.793) [-350.370] (-348.074) (-351.465) * (-349.000) (-350.215) (-350.725) [-349.368] -- 0:00:14
753500 -- (-349.502) (-355.015) [-348.556] (-355.457) * (-349.288) [-352.183] (-348.977) (-350.026) -- 0:00:14
754000 -- (-352.177) [-352.451] (-348.610) (-354.918) * [-348.748] (-352.523) (-348.608) (-349.483) -- 0:00:14
754500 -- [-351.461] (-352.346) (-349.860) (-351.219) * (-349.299) (-352.863) (-348.828) [-349.739] -- 0:00:14
755000 -- (-355.716) [-353.634] (-348.534) (-351.656) * (-350.441) (-349.888) [-352.434] (-352.192) -- 0:00:14
Average standard deviation of split frequencies: 0.006125
755500 -- (-350.875) (-353.811) (-350.244) [-351.707] * (-351.239) (-351.481) (-351.981) [-349.310] -- 0:00:14
756000 -- (-349.089) [-350.666] (-348.195) (-349.240) * (-352.307) [-351.380] (-349.212) (-350.168) -- 0:00:14
756500 -- (-350.830) [-350.675] (-353.014) (-349.586) * (-351.077) (-348.599) (-352.213) [-348.816] -- 0:00:14
757000 -- (-352.311) (-349.883) (-351.042) [-352.103] * (-351.333) [-349.036] (-349.925) (-348.321) -- 0:00:14
757500 -- (-351.269) (-349.117) [-350.902] (-349.656) * (-349.782) (-350.103) (-349.948) [-349.829] -- 0:00:14
758000 -- (-355.512) [-349.245] (-354.376) (-349.411) * [-349.623] (-353.374) (-348.851) (-349.265) -- 0:00:14
758500 -- [-351.349] (-348.999) (-349.355) (-352.130) * [-349.163] (-351.178) (-351.618) (-348.504) -- 0:00:14
759000 -- (-350.477) [-348.937] (-350.116) (-353.462) * [-349.200] (-348.557) (-350.159) (-348.424) -- 0:00:14
759500 -- (-350.070) [-352.858] (-350.218) (-351.707) * [-351.411] (-351.720) (-348.430) (-349.416) -- 0:00:14
760000 -- (-349.833) [-349.579] (-351.722) (-351.389) * [-350.473] (-349.291) (-348.223) (-349.539) -- 0:00:14
Average standard deviation of split frequencies: 0.005694
760500 -- (-356.790) [-348.556] (-351.863) (-352.450) * (-352.384) (-350.266) (-349.127) [-350.228] -- 0:00:14
761000 -- (-350.545) [-348.418] (-350.110) (-352.730) * (-348.154) (-348.138) (-351.977) [-350.114] -- 0:00:14
761500 -- (-351.437) (-349.890) (-350.396) [-349.435] * (-348.037) [-350.653] (-349.691) (-349.300) -- 0:00:14
762000 -- [-348.659] (-348.316) (-350.312) (-349.686) * (-349.651) (-348.557) [-348.834] (-348.296) -- 0:00:14
762500 -- (-350.631) (-348.258) [-351.649] (-350.275) * (-350.089) (-351.240) (-350.201) [-348.802] -- 0:00:14
763000 -- (-349.626) (-348.624) (-350.566) [-350.746] * (-351.619) [-349.297] (-350.979) (-349.886) -- 0:00:13
763500 -- (-352.721) (-350.331) [-352.680] (-353.537) * (-350.484) [-349.028] (-350.687) (-348.662) -- 0:00:13
764000 -- (-350.735) (-349.780) [-348.797] (-354.605) * (-354.239) [-349.966] (-351.487) (-349.563) -- 0:00:13
764500 -- (-349.908) [-350.160] (-351.410) (-356.434) * (-350.908) (-350.515) (-350.797) [-349.246] -- 0:00:13
765000 -- (-349.844) (-351.796) (-350.618) [-349.631] * (-354.740) [-349.242] (-350.020) (-350.237) -- 0:00:13
Average standard deviation of split frequencies: 0.006118
765500 -- [-352.718] (-349.832) (-349.626) (-349.226) * (-349.564) (-350.178) [-350.262] (-351.647) -- 0:00:13
766000 -- (-349.418) (-351.452) (-356.536) [-349.196] * (-351.144) (-352.369) [-352.581] (-349.869) -- 0:00:13
766500 -- (-352.637) (-353.587) (-351.206) [-349.392] * (-351.099) (-353.103) (-348.345) [-349.535] -- 0:00:13
767000 -- [-348.870] (-350.342) (-350.719) (-350.191) * [-351.313] (-350.273) (-349.119) (-348.518) -- 0:00:13
767500 -- (-352.118) [-351.830] (-350.164) (-349.991) * (-354.021) (-351.471) [-349.365] (-348.284) -- 0:00:13
768000 -- (-352.816) [-349.530] (-350.928) (-349.300) * [-349.876] (-348.267) (-350.159) (-349.731) -- 0:00:13
768500 -- (-349.413) (-349.052) [-348.416] (-350.217) * (-350.393) (-352.486) (-350.353) [-348.990] -- 0:00:13
769000 -- (-348.760) (-351.188) [-353.261] (-352.532) * (-350.753) (-355.387) (-353.500) [-349.365] -- 0:00:13
769500 -- (-348.360) (-351.554) (-350.333) [-350.006] * (-352.141) (-352.821) (-351.061) [-348.488] -- 0:00:13
770000 -- (-351.378) [-348.651] (-351.020) (-349.669) * (-348.882) (-349.826) (-348.667) [-348.635] -- 0:00:13
Average standard deviation of split frequencies: 0.006117
770500 -- (-351.657) [-350.657] (-352.007) (-352.041) * (-348.470) [-350.835] (-348.082) (-349.969) -- 0:00:13
771000 -- (-357.585) [-353.556] (-349.304) (-351.094) * (-350.186) [-352.817] (-348.747) (-352.792) -- 0:00:13
771500 -- (-349.286) [-349.412] (-349.247) (-349.017) * (-350.629) (-352.107) (-351.595) [-350.560] -- 0:00:13
772000 -- (-349.872) [-350.331] (-350.984) (-351.631) * (-348.696) [-348.528] (-350.068) (-349.805) -- 0:00:13
772500 -- (-355.623) [-349.829] (-352.777) (-353.107) * (-352.310) (-352.010) [-351.277] (-349.331) -- 0:00:13
773000 -- [-348.219] (-349.739) (-349.219) (-351.401) * (-350.713) (-351.855) [-351.195] (-351.295) -- 0:00:13
773500 -- (-353.111) (-350.339) (-349.167) [-350.625] * (-352.435) (-350.616) (-350.856) [-351.041] -- 0:00:13
774000 -- (-354.808) [-348.311] (-349.827) (-349.827) * (-348.444) [-354.112] (-348.653) (-354.376) -- 0:00:13
774500 -- (-348.384) [-350.467] (-350.659) (-349.798) * (-350.338) [-349.124] (-350.093) (-354.229) -- 0:00:13
775000 -- (-348.416) [-348.786] (-349.124) (-349.113) * [-349.415] (-352.461) (-350.858) (-351.657) -- 0:00:13
Average standard deviation of split frequencies: 0.006611
775500 -- (-351.737) (-349.476) [-349.853] (-352.085) * (-350.142) [-348.756] (-351.797) (-351.040) -- 0:00:13
776000 -- (-350.192) [-351.367] (-349.251) (-348.263) * (-350.719) (-353.769) [-348.696] (-351.989) -- 0:00:13
776500 -- (-349.896) (-348.473) [-349.428] (-348.656) * (-350.856) (-353.564) [-350.401] (-350.647) -- 0:00:13
777000 -- (-354.504) (-353.547) (-352.642) [-349.697] * (-352.192) [-356.229] (-355.576) (-347.886) -- 0:00:13
777500 -- (-348.900) (-352.511) (-364.712) [-349.683] * (-348.778) (-351.584) [-351.073] (-348.218) -- 0:00:13
778000 -- (-349.909) (-356.132) (-361.000) [-352.284] * (-349.148) (-353.793) (-352.806) [-349.742] -- 0:00:13
778500 -- (-348.603) (-352.484) [-349.858] (-350.197) * [-351.444] (-351.154) (-352.128) (-350.111) -- 0:00:13
779000 -- (-350.543) (-350.138) (-353.565) [-351.660] * (-349.445) [-350.485] (-348.690) (-351.075) -- 0:00:13
779500 -- (-351.073) (-350.538) (-350.539) [-349.009] * [-352.761] (-350.360) (-353.098) (-349.804) -- 0:00:13
780000 -- (-352.584) (-349.067) (-350.434) [-348.870] * (-352.816) (-351.922) (-349.391) [-349.761] -- 0:00:12
Average standard deviation of split frequencies: 0.007246
780500 -- [-352.518] (-348.968) (-353.622) (-348.371) * [-351.660] (-351.920) (-352.097) (-349.526) -- 0:00:12
781000 -- (-347.986) (-351.471) [-350.544] (-350.172) * (-353.430) [-350.567] (-350.235) (-355.066) -- 0:00:12
781500 -- (-348.662) [-348.987] (-348.469) (-348.933) * (-352.308) (-354.852) (-351.085) [-351.833] -- 0:00:12
782000 -- (-349.698) (-352.073) [-349.150] (-348.872) * (-349.702) [-349.456] (-349.433) (-351.981) -- 0:00:12
782500 -- (-351.163) [-350.490] (-350.335) (-351.592) * (-350.763) (-348.497) (-350.596) [-349.227] -- 0:00:12
783000 -- (-349.428) (-350.534) (-350.032) [-349.456] * (-348.948) [-350.387] (-349.347) (-348.551) -- 0:00:12
783500 -- (-351.557) (-350.997) (-349.610) [-351.035] * (-350.627) (-350.205) [-349.199] (-350.727) -- 0:00:12
784000 -- [-352.119] (-351.562) (-352.413) (-351.270) * (-353.280) (-351.477) (-351.223) [-350.674] -- 0:00:12
784500 -- [-350.991] (-349.274) (-351.585) (-348.699) * [-348.165] (-350.544) (-350.244) (-351.000) -- 0:00:12
785000 -- (-352.091) (-348.868) [-349.420] (-350.226) * [-348.537] (-350.471) (-352.755) (-350.657) -- 0:00:12
Average standard deviation of split frequencies: 0.007085
785500 -- (-349.205) [-351.371] (-351.059) (-354.717) * (-351.999) [-350.907] (-348.772) (-351.980) -- 0:00:12
786000 -- (-349.646) [-349.022] (-353.442) (-353.837) * (-349.058) (-351.743) [-348.818] (-352.949) -- 0:00:12
786500 -- (-352.527) (-351.554) (-350.924) [-350.401] * (-349.129) [-350.668] (-348.925) (-350.372) -- 0:00:12
787000 -- (-354.549) (-360.311) (-350.342) [-350.662] * (-349.753) (-349.876) [-350.753] (-348.666) -- 0:00:12
787500 -- (-353.129) [-349.172] (-351.703) (-349.311) * (-351.422) (-354.129) (-350.359) [-353.582] -- 0:00:12
788000 -- (-350.705) (-348.672) (-349.967) [-349.321] * (-350.685) [-349.439] (-350.485) (-349.940) -- 0:00:12
788500 -- (-350.555) [-350.317] (-352.986) (-350.485) * (-350.377) (-348.057) (-348.732) [-349.615] -- 0:00:12
789000 -- (-350.613) [-350.006] (-352.857) (-350.583) * [-354.229] (-353.645) (-351.894) (-351.819) -- 0:00:12
789500 -- (-348.798) [-352.598] (-349.310) (-348.784) * (-351.241) (-351.536) [-349.570] (-349.891) -- 0:00:12
790000 -- (-353.017) [-348.619] (-350.345) (-354.777) * [-353.028] (-354.253) (-349.646) (-350.068) -- 0:00:12
Average standard deviation of split frequencies: 0.007117
790500 -- (-350.831) [-349.005] (-351.343) (-353.202) * (-351.044) [-351.788] (-357.433) (-348.941) -- 0:00:12
791000 -- (-350.937) (-348.861) [-358.427] (-349.702) * [-349.268] (-349.983) (-351.451) (-350.176) -- 0:00:12
791500 -- (-353.809) (-354.037) (-353.502) [-349.184] * [-348.397] (-351.849) (-349.756) (-349.370) -- 0:00:12
792000 -- [-350.175] (-353.208) (-353.411) (-349.682) * [-352.035] (-355.879) (-348.329) (-349.840) -- 0:00:12
792500 -- (-351.688) (-351.667) (-349.747) [-350.797] * [-350.319] (-351.043) (-352.944) (-350.821) -- 0:00:12
793000 -- [-357.181] (-350.784) (-347.896) (-348.336) * [-352.157] (-353.302) (-358.854) (-349.406) -- 0:00:12
793500 -- (-353.614) (-352.238) (-350.926) [-353.149] * [-351.702] (-350.858) (-349.529) (-350.523) -- 0:00:12
794000 -- (-351.726) (-349.728) [-349.110] (-352.127) * (-351.840) (-351.799) [-349.441] (-351.105) -- 0:00:12
794500 -- (-351.332) [-348.057] (-349.797) (-351.696) * [-348.674] (-349.320) (-350.117) (-349.031) -- 0:00:12
795000 -- [-351.752] (-348.455) (-349.104) (-348.991) * (-348.704) (-348.513) [-350.418] (-349.354) -- 0:00:12
Average standard deviation of split frequencies: 0.006699
795500 -- (-348.041) [-348.573] (-348.795) (-350.784) * (-350.048) (-350.066) (-352.114) [-350.744] -- 0:00:12
796000 -- (-348.192) (-350.430) [-349.096] (-348.809) * [-352.953] (-349.653) (-348.503) (-349.428) -- 0:00:12
796500 -- (-348.323) (-350.214) [-349.620] (-350.135) * (-348.464) (-349.667) [-348.510] (-354.516) -- 0:00:12
797000 -- (-349.580) [-348.500] (-355.500) (-348.442) * (-352.992) (-351.116) (-348.259) [-350.303] -- 0:00:11
797500 -- [-350.712] (-350.249) (-356.741) (-354.791) * [-349.816] (-349.950) (-349.064) (-352.949) -- 0:00:11
798000 -- (-349.110) [-348.880] (-358.302) (-350.841) * (-351.211) (-350.666) [-349.288] (-348.766) -- 0:00:11
798500 -- (-349.924) (-350.442) (-350.386) [-356.833] * (-348.773) [-348.721] (-349.450) (-353.878) -- 0:00:11
799000 -- [-349.866] (-350.868) (-351.376) (-353.362) * (-352.255) (-349.398) [-348.868] (-348.607) -- 0:00:11
799500 -- (-350.655) (-349.633) (-351.119) [-353.752] * (-348.500) (-349.900) (-349.925) [-350.437] -- 0:00:11
800000 -- [-348.382] (-349.916) (-349.625) (-353.246) * (-350.634) [-349.915] (-351.031) (-349.439) -- 0:00:11
Average standard deviation of split frequencies: 0.006734
800500 -- (-351.163) [-348.527] (-349.251) (-355.178) * (-350.775) (-349.135) (-348.942) [-349.484] -- 0:00:11
801000 -- (-351.170) (-348.083) (-348.817) [-349.105] * (-353.153) (-351.224) [-350.078] (-349.128) -- 0:00:11
801500 -- (-350.577) [-351.628] (-349.705) (-349.243) * (-350.822) [-350.805] (-349.616) (-349.121) -- 0:00:11
802000 -- [-349.569] (-354.556) (-350.506) (-351.035) * (-353.664) [-353.755] (-351.360) (-350.554) -- 0:00:11
802500 -- (-352.668) (-350.939) (-350.251) [-349.527] * [-349.163] (-351.312) (-351.798) (-349.998) -- 0:00:11
803000 -- (-352.617) (-352.790) [-351.540] (-348.900) * (-349.685) (-350.754) (-350.871) [-349.081] -- 0:00:11
803500 -- (-353.953) [-351.006] (-353.105) (-348.543) * (-349.351) (-356.935) [-350.129] (-350.519) -- 0:00:11
804000 -- (-350.375) (-349.330) [-349.034] (-350.756) * (-348.874) [-349.425] (-361.411) (-351.671) -- 0:00:11
804500 -- (-350.823) (-352.983) [-350.408] (-349.280) * [-349.774] (-349.321) (-356.149) (-350.877) -- 0:00:11
805000 -- [-350.072] (-348.571) (-350.034) (-348.890) * (-349.440) [-348.723] (-352.341) (-350.974) -- 0:00:11
Average standard deviation of split frequencies: 0.006726
805500 -- [-349.855] (-349.795) (-352.331) (-349.395) * (-350.004) [-350.371] (-351.063) (-349.352) -- 0:00:11
806000 -- (-348.358) (-352.675) (-350.214) [-349.893] * (-350.611) (-349.499) [-350.560] (-349.520) -- 0:00:11
806500 -- [-349.299] (-349.875) (-348.686) (-353.311) * (-351.439) (-353.367) (-353.055) [-351.282] -- 0:00:11
807000 -- (-351.049) (-349.809) [-349.871] (-351.917) * (-351.342) (-349.652) (-349.119) [-350.502] -- 0:00:11
807500 -- [-351.646] (-348.489) (-351.270) (-352.405) * (-349.849) (-351.019) [-352.164] (-352.912) -- 0:00:11
808000 -- (-350.801) [-350.558] (-350.032) (-348.157) * (-352.603) (-354.513) (-351.136) [-349.552] -- 0:00:11
808500 -- (-349.923) (-350.683) (-351.726) [-350.986] * (-350.348) (-348.853) [-348.105] (-352.742) -- 0:00:11
809000 -- (-348.417) (-350.796) (-350.809) [-350.793] * [-348.872] (-348.896) (-349.218) (-348.822) -- 0:00:11
809500 -- [-352.650] (-351.005) (-348.401) (-350.226) * (-350.174) (-348.614) [-350.657] (-348.927) -- 0:00:11
810000 -- [-350.834] (-348.788) (-349.182) (-350.585) * (-348.599) [-350.063] (-354.667) (-350.129) -- 0:00:11
Average standard deviation of split frequencies: 0.006615
810500 -- (-351.047) [-348.750] (-349.462) (-351.646) * (-350.340) (-354.763) (-352.693) [-352.118] -- 0:00:11
811000 -- (-350.950) (-355.200) (-350.468) [-350.623] * (-353.216) [-348.030] (-352.753) (-348.944) -- 0:00:11
811500 -- (-350.840) (-352.239) (-349.080) [-350.001] * (-348.303) (-353.340) [-348.929] (-350.164) -- 0:00:11
812000 -- [-349.294] (-349.748) (-349.946) (-352.628) * (-349.940) (-348.197) [-349.789] (-352.762) -- 0:00:11
812500 -- (-348.445) [-351.177] (-350.080) (-352.578) * (-349.459) (-350.821) (-348.813) [-349.150] -- 0:00:11
813000 -- [-349.272] (-349.407) (-351.257) (-354.373) * (-351.214) (-351.457) [-349.716] (-351.142) -- 0:00:11
813500 -- [-348.779] (-348.646) (-349.583) (-349.614) * (-351.877) (-352.552) (-349.157) [-352.378] -- 0:00:11
814000 -- (-349.835) (-354.138) [-353.744] (-353.559) * (-350.770) (-353.093) (-350.903) [-351.456] -- 0:00:10
814500 -- (-349.378) (-349.780) (-353.685) [-350.820] * (-350.396) (-352.529) (-353.924) [-350.961] -- 0:00:10
815000 -- (-351.868) (-349.778) [-349.212] (-352.687) * (-353.868) (-355.243) (-353.986) [-349.322] -- 0:00:10
Average standard deviation of split frequencies: 0.006391
815500 -- (-350.736) (-356.034) (-352.496) [-349.770] * [-348.741] (-350.853) (-349.985) (-349.893) -- 0:00:10
816000 -- [-350.670] (-352.216) (-349.268) (-351.084) * (-352.244) (-350.252) [-349.311] (-347.869) -- 0:00:10
816500 -- [-349.733] (-353.585) (-348.110) (-348.517) * [-353.352] (-349.254) (-350.373) (-348.043) -- 0:00:10
817000 -- [-352.215] (-351.022) (-351.150) (-351.084) * (-350.811) [-352.868] (-352.583) (-352.080) -- 0:00:10
817500 -- [-355.017] (-350.379) (-352.820) (-350.043) * (-349.112) [-348.508] (-353.190) (-350.882) -- 0:00:10
818000 -- (-350.581) (-350.162) (-352.352) [-349.345] * (-351.447) (-352.258) (-352.535) [-350.400] -- 0:00:10
818500 -- (-353.971) (-351.214) (-353.637) [-350.852] * [-348.426] (-348.921) (-349.752) (-354.109) -- 0:00:10
819000 -- (-350.667) (-356.026) (-349.916) [-350.122] * (-352.212) [-349.709] (-350.250) (-352.681) -- 0:00:10
819500 -- [-349.398] (-352.142) (-349.743) (-348.781) * (-349.674) (-350.612) [-352.647] (-351.083) -- 0:00:10
820000 -- (-351.022) (-351.286) [-349.488] (-351.466) * (-350.713) (-350.667) (-352.907) [-350.289] -- 0:00:10
Average standard deviation of split frequencies: 0.006354
820500 -- (-350.036) (-351.531) (-353.038) [-350.571] * (-351.129) (-354.511) [-354.351] (-350.530) -- 0:00:10
821000 -- (-351.255) (-350.388) (-351.228) [-349.411] * (-349.553) (-349.832) [-352.234] (-350.413) -- 0:00:10
821500 -- (-349.483) (-349.911) [-354.161] (-350.427) * (-353.550) [-349.594] (-348.978) (-349.212) -- 0:00:10
822000 -- [-350.558] (-352.470) (-350.238) (-354.458) * (-351.068) [-348.775] (-348.291) (-349.871) -- 0:00:10
822500 -- (-352.121) (-348.271) [-348.455] (-351.021) * (-351.741) (-353.492) (-349.667) [-349.540] -- 0:00:10
823000 -- (-348.640) (-348.516) [-350.155] (-351.798) * (-349.616) (-353.406) [-350.035] (-350.129) -- 0:00:10
823500 -- (-350.370) [-351.564] (-349.769) (-349.661) * (-350.424) (-350.701) [-349.450] (-349.924) -- 0:00:10
824000 -- (-349.232) [-354.657] (-351.346) (-349.651) * (-350.334) (-349.963) [-348.215] (-351.497) -- 0:00:10
824500 -- (-352.624) (-356.747) (-350.626) [-350.190] * (-351.120) (-348.330) (-350.889) [-350.993] -- 0:00:10
825000 -- (-349.666) [-350.689] (-352.035) (-351.298) * [-349.736] (-351.141) (-351.233) (-349.461) -- 0:00:10
Average standard deviation of split frequencies: 0.006813
825500 -- [-348.951] (-350.044) (-351.128) (-354.713) * (-348.852) (-349.831) [-350.128] (-349.188) -- 0:00:10
826000 -- (-350.056) [-351.627] (-348.869) (-349.464) * [-350.759] (-351.165) (-352.528) (-348.682) -- 0:00:10
826500 -- (-352.641) (-349.580) (-348.690) [-350.538] * (-350.551) (-353.201) (-350.296) [-351.025] -- 0:00:10
827000 -- (-349.053) (-349.500) (-349.432) [-351.703] * (-352.483) [-349.500] (-349.078) (-351.061) -- 0:00:10
827500 -- (-353.099) (-354.921) (-350.731) [-348.490] * (-353.830) (-350.095) [-350.615] (-352.361) -- 0:00:10
828000 -- [-352.410] (-350.154) (-350.997) (-351.303) * [-348.525] (-354.037) (-351.012) (-352.929) -- 0:00:10
828500 -- [-349.393] (-351.128) (-351.652) (-348.998) * (-349.831) (-350.747) [-350.432] (-349.705) -- 0:00:10
829000 -- (-349.871) (-350.361) (-350.201) [-351.763] * (-351.625) [-349.061] (-348.726) (-350.193) -- 0:00:10
829500 -- [-350.174] (-352.024) (-350.207) (-349.965) * [-350.895] (-351.276) (-349.417) (-349.095) -- 0:00:10
830000 -- (-349.732) [-350.678] (-348.975) (-348.683) * [-349.321] (-353.247) (-348.218) (-350.491) -- 0:00:10
Average standard deviation of split frequencies: 0.005864
830500 -- (-351.885) (-349.484) [-349.228] (-353.277) * (-349.163) (-348.991) [-348.919] (-352.899) -- 0:00:10
831000 -- (-352.539) [-349.501] (-355.092) (-348.676) * (-351.017) (-350.853) (-351.445) [-349.861] -- 0:00:09
831500 -- (-353.889) (-351.479) [-351.039] (-349.470) * [-351.746] (-350.677) (-352.928) (-350.044) -- 0:00:09
832000 -- [-348.908] (-351.018) (-350.023) (-350.424) * [-349.593] (-351.203) (-352.449) (-349.571) -- 0:00:09
832500 -- [-348.833] (-354.128) (-351.191) (-348.644) * [-348.768] (-353.282) (-352.500) (-350.617) -- 0:00:09
833000 -- (-351.361) (-350.286) (-354.326) [-349.108] * (-348.424) (-350.870) (-348.779) [-350.231] -- 0:00:09
833500 -- (-353.828) (-349.491) [-352.228] (-348.838) * (-348.707) (-349.249) (-348.424) [-349.387] -- 0:00:09
834000 -- (-349.364) (-349.019) [-348.535] (-348.257) * (-348.933) (-350.180) [-349.112] (-350.219) -- 0:00:09
834500 -- (-350.936) (-350.260) (-348.627) [-348.343] * [-350.216] (-351.520) (-349.699) (-355.075) -- 0:00:09
835000 -- (-352.181) (-348.444) (-348.336) [-347.980] * (-348.071) [-347.988] (-348.426) (-349.985) -- 0:00:09
Average standard deviation of split frequencies: 0.006167
835500 -- [-352.061] (-350.646) (-349.592) (-355.950) * [-348.229] (-349.841) (-352.035) (-350.333) -- 0:00:09
836000 -- (-348.540) [-349.331] (-348.879) (-350.009) * (-351.129) [-348.216] (-351.179) (-350.562) -- 0:00:09
836500 -- (-348.651) (-350.102) [-348.643] (-351.658) * (-350.817) (-350.738) (-349.434) [-349.630] -- 0:00:09
837000 -- (-349.874) (-351.548) [-348.846] (-350.780) * (-350.939) [-350.398] (-349.254) (-349.315) -- 0:00:09
837500 -- (-349.779) (-352.561) [-349.147] (-348.295) * (-351.116) (-352.965) [-350.213] (-350.400) -- 0:00:09
838000 -- (-350.965) (-355.081) (-357.682) [-349.312] * (-354.656) [-350.958] (-348.754) (-350.749) -- 0:00:09
838500 -- [-348.102] (-349.295) (-352.990) (-348.854) * (-352.703) (-351.509) [-349.601] (-351.935) -- 0:00:09
839000 -- (-350.288) [-349.136] (-354.927) (-353.776) * (-352.091) [-350.343] (-349.892) (-352.658) -- 0:00:09
839500 -- (-350.626) (-350.448) (-352.215) [-348.301] * [-349.718] (-348.754) (-348.797) (-350.181) -- 0:00:09
840000 -- (-350.470) [-348.380] (-352.972) (-349.648) * (-349.329) (-351.156) [-349.343] (-348.983) -- 0:00:09
Average standard deviation of split frequencies: 0.005643
840500 -- (-349.404) (-350.940) [-350.701] (-353.938) * (-350.640) [-349.546] (-351.209) (-348.647) -- 0:00:09
841000 -- (-350.216) [-351.528] (-349.129) (-352.383) * (-348.731) (-349.576) [-348.862] (-348.272) -- 0:00:09
841500 -- (-353.062) (-348.913) (-348.874) [-353.907] * (-350.017) (-351.153) [-348.444] (-350.014) -- 0:00:09
842000 -- (-350.903) [-348.817] (-350.315) (-348.491) * [-349.608] (-354.122) (-349.747) (-350.965) -- 0:00:09
842500 -- (-349.118) (-348.946) (-352.261) [-348.607] * [-349.908] (-350.551) (-350.125) (-349.126) -- 0:00:09
843000 -- (-353.470) (-348.859) (-351.870) [-349.011] * (-353.171) (-348.709) (-351.517) [-350.300] -- 0:00:09
843500 -- (-352.457) (-350.853) (-359.482) [-350.229] * (-349.946) [-350.017] (-354.253) (-351.209) -- 0:00:09
844000 -- (-350.173) (-349.977) [-350.751] (-349.899) * (-349.706) (-351.541) (-349.382) [-348.932] -- 0:00:09
844500 -- (-350.299) [-349.113] (-348.475) (-350.165) * (-353.834) [-351.560] (-348.349) (-349.530) -- 0:00:09
845000 -- (-351.448) (-352.347) [-350.915] (-349.673) * [-352.084] (-351.963) (-348.191) (-350.052) -- 0:00:09
Average standard deviation of split frequencies: 0.005294
845500 -- (-349.543) (-348.737) [-350.297] (-353.411) * (-349.375) (-349.763) (-348.274) [-353.194] -- 0:00:09
846000 -- [-350.618] (-351.612) (-349.778) (-350.894) * [-349.349] (-349.519) (-350.965) (-351.074) -- 0:00:09
846500 -- (-352.484) (-349.103) (-349.437) [-349.438] * (-348.454) (-352.205) [-352.208] (-353.204) -- 0:00:09
847000 -- (-351.000) (-348.634) [-349.522] (-349.612) * [-351.863] (-348.343) (-349.653) (-350.292) -- 0:00:09
847500 -- (-352.731) (-350.602) [-349.595] (-349.738) * (-352.551) (-349.060) (-349.491) [-350.436] -- 0:00:08
848000 -- (-350.222) (-348.372) [-349.121] (-349.909) * (-351.320) [-352.879] (-350.998) (-353.088) -- 0:00:08
848500 -- [-349.646] (-348.842) (-348.099) (-349.972) * (-348.577) (-350.565) (-353.768) [-353.600] -- 0:00:08
849000 -- [-348.569] (-347.828) (-348.909) (-350.601) * [-348.748] (-349.547) (-350.244) (-352.671) -- 0:00:08
849500 -- (-353.014) (-350.774) [-348.926] (-351.535) * (-350.263) (-352.786) [-351.392] (-358.985) -- 0:00:08
850000 -- (-348.685) (-349.550) (-352.092) [-351.293] * (-348.502) [-350.877] (-350.896) (-350.763) -- 0:00:08
Average standard deviation of split frequencies: 0.005126
850500 -- (-349.763) (-350.785) (-350.322) [-351.237] * (-352.202) [-349.985] (-348.612) (-350.275) -- 0:00:08
851000 -- (-348.796) (-350.625) [-355.482] (-349.416) * (-351.402) [-350.243] (-352.283) (-350.330) -- 0:00:08
851500 -- [-349.855] (-349.251) (-356.673) (-350.835) * (-352.717) (-353.557) [-353.146] (-351.481) -- 0:00:08
852000 -- [-351.286] (-349.935) (-350.586) (-349.690) * (-349.803) (-352.141) (-349.898) [-353.074] -- 0:00:08
852500 -- (-349.344) (-350.109) [-350.564] (-350.463) * (-349.146) (-350.724) (-350.414) [-352.234] -- 0:00:08
853000 -- [-350.203] (-348.674) (-352.634) (-349.471) * (-349.253) [-351.354] (-352.366) (-348.201) -- 0:00:08
853500 -- [-348.603] (-348.800) (-350.502) (-348.923) * (-349.980) (-350.668) (-350.208) [-349.205] -- 0:00:08
854000 -- (-353.726) [-351.959] (-349.532) (-349.097) * (-352.520) [-350.917] (-348.453) (-350.103) -- 0:00:08
854500 -- (-357.120) (-351.595) (-348.887) [-350.159] * (-350.529) (-350.009) (-350.433) [-349.401] -- 0:00:08
855000 -- [-348.386] (-352.466) (-356.161) (-351.481) * (-351.354) (-351.264) [-350.600] (-349.358) -- 0:00:08
Average standard deviation of split frequencies: 0.005335
855500 -- (-351.412) (-350.844) [-352.784] (-349.937) * [-348.208] (-350.203) (-348.984) (-352.374) -- 0:00:08
856000 -- (-349.321) [-350.533] (-349.958) (-350.205) * (-349.944) (-349.074) (-349.872) [-349.909] -- 0:00:08
856500 -- (-348.681) (-350.736) [-348.581] (-348.947) * (-349.981) (-356.070) [-350.578] (-351.910) -- 0:00:08
857000 -- (-348.946) (-350.943) (-349.191) [-350.008] * [-352.669] (-352.565) (-348.850) (-352.965) -- 0:00:08
857500 -- (-348.427) (-350.473) [-351.050] (-349.092) * (-350.671) (-353.135) (-352.006) [-351.218] -- 0:00:08
858000 -- (-348.448) [-350.095] (-350.929) (-350.620) * [-349.116] (-350.552) (-351.846) (-349.065) -- 0:00:08
858500 -- [-352.034] (-349.412) (-352.025) (-349.911) * (-352.219) [-348.851] (-351.040) (-350.988) -- 0:00:08
859000 -- (-349.626) [-349.231] (-349.000) (-350.599) * [-349.178] (-350.911) (-351.868) (-355.281) -- 0:00:08
859500 -- [-350.610] (-350.813) (-350.781) (-349.422) * [-350.487] (-353.509) (-350.113) (-348.280) -- 0:00:08
860000 -- (-348.929) [-349.072] (-351.004) (-352.568) * (-349.109) (-348.265) [-350.182] (-350.076) -- 0:00:08
Average standard deviation of split frequencies: 0.004674
860500 -- (-349.422) [-350.494] (-348.508) (-353.525) * [-348.981] (-348.331) (-358.170) (-350.037) -- 0:00:08
861000 -- [-349.911] (-348.633) (-350.989) (-349.898) * (-348.981) [-348.024] (-350.730) (-349.574) -- 0:00:08
861500 -- (-349.316) [-349.819] (-351.039) (-351.112) * (-350.616) (-353.243) [-349.535] (-349.267) -- 0:00:08
862000 -- (-351.679) (-349.770) (-349.147) [-350.123] * (-352.522) (-348.847) [-355.124] (-348.762) -- 0:00:08
862500 -- (-353.977) (-352.205) (-350.049) [-351.107] * (-348.785) [-349.668] (-349.046) (-348.293) -- 0:00:08
863000 -- [-349.779] (-350.156) (-348.386) (-354.027) * (-348.641) (-350.165) (-349.651) [-349.576] -- 0:00:08
863500 -- (-350.841) [-352.510] (-348.655) (-350.518) * (-349.861) [-350.918] (-348.603) (-350.981) -- 0:00:08
864000 -- [-354.013] (-352.838) (-348.939) (-351.992) * (-348.733) (-352.151) [-348.556] (-354.642) -- 0:00:08
864500 -- (-349.613) [-349.298] (-348.734) (-348.940) * (-352.059) [-352.009] (-348.485) (-349.221) -- 0:00:07
865000 -- (-349.924) (-352.400) (-350.633) [-351.448] * [-350.318] (-348.501) (-350.884) (-355.424) -- 0:00:07
Average standard deviation of split frequencies: 0.004790
865500 -- [-350.686] (-354.279) (-349.737) (-351.448) * (-350.615) (-349.841) [-351.420] (-353.616) -- 0:00:07
866000 -- [-350.566] (-349.910) (-348.718) (-349.641) * (-348.879) [-348.598] (-349.146) (-349.777) -- 0:00:07
866500 -- (-349.222) (-352.602) (-349.033) [-349.861] * (-348.793) (-349.993) (-353.573) [-348.482] -- 0:00:07
867000 -- (-349.604) (-355.296) [-351.348] (-349.981) * [-348.025] (-353.704) (-352.153) (-349.766) -- 0:00:07
867500 -- (-351.126) [-349.301] (-349.392) (-349.790) * (-349.310) (-349.277) [-350.612] (-349.844) -- 0:00:07
868000 -- [-351.476] (-351.554) (-357.140) (-350.323) * (-351.116) [-348.722] (-351.348) (-351.362) -- 0:00:07
868500 -- [-349.611] (-349.811) (-353.667) (-350.205) * (-349.876) (-353.542) (-352.526) [-352.187] -- 0:00:07
869000 -- (-349.160) (-348.559) (-349.439) [-349.434] * (-348.614) [-350.613] (-349.537) (-349.801) -- 0:00:07
869500 -- [-350.157] (-348.544) (-348.533) (-349.868) * (-353.796) [-350.089] (-353.275) (-349.185) -- 0:00:07
870000 -- [-353.900] (-351.958) (-348.755) (-350.119) * [-351.355] (-352.708) (-351.452) (-351.855) -- 0:00:07
Average standard deviation of split frequencies: 0.004331
870500 -- (-356.240) (-350.559) (-349.676) [-351.864] * [-349.652] (-353.507) (-349.576) (-349.294) -- 0:00:07
871000 -- (-354.633) (-349.932) [-350.360] (-350.660) * (-349.401) (-353.496) [-349.720] (-351.942) -- 0:00:07
871500 -- (-349.864) (-349.640) [-349.288] (-350.232) * (-349.809) (-352.529) (-348.348) [-349.835] -- 0:00:07
872000 -- [-348.943] (-352.101) (-355.941) (-351.872) * (-353.335) (-348.377) (-348.940) [-354.303] -- 0:00:07
872500 -- [-349.281] (-351.038) (-350.812) (-354.583) * [-349.609] (-350.093) (-350.372) (-352.901) -- 0:00:07
873000 -- (-349.922) (-351.901) [-349.447] (-349.447) * (-353.277) (-353.430) (-352.053) [-349.513] -- 0:00:07
873500 -- (-351.247) [-348.796] (-349.441) (-349.966) * [-349.355] (-355.794) (-350.660) (-351.904) -- 0:00:07
874000 -- (-352.254) (-348.860) [-351.163] (-349.761) * [-349.213] (-351.992) (-352.383) (-349.706) -- 0:00:07
874500 -- [-348.707] (-351.094) (-352.130) (-350.912) * (-348.877) (-350.989) [-350.147] (-350.592) -- 0:00:07
875000 -- (-348.077) (-348.724) [-350.956] (-349.685) * [-348.720] (-349.131) (-353.360) (-348.888) -- 0:00:07
Average standard deviation of split frequencies: 0.004269
875500 -- (-349.490) [-349.811] (-353.989) (-351.698) * (-352.770) [-348.933] (-351.393) (-349.304) -- 0:00:07
876000 -- (-350.435) (-352.464) (-352.034) [-353.567] * [-351.656] (-349.259) (-349.925) (-350.056) -- 0:00:07
876500 -- (-349.212) (-354.426) [-349.025] (-352.929) * (-351.039) (-351.680) (-353.328) [-349.049] -- 0:00:07
877000 -- (-348.060) [-350.762] (-353.626) (-353.845) * [-349.278] (-351.429) (-354.716) (-349.631) -- 0:00:07
877500 -- (-350.617) (-350.923) [-350.225] (-353.091) * (-351.108) (-352.764) [-350.204] (-349.952) -- 0:00:07
878000 -- [-349.806] (-348.068) (-354.586) (-352.983) * (-352.206) (-350.079) [-350.233] (-349.212) -- 0:00:07
878500 -- [-350.814] (-350.123) (-351.762) (-349.156) * [-350.523] (-349.091) (-351.725) (-349.904) -- 0:00:07
879000 -- (-350.730) (-349.490) [-354.544] (-351.748) * (-350.639) (-351.664) (-353.532) [-351.694] -- 0:00:07
879500 -- (-351.336) (-349.293) (-349.967) [-348.407] * (-349.925) (-356.883) (-355.925) [-348.352] -- 0:00:07
880000 -- [-350.300] (-351.242) (-356.653) (-353.469) * (-350.339) [-348.528] (-350.640) (-350.548) -- 0:00:07
Average standard deviation of split frequencies: 0.004639
880500 -- (-354.563) (-350.863) [-350.789] (-350.432) * (-352.001) (-348.370) [-356.714] (-350.503) -- 0:00:07
881000 -- (-349.633) (-353.096) [-349.528] (-348.865) * [-349.241] (-350.251) (-354.982) (-350.232) -- 0:00:07
881500 -- (-349.338) (-352.103) [-350.057] (-351.603) * (-349.101) (-349.177) [-350.707] (-350.804) -- 0:00:06
882000 -- (-349.349) [-350.249] (-349.807) (-350.730) * (-349.381) [-352.656] (-350.841) (-350.874) -- 0:00:06
882500 -- (-348.874) (-349.605) (-353.549) [-350.708] * (-348.965) (-349.340) (-350.688) [-348.403] -- 0:00:06
883000 -- (-350.902) [-349.459] (-349.682) (-353.153) * [-348.212] (-354.499) (-350.527) (-349.397) -- 0:00:06
883500 -- (-349.949) (-350.199) [-349.883] (-351.005) * (-353.496) (-355.712) [-348.837] (-348.934) -- 0:00:06
884000 -- (-351.536) (-352.414) (-352.598) [-350.653] * (-350.898) (-350.404) [-351.156] (-349.676) -- 0:00:06
884500 -- [-350.505] (-351.564) (-350.038) (-353.893) * [-354.238] (-351.255) (-350.095) (-351.880) -- 0:00:06
885000 -- (-350.327) (-350.504) [-349.459] (-350.565) * (-350.762) (-349.825) [-350.521] (-354.159) -- 0:00:06
Average standard deviation of split frequencies: 0.004930
885500 -- [-350.000] (-350.245) (-349.155) (-348.560) * (-353.089) (-349.936) (-350.683) [-351.091] -- 0:00:06
886000 -- (-350.414) (-349.233) (-352.060) [-352.878] * (-351.781) [-349.741] (-351.375) (-350.998) -- 0:00:06
886500 -- (-351.653) [-349.333] (-352.074) (-352.831) * [-349.605] (-350.753) (-348.713) (-348.189) -- 0:00:06
887000 -- (-350.295) (-353.966) (-351.248) [-349.517] * (-348.572) (-348.652) [-351.622] (-348.447) -- 0:00:06
887500 -- (-348.849) (-349.524) (-351.296) [-348.304] * [-354.095] (-350.185) (-351.592) (-348.635) -- 0:00:06
888000 -- (-352.026) (-350.607) (-352.694) [-349.667] * (-350.720) [-350.557] (-348.847) (-349.278) -- 0:00:06
888500 -- (-350.341) (-350.815) [-350.322] (-349.279) * (-350.919) (-348.359) [-349.583] (-349.192) -- 0:00:06
889000 -- [-349.187] (-349.265) (-349.967) (-350.056) * (-352.710) [-349.002] (-353.617) (-348.286) -- 0:00:06
889500 -- (-350.260) (-349.291) (-349.567) [-351.522] * [-350.862] (-349.386) (-349.274) (-354.927) -- 0:00:06
890000 -- (-351.128) (-349.583) (-348.471) [-349.124] * [-348.710] (-348.946) (-348.332) (-352.063) -- 0:00:06
Average standard deviation of split frequencies: 0.004896
890500 -- (-353.735) (-350.085) [-349.768] (-350.790) * [-350.123] (-349.370) (-350.789) (-349.979) -- 0:00:06
891000 -- (-354.194) (-349.967) [-348.873] (-352.315) * (-350.740) (-350.408) (-349.171) [-349.235] -- 0:00:06
891500 -- [-349.990] (-351.003) (-351.726) (-349.687) * (-350.032) [-348.670] (-350.453) (-351.295) -- 0:00:06
892000 -- [-349.930] (-348.555) (-350.596) (-348.660) * [-350.040] (-352.854) (-352.058) (-349.770) -- 0:00:06
892500 -- [-351.101] (-348.642) (-349.308) (-350.630) * (-349.472) [-357.125] (-351.196) (-350.169) -- 0:00:06
893000 -- [-350.074] (-348.538) (-349.834) (-349.300) * (-352.272) (-348.816) (-351.681) [-351.963] -- 0:00:06
893500 -- (-350.269) [-349.329] (-351.917) (-349.167) * (-355.686) [-350.742] (-349.101) (-354.099) -- 0:00:06
894000 -- (-351.797) (-350.077) (-350.254) [-349.328] * [-351.260] (-352.287) (-351.497) (-350.428) -- 0:00:06
894500 -- [-349.047] (-349.755) (-353.144) (-348.180) * (-350.381) [-350.956] (-349.283) (-351.761) -- 0:00:06
895000 -- (-352.539) (-351.956) (-351.735) [-348.452] * [-350.393] (-349.885) (-350.768) (-351.382) -- 0:00:06
Average standard deviation of split frequencies: 0.004735
895500 -- (-348.527) (-351.662) (-350.471) [-352.680] * (-348.883) (-351.417) [-350.519] (-351.869) -- 0:00:06
896000 -- (-351.147) [-350.164] (-350.243) (-353.715) * [-348.009] (-350.180) (-350.753) (-348.707) -- 0:00:06
896500 -- (-351.281) (-351.552) [-348.968] (-355.478) * (-350.276) (-353.959) (-351.787) [-351.183] -- 0:00:06
897000 -- (-348.267) (-348.707) (-353.849) [-352.831] * (-351.522) (-349.019) [-350.497] (-350.683) -- 0:00:06
897500 -- [-349.972] (-349.535) (-350.058) (-350.366) * (-353.490) (-350.847) (-348.212) [-349.420] -- 0:00:06
898000 -- (-348.805) [-348.862] (-350.652) (-352.791) * (-353.589) [-348.193] (-348.027) (-351.562) -- 0:00:06
898500 -- [-348.173] (-349.652) (-349.518) (-352.473) * (-355.243) (-348.775) (-352.407) [-351.263] -- 0:00:05
899000 -- (-348.324) [-351.613] (-349.634) (-357.014) * (-350.483) [-348.634] (-351.520) (-349.737) -- 0:00:05
899500 -- [-348.044] (-353.307) (-353.704) (-353.281) * (-351.963) [-347.996] (-349.729) (-352.550) -- 0:00:05
900000 -- (-349.437) (-353.307) [-352.092] (-353.474) * (-353.629) (-350.142) (-349.841) [-350.581] -- 0:00:05
Average standard deviation of split frequencies: 0.004815
900500 -- (-350.521) (-353.607) [-348.915] (-353.583) * (-350.912) (-348.862) (-352.167) [-352.122] -- 0:00:05
901000 -- (-351.589) (-353.501) [-348.649] (-349.282) * (-349.813) (-351.610) (-348.799) [-349.400] -- 0:00:05
901500 -- (-352.426) (-353.834) (-349.447) [-353.136] * (-352.730) [-349.788] (-350.259) (-350.805) -- 0:00:05
902000 -- [-351.014] (-352.339) (-354.285) (-355.602) * (-350.811) [-349.912] (-351.035) (-350.880) -- 0:00:05
902500 -- [-349.875] (-350.090) (-349.796) (-350.059) * [-348.827] (-349.096) (-349.464) (-349.403) -- 0:00:05
903000 -- (-349.494) (-350.764) (-352.869) [-352.961] * (-349.578) (-358.820) (-350.851) [-348.889] -- 0:00:05
903500 -- [-351.379] (-350.356) (-350.060) (-350.466) * (-349.306) (-351.225) [-350.781] (-354.469) -- 0:00:05
904000 -- (-352.311) [-353.940] (-349.332) (-350.333) * (-349.038) [-348.434] (-353.349) (-351.075) -- 0:00:05
904500 -- (-354.693) (-350.884) (-350.930) [-350.376] * [-351.129] (-349.091) (-351.763) (-349.836) -- 0:00:05
905000 -- (-354.997) (-350.179) [-350.942] (-352.520) * (-352.164) [-349.475] (-349.720) (-349.875) -- 0:00:05
Average standard deviation of split frequencies: 0.004995
905500 -- (-352.757) [-351.464] (-351.106) (-350.418) * [-351.123] (-348.722) (-349.677) (-351.912) -- 0:00:05
906000 -- (-349.117) (-351.768) (-352.292) [-348.807] * (-352.315) [-348.937] (-349.366) (-350.768) -- 0:00:05
906500 -- (-354.400) (-350.387) (-351.532) [-348.681] * (-356.779) (-350.164) (-349.973) [-350.855] -- 0:00:05
907000 -- (-355.241) (-349.695) [-349.472] (-350.821) * (-349.785) (-351.292) [-351.599] (-352.160) -- 0:00:05
907500 -- (-351.364) (-349.736) [-351.940] (-350.872) * (-356.051) [-349.454] (-350.563) (-350.673) -- 0:00:05
908000 -- (-352.242) (-353.036) (-348.886) [-351.313] * (-348.894) (-349.334) [-349.192] (-350.154) -- 0:00:05
908500 -- [-350.716] (-351.406) (-350.558) (-348.998) * [-349.281] (-349.144) (-350.126) (-349.565) -- 0:00:05
909000 -- (-350.614) (-354.008) (-352.636) [-350.738] * (-351.134) (-349.234) (-350.233) [-349.955] -- 0:00:05
909500 -- (-348.827) (-354.696) (-349.848) [-348.841] * (-352.930) [-349.096] (-351.704) (-352.516) -- 0:00:05
910000 -- (-348.809) (-348.147) (-351.302) [-350.226] * (-352.285) [-352.382] (-349.882) (-349.361) -- 0:00:05
Average standard deviation of split frequencies: 0.005142
910500 -- (-350.991) [-353.794] (-349.060) (-352.314) * (-349.917) (-351.294) [-349.880] (-347.866) -- 0:00:05
911000 -- (-353.713) (-349.775) [-350.078] (-350.923) * (-351.210) (-350.191) [-351.777] (-348.517) -- 0:00:05
911500 -- (-351.183) (-350.949) (-351.226) [-351.071] * (-350.916) (-349.995) (-352.281) [-351.009] -- 0:00:05
912000 -- [-350.268] (-350.104) (-349.044) (-350.930) * (-354.402) [-350.254] (-359.302) (-350.887) -- 0:00:05
912500 -- (-350.706) [-350.645] (-348.968) (-358.140) * (-350.925) (-351.834) [-350.335] (-349.333) -- 0:00:05
913000 -- [-348.850] (-349.723) (-353.002) (-352.415) * (-351.247) (-348.873) (-352.585) [-350.209] -- 0:00:05
913500 -- (-348.977) [-349.576] (-354.284) (-349.256) * [-349.687] (-352.548) (-349.881) (-350.114) -- 0:00:05
914000 -- (-351.361) [-350.073] (-352.487) (-353.558) * [-350.286] (-350.244) (-351.894) (-349.812) -- 0:00:05
914500 -- [-349.213] (-350.013) (-355.851) (-352.672) * (-349.451) (-349.145) (-351.977) [-348.901] -- 0:00:05
915000 -- (-355.788) (-351.349) [-349.407] (-349.847) * (-353.619) (-349.133) (-350.037) [-352.889] -- 0:00:05
Average standard deviation of split frequencies: 0.005146
915500 -- (-352.412) [-352.134] (-349.943) (-354.561) * (-353.396) [-350.158] (-351.441) (-353.633) -- 0:00:04
916000 -- (-349.995) [-351.302] (-352.396) (-349.765) * [-349.657] (-351.881) (-350.016) (-349.530) -- 0:00:04
916500 -- (-348.772) (-352.390) (-351.962) [-348.627] * (-349.808) (-349.128) [-349.344] (-349.928) -- 0:00:04
917000 -- [-349.287] (-351.851) (-351.209) (-348.434) * (-354.963) (-353.805) (-348.693) [-348.266] -- 0:00:04
917500 -- [-349.637] (-355.706) (-350.703) (-350.685) * (-362.592) (-349.699) (-351.494) [-348.592] -- 0:00:04
918000 -- (-350.550) [-349.736] (-351.547) (-350.564) * [-354.663] (-349.648) (-351.215) (-349.552) -- 0:00:04
918500 -- (-350.345) (-350.246) (-347.964) [-349.943] * (-350.406) [-348.566] (-348.838) (-348.381) -- 0:00:04
919000 -- (-348.885) [-348.702] (-349.245) (-350.407) * (-349.389) [-350.864] (-352.846) (-348.380) -- 0:00:04
919500 -- (-352.332) (-350.025) [-348.419] (-348.959) * (-350.310) (-350.459) (-356.012) [-348.304] -- 0:00:04
920000 -- (-353.225) (-350.185) (-348.722) [-350.631] * (-350.827) [-349.823] (-348.938) (-349.297) -- 0:00:04
Average standard deviation of split frequencies: 0.004403
920500 -- (-348.504) (-349.840) [-348.635] (-353.238) * (-348.663) (-350.147) [-350.408] (-352.906) -- 0:00:04
921000 -- (-349.595) (-350.520) (-350.166) [-350.503] * (-348.812) [-348.532] (-350.234) (-353.360) -- 0:00:04
921500 -- (-351.726) (-349.367) (-350.887) [-350.707] * [-349.001] (-349.335) (-350.326) (-349.070) -- 0:00:04
922000 -- [-350.065] (-349.249) (-351.298) (-348.628) * (-348.912) [-350.931] (-352.456) (-348.857) -- 0:00:04
922500 -- (-349.761) (-350.030) [-350.824] (-352.071) * (-348.898) (-351.447) [-350.685] (-349.633) -- 0:00:04
923000 -- (-356.189) (-349.455) (-351.718) [-350.096] * (-349.247) [-350.352] (-353.028) (-349.448) -- 0:00:04
923500 -- (-350.923) (-349.140) [-352.738] (-355.084) * (-350.159) (-350.544) (-351.484) [-350.984] -- 0:00:04
924000 -- [-350.699] (-348.231) (-350.030) (-354.633) * (-350.975) [-350.954] (-353.292) (-349.875) -- 0:00:04
924500 -- (-350.302) (-349.533) [-353.665] (-351.139) * (-351.490) (-351.686) [-350.045] (-353.955) -- 0:00:04
925000 -- (-349.851) [-349.514] (-348.347) (-351.057) * (-351.318) (-352.033) [-349.359] (-352.496) -- 0:00:04
Average standard deviation of split frequencies: 0.004614
925500 -- (-352.318) [-348.835] (-348.349) (-349.705) * (-348.890) (-354.088) [-351.799] (-352.200) -- 0:00:04
926000 -- (-351.389) (-351.993) [-350.117] (-350.208) * (-351.583) [-348.878] (-355.891) (-350.026) -- 0:00:04
926500 -- [-353.231] (-350.420) (-354.798) (-351.508) * (-349.582) (-354.486) [-350.121] (-349.979) -- 0:00:04
927000 -- (-348.698) (-349.358) (-351.858) [-349.088] * [-349.598] (-348.956) (-348.877) (-351.686) -- 0:00:04
927500 -- (-349.169) [-348.728] (-349.142) (-348.792) * (-356.346) (-347.930) (-357.139) [-348.423] -- 0:00:04
928000 -- [-351.322] (-348.740) (-352.394) (-349.310) * (-356.107) (-348.862) [-353.964] (-349.678) -- 0:00:04
928500 -- [-351.412] (-349.783) (-349.088) (-351.269) * (-351.746) (-350.091) (-349.761) [-352.210] -- 0:00:04
929000 -- [-348.910] (-349.149) (-351.250) (-351.755) * (-352.362) [-351.279] (-348.395) (-352.365) -- 0:00:04
929500 -- (-350.110) (-351.119) [-349.185] (-357.007) * (-349.296) (-350.753) (-352.122) [-350.152] -- 0:00:04
930000 -- [-352.373] (-349.369) (-350.964) (-348.411) * (-351.870) (-350.252) (-348.795) [-349.952] -- 0:00:04
Average standard deviation of split frequencies: 0.004495
930500 -- (-350.081) (-350.680) [-351.052] (-349.973) * (-350.611) (-351.254) [-348.935] (-351.155) -- 0:00:04
931000 -- (-349.690) (-350.622) [-352.546] (-353.586) * (-349.573) (-349.643) [-349.771] (-353.511) -- 0:00:04
931500 -- (-355.322) [-349.747] (-348.910) (-354.657) * (-348.631) [-349.929] (-348.893) (-349.228) -- 0:00:04
932000 -- [-349.871] (-349.404) (-349.672) (-351.230) * (-348.488) (-351.708) [-352.062] (-348.640) -- 0:00:04
932500 -- (-349.988) (-352.734) (-350.818) [-348.827] * [-351.524] (-349.540) (-350.283) (-351.567) -- 0:00:03
933000 -- [-354.440] (-349.538) (-349.536) (-348.660) * (-350.509) (-350.681) (-351.891) [-350.786] -- 0:00:03
933500 -- (-351.054) [-349.427] (-350.304) (-348.324) * (-351.238) [-348.367] (-350.549) (-352.773) -- 0:00:03
934000 -- (-354.010) [-348.556] (-349.949) (-351.589) * (-349.824) (-348.511) [-350.879] (-352.548) -- 0:00:03
934500 -- [-352.346] (-350.492) (-349.246) (-355.795) * [-349.783] (-351.859) (-349.722) (-349.495) -- 0:00:03
935000 -- [-352.439] (-348.467) (-349.637) (-351.362) * (-349.913) [-350.356] (-351.162) (-349.231) -- 0:00:03
Average standard deviation of split frequencies: 0.004470
935500 -- (-350.645) [-349.166] (-350.016) (-350.499) * (-349.099) (-352.903) (-349.941) [-351.062] -- 0:00:03
936000 -- (-351.096) [-349.656] (-350.459) (-348.560) * [-348.120] (-350.719) (-350.507) (-350.716) -- 0:00:03
936500 -- [-350.926] (-349.400) (-352.071) (-348.053) * (-349.686) (-352.206) (-351.871) [-356.534] -- 0:00:03
937000 -- [-350.212] (-351.647) (-348.317) (-349.964) * [-350.169] (-351.198) (-349.672) (-349.239) -- 0:00:03
937500 -- [-350.916] (-353.919) (-350.311) (-348.133) * (-353.357) (-348.556) [-350.332] (-350.173) -- 0:00:03
938000 -- (-348.752) [-350.693] (-351.687) (-349.625) * (-351.435) [-349.078] (-349.359) (-350.820) -- 0:00:03
938500 -- (-348.519) [-348.109] (-350.841) (-351.371) * (-350.236) [-351.018] (-348.335) (-350.220) -- 0:00:03
939000 -- (-352.691) (-350.669) (-349.879) [-350.032] * (-353.710) (-351.912) (-349.612) [-350.310] -- 0:00:03
939500 -- (-349.478) [-349.246] (-352.940) (-353.384) * (-352.928) (-353.834) [-349.536] (-348.762) -- 0:00:03
940000 -- (-349.885) (-349.778) [-350.523] (-348.568) * (-350.852) (-356.272) [-348.991] (-349.325) -- 0:00:03
Average standard deviation of split frequencies: 0.004228
940500 -- (-349.002) (-351.427) (-350.175) [-348.043] * (-352.685) (-354.557) [-349.030] (-349.405) -- 0:00:03
941000 -- (-350.791) (-352.082) [-348.640] (-350.911) * (-349.706) [-353.300] (-350.524) (-349.076) -- 0:00:03
941500 -- [-349.795] (-351.563) (-349.465) (-348.661) * (-349.097) (-352.276) (-352.175) [-350.357] -- 0:00:03
942000 -- [-350.271] (-349.513) (-352.775) (-348.134) * (-351.277) [-351.640] (-349.947) (-354.452) -- 0:00:03
942500 -- [-348.372] (-350.353) (-349.215) (-350.287) * (-350.211) (-350.393) (-352.673) [-348.116] -- 0:00:03
943000 -- (-349.471) (-349.403) [-350.148] (-351.095) * (-355.198) (-349.350) (-350.169) [-348.250] -- 0:00:03
943500 -- (-349.877) (-349.776) (-351.359) [-349.179] * (-352.290) [-352.994] (-357.901) (-352.026) -- 0:00:03
944000 -- (-350.374) (-350.050) [-352.024] (-348.946) * (-352.470) (-354.973) (-350.045) [-350.833] -- 0:00:03
944500 -- (-348.923) [-349.783] (-353.171) (-349.047) * [-350.275] (-348.658) (-349.514) (-350.495) -- 0:00:03
945000 -- [-349.335] (-358.339) (-350.897) (-348.418) * (-349.587) [-351.416] (-350.469) (-349.037) -- 0:00:03
Average standard deviation of split frequencies: 0.004329
945500 -- [-348.810] (-352.134) (-348.938) (-349.569) * (-348.683) (-349.681) (-352.896) [-348.341] -- 0:00:03
946000 -- (-351.641) (-349.796) [-349.516] (-350.267) * [-350.310] (-349.728) (-350.407) (-347.983) -- 0:00:03
946500 -- (-348.754) (-352.482) (-349.510) [-350.548] * (-350.447) (-353.074) [-353.091] (-350.667) -- 0:00:03
947000 -- (-350.262) (-353.144) [-351.570] (-350.229) * (-350.952) (-350.484) [-352.148] (-351.650) -- 0:00:03
947500 -- (-349.896) (-350.813) [-353.943] (-353.337) * (-349.673) (-350.310) (-355.600) [-348.457] -- 0:00:03
948000 -- (-350.253) (-351.019) (-349.982) [-349.606] * (-348.321) (-352.380) (-350.568) [-349.035] -- 0:00:03
948500 -- (-348.895) [-352.941] (-352.357) (-348.677) * (-348.895) (-349.164) (-351.225) [-348.667] -- 0:00:03
949000 -- (-350.370) [-349.143] (-349.196) (-354.892) * (-351.015) (-348.830) (-350.482) [-351.172] -- 0:00:03
949500 -- (-353.752) (-351.383) [-349.171] (-352.548) * (-349.090) [-349.139] (-348.897) (-351.011) -- 0:00:02
950000 -- (-349.330) (-351.653) (-349.092) [-353.022] * (-350.518) [-351.004] (-349.491) (-348.444) -- 0:00:02
Average standard deviation of split frequencies: 0.004184
950500 -- (-351.056) [-353.465] (-348.316) (-353.498) * [-352.115] (-350.512) (-349.225) (-349.244) -- 0:00:02
951000 -- (-348.497) (-348.440) [-351.272] (-349.426) * (-350.406) (-350.398) (-350.673) [-350.676] -- 0:00:02
951500 -- [-350.748] (-348.488) (-352.156) (-350.206) * (-348.555) [-348.780] (-352.000) (-349.215) -- 0:00:02
952000 -- [-351.328] (-348.732) (-353.046) (-350.152) * [-348.692] (-350.112) (-349.613) (-348.858) -- 0:00:02
952500 -- (-350.899) (-348.842) (-356.498) [-351.258] * (-350.785) (-355.986) (-349.662) [-354.068] -- 0:00:02
953000 -- (-350.742) [-350.031] (-353.285) (-349.387) * (-353.447) [-349.540] (-350.594) (-350.508) -- 0:00:02
953500 -- (-353.986) (-351.200) (-350.629) [-352.032] * (-349.163) (-350.718) (-352.288) [-351.487] -- 0:00:02
954000 -- [-350.802] (-349.037) (-348.648) (-350.768) * (-351.725) (-349.243) [-352.133] (-349.831) -- 0:00:02
954500 -- (-350.077) (-351.860) [-348.369] (-351.575) * [-352.394] (-352.878) (-348.839) (-350.072) -- 0:00:02
955000 -- (-351.163) (-352.422) (-351.127) [-350.074] * (-348.299) (-348.478) (-350.333) [-349.639] -- 0:00:02
Average standard deviation of split frequencies: 0.003715
955500 -- [-348.943] (-349.201) (-350.488) (-352.490) * (-350.328) (-348.954) (-352.273) [-351.133] -- 0:00:02
956000 -- (-353.570) (-352.349) (-350.122) [-349.849] * [-348.552] (-352.030) (-352.280) (-349.882) -- 0:00:02
956500 -- (-350.168) (-351.504) (-349.366) [-349.594] * (-349.090) [-348.863] (-351.114) (-349.154) -- 0:00:02
957000 -- [-350.390] (-349.540) (-350.041) (-353.919) * [-350.036] (-348.946) (-354.256) (-348.286) -- 0:00:02
957500 -- (-348.298) (-349.120) (-349.538) [-349.420] * (-348.763) [-349.111] (-350.663) (-351.078) -- 0:00:02
958000 -- [-350.567] (-351.460) (-350.265) (-349.948) * [-348.955] (-348.347) (-356.819) (-348.711) -- 0:00:02
958500 -- (-349.135) (-354.640) (-349.543) [-350.793] * (-350.681) [-348.911] (-354.311) (-351.210) -- 0:00:02
959000 -- (-351.507) (-349.769) (-349.303) [-349.227] * (-351.181) (-352.972) (-349.972) [-348.933] -- 0:00:02
959500 -- (-349.243) (-351.844) [-350.769] (-348.847) * (-351.107) [-351.416] (-351.413) (-348.166) -- 0:00:02
960000 -- (-349.343) [-349.686] (-351.853) (-349.225) * (-349.243) (-351.253) [-351.077] (-352.556) -- 0:00:02
Average standard deviation of split frequencies: 0.003173
960500 -- (-349.981) (-350.347) [-352.098] (-351.625) * (-351.634) (-352.975) [-349.103] (-355.593) -- 0:00:02
961000 -- [-349.310] (-352.023) (-350.679) (-348.743) * (-351.602) (-351.538) (-349.064) [-351.340] -- 0:00:02
961500 -- [-351.921] (-350.067) (-348.705) (-348.843) * (-351.602) [-352.085] (-348.548) (-351.130) -- 0:00:02
962000 -- (-355.253) (-351.513) [-348.624] (-353.087) * (-351.173) [-351.661] (-349.006) (-351.668) -- 0:00:02
962500 -- (-351.905) [-352.027] (-349.247) (-349.453) * (-356.389) (-348.407) (-349.972) [-349.805] -- 0:00:02
963000 -- (-349.575) [-348.960] (-351.689) (-349.361) * (-353.072) (-348.282) [-349.670] (-349.095) -- 0:00:02
963500 -- [-348.796] (-349.860) (-355.261) (-348.322) * (-352.539) (-352.582) [-348.569] (-348.505) -- 0:00:02
964000 -- [-347.932] (-350.922) (-349.369) (-349.570) * (-351.156) (-348.775) (-349.028) [-353.631] -- 0:00:02
964500 -- (-350.934) (-351.682) (-351.126) [-349.879] * [-352.586] (-354.597) (-349.359) (-351.102) -- 0:00:02
965000 -- (-351.589) [-349.017] (-349.463) (-352.541) * (-351.351) (-348.566) (-349.296) [-352.560] -- 0:00:02
Average standard deviation of split frequencies: 0.004178
965500 -- (-352.107) [-352.156] (-350.206) (-349.526) * (-351.902) (-350.931) (-351.557) [-349.496] -- 0:00:02
966000 -- (-352.222) [-351.044] (-349.995) (-349.967) * (-350.316) (-350.771) [-350.014] (-350.050) -- 0:00:02
966500 -- (-351.134) (-352.344) [-348.118] (-348.926) * (-352.860) (-350.828) [-348.634] (-349.211) -- 0:00:01
967000 -- (-350.747) [-349.271] (-349.058) (-348.048) * [-352.719] (-351.023) (-352.804) (-348.817) -- 0:00:01
967500 -- [-349.450] (-351.434) (-351.674) (-347.899) * (-348.335) [-349.765] (-349.943) (-347.881) -- 0:00:01
968000 -- [-353.373] (-351.508) (-353.427) (-348.473) * (-349.818) [-350.565] (-348.684) (-349.238) -- 0:00:01
968500 -- (-349.307) (-354.460) (-351.460) [-351.247] * (-348.415) (-350.669) (-348.997) [-349.794] -- 0:00:01
969000 -- (-348.817) (-352.412) (-354.280) [-349.532] * (-348.042) [-348.533] (-349.568) (-349.161) -- 0:00:01
969500 -- (-348.888) (-350.117) [-350.827] (-353.327) * (-348.980) (-352.534) [-350.083] (-351.643) -- 0:00:01
970000 -- (-348.123) [-348.285] (-348.465) (-349.275) * [-349.960] (-349.856) (-351.610) (-349.200) -- 0:00:01
Average standard deviation of split frequencies: 0.004158
970500 -- (-350.669) (-353.313) [-348.480] (-349.340) * (-349.089) (-348.588) [-351.029] (-349.699) -- 0:00:01
971000 -- [-348.167] (-352.026) (-348.805) (-349.795) * (-349.537) (-348.775) (-350.640) [-350.556] -- 0:00:01
971500 -- [-349.156] (-349.446) (-348.537) (-349.391) * (-348.973) (-351.007) [-349.512] (-353.572) -- 0:00:01
972000 -- [-349.251] (-350.352) (-348.711) (-349.627) * (-351.728) [-350.213] (-348.189) (-353.702) -- 0:00:01
972500 -- (-348.217) (-349.683) (-349.379) [-352.801] * (-351.519) (-353.934) [-348.997] (-349.627) -- 0:00:01
973000 -- (-349.484) (-348.654) [-348.610] (-351.726) * (-350.754) (-348.823) (-353.968) [-349.957] -- 0:00:01
973500 -- (-349.521) [-348.604] (-352.274) (-349.215) * [-351.315] (-351.805) (-351.551) (-350.746) -- 0:00:01
974000 -- [-349.166] (-350.723) (-351.663) (-352.532) * (-350.576) (-349.317) (-350.763) [-349.265] -- 0:00:01
974500 -- (-349.395) (-350.494) (-349.826) [-349.261] * (-351.816) (-352.380) (-350.556) [-350.193] -- 0:00:01
975000 -- [-350.423] (-352.838) (-349.970) (-349.587) * [-351.506] (-349.815) (-349.059) (-349.313) -- 0:00:01
Average standard deviation of split frequencies: 0.004045
975500 -- (-348.508) (-352.238) [-348.349] (-352.876) * [-349.274] (-350.079) (-348.862) (-351.976) -- 0:00:01
976000 -- (-349.052) [-348.325] (-351.012) (-350.653) * (-348.825) [-350.960] (-348.708) (-353.952) -- 0:00:01
976500 -- (-349.095) [-349.642] (-352.117) (-350.087) * [-349.423] (-350.997) (-349.951) (-352.743) -- 0:00:01
977000 -- (-348.828) (-349.337) [-349.011] (-349.638) * (-351.799) (-349.832) (-359.516) [-349.488] -- 0:00:01
977500 -- [-355.155] (-352.874) (-351.049) (-351.268) * (-350.292) (-351.810) [-351.047] (-349.440) -- 0:00:01
978000 -- (-351.526) (-349.769) (-349.828) [-351.925] * (-348.413) [-350.134] (-352.513) (-350.800) -- 0:00:01
978500 -- [-349.165] (-348.738) (-351.196) (-349.705) * (-349.885) (-349.923) [-348.658] (-349.630) -- 0:00:01
979000 -- [-350.369] (-351.541) (-352.207) (-351.084) * (-350.436) (-349.807) (-348.722) [-348.274] -- 0:00:01
979500 -- (-351.285) [-351.390] (-348.639) (-350.392) * [-351.303] (-348.884) (-352.807) (-351.094) -- 0:00:01
980000 -- [-349.680] (-349.184) (-350.817) (-349.956) * (-350.475) (-351.137) (-349.805) [-348.561] -- 0:00:01
Average standard deviation of split frequencies: 0.003749
980500 -- (-350.826) [-350.337] (-349.923) (-351.318) * [-348.789] (-351.419) (-352.540) (-350.823) -- 0:00:01
981000 -- (-349.407) [-353.208] (-349.644) (-349.016) * (-349.866) (-350.000) (-352.385) [-351.050] -- 0:00:01
981500 -- (-351.813) [-348.393] (-349.693) (-351.116) * [-351.329] (-349.047) (-349.316) (-351.167) -- 0:00:01
982000 -- [-355.831] (-349.226) (-348.969) (-352.535) * (-349.587) [-352.073] (-348.733) (-352.627) -- 0:00:01
982500 -- (-352.619) (-352.458) [-348.519] (-348.435) * [-348.413] (-348.355) (-348.680) (-355.959) -- 0:00:01
983000 -- (-349.947) (-350.997) (-349.227) [-348.822] * (-348.716) (-348.192) (-349.418) [-354.669] -- 0:00:01
983500 -- (-350.461) (-349.118) [-348.143] (-350.836) * (-351.377) (-348.443) [-349.007] (-357.319) -- 0:00:00
984000 -- (-352.267) [-348.441] (-348.441) (-349.800) * [-349.406] (-351.681) (-348.919) (-350.672) -- 0:00:00
984500 -- [-349.585] (-350.325) (-351.490) (-351.671) * (-350.663) [-352.895] (-348.001) (-354.135) -- 0:00:00
985000 -- (-349.135) (-348.809) (-349.161) [-351.497] * (-350.811) (-352.022) [-348.155] (-349.676) -- 0:00:00
Average standard deviation of split frequencies: 0.003889
985500 -- [-351.342] (-350.204) (-350.977) (-351.494) * (-350.222) (-355.412) (-350.568) [-348.287] -- 0:00:00
986000 -- (-352.171) (-350.955) (-352.064) [-352.280] * [-348.169] (-349.487) (-349.959) (-349.121) -- 0:00:00
986500 -- (-352.617) (-348.492) (-348.712) [-349.504] * (-349.901) (-350.676) (-349.278) [-348.674] -- 0:00:00
987000 -- (-354.917) (-348.782) (-350.693) [-353.561] * [-350.609] (-354.297) (-349.969) (-348.930) -- 0:00:00
987500 -- [-350.484] (-352.257) (-353.637) (-352.467) * [-350.996] (-350.855) (-350.206) (-351.612) -- 0:00:00
988000 -- (-351.673) [-349.778] (-351.731) (-351.311) * (-351.356) (-350.117) [-349.827] (-349.635) -- 0:00:00
988500 -- (-349.351) (-348.474) [-348.868] (-352.841) * (-348.333) [-348.700] (-352.344) (-350.333) -- 0:00:00
989000 -- (-352.379) (-350.515) [-350.133] (-352.490) * [-350.629] (-348.911) (-350.469) (-351.123) -- 0:00:00
989500 -- [-351.002] (-350.164) (-349.439) (-352.937) * (-352.854) [-348.386] (-348.599) (-348.855) -- 0:00:00
990000 -- (-349.585) (-349.777) (-348.807) [-349.776] * (-349.387) (-349.788) [-349.367] (-352.896) -- 0:00:00
Average standard deviation of split frequencies: 0.004092
990500 -- (-351.232) (-351.521) [-349.248] (-348.016) * (-349.415) (-350.601) [-351.022] (-351.888) -- 0:00:00
991000 -- (-348.418) [-349.210] (-350.314) (-348.567) * (-353.988) (-350.536) (-354.950) [-352.010] -- 0:00:00
991500 -- (-350.534) [-349.905] (-351.207) (-352.594) * (-348.880) (-348.792) (-357.412) [-352.658] -- 0:00:00
992000 -- (-349.564) [-348.456] (-350.003) (-349.040) * [-349.421] (-348.330) (-351.202) (-352.043) -- 0:00:00
992500 -- (-349.954) (-350.460) (-350.906) [-350.905] * (-350.435) [-350.250] (-350.335) (-354.651) -- 0:00:00
993000 -- (-351.346) (-353.908) (-351.477) [-351.330] * (-348.227) (-349.663) [-352.687] (-352.233) -- 0:00:00
993500 -- (-349.504) (-356.244) [-350.428] (-350.314) * (-348.743) (-349.849) (-351.977) [-348.464] -- 0:00:00
994000 -- (-354.244) (-349.444) [-349.186] (-350.580) * [-349.281] (-349.620) (-352.255) (-352.557) -- 0:00:00
994500 -- (-353.140) (-355.226) (-350.875) [-348.248] * (-352.069) [-349.272] (-348.799) (-352.609) -- 0:00:00
995000 -- (-357.272) [-349.762] (-351.185) (-348.536) * (-348.511) [-348.528] (-349.970) (-352.313) -- 0:00:00
Average standard deviation of split frequencies: 0.004197
995500 -- (-351.784) (-351.472) [-353.928] (-348.756) * (-348.714) (-351.329) (-350.531) [-348.918] -- 0:00:00
996000 -- (-350.467) (-351.175) (-350.272) [-349.828] * (-348.407) (-348.797) [-350.653] (-355.536) -- 0:00:00
996500 -- (-349.558) [-350.916] (-356.465) (-350.162) * (-348.971) (-350.395) [-352.344] (-356.053) -- 0:00:00
997000 -- [-352.881] (-347.931) (-351.584) (-353.550) * [-353.219] (-349.631) (-351.492) (-354.047) -- 0:00:00
997500 -- (-351.520) [-349.886] (-350.534) (-352.079) * (-349.266) (-349.136) [-350.034] (-355.420) -- 0:00:00
998000 -- (-351.162) (-349.007) (-351.044) [-350.626] * (-353.107) (-350.042) [-349.495] (-350.235) -- 0:00:00
998500 -- (-351.151) [-350.119] (-349.312) (-349.333) * (-350.267) (-351.795) (-351.608) [-350.737] -- 0:00:00
999000 -- [-350.729] (-350.227) (-350.216) (-350.193) * (-350.735) (-348.124) (-350.257) [-350.313] -- 0:00:00
999500 -- (-349.306) (-350.854) [-349.428] (-350.447) * (-349.133) [-348.156] (-350.804) (-351.802) -- 0:00:00
1000000 -- (-354.648) (-351.772) (-348.853) [-348.350] * (-348.394) [-348.253] (-350.597) (-352.316) -- 0:00:00
Average standard deviation of split frequencies: 0.003894
Analysis completed in 59 seconds
Analysis used 57.50 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -347.81
Likelihood of best state for "cold" chain of run 2 was -347.81
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
76.2 % ( 82 %) Dirichlet(Revmat{all})
99.9 % (100 %) Slider(Revmat{all})
42.7 % ( 34 %) Dirichlet(Pi{all})
40.2 % ( 29 %) Slider(Pi{all})
78.2 % ( 49 %) Multiplier(Alpha{1,2})
77.8 % ( 58 %) Multiplier(Alpha{3})
26.5 % ( 31 %) Slider(Pinvar{all})
98.7 % ( 98 %) ExtSPR(Tau{all},V{all})
69.9 % ( 83 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.5 % ( 89 %) ParsSPR(Tau{all},V{all})
28.2 % ( 25 %) Multiplier(V{all})
97.4 % ( 96 %) Nodeslider(V{all})
30.8 % ( 18 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
75.1 % ( 77 %) Dirichlet(Revmat{all})
100.0 % (100 %) Slider(Revmat{all})
43.5 % ( 35 %) Dirichlet(Pi{all})
40.1 % ( 16 %) Slider(Pi{all})
78.3 % ( 48 %) Multiplier(Alpha{1,2})
77.2 % ( 45 %) Multiplier(Alpha{3})
26.5 % ( 16 %) Slider(Pinvar{all})
98.7 % ( 98 %) ExtSPR(Tau{all},V{all})
70.0 % ( 70 %) ExtTBR(Tau{all},V{all})
100.0 % (100 %) NNI(Tau{all},V{all})
89.4 % ( 85 %) ParsSPR(Tau{all},V{all})
28.1 % ( 29 %) Multiplier(V{all})
97.4 % ( 96 %) Nodeslider(V{all})
30.6 % ( 25 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.81 0.64 0.50
2 | 166867 0.82 0.67
3 | 167275 166357 0.84
4 | 166178 167217 166106
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.81 0.64 0.50
2 | 167028 0.82 0.67
3 | 166489 165992 0.84
4 | 166919 166705 166867
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p and /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p
Writing summary statistics to file /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -349.67
| 1 1 21 1 |
| 2 2 2 2 * 1 1 |
|1 11 2 1 1 2 1 |
| 1 2 2 1 2 2 2 1 2 |
| 1 2 2 *21 * 1 2 2 1 2 2 1 21 *|
| 111 2 2 2 2 * 2 11 2 2 |
| 2 121 11 1 1 1 2 2 2 2 22 |
|2 22 12 1 1 1 2 2*11 1 * 1 |
| 1 2 2 11 11 2 |
| 12 1 |
| 222 1 2 1 1 |
| 2 1 2 1 |
| |
| |
| 2 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -351.32
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -349.51 -352.77
2 -349.55 -352.72
--------------------------------------
TOTAL -349.53 -352.75
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.889883 0.087259 0.373885 1.490329 0.857316 1472.68 1486.84 1.000
r(A<->C){all} 0.160454 0.017728 0.000025 0.428458 0.125238 301.96 411.06 1.003
r(A<->G){all} 0.174915 0.022689 0.000107 0.481316 0.132507 175.57 234.19 1.001
r(A<->T){all} 0.162989 0.021149 0.000009 0.460036 0.120701 155.50 216.67 1.000
r(C<->G){all} 0.176492 0.021281 0.000033 0.468418 0.140047 183.85 233.07 1.002
r(C<->T){all} 0.158302 0.019004 0.000123 0.445024 0.121412 145.05 210.62 1.011
r(G<->T){all} 0.166849 0.020755 0.000253 0.470555 0.126143 132.78 188.77 1.002
pi(A){all} 0.264036 0.000754 0.211385 0.318238 0.262907 1191.31 1299.11 1.000
pi(C){all} 0.297586 0.000800 0.240391 0.352497 0.297428 1197.22 1332.29 1.000
pi(G){all} 0.298058 0.000833 0.239678 0.350781 0.297674 1223.21 1286.46 1.001
pi(T){all} 0.140320 0.000463 0.097220 0.180942 0.139491 1171.40 1309.65 1.000
alpha{1,2} 0.411421 0.230906 0.000149 1.361843 0.240460 1010.02 1219.13 1.000
alpha{3} 0.438581 0.241406 0.000394 1.384557 0.278381 1256.94 1323.86 1.000
pinvar{all} 0.993875 0.000051 0.980346 1.000000 0.996201 1194.93 1262.31 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a paramiter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
5 -- C5
6 -- C6
Key to taxon bipartitions (saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.parts"):
ID -- Partition
------------
1 -- .*****
2 -- .*....
3 -- ..*...
4 -- ...*..
5 -- ....*.
6 -- .....*
7 -- ..****
8 -- ....**
9 -- .**...
10 -- .**.**
11 -- ..*..*
12 -- ..**..
13 -- .*.***
14 -- .****.
15 -- ...*.*
16 -- .*...*
17 -- .*..*.
18 -- .*.*..
19 -- ...**.
20 -- ..*.*.
21 -- .***.*
------------
Summary statistics for informative taxon bipartitions
(saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
7 465 0.154897 0.000471 0.154564 0.155230 2
8 457 0.152232 0.002355 0.150566 0.153897 2
9 453 0.150899 0.000471 0.150566 0.151233 2
10 442 0.147235 0.004711 0.143904 0.150566 2
11 441 0.146902 0.005182 0.143238 0.150566 2
12 435 0.144903 0.002355 0.143238 0.146569 2
13 430 0.143238 0.008480 0.137242 0.149234 2
14 422 0.140573 0.000942 0.139907 0.141239 2
15 422 0.140573 0.001884 0.139241 0.141905 2
16 422 0.140573 0.002827 0.138574 0.142572 2
17 421 0.140240 0.005182 0.136576 0.143904 2
18 416 0.138574 0.009422 0.131912 0.145237 2
19 412 0.137242 0.014133 0.127249 0.147235 2
20 398 0.132578 0.000000 0.132578 0.132578 2
21 388 0.129247 0.000000 0.129247 0.129247 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.095980 0.009198 0.000002 0.292749 0.066627 1.000 2
length{all}[2] 0.097661 0.009627 0.000013 0.296986 0.067587 1.000 2
length{all}[3] 0.100912 0.010125 0.000025 0.301864 0.071373 1.000 2
length{all}[4] 0.102491 0.010502 0.000017 0.298962 0.071352 1.000 2
length{all}[5] 0.099105 0.009933 0.000040 0.303897 0.066336 1.000 2
length{all}[6] 0.098914 0.010209 0.000053 0.300820 0.067241 1.000 2
length{all}[7] 0.091718 0.007982 0.000006 0.272258 0.066027 1.000 2
length{all}[8] 0.100591 0.009739 0.000437 0.298969 0.071124 1.004 2
length{all}[9] 0.096264 0.009697 0.000018 0.293840 0.065730 1.001 2
length{all}[10] 0.101990 0.011214 0.000519 0.309980 0.067686 1.001 2
length{all}[11] 0.092682 0.006981 0.000549 0.241824 0.071687 1.001 2
length{all}[12] 0.100182 0.010888 0.000626 0.297858 0.069611 1.003 2
length{all}[13] 0.104639 0.013633 0.000253 0.305308 0.066411 0.998 2
length{all}[14] 0.095112 0.009474 0.000019 0.294233 0.065468 1.007 2
length{all}[15] 0.094003 0.009789 0.000102 0.289753 0.064607 0.999 2
length{all}[16] 0.095496 0.008680 0.000198 0.290047 0.066698 0.998 2
length{all}[17] 0.097580 0.009435 0.000018 0.282645 0.066340 1.002 2
length{all}[18] 0.096952 0.008762 0.000203 0.285423 0.068488 0.998 2
length{all}[19] 0.101069 0.009213 0.001090 0.296479 0.070706 0.998 2
length{all}[20] 0.096623 0.010401 0.000100 0.298506 0.067913 0.999 2
length{all}[21] 0.105903 0.009742 0.000097 0.311201 0.081474 1.004 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.003894
Maximum standard deviation of split frequencies = 0.014133
Average PSRF for parameter values ( excluding NA and >10.0 ) = 1.001
Maximum PSRF for parameter values = 1.007
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|------------------------------------------------------------------------ C5 (5)
|
\------------------------------------------------------------------------ C6 (6)
Phylogram (based on average branch lengths):
/------------------------------------------------------------------- C1 (1)
|
|-------------------------------------------------------------------- C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
|------------------------------------------------------------------------ C4 (4)
|
|------------------------------------------------------------------- C5 (5)
|
\-------------------------------------------------------------------- C6 (6)
|---------| 0.010 expected changes per site
Calculating tree probabilities...
Credible sets of trees (105 trees sampled):
50 % credible set contains 45 trees
90 % credible set contains 90 trees
95 % credible set contains 97 trees
99 % credible set contains 104 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
MrBayes output code: 0
CODONML in paml version 4.9h, March 2018
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 0 1 2 7 8
seq file is not paml/phylip format. Trying nexus format.ns = 6 ls = 258
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Sequences read..
Counting site patterns.. 0:00
Compressing, 30 patterns at 86 / 86 sites (100.0%), 0:00
Collecting fpatt[] & pose[], 30 patterns at 86 / 86 sites (100.0%), 0:00
Counting codons..
120 bytes for distance
29280 bytes for conP
2640 bytes for fhK
5000000 bytes for space
Model 0: one-ratio
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.103831 0.053650 0.069979 0.072160 0.069549 0.019380 0.300000 1.300000
ntime & nrate & np: 6 2 8
Bounds (np=8):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000100
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 999.000000
np = 8
lnL0 = -358.619468
Iterating by ming2
Initial: fx= 358.619468
x= 0.10383 0.05365 0.06998 0.07216 0.06955 0.01938 0.30000 1.30000
1 h-m-p 0.0000 0.0002 204.2716 +++ 348.999733 m 0.0002 14 | 1/8
2 h-m-p 0.0015 0.0106 28.8241 -----------.. | 1/8
3 h-m-p 0.0000 0.0004 186.8851 +++ 334.628333 m 0.0004 46 | 2/8
4 h-m-p 0.0030 0.0152 20.9301 ------------.. | 2/8
5 h-m-p 0.0000 0.0002 168.2177 +++ 329.218211 m 0.0002 79 | 3/8
6 h-m-p 0.0020 0.0244 14.1680 ------------.. | 3/8
7 h-m-p 0.0000 0.0000 146.0863 ++ 329.108207 m 0.0000 111 | 4/8
8 h-m-p 0.0001 0.0351 10.4286 ---------.. | 4/8
9 h-m-p 0.0000 0.0000 119.1336 ++ 328.736170 m 0.0000 140 | 5/8
10 h-m-p 0.0003 0.0491 7.3980 ----------.. | 5/8
11 h-m-p 0.0000 0.0004 83.9879 +++ 326.024576 m 0.0004 171 | 6/8
12 h-m-p 1.6000 8.0000 0.0000 +C 326.024576 0 6.4000 183 | 6/8
13 h-m-p 0.5785 8.0000 0.0000 ----------------.. | 6/8
14 h-m-p 0.0160 8.0000 0.0000 +++++ 326.024576 m 8.0000 226 | 6/8
15 h-m-p 0.0016 0.8119 0.3718 +++++ 326.024572 m 0.8119 242 | 7/8
16 h-m-p 0.6749 8.0000 0.0548 ---------Y 326.024572 0 0.0000 264 | 7/8
17 h-m-p 0.0160 8.0000 0.0001 +++++ 326.024572 m 8.0000 279 | 7/8
18 h-m-p 0.0160 8.0000 0.5308 --------C 326.024572 0 0.0000 299 | 7/8
19 h-m-p 0.0160 8.0000 0.0005 +++++ 326.024572 m 8.0000 314 | 7/8
20 h-m-p 0.0160 8.0000 0.7485 -------------.. | 7/8
21 h-m-p 0.0160 8.0000 0.0000 +++++ 326.024572 m 8.0000 352 | 7/8
22 h-m-p 0.0160 8.0000 3.3701 ---------Y 326.024572 0 0.0000 373 | 7/8
23 h-m-p 0.0519 8.0000 0.0000 ---------Y 326.024572 0 0.0000 393 | 7/8
24 h-m-p 0.0542 8.0000 0.0000 ----Y 326.024572 0 0.0001 409
Out..
lnL = -326.024572
410 lfun, 410 eigenQcodon, 2460 P(t)
Time used: 0:00
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.044074 0.072743 0.035671 0.076963 0.065532 0.024124 0.000100 0.741291 0.282737
ntime & nrate & np: 6 2 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 13.981596
np = 9
lnL0 = -351.431309
Iterating by ming2
Initial: fx= 351.431309
x= 0.04407 0.07274 0.03567 0.07696 0.06553 0.02412 0.00011 0.74129 0.28274
1 h-m-p 0.0000 0.0000 185.8160 ++ 351.235324 m 0.0000 14 | 1/9
2 h-m-p 0.0000 0.0007 162.5178 ++++ 339.830392 m 0.0007 28 | 2/9
3 h-m-p 0.0000 0.0002 126.0344 ++ 335.775010 m 0.0002 40 | 3/9
4 h-m-p 0.0002 0.0008 67.7096 ++ 332.804907 m 0.0008 52 | 4/9
5 h-m-p 0.0000 0.0001 745.6861 ++ 327.616015 m 0.0001 64 | 5/9
6 h-m-p 0.0000 0.0002 306.0178 ++ 326.371219 m 0.0002 76 | 6/9
7 h-m-p 0.0000 0.0000 2363.7524 ++ 326.145628 m 0.0000 88 | 7/9
8 h-m-p 0.0043 0.2444 3.5861 ------------.. | 7/9
9 h-m-p 0.0000 0.0000 83.1202 ++ 326.024548 m 0.0000 122 | 8/9
10 h-m-p 1.6000 8.0000 0.0000 ++ 326.024548 m 8.0000 134 | 8/9
11 h-m-p 0.0160 8.0000 0.0000 +++++ 326.024548 m 8.0000 150 | 8/9
12 h-m-p 0.0113 5.6345 0.1513 -------------.. | 8/9
13 h-m-p 0.0160 8.0000 0.0001 +++++ 326.024548 m 8.0000 190 | 8/9
14 h-m-p 0.0112 5.6050 0.1522 -----------N 326.024548 0 0.0000 214 | 8/9
15 h-m-p 0.0160 8.0000 0.0000 +++++ 326.024548 m 8.0000 230 | 8/9
16 h-m-p 0.0113 5.6635 0.1506 ----------Y 326.024548 0 0.0000 253 | 8/9
17 h-m-p 0.0160 8.0000 0.0002 --------Y 326.024548 0 0.0000 274 | 8/9
18 h-m-p 0.0160 8.0000 0.0000 -----Y 326.024548 0 0.0000 292
Out..
lnL = -326.024548
293 lfun, 879 eigenQcodon, 3516 P(t)
Time used: 0:01
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.101373 0.030244 0.017588 0.077046 0.022087 0.022278 0.000100 0.933039 0.529925 0.110151 1.466783
ntime & nrate & np: 6 3 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 10.728693
np = 11
lnL0 = -346.895330
Iterating by ming2
Initial: fx= 346.895330
x= 0.10137 0.03024 0.01759 0.07705 0.02209 0.02228 0.00011 0.93304 0.52993 0.11015 1.46678
1 h-m-p 0.0000 0.0000 174.2557 ++ 346.694884 m 0.0000 16 | 1/11
2 h-m-p 0.0000 0.0018 68.2958 ++++ 339.725523 m 0.0018 32 | 2/11
3 h-m-p 0.0005 0.0024 76.4299 ++ 331.274339 m 0.0024 46 | 3/11
4 h-m-p 0.0014 0.0071 64.4467 ++ 326.857447 m 0.0071 60 | 4/11
5 h-m-p 0.0001 0.0003 738.8412 ++ 326.179890 m 0.0003 74 | 5/11
6 h-m-p 0.0000 0.0000 99683.1843 ++ 326.127110 m 0.0000 88 | 6/11
7 h-m-p 0.0000 0.0000 66691.9590 ++ 326.030836 m 0.0000 102 | 7/11
8 h-m-p 0.0000 0.0000 1213539.7835 ++ 326.024564 m 0.0000 116 | 8/11
9 h-m-p 1.6000 8.0000 0.0174 ++ 326.024563 m 8.0000 130 | 8/11
10 h-m-p 0.0620 1.0225 2.2436 -------------N 326.024563 0 0.0000 160 | 8/11
11 h-m-p 0.0160 8.0000 0.0002 +++++ 326.024563 m 8.0000 177 | 8/11
12 h-m-p 0.0024 1.2108 1.8721 ---------Y 326.024563 0 0.0000 203 | 8/11
13 h-m-p 0.0160 8.0000 0.0000 +++++ 326.024563 m 8.0000 220 | 8/11
14 h-m-p 0.0031 1.5641 1.4052 +++++ 326.024539 m 1.5641 240 | 9/11
15 h-m-p 0.2351 8.0000 6.1167 -------------Y 326.024539 0 0.0000 267 | 9/11
16 h-m-p 0.0160 8.0000 0.0021 ---------N 326.024539 0 0.0000 290 | 9/11
17 h-m-p 0.0160 8.0000 0.0000 ----N 326.024539 0 0.0000 310
Out..
lnL = -326.024539
311 lfun, 1244 eigenQcodon, 5598 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -326.045957 S = -326.024331 -0.008298
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 30 patterns 0:03
did 20 / 30 patterns 0:03
did 30 / 30 patterns 0:03
Time used: 0:03
Model 7: beta
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.060378 0.034253 0.012853 0.052190 0.033292 0.061690 0.000100 0.664762 1.663424
ntime & nrate & np: 6 1 9
Bounds (np=9):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 19.865224
np = 9
lnL0 = -346.239602
Iterating by ming2
Initial: fx= 346.239602
x= 0.06038 0.03425 0.01285 0.05219 0.03329 0.06169 0.00011 0.66476 1.66342
1 h-m-p 0.0000 0.0000 184.8190 ++ 346.056850 m 0.0000 14 | 1/9
2 h-m-p 0.0001 0.0344 19.2240 +++++ 340.539984 m 0.0344 29 | 2/9
3 h-m-p 0.0005 0.0025 32.9681 ++ 338.281698 m 0.0025 41 | 3/9
4 h-m-p 0.0000 0.0001 27.6282 ++ 337.683626 m 0.0001 53 | 4/9
5 h-m-p 0.0008 0.0295 3.9062 -----------.. | 4/9
6 h-m-p 0.0000 0.0001 156.7973 ++ 334.409969 m 0.0001 86 | 5/9
7 h-m-p 0.0160 8.0000 1.4577 -------------.. | 5/9
8 h-m-p 0.0000 0.0003 136.0647 +++ 328.646235 m 0.0003 122 | 6/9
9 h-m-p 0.0291 8.0000 1.1600 --------------.. | 6/9
10 h-m-p 0.0000 0.0000 113.8947 ++ 328.427454 m 0.0000 158 | 7/9
11 h-m-p 0.0160 8.0000 0.7463 -------------.. | 7/9
12 h-m-p 0.0000 0.0004 79.0806 +++ 326.024520 m 0.0004 196 | 8/9
13 h-m-p 1.6000 8.0000 0.0000 C 326.024520 0 1.6000 208 | 8/9
14 h-m-p 1.6000 8.0000 0.0000 ---Y 326.024520 0 0.0063 224
Out..
lnL = -326.024520
225 lfun, 2475 eigenQcodon, 13500 P(t)
Time used: 0:07
Model 8: beta&w>1
TREE # 1
(1, 2, 3, 4, 5, 6); MP score: 0
0.016506 0.044456 0.047581 0.101427 0.056423 0.010113 0.000100 0.900000 1.050233 1.718199 1.257942
ntime & nrate & np: 6 2 11
Bounds (np=11):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 14.030593
np = 11
lnL0 = -347.885414
Iterating by ming2
Initial: fx= 347.885414
x= 0.01651 0.04446 0.04758 0.10143 0.05642 0.01011 0.00011 0.90000 1.05023 1.71820 1.25794
1 h-m-p 0.0000 0.0000 183.6793 ++ 347.678449 m 0.0000 16 | 1/11
2 h-m-p 0.0000 0.0035 44.3118 ++++ 341.983549 m 0.0035 32 | 2/11
3 h-m-p 0.0001 0.0003 90.1687 ++ 339.458019 m 0.0003 46 | 3/11
4 h-m-p 0.0007 0.0156 38.3209 +++ 330.065271 m 0.0156 61 | 4/11
5 h-m-p 0.0000 0.0000 25701.7072 ++ 329.464702 m 0.0000 75 | 5/11
6 h-m-p 0.0002 0.0018 270.2467 ++ 328.046443 m 0.0018 89 | 6/11
7 h-m-p 0.0000 0.0000 7444.7762 +
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
+ 327.080127 m 0.0000 103
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
| 7/11
8 h-m-p 0.0181 0.1137 12.5769 -
QuantileBeta(0.15, 0.00500, 2.14312) = 1.234260e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14703) = 1.231418e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14801) = 1.230710e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14825) = 1.230533e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14831) = 1.230488e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230477e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
-..
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
| 7/11
9 h-m-p 0.0000 0.0002 82.3160
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
+ 326.024570 m 0.0002 142
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
| 8/11
10 h-m-p 1.6000 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
+ 326.024570 m 8.0000 156
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14845) = 1.230386e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14821) = 1.230561e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
| 8/11
11 h-m-p 0.0160 8.0000 0.0031
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
Y 326.024570 0 0.0000 178
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14845) = 1.230386e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14821) = 1.230561e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
| 8/11
12 h-m-p 0.0160 8.0000 0.0001
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230473e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230471e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
+ 326.024570 m 8.0000 198
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14846) = 1.230380e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14822) = 1.230555e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
| 8/11
13 h-m-p 0.0160 8.0000 1.2847
QuantileBeta(0.15, 0.00500, 2.14810) = 1.230640e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14828) = 1.230511e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14833) = 1.230479e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230471e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230469e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
N 326.024570 0 0.0000 226
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230467e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
| 8/11
14 h-m-p 0.0160 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
Y 326.024570 0 0.0160 240
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14846) = 1.230380e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14822) = 1.230555e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
| 8/11
15 h-m-p 0.0160 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
-
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
N 326.024570 0 0.0010 258
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
Out..
lnL = -326.024570
259 lfun, 3108 eigenQcodon, 17094 P(t)
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal likelihood.
log(fX) = -326.028978 S = -326.022927 -0.002652
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 30 patterns 0:12
did 20 / 30 patterns 0:12
did 30 / 30 patterns 0:12
QuantileBeta(0.15, 0.00500, 2.14834) = 1.230468e-160 2000 rounds
Time used: 0:12
CodeML output code: -1
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=6, Len=86
NC_011896_1_WP_010907833_1_633_MLBR_RS03000 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
NC_002677_1_NP_301509_1_381_rpsT VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL
**************************************************
NC_011896_1_WP_010907833_1_633_MLBR_RS03000 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
NC_002677_1_NP_301509_1_381_rpsT LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385 LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
************************************
>NC_011896_1_WP_010907833_1_633_MLBR_RS03000 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA ACAAACTC >NC_002677_1_NP_301509_1_381_rpsT GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA ACAAACTC >NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA ACAAACTC >NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA ACAAACTC >NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA ACAAACTC >NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385 GTGACCAACATCAAGTCGCAGCAGAAGCGCAACCGCACCAACGAGCGCGC CAGATTGCGCAACAAGTCGGTGAAGTCTTCGCTTCGTACCGCTGTCCGCG CGTTCCGCGAGGCGGTCCATGCCGGCGAGAAGGAGAAGGCAGCGAAGCTG CTGGTGTCGACCAGCCGCAAATTGGACAAGGCGGCCAGCAAAGGTGTGAT CCACAAGAACCAGGCGGCTAACAAGAAGTCGGCACTGGCTCGTACTCTCA ACAAACTC
>NC_011896_1_WP_010907833_1_633_MLBR_RS03000 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL >NC_002677_1_NP_301509_1_381_rpsT VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL >NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL >NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL >NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL >NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385 VTNIKSQQKRNRTNERARLRNKSVKSSLRTAVRAFREAVHAGEKEKAAKL LVSTSRKLDKAASKGVIHKNQAANKKSALARTLNKL
#NEXUS
[ID: 0363175584]
begin taxa;
dimensions ntax=6;
taxlabels
NC_011896_1_WP_010907833_1_633_MLBR_RS03000
NC_002677_1_NP_301509_1_381_rpsT
NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095
NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040
NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305
NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385
;
end;
begin trees;
translate
1 NC_011896_1_WP_010907833_1_633_MLBR_RS03000,
2 NC_002677_1_NP_301509_1_381_rpsT,
3 NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095,
4 NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040,
5 NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305,
6 NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:0.06662652,2:0.06758749,3:0.07137317,4:0.07135233,5:0.06633551,6:0.06724124);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:0.06662652,2:0.06758749,3:0.07137317,4:0.07135233,5:0.06633551,6:0.06724124);
end;
Estimated marginal likelihoods for runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -349.51 -352.77
2 -349.55 -352.72
--------------------------------------
TOTAL -349.53 -352.75
--------------------------------------
Model parameter summaries over the runs sampled in files
"/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/data/12res/rpsT/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.889883 0.087259 0.373885 1.490329 0.857316 1472.68 1486.84 1.000
r(A<->C){all} 0.160454 0.017728 0.000025 0.428458 0.125238 301.96 411.06 1.003
r(A<->G){all} 0.174915 0.022689 0.000107 0.481316 0.132507 175.57 234.19 1.001
r(A<->T){all} 0.162989 0.021149 0.000009 0.460036 0.120701 155.50 216.67 1.000
r(C<->G){all} 0.176492 0.021281 0.000033 0.468418 0.140047 183.85 233.07 1.002
r(C<->T){all} 0.158302 0.019004 0.000123 0.445024 0.121412 145.05 210.62 1.011
r(G<->T){all} 0.166849 0.020755 0.000253 0.470555 0.126143 132.78 188.77 1.002
pi(A){all} 0.264036 0.000754 0.211385 0.318238 0.262907 1191.31 1299.11 1.000
pi(C){all} 0.297586 0.000800 0.240391 0.352497 0.297428 1197.22 1332.29 1.000
pi(G){all} 0.298058 0.000833 0.239678 0.350781 0.297674 1223.21 1286.46 1.001
pi(T){all} 0.140320 0.000463 0.097220 0.180942 0.139491 1171.40 1309.65 1.000
alpha{1,2} 0.411421 0.230906 0.000149 1.361843 0.240460 1010.02 1219.13 1.000
alpha{3} 0.438581 0.241406 0.000394 1.384557 0.278381 1256.94 1323.86 1.000
pinvar{all} 0.993875 0.000051 0.980346 1.000000 0.996201 1194.93 1262.31 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
CODONML (in paml version 4.9h, March 2018) /data/12res/rpsT/batch/allfiles/codeml/input.fasta.fasta.pnxs
Model: One dN/dS ratio,
Codon frequency model: F3x4
Site-class models:
ns = 6 ls = 86
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 0 0 0 0 0 0 | Ser TCT 1 1 1 1 1 1 | Tyr TAT 0 0 0 0 0 0 | Cys TGT 0 0 0 0 0 0
TTC 1 1 1 1 1 1 | TCC 0 0 0 0 0 0 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 0 0 0 0 0 0 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 2 2 2 2 2 2 | TCG 5 5 5 5 5 5 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 1 1 1 1 1 1 | Pro CCT 0 0 0 0 0 0 | His CAT 1 1 1 1 1 1 | Arg CGT 2 2 2 2 2 2
CTC 2 2 2 2 2 2 | CCC 0 0 0 0 0 0 | CAC 1 1 1 1 1 1 | CGC 7 7 7 7 7 7
CTA 0 0 0 0 0 0 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 3 3 3 3 3 3 | CCG 0 0 0 0 0 0 | CAG 3 3 3 3 3 3 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 1 1 1 1 1 1 | Asn AAT 0 0 0 0 0 0 | Ser AGT 0 0 0 0 0 0
ATC 2 2 2 2 2 2 | ACC 4 4 4 4 4 4 | AAC 7 7 7 7 7 7 | AGC 2 2 2 2 2 2
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 3 3 3 3 3 3 | Arg AGA 1 1 1 1 1 1
Met ATG 0 0 0 0 0 0 | ACG 0 0 0 0 0 0 | AAG 11 11 11 11 11 11 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 0 0 0 0 0 0 | Ala GCT 3 3 3 3 3 3 | Asp GAT 0 0 0 0 0 0 | Gly GGT 1 1 1 1 1 1
GTC 2 2 2 2 2 2 | GCC 3 3 3 3 3 3 | GAC 1 1 1 1 1 1 | GGC 1 1 1 1 1 1
GTA 0 0 0 0 0 0 | GCA 2 2 2 2 2 2 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 4 4 4 4 4 4 | GCG 5 5 5 5 5 5 | GAG 4 4 4 4 4 4 | GGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: NC_011896_1_WP_010907833_1_633_MLBR_RS03000
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
#2: NC_002677_1_NP_301509_1_381_rpsT
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
#3: NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
#4: NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
#5: NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
#6: NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 0 | Ser S TCT 6 | Tyr Y TAT 0 | Cys C TGT 0
TTC 6 | TCC 0 | TAC 0 | TGC 0
Leu L TTA 0 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 12 | TCG 30 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 6 | Pro P CCT 0 | His H CAT 6 | Arg R CGT 12
CTC 12 | CCC 0 | CAC 6 | CGC 42
CTA 0 | CCA 0 | Gln Q CAA 0 | CGA 0
CTG 18 | CCG 0 | CAG 18 | CGG 0
------------------------------------------------------------------------------
Ile I ATT 0 | Thr T ACT 6 | Asn N AAT 0 | Ser S AGT 0
ATC 12 | ACC 24 | AAC 42 | AGC 12
ATA 0 | ACA 0 | Lys K AAA 18 | Arg R AGA 6
Met M ATG 0 | ACG 0 | AAG 66 | AGG 0
------------------------------------------------------------------------------
Val V GTT 0 | Ala A GCT 18 | Asp D GAT 0 | Gly G GGT 6
GTC 12 | GCC 18 | GAC 6 | GGC 6
GTA 0 | GCA 12 | Glu E GAA 0 | GGA 0
GTG 24 | GCG 30 | GAG 24 | GGG 0
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.10465 C:0.23256 A:0.36047 G:0.30233
position 2: T:0.19767 C:0.27907 A:0.36047 G:0.16279
position 3: T:0.11628 C:0.38372 A:0.06977 G:0.43023
Average T:0.13953 C:0.29845 A:0.26357 G:0.29845
Model 0: one-ratio
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 8): -326.024572 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 1.257942
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010907833_1_633_MLBR_RS03000: 0.000004, NC_002677_1_NP_301509_1_381_rpsT: 0.000004, NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095: 0.000004, NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040: 0.000004, NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305: 0.000004, NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
omega (dN/dS) = 1.25794
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 223.3 34.7 1.2579 0.0000 0.0000 0.0 0.0
7..2 0.000 223.3 34.7 1.2579 0.0000 0.0000 0.0 0.0
7..3 0.000 223.3 34.7 1.2579 0.0000 0.0000 0.0 0.0
7..4 0.000 223.3 34.7 1.2579 0.0000 0.0000 0.0 0.0
7..5 0.000 223.3 34.7 1.2579 0.0000 0.0000 0.0 0.0
7..6 0.000 223.3 34.7 1.2579 0.0000 0.0000 0.0 0.0
tree length for dN: 0.0000
tree length for dS: 0.0000
Time used: 0:00
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -326.024548 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.853208 0.000001
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010907833_1_633_MLBR_RS03000: 0.000004, NC_002677_1_NP_301509_1_381_rpsT: 0.000004, NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095: 0.000004, NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040: 0.000004, NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305: 0.000004, NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
MLEs of dN/dS (w) for site classes (K=2)
p: 0.85321 0.14679
w: 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 223.3 34.7 0.1468 0.0000 0.0000 0.0 0.0
7..2 0.000 223.3 34.7 0.1468 0.0000 0.0000 0.0 0.0
7..3 0.000 223.3 34.7 0.1468 0.0000 0.0000 0.0 0.0
7..4 0.000 223.3 34.7 0.1468 0.0000 0.0000 0.0 0.0
7..5 0.000 223.3 34.7 0.1468 0.0000 0.0000 0.0 0.0
7..6 0.000 223.3 34.7 0.1468 0.0000 0.0000 0.0 0.0
Time used: 0:01
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -326.024539 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.926552 0.036083 0.000001 1.000000
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010907833_1_633_MLBR_RS03000: 0.000004, NC_002677_1_NP_301509_1_381_rpsT: 0.000004, NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095: 0.000004, NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040: 0.000004, NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305: 0.000004, NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
MLEs of dN/dS (w) for site classes (K=3)
p: 0.92655 0.03608 0.03736
w: 0.00000 1.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 223.3 34.7 0.0734 0.0000 0.0000 0.0 0.0
7..2 0.000 223.3 34.7 0.0734 0.0000 0.0000 0.0 0.0
7..3 0.000 223.3 34.7 0.0734 0.0000 0.0000 0.0 0.0
7..4 0.000 223.3 34.7 0.0734 0.0000 0.0000 0.0 0.0
7..5 0.000 223.3 34.7 0.0734 0.0000 0.0000 0.0 0.0
7..6 0.000 223.3 34.7 0.0734 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010907833_1_633_MLBR_RS03000)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
w2: 0.101 0.101 0.101 0.100 0.100 0.100 0.100 0.099 0.099 0.099
Posterior for p0-p1 (see the ternary graph) (YWN2015, fig. 1)
0.010
0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010 0.010
sum of density on p0-p1 = 1.000000
Time used: 0:03
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 9): -326.024520 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 1.649446
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010907833_1_633_MLBR_RS03000: 0.000004, NC_002677_1_NP_301509_1_381_rpsT: 0.000004, NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095: 0.000004, NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040: 0.000004, NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305: 0.000004, NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M7 (beta):
p = 0.00500 q = 1.64945
MLEs of dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00002
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 223.3 34.7 0.0000 0.0000 0.0000 0.0 0.0
7..2 0.000 223.3 34.7 0.0000 0.0000 0.0000 0.0 0.0
7..3 0.000 223.3 34.7 0.0000 0.0000 0.0000 0.0 0.0
7..4 0.000 223.3 34.7 0.0000 0.0000 0.0000 0.0 0.0
7..5 0.000 223.3 34.7 0.0000 0.0000 0.0000 0.0 0.0
7..6 0.000 223.3 34.7 0.0000 0.0000 0.0000 0.0 0.0
Time used: 0:07
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, 4, 5, 6); MP score: 0
lnL(ntime: 6 np: 11): -326.024570 +0.000000
7..1 7..2 7..3 7..4 7..5 7..6
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.597359 0.005000 2.148341 2.278212
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.000024
(1: 0.000004, 2: 0.000004, 3: 0.000004, 4: 0.000004, 5: 0.000004, 6: 0.000004);
(NC_011896_1_WP_010907833_1_633_MLBR_RS03000: 0.000004, NC_002677_1_NP_301509_1_381_rpsT: 0.000004, NZ_LVXE01000001_1_WP_010907833_1_19_A3216_RS00095: 0.000004, NZ_LYPH01000001_1_WP_010907833_1_7_A8144_RS00040: 0.000004, NZ_CP029543_1_WP_010907833_1_649_DIJ64_RS03305: 0.000004, NZ_AP014567_1_WP_010907833_1_665_JK2ML_RS03385: 0.000004);
Detailed output identifying parameters
kappa (ts/tv) = 0.00010
Parameters in M8 (beta&w>1):
p0 = 0.59736 p = 0.00500 q = 2.14834
(p1 = 0.40264) w = 2.27821
MLEs of dN/dS (w) for site classes (K=11)
p: 0.05974 0.05974 0.05974 0.05974 0.05974 0.05974 0.05974 0.05974 0.05974 0.05974 0.40264
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00001 2.27821
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
7..1 0.000 223.3 34.7 0.9173 0.0000 0.0000 0.0 0.0
7..2 0.000 223.3 34.7 0.9173 0.0000 0.0000 0.0 0.0
7..3 0.000 223.3 34.7 0.9173 0.0000 0.0000 0.0 0.0
7..4 0.000 223.3 34.7 0.9173 0.0000 0.0000 0.0 0.0
7..5 0.000 223.3 34.7 0.9173 0.0000 0.0000 0.0 0.0
7..6 0.000 223.3 34.7 0.9173 0.0000 0.0000 0.0 0.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010907833_1_633_MLBR_RS03000)
Pr(w>1) post mean +- SE for w
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: NC_011896_1_WP_010907833_1_633_MLBR_RS03000)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
p : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
q : 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
ws: 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100 0.100
Time used: 0:12
Model 1: NearlyNeutral -326.024548 Model 2: PositiveSelection -326.024539 Model 0: one-ratio -326.024572 Model 7: beta -326.02452 Model 8: beta&w>1 -326.02457 Model 0 vs 1 4.799999999249849E-5 Model 2 vs 1 1.799999995455437E-5 Model 8 vs 7 9.999999997489795E-5
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
