--- EXPERIMENT NOTES
--- EXPERIMENT PROPERTIES
#Tue Dec 06 10:14:10 WET 2016
codeml.models=0 1 2 3 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=CLUSTALW2
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb_adops
tcoffee.bin=t_coffee_ADOPS
mrbayes.dir=/usr/bin/
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/opt/ADOPS/383/SclA-PC/input.fasta
input.names=
mrbayes.params=
codeml.params=
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -194.82 -210.04
2 -194.69 -208.89
--------------------------------------
TOTAL -194.75 -209.62
--------------------------------------
Model parameter summaries over the runs sampled in files
"/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.841705 0.069177 0.406774 1.365913 0.804071 1216.94 1331.18 1.000
r(A<->C){all} 0.125521 0.010805 0.000214 0.334950 0.097044 252.59 272.03 1.000
r(A<->G){all} 0.139760 0.011900 0.000027 0.349758 0.115069 200.89 263.41 1.002
r(A<->T){all} 0.098068 0.009715 0.000015 0.304714 0.065422 365.84 377.81 1.003
r(C<->G){all} 0.039385 0.001474 0.000007 0.119636 0.027758 505.39 554.30 1.000
r(C<->T){all} 0.309678 0.018920 0.063552 0.567203 0.294527 286.14 312.87 1.000
r(G<->T){all} 0.287587 0.018006 0.051869 0.537914 0.270750 243.96 263.63 1.000
pi(A){all} 0.151568 0.001302 0.078346 0.218883 0.149867 1062.38 1132.72 1.000
pi(C){all} 0.350473 0.002326 0.263175 0.452109 0.349721 1098.93 1145.53 1.000
pi(G){all} 0.170989 0.001494 0.095073 0.243612 0.168585 1104.58 1302.79 1.000
pi(T){all} 0.326971 0.002283 0.239114 0.421947 0.325968 1210.90 1235.98 1.000
alpha{1,2} 0.095950 0.005711 0.000153 0.218025 0.085720 1217.03 1234.57 1.001
alpha{3} 1.186738 0.380873 0.249396 2.435140 1.056066 1377.27 1439.14 1.000
pinvar{all} 0.348527 0.027962 0.018671 0.629413 0.354800 814.08 961.68 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
--- CODEML SUMMARY
Model 1: NearlyNeutral -167.189371
Model 2: PositiveSelection -166.914967
Model 0: one-ratio -168.517752
Model 3: discrete -166.914967
Model 7: beta -167.768935
Model 8: beta&w>1 -166.914905
Model 0 vs 1 2.6567620000000147
Model 2 vs 1 0.5488080000000082
Model 8 vs 7 1.708059999999989
>C1
MSEARNLFTTFGILAILLFFLYLIYAVL
>C2
MSEARNLFTTFGILAILLFFLYLIYAVL
>C3
MSEARNLFTTFGILAILLFFLYLIYAVL
>C4
MSEARNLFTTFGILAILLFFLYLIYAVL
>C5
MSEARNLFTTFGILAILLFFLYLIYAVL
>C6
MSEARNLFTTFGILAILLFFLYLIYAVL
>C7
MSEARNLFTTFGILAILLFFLYLIYAVL
>C8
MSEAQNLFTTFGILAILLFFLYLIYAVL
>C9
MSEARNLFTTFGILAILLFFLYLIYAVL
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=9, Len=28
C1 MSEARNLFTTFGILAILLFFLYLIYAVL
C2 MSEARNLFTTFGILAILLFFLYLIYAVL
C3 MSEARNLFTTFGILAILLFFLYLIYAVL
C4 MSEARNLFTTFGILAILLFFLYLIYAVL
C5 MSEARNLFTTFGILAILLFFLYLIYAVL
C6 MSEARNLFTTFGILAILLFFLYLIYAVL
C7 MSEARNLFTTFGILAILLFFLYLIYAVL
C8 MSEAQNLFTTFGILAILLFFLYLIYAVL
C9 MSEARNLFTTFGILAILLFFLYLIYAVL
****:***********************
PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:04 - Revision 1613 - Build 427)
-full_log S [0]
-genepred_score S [0] nsd
-run_name S [0]
-mem_mode S [0] mem
-extend D [1] 1
-extend_mode S [0] very_fast_triplet
-max_n_pair D [0] 10
-seq_name_for_quadruplet S [0] all
-compact S [0] default
-clean S [0] no
-do_self FL [0] 0
-do_normalise D [0] 1000
-template_file S [0]
-setenv S [0] 0
-template_mode S [0]
-flip D [0] 0
-remove_template_file D [0] 0
-profile_template_file S [0]
-in S [0]
-seq S [0]
-aln S [0]
-method_limits S [0]
-method S [0]
-lib S [0]
-profile S [0]
-profile1 S [0]
-profile2 S [0]
-pdb S [0]
-relax_lib D [0] 1
-filter_lib D [0] 0
-shrink_lib D [0] 0
-out_lib W_F [0] no
-out_lib_mode S [0] primary
-lib_only D [0] 0
-outseqweight W_F [0] no
-dpa FL [0] 0
-seq_source S [0] ANY
-cosmetic_penalty D [0] 0
-gapopen D [0] 0
-gapext D [0] 0
-fgapopen D [0] 0
-fgapext D [0] 0
-nomatch D [0] 0
-newtree W_F [0] default
-tree W_F [0] NO
-usetree R_F [0]
-tree_mode S [0] nj
-distance_matrix_mode S [0] ktup
-distance_matrix_sim_mode S [0] idmat_sim1
-quicktree FL [0] 0
-outfile W_F [0] default
-maximise FL [1] 1
-output S [1] score_ascii html score_ascii
-len D [0] 0
-infile R_F [1] /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
-matrix S [0] default
-tg_mode D [0] 1
-profile_mode S [0] cw_profile_profile
-profile_comparison S [0] profile
-dp_mode S [0] linked_pair_wise
-ktuple D [0] 1
-ndiag D [0] 0
-diag_threshold D [0] 0
-diag_mode D [0] 0
-sim_matrix S [0] vasiliky
-transform S [0]
-extend_seq FL [0] 0
-outorder S [0] input
-inorder S [0] aligned
-seqnos S [0] off
-case S [0] keep
-cpu D [0] 0
-maxnseq D [0] 1000
-maxlen D [0] -1
-sample_dp D [0] 0
-weight S [0] default
-seq_weight S [0] no
-align FL [1] 1
-mocca FL [0] 0
-domain FL [0] 0
-start D [0] 0
-len D [0] 0
-scale D [0] 0
-mocca_interactive FL [0] 0
-method_evaluate_mode S [0] default
-evaluate_mode S [1] t_coffee_fast
-get_type FL [0] 0
-clean_aln D [0] 0
-clean_threshold D [1] 1
-clean_iteration D [1] 1
-clean_evaluate_mode S [0] t_coffee_fast
-extend_matrix FL [0] 0
-prot_min_sim D [40] 40
-prot_max_sim D [90] 90
-prot_min_cov D [40] 40
-pdb_type S [0] d
-pdb_min_sim D [35] 35
-pdb_max_sim D [100] 100
-pdb_min_cov D [50] 50
-pdb_blast_server W_F [0] EBI
-blast W_F [0]
-blast_server W_F [0] EBI
-pdb_db W_F [0] pdb
-protein_db W_F [0] uniprot
-method_log W_F [0] no
-struc_to_use S [0]
-cache W_F [0] use
-align_pdb_param_file W_F [0] no
-align_pdb_hasch_mode W_F [0] hasch_ca_trace_bubble
-external_aligner S [0] NO
-msa_mode S [0] tree
-master S [0] no
-blast_nseq D [0] 0
-lalign_n_top D [0] 10
-iterate D [1] 0
-trim D [0] 0
-split D [0] 0
-trimfile S [0] default
-split D [0] 0
-split_nseq_thres D [0] 0
-split_score_thres D [0] 0
-check_pdb_status D [0] 0
-clean_seq_name D [0] 0
-seq_to_keep S [0]
-dpa_master_aln S [0]
-dpa_maxnseq D [0] 0
-dpa_min_score1 D [0]
-dpa_min_score2 D [0]
-dpa_keep_tmpfile FL [0] 0
-dpa_debug D [0] 0
-multi_core S [0] templates_jobs_relax_msa_evaluate
-n_core D [0] 0
-max_n_proc D [0] 0
-lib_list S [0]
-prune_lib_mode S [0] 5
-tip S [0] none
-rna_lib S [0]
-no_warning D [0] 0
-run_local_script D [0] 0
-plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alngins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
gins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 9 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 28 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 28 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [2016]
Library Relaxation: Multi_proc [72]
Relaxation Summary: [2016]--->[2016]
UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1
OUTPUT RESULTS
#### File Type= MSA Format= score_ascii Name= input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.score_ascii
#### File Type= MSA Format= html Name= input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.html
#### File Type= MSA Format= score_ascii Name= input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.score_ascii
# Command Line: t_coffee_ADOPS -infile /opt/ADOPS/383/SclA-PC/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.420 Mb, Max= 30.501 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:04 - Revision 1613 - Build 427)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/
>C1
MSEARNLFTTFGILAILLFFLYLIYAVL
>C2
MSEARNLFTTFGILAILLFFLYLIYAVL
>C3
MSEARNLFTTFGILAILLFFLYLIYAVL
>C4
MSEARNLFTTFGILAILLFFLYLIYAVL
>C5
MSEARNLFTTFGILAILLFFLYLIYAVL
>C6
MSEARNLFTTFGILAILLFFLYLIYAVL
>C7
MSEARNLFTTFGILAILLFFLYLIYAVL
>C8
MSEAQNLFTTFGILAILLFFLYLIYAVL
>C9
MSEARNLFTTFGILAILLFFLYLIYAVL
FORMAT of file /tmp/tmp3711667401071660840aln Not Supported[FATAL:T-COFFEE]
>C1
MSEARNLFTTFGILAILLFFLYLIYAVL
>C2
MSEARNLFTTFGILAILLFFLYLIYAVL
>C3
MSEARNLFTTFGILAILLFFLYLIYAVL
>C4
MSEARNLFTTFGILAILLFFLYLIYAVL
>C5
MSEARNLFTTFGILAILLFFLYLIYAVL
>C6
MSEARNLFTTFGILAILLFFLYLIYAVL
>C7
MSEARNLFTTFGILAILLFFLYLIYAVL
>C8
MSEAQNLFTTFGILAILLFFLYLIYAVL
>C9
MSEARNLFTTFGILAILLFFLYLIYAVL
input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln I:28 S:100 BS:28
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# SEQ_INDEX C7 6
# SEQ_INDEX C8 7
# SEQ_INDEX C9 8
# PW_SEQ_DISTANCES
BOT 0 1 100.00 C1 C2 100.00
TOP 1 0 100.00 C2 C1 100.00
BOT 0 2 100.00 C1 C3 100.00
TOP 2 0 100.00 C3 C1 100.00
BOT 0 3 100.00 C1 C4 100.00
TOP 3 0 100.00 C4 C1 100.00
BOT 0 4 100.00 C1 C5 100.00
TOP 4 0 100.00 C5 C1 100.00
BOT 0 5 100.00 C1 C6 100.00
TOP 5 0 100.00 C6 C1 100.00
BOT 0 6 100.00 C1 C7 100.00
TOP 6 0 100.00 C7 C1 100.00
BOT 0 7 96.43 C1 C8 96.43
TOP 7 0 96.43 C8 C1 96.43
BOT 0 8 100.00 C1 C9 100.00
TOP 8 0 100.00 C9 C1 100.00
BOT 1 2 100.00 C2 C3 100.00
TOP 2 1 100.00 C3 C2 100.00
BOT 1 3 100.00 C2 C4 100.00
TOP 3 1 100.00 C4 C2 100.00
BOT 1 4 100.00 C2 C5 100.00
TOP 4 1 100.00 C5 C2 100.00
BOT 1 5 100.00 C2 C6 100.00
TOP 5 1 100.00 C6 C2 100.00
BOT 1 6 100.00 C2 C7 100.00
TOP 6 1 100.00 C7 C2 100.00
BOT 1 7 96.43 C2 C8 96.43
TOP 7 1 96.43 C8 C2 96.43
BOT 1 8 100.00 C2 C9 100.00
TOP 8 1 100.00 C9 C2 100.00
BOT 2 3 100.00 C3 C4 100.00
TOP 3 2 100.00 C4 C3 100.00
BOT 2 4 100.00 C3 C5 100.00
TOP 4 2 100.00 C5 C3 100.00
BOT 2 5 100.00 C3 C6 100.00
TOP 5 2 100.00 C6 C3 100.00
BOT 2 6 100.00 C3 C7 100.00
TOP 6 2 100.00 C7 C3 100.00
BOT 2 7 96.43 C3 C8 96.43
TOP 7 2 96.43 C8 C3 96.43
BOT 2 8 100.00 C3 C9 100.00
TOP 8 2 100.00 C9 C3 100.00
BOT 3 4 100.00 C4 C5 100.00
TOP 4 3 100.00 C5 C4 100.00
BOT 3 5 100.00 C4 C6 100.00
TOP 5 3 100.00 C6 C4 100.00
BOT 3 6 100.00 C4 C7 100.00
TOP 6 3 100.00 C7 C4 100.00
BOT 3 7 96.43 C4 C8 96.43
TOP 7 3 96.43 C8 C4 96.43
BOT 3 8 100.00 C4 C9 100.00
TOP 8 3 100.00 C9 C4 100.00
BOT 4 5 100.00 C5 C6 100.00
TOP 5 4 100.00 C6 C5 100.00
BOT 4 6 100.00 C5 C7 100.00
TOP 6 4 100.00 C7 C5 100.00
BOT 4 7 96.43 C5 C8 96.43
TOP 7 4 96.43 C8 C5 96.43
BOT 4 8 100.00 C5 C9 100.00
TOP 8 4 100.00 C9 C5 100.00
BOT 5 6 100.00 C6 C7 100.00
TOP 6 5 100.00 C7 C6 100.00
BOT 5 7 96.43 C6 C8 96.43
TOP 7 5 96.43 C8 C6 96.43
BOT 5 8 100.00 C6 C9 100.00
TOP 8 5 100.00 C9 C6 100.00
BOT 6 7 96.43 C7 C8 96.43
TOP 7 6 96.43 C8 C7 96.43
BOT 6 8 100.00 C7 C9 100.00
TOP 8 6 100.00 C9 C7 100.00
BOT 7 8 96.43 C8 C9 96.43
TOP 8 7 96.43 C9 C8 96.43
AVG 0 C1 * 99.55
AVG 1 C2 * 99.55
AVG 2 C3 * 99.55
AVG 3 C4 * 99.55
AVG 4 C5 * 99.55
AVG 5 C6 * 99.55
AVG 6 C7 * 99.55
AVG 7 C8 * 96.43
AVG 8 C9 * 99.55
TOT TOT * 99.21
CLUSTAL W (1.83) multiple sequence alignment
C1 ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
C2 ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATTCT
C3 ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
C4 ATGAGCGAAGCCCGTAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
C5 ATGAGCGAAGCCCGTAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
C6 ATGAGCGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTTGCCATCCT
C7 ATGAGTGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTGGCCATCCT
C8 ATGAGTGAAGCCCAGAACCTTTTCACCACCTTCGGCATCCTGGCCATCCT
C9 ATGAGCGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTGGCCATCCT
***** *******. *** * *********** ******** ***** **
C1 GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG
C2 GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG
C3 GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG
C4 GCTTTTCTTCCTTTACCTCATCTATGCCGTATTG
C5 GCTTTTCTTCCTTTACCTCATCTATGCCGTATTG
C6 GCTTTTCTTCCTTTACCTCATCTATGCCGTCTTG
C7 GCTGTTCTTCCTTTACCTCATCTATGCCGTCTTG
C8 TCTTTTCTTCCTTTACCTCATCTATGCCGTCTTG
C9 GCTTTTCTTCCTTTACCTCATCTACGCCGTCTTG
** ******** *********** *****.***
>C1
ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG
>C2
ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATTCT
GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG
>C3
ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG
>C4
ATGAGCGAAGCCCGTAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
GCTTTTCTTCCTTTACCTCATCTATGCCGTATTG
>C5
ATGAGCGAAGCCCGTAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT
GCTTTTCTTCCTTTACCTCATCTATGCCGTATTG
>C6
ATGAGCGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTTGCCATCCT
GCTTTTCTTCCTTTACCTCATCTATGCCGTCTTG
>C7
ATGAGTGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTGGCCATCCT
GCTGTTCTTCCTTTACCTCATCTATGCCGTCTTG
>C8
ATGAGTGAAGCCCAGAACCTTTTCACCACCTTCGGCATCCTGGCCATCCT
TCTTTTCTTCCTTTACCTCATCTATGCCGTCTTG
>C9
ATGAGCGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTGGCCATCCT
GCTTTTCTTCCTTTACCTCATCTACGCCGTCTTG
>C1
MSEARNLFTTFGILAILLFFLYLIYAVL
>C2
MSEARNLFTTFGILAILLFFLYLIYAVL
>C3
MSEARNLFTTFGILAILLFFLYLIYAVL
>C4
MSEARNLFTTFGILAILLFFLYLIYAVL
>C5
MSEARNLFTTFGILAILLFFLYLIYAVL
>C6
MSEARNLFTTFGILAILLFFLYLIYAVL
>C7
MSEARNLFTTFGILAILLFFLYLIYAVL
>C8
MSEAQNLFTTFGILAILLFFLYLIYAVL
>C9
MSEARNLFTTFGILAILLFFLYLIYAVL
MrBayes v3.2.2 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 9 taxa and 84 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Taxon 5 -> C5
Taxon 6 -> C6
Taxon 7 -> C7
Taxon 8 -> C8
Taxon 9 -> C9
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1481019000
Setting output file names to "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called first_pos
Defining charset called second_pos
Defining charset called third_pos
Defining partition called by_codon
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1837412298
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 0467114160
Seed = 573199192
Swapseed = 1481019000
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Active parameters:
Partition(s)
Parameters 1 2 3
------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:Exponential(10.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.06 % Dirichlet(Revmat{all})
1.06 % Slider(Revmat{all})
1.06 % Dirichlet(Pi{all})
1.06 % Slider(Pi{all})
2.13 % Multiplier(Alpha{1,2})
2.13 % Multiplier(Alpha{3})
2.13 % Slider(Pinvar{all})
10.64 % ExtSPR(Tau{all},V{all})
10.64 % ExtTBR(Tau{all},V{all})
10.64 % NNI(Tau{all},V{all})
10.64 % ParsSPR(Tau{all},V{all})
31.91 % Multiplier(V{all})
10.64 % Nodeslider(V{all})
4.26 % TLMultiplier(V{all})
Division 1 has 5 unique site patterns
Division 2 has 5 unique site patterns
Division 3 has 13 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -302.513739 -- -24.309708
Chain 2 -- -321.022698 -- -24.309708
Chain 3 -- -322.072132 -- -24.309708
Chain 4 -- -321.225138 -- -24.309708
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -321.580658 -- -24.309708
Chain 2 -- -312.682271 -- -24.309708
Chain 3 -- -315.504530 -- -24.309708
Chain 4 -- -319.895766 -- -24.309708
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-302.514] (-321.023) (-322.072) (-321.225) * [-321.581] (-312.682) (-315.505) (-319.896)
500 -- [-201.577] (-204.400) (-211.763) (-216.543) * (-204.116) (-208.070) [-206.784] (-203.653) -- 0:00:00
1000 -- (-201.517) [-206.105] (-202.121) (-211.570) * (-200.489) [-206.629] (-201.100) (-210.653) -- 0:16:39
1500 -- [-201.115] (-208.214) (-215.058) (-214.581) * (-202.127) [-202.819] (-204.587) (-208.456) -- 0:11:05
2000 -- (-199.805) [-210.502] (-209.899) (-204.117) * [-207.349] (-202.895) (-209.354) (-201.914) -- 0:08:19
2500 -- [-202.279] (-210.872) (-199.770) (-211.445) * [-209.660] (-210.603) (-203.195) (-199.992) -- 0:06:39
3000 -- [-205.040] (-199.356) (-202.062) (-208.938) * (-214.258) [-205.855] (-207.698) (-204.625) -- 0:05:32
3500 -- (-202.442) (-200.305) [-195.762] (-214.480) * (-215.173) (-204.832) (-198.465) [-202.375] -- 0:04:44
4000 -- (-201.651) [-201.919] (-199.937) (-207.354) * (-215.514) (-204.715) [-202.582] (-200.344) -- 0:04:09
4500 -- [-203.435] (-200.726) (-202.676) (-203.220) * (-204.480) [-202.265] (-202.445) (-199.267) -- 0:03:41
5000 -- (-206.351) (-201.815) [-200.253] (-203.758) * [-206.573] (-203.594) (-205.559) (-201.602) -- 0:03:19
Average standard deviation of split frequencies: 0.082309
5500 -- (-201.353) (-211.472) [-199.884] (-202.186) * [-205.139] (-209.199) (-203.935) (-192.715) -- 0:03:00
6000 -- (-201.384) (-210.843) [-196.459] (-205.067) * [-198.391] (-210.050) (-196.500) (-212.575) -- 0:02:45
6500 -- (-197.768) [-213.344] (-210.434) (-202.082) * [-200.977] (-201.007) (-202.513) (-197.669) -- 0:02:32
7000 -- (-209.765) (-204.068) [-206.194] (-198.740) * (-204.760) [-195.678] (-200.576) (-198.853) -- 0:02:21
7500 -- (-207.882) (-209.555) [-197.892] (-200.414) * (-211.621) [-195.983] (-208.881) (-201.738) -- 0:02:12
8000 -- (-203.840) (-205.445) [-197.786] (-200.467) * (-202.248) [-199.904] (-207.897) (-197.217) -- 0:04:08
8500 -- (-202.067) (-202.156) (-203.781) [-201.917] * [-211.309] (-203.698) (-195.377) (-195.262) -- 0:03:53
9000 -- (-215.374) (-206.527) (-204.306) [-202.292] * (-202.272) [-196.833] (-200.277) (-201.585) -- 0:03:40
9500 -- (-210.039) (-213.904) (-209.970) [-197.130] * (-207.762) [-201.534] (-200.891) (-204.670) -- 0:03:28
10000 -- (-199.774) (-211.943) [-200.498] (-200.839) * (-208.734) [-199.087] (-199.653) (-201.257) -- 0:03:18
Average standard deviation of split frequencies: 0.074578
10500 -- [-206.370] (-207.131) (-206.319) (-198.919) * [-206.946] (-198.366) (-204.968) (-198.239) -- 0:03:08
11000 -- (-209.556) (-208.571) [-207.090] (-212.501) * (-202.036) [-196.496] (-207.778) (-198.998) -- 0:02:59
11500 -- (-200.926) (-216.722) (-197.540) [-197.138] * (-202.226) [-197.518] (-205.533) (-197.779) -- 0:02:51
12000 -- (-200.135) (-219.639) [-193.570] (-208.619) * (-195.649) (-201.407) (-212.884) [-204.204] -- 0:02:44
12500 -- (-202.042) (-204.884) [-195.152] (-207.503) * (-191.979) (-195.668) (-201.695) [-200.624] -- 0:02:38
13000 -- (-200.718) (-203.116) [-199.105] (-206.663) * [-200.776] (-209.186) (-206.642) (-209.508) -- 0:02:31
13500 -- (-197.482) (-211.472) [-193.221] (-209.794) * [-196.359] (-202.884) (-203.036) (-206.058) -- 0:02:26
14000 -- (-202.489) (-208.592) [-200.679] (-209.045) * (-204.862) (-208.480) (-201.311) [-200.721] -- 0:02:20
14500 -- (-201.708) (-208.324) [-195.625] (-209.120) * (-206.647) [-206.498] (-196.074) (-204.439) -- 0:02:15
15000 -- [-202.233] (-198.926) (-196.447) (-210.503) * (-206.240) (-209.836) (-203.016) [-204.843] -- 0:02:11
Average standard deviation of split frequencies: 0.058926
15500 -- (-204.712) [-193.414] (-198.263) (-203.316) * (-212.314) [-202.996] (-197.214) (-200.907) -- 0:03:10
16000 -- (-199.952) (-194.693) (-194.620) [-201.551] * [-196.696] (-204.946) (-206.154) (-206.067) -- 0:03:04
16500 -- [-204.783] (-204.748) (-201.634) (-212.091) * [-204.400] (-206.636) (-210.457) (-203.884) -- 0:02:58
17000 -- (-201.666) (-197.399) [-198.403] (-203.723) * (-207.334) [-202.633] (-198.464) (-200.606) -- 0:02:53
17500 -- (-199.305) [-199.194] (-196.950) (-203.664) * (-201.113) (-203.807) [-204.141] (-206.737) -- 0:02:48
18000 -- (-200.327) [-194.058] (-201.037) (-199.242) * (-205.133) (-203.291) [-201.576] (-209.544) -- 0:02:43
18500 -- (-202.903) (-197.944) [-195.818] (-196.919) * (-204.175) (-207.406) [-205.608] (-212.906) -- 0:02:39
19000 -- (-197.023) (-205.257) [-202.060] (-202.858) * (-198.275) [-198.825] (-210.175) (-209.239) -- 0:02:34
19500 -- [-194.402] (-199.166) (-204.824) (-201.498) * (-211.430) [-201.902] (-203.353) (-205.612) -- 0:02:30
20000 -- [-194.523] (-197.091) (-214.443) (-209.419) * (-211.817) (-202.664) [-195.022] (-202.913) -- 0:02:27
Average standard deviation of split frequencies: 0.039537
20500 -- (-198.985) (-206.647) [-195.263] (-196.877) * (-209.735) (-196.270) (-204.210) [-203.950] -- 0:02:23
21000 -- [-194.503] (-200.698) (-209.747) (-198.881) * [-202.250] (-206.290) (-211.127) (-205.669) -- 0:02:19
21500 -- (-202.388) [-196.622] (-213.850) (-199.878) * (-215.050) [-200.771] (-196.318) (-205.460) -- 0:02:16
22000 -- [-193.980] (-206.294) (-201.590) (-203.306) * (-203.029) [-200.350] (-198.667) (-202.960) -- 0:02:13
22500 -- [-199.335] (-202.986) (-203.167) (-209.390) * (-214.496) (-199.803) [-195.681] (-200.518) -- 0:02:53
23000 -- (-208.031) (-203.990) [-198.382] (-200.626) * (-215.856) [-198.953] (-203.747) (-199.310) -- 0:02:49
23500 -- (-205.871) (-207.615) [-203.421] (-207.418) * (-211.687) [-197.106] (-206.329) (-199.003) -- 0:02:46
24000 -- (-205.225) [-201.984] (-206.702) (-196.930) * [-208.685] (-206.303) (-199.180) (-209.143) -- 0:02:42
24500 -- (-198.571) [-197.488] (-204.333) (-197.524) * (-210.005) [-197.791] (-203.795) (-207.536) -- 0:02:39
25000 -- (-204.191) [-204.068] (-209.273) (-199.496) * (-215.367) (-199.989) [-196.990] (-205.322) -- 0:02:36
Average standard deviation of split frequencies: 0.028330
25500 -- [-196.967] (-197.821) (-207.078) (-203.271) * (-213.835) (-195.628) [-197.952] (-200.381) -- 0:02:32
26000 -- (-202.099) (-201.763) (-207.764) [-202.073] * (-206.711) [-196.321] (-202.668) (-208.642) -- 0:02:29
26500 -- (-202.789) (-200.215) [-202.012] (-206.307) * (-208.765) (-196.621) [-196.078] (-202.196) -- 0:02:26
27000 -- (-202.262) (-201.523) (-208.340) [-197.597] * (-198.928) (-207.537) (-196.509) [-209.900] -- 0:02:24
27500 -- [-199.012] (-204.938) (-204.984) (-208.862) * [-204.029] (-206.146) (-198.568) (-213.480) -- 0:02:21
28000 -- (-198.979) (-199.362) (-204.385) [-199.447] * (-206.393) (-199.520) [-195.457] (-212.281) -- 0:02:18
28500 -- (-204.310) [-201.061] (-199.677) (-207.038) * (-208.152) (-198.492) (-196.014) [-198.631] -- 0:02:16
29000 -- (-204.143) (-197.103) (-201.208) [-196.003] * (-205.812) (-201.574) (-204.509) [-202.339] -- 0:02:13
29500 -- (-199.863) (-194.749) [-202.725] (-201.027) * (-207.108) (-204.675) (-194.359) [-196.232] -- 0:02:44
30000 -- (-196.779) (-201.116) (-205.356) [-199.552] * (-205.711) (-205.721) [-199.860] (-200.312) -- 0:02:41
Average standard deviation of split frequencies: 0.039786
30500 -- (-198.015) (-201.918) [-203.713] (-205.925) * (-201.923) (-200.940) (-201.924) [-194.837] -- 0:02:38
31000 -- [-209.446] (-195.166) (-206.598) (-205.398) * (-212.327) [-194.942] (-199.878) (-202.673) -- 0:02:36
31500 -- (-203.538) (-208.931) [-210.614] (-213.581) * (-209.279) (-195.344) [-195.138] (-200.913) -- 0:02:33
32000 -- (-210.105) (-199.667) [-202.103] (-204.852) * [-203.582] (-201.076) (-215.394) (-203.804) -- 0:02:31
32500 -- (-196.943) (-210.298) [-203.101] (-199.252) * (-215.541) (-202.558) (-198.471) [-192.316] -- 0:02:28
33000 -- (-199.792) [-207.636] (-207.683) (-210.053) * (-215.402) [-203.134] (-206.083) (-201.010) -- 0:02:26
33500 -- [-197.585] (-202.041) (-203.088) (-198.797) * (-211.847) (-202.280) [-194.260] (-203.564) -- 0:02:24
34000 -- (-197.227) (-207.919) (-195.408) [-193.649] * (-212.387) (-202.886) [-197.836] (-201.334) -- 0:02:22
34500 -- (-203.064) [-201.530] (-202.944) (-198.641) * (-210.733) (-209.515) [-195.107] (-198.494) -- 0:02:19
35000 -- (-202.238) (-201.580) (-204.170) [-198.795] * (-209.847) [-195.622] (-204.279) (-208.287) -- 0:02:17
Average standard deviation of split frequencies: 0.031281
35500 -- (-205.820) [-198.697] (-206.816) (-205.750) * (-201.367) [-198.513] (-205.852) (-211.465) -- 0:02:15
36000 -- (-200.425) [-199.990] (-210.377) (-205.201) * (-201.336) [-202.361] (-199.041) (-201.547) -- 0:02:13
36500 -- (-198.987) (-208.494) (-209.888) [-202.173] * (-204.505) (-205.283) [-201.148] (-202.971) -- 0:02:38
37000 -- (-199.244) (-210.637) [-207.939] (-208.674) * (-203.561) [-200.632] (-202.117) (-196.732) -- 0:02:36
37500 -- [-199.784] (-207.914) (-209.074) (-202.099) * (-199.794) [-204.639] (-199.947) (-194.020) -- 0:02:34
38000 -- (-202.872) [-200.561] (-203.824) (-200.500) * (-206.577) [-195.184] (-199.917) (-200.051) -- 0:02:31
38500 -- (-200.577) (-197.863) [-205.569] (-198.502) * (-215.518) (-200.543) (-197.743) [-199.587] -- 0:02:29
39000 -- (-205.677) [-200.612] (-206.170) (-206.791) * (-212.879) [-197.320] (-196.997) (-201.021) -- 0:02:27
39500 -- (-204.091) [-207.589] (-204.871) (-204.184) * [-206.512] (-201.811) (-202.143) (-210.168) -- 0:02:25
40000 -- (-200.836) [-204.146] (-196.675) (-211.290) * (-210.520) (-206.706) (-200.178) [-197.218] -- 0:02:24
Average standard deviation of split frequencies: 0.032844
40500 -- (-202.477) (-207.726) (-206.788) [-203.284] * [-195.093] (-205.942) (-222.976) (-200.493) -- 0:02:22
41000 -- (-201.155) (-201.749) [-203.333] (-206.287) * (-209.552) (-205.916) [-202.552] (-206.452) -- 0:02:20
41500 -- [-199.323] (-211.221) (-204.810) (-203.566) * (-209.245) [-205.083] (-201.718) (-199.562) -- 0:02:18
42000 -- (-205.283) (-214.049) (-206.046) [-202.666] * (-201.706) (-200.695) [-198.217] (-198.319) -- 0:02:16
42500 -- [-197.734] (-205.047) (-196.207) (-207.174) * (-208.093) [-198.123] (-201.550) (-207.868) -- 0:02:15
43000 -- (-208.858) (-204.730) (-202.095) [-200.752] * [-206.794] (-196.793) (-204.416) (-211.612) -- 0:02:13
43500 -- (-205.585) (-202.373) (-201.686) [-204.568] * (-198.510) (-202.122) (-203.137) [-200.940] -- 0:02:33
44000 -- [-200.581] (-206.973) (-203.198) (-194.838) * (-207.287) (-204.379) (-205.444) [-206.476] -- 0:02:32
44500 -- (-209.722) (-202.740) [-197.551] (-193.813) * (-208.029) (-197.262) (-205.209) [-197.703] -- 0:02:30
45000 -- (-208.981) (-200.730) [-207.868] (-196.808) * (-209.001) (-210.335) (-202.085) [-203.603] -- 0:02:28
Average standard deviation of split frequencies: 0.034729
45500 -- (-211.814) [-203.576] (-199.039) (-206.457) * (-207.754) (-205.404) (-201.579) [-203.627] -- 0:02:26
46000 -- (-205.000) (-207.377) (-211.546) [-197.823] * (-210.567) [-205.069] (-199.675) (-201.641) -- 0:02:25
46500 -- [-208.596] (-205.070) (-215.247) (-205.065) * (-204.555) (-207.124) (-197.899) [-202.273] -- 0:02:23
47000 -- [-203.216] (-213.946) (-206.618) (-196.098) * (-207.362) (-202.865) [-206.532] (-204.748) -- 0:02:21
47500 -- [-198.279] (-207.417) (-200.815) (-204.661) * (-211.500) [-196.984] (-201.871) (-204.393) -- 0:02:20
48000 -- (-203.855) [-201.297] (-210.835) (-200.416) * (-206.453) (-198.417) [-197.196] (-204.063) -- 0:02:18
48500 -- (-201.836) (-201.330) (-198.907) [-197.745] * (-210.483) (-202.290) [-196.087] (-205.367) -- 0:02:17
49000 -- (-202.010) (-200.103) (-218.979) [-198.279] * (-199.581) (-202.768) [-196.651] (-212.745) -- 0:02:15
49500 -- (-201.073) [-198.035] (-205.137) (-200.388) * (-204.448) (-211.158) [-198.864] (-196.203) -- 0:02:14
50000 -- (-204.214) [-201.064] (-200.330) (-197.459) * (-207.889) (-207.703) (-202.067) [-208.408] -- 0:02:13
Average standard deviation of split frequencies: 0.030497
50500 -- (-194.930) (-200.933) (-201.957) [-201.606] * (-204.436) (-208.537) (-196.113) [-202.591] -- 0:02:11
51000 -- (-209.738) [-201.491] (-200.033) (-208.954) * (-199.116) (-210.881) [-204.904] (-203.163) -- 0:02:28
51500 -- (-202.680) [-202.135] (-198.887) (-214.694) * (-203.713) (-199.787) [-203.466] (-204.199) -- 0:02:27
52000 -- [-200.419] (-200.255) (-208.540) (-204.896) * [-195.773] (-205.186) (-192.943) (-206.956) -- 0:02:25
52500 -- (-201.083) (-198.422) (-205.174) [-200.735] * [-198.723] (-205.269) (-201.744) (-210.032) -- 0:02:24
53000 -- (-205.768) (-200.908) [-197.077] (-197.155) * (-202.229) (-201.145) (-200.034) [-207.743] -- 0:02:22
53500 -- [-196.744] (-203.985) (-205.419) (-214.672) * [-201.631] (-211.130) (-198.983) (-198.828) -- 0:02:21
54000 -- [-197.483] (-196.961) (-200.998) (-206.582) * (-201.878) (-208.754) [-194.436] (-201.714) -- 0:02:20
54500 -- (-198.099) (-202.127) [-197.665] (-212.874) * [-200.041] (-211.144) (-202.295) (-202.702) -- 0:02:18
55000 -- (-204.605) (-207.177) [-197.165] (-214.405) * (-204.261) (-211.853) [-196.689] (-195.690) -- 0:02:17
Average standard deviation of split frequencies: 0.026189
55500 -- (-206.508) [-209.457] (-193.413) (-206.032) * [-198.487] (-198.600) (-211.344) (-203.312) -- 0:02:16
56000 -- [-205.541] (-202.392) (-197.868) (-212.802) * (-199.758) (-207.387) [-196.579] (-206.195) -- 0:02:14
56500 -- (-204.316) [-202.934] (-201.536) (-209.123) * (-205.259) [-200.493] (-198.876) (-202.575) -- 0:02:13
57000 -- (-207.339) [-195.894] (-200.047) (-209.661) * [-210.690] (-205.326) (-191.258) (-203.957) -- 0:02:12
57500 -- (-210.781) (-200.418) [-196.085] (-206.800) * [-204.070] (-207.549) (-198.415) (-209.938) -- 0:02:11
58000 -- [-200.917] (-204.803) (-198.196) (-207.788) * (-201.525) [-206.634] (-198.682) (-204.059) -- 0:02:09
58500 -- (-201.427) [-204.975] (-207.356) (-203.500) * (-198.286) (-201.981) [-195.454] (-209.723) -- 0:02:24
59000 -- (-204.448) (-199.173) [-195.431] (-208.283) * [-195.298] (-204.695) (-206.821) (-206.143) -- 0:02:23
59500 -- (-200.306) (-203.197) [-201.389] (-205.228) * (-199.003) [-202.345] (-197.058) (-205.971) -- 0:02:22
60000 -- [-200.943] (-198.514) (-203.950) (-204.161) * (-201.724) (-201.249) (-207.263) [-192.037] -- 0:02:21
Average standard deviation of split frequencies: 0.027196
60500 -- (-199.027) (-209.631) (-202.173) [-196.819] * (-206.782) (-200.604) [-200.431] (-196.884) -- 0:02:19
61000 -- (-203.254) [-196.938] (-201.361) (-195.919) * [-196.462] (-193.747) (-201.422) (-217.392) -- 0:02:18
61500 -- (-209.154) (-199.519) (-202.204) [-197.708] * [-197.953] (-198.332) (-211.564) (-201.841) -- 0:02:17
62000 -- (-197.211) [-196.026] (-214.489) (-206.517) * [-193.213] (-198.088) (-203.781) (-198.596) -- 0:02:16
62500 -- (-203.435) (-212.790) [-204.181] (-196.902) * [-196.743] (-201.996) (-198.258) (-203.341) -- 0:02:15
63000 -- (-193.263) (-204.431) (-204.528) [-197.837] * (-207.164) (-204.094) [-196.028] (-198.137) -- 0:02:13
63500 -- (-196.349) (-204.917) [-198.343] (-204.861) * (-197.697) [-207.543] (-195.994) (-202.745) -- 0:02:12
64000 -- (-211.042) [-195.072] (-200.625) (-199.016) * (-196.958) [-197.953] (-205.120) (-210.257) -- 0:02:11
64500 -- (-195.982) (-202.587) [-195.036] (-205.095) * (-198.447) (-207.669) [-198.085] (-210.797) -- 0:02:10
65000 -- [-199.837] (-208.984) (-202.323) (-206.076) * [-200.203] (-194.180) (-205.002) (-202.397) -- 0:02:23
Average standard deviation of split frequencies: 0.032141
65500 -- [-193.780] (-208.548) (-206.580) (-202.405) * (-199.728) (-209.727) [-196.206] (-202.734) -- 0:02:22
66000 -- (-204.481) (-202.035) (-196.744) [-197.571] * (-201.492) (-203.614) [-201.288] (-204.215) -- 0:02:21
66500 -- [-198.552] (-208.197) (-205.709) (-200.482) * [-199.373] (-197.430) (-198.559) (-196.040) -- 0:02:20
67000 -- (-195.748) (-203.396) (-200.260) [-203.787] * [-201.215] (-198.354) (-203.829) (-199.832) -- 0:02:19
67500 -- (-200.811) [-206.940] (-196.920) (-201.917) * (-202.569) [-199.505] (-206.084) (-203.571) -- 0:02:18
68000 -- (-204.101) [-203.830] (-198.365) (-200.631) * (-198.646) [-200.539] (-204.416) (-202.277) -- 0:02:17
68500 -- (-203.266) (-200.216) (-205.931) [-197.978] * (-206.185) [-198.777] (-206.727) (-203.211) -- 0:02:15
69000 -- [-203.470] (-201.667) (-208.349) (-201.288) * (-199.813) (-205.739) [-212.829] (-207.628) -- 0:02:14
69500 -- (-202.601) [-203.006] (-202.061) (-207.723) * (-197.460) [-203.763] (-212.179) (-209.183) -- 0:02:13
70000 -- [-193.748] (-204.190) (-208.688) (-202.404) * (-202.733) (-204.365) (-204.880) [-204.110] -- 0:02:12
Average standard deviation of split frequencies: 0.033354
70500 -- (-207.116) (-202.510) [-198.917] (-198.671) * (-201.810) [-198.810] (-218.947) (-205.024) -- 0:02:11
71000 -- (-206.186) (-201.061) (-197.411) [-199.415] * (-206.244) (-212.729) (-212.780) [-204.482] -- 0:02:10
71500 -- (-197.172) (-200.831) (-196.460) [-203.998] * [-203.219] (-196.155) (-205.507) (-198.851) -- 0:02:09
72000 -- (-203.912) (-203.818) [-198.052] (-204.206) * (-201.255) [-201.141] (-201.272) (-194.282) -- 0:02:08
72500 -- (-205.551) (-207.095) [-198.398] (-206.306) * (-205.109) [-202.704] (-200.831) (-205.166) -- 0:02:20
73000 -- (-201.277) (-206.646) [-200.902] (-197.161) * (-197.947) (-202.884) [-202.106] (-199.692) -- 0:02:19
73500 -- [-211.792] (-201.025) (-201.139) (-209.249) * (-201.505) [-198.055] (-204.756) (-201.356) -- 0:02:18
74000 -- (-204.715) (-204.259) [-198.422] (-206.094) * (-217.152) [-204.169] (-197.097) (-196.088) -- 0:02:17
74500 -- (-205.923) (-207.106) [-198.374] (-194.001) * [-197.914] (-205.990) (-202.942) (-198.371) -- 0:02:16
75000 -- (-204.800) (-205.268) (-206.415) [-190.472] * (-196.525) [-204.754] (-203.592) (-192.893) -- 0:02:15
Average standard deviation of split frequencies: 0.034115
75500 -- (-202.704) (-208.896) (-204.633) [-194.447] * (-203.197) (-198.083) [-200.231] (-208.063) -- 0:02:14
76000 -- (-201.388) [-206.886] (-203.191) (-199.887) * (-202.588) (-202.645) [-193.328] (-201.579) -- 0:02:13
76500 -- (-210.681) [-207.505] (-198.686) (-195.261) * (-212.926) (-204.265) (-198.710) [-193.741] -- 0:02:12
77000 -- (-204.171) (-205.002) (-201.048) [-191.973] * (-209.353) (-211.356) [-200.779] (-200.577) -- 0:02:11
77500 -- (-206.583) (-203.514) [-202.520] (-200.169) * (-204.096) (-195.576) (-200.446) [-200.945] -- 0:02:10
78000 -- (-216.823) [-195.400] (-200.550) (-198.457) * (-204.357) (-200.943) [-198.523] (-202.785) -- 0:02:10
78500 -- (-205.578) (-196.846) (-204.975) [-197.449] * (-206.963) (-200.799) (-199.699) [-205.929] -- 0:02:09
79000 -- (-198.575) (-205.904) [-204.765] (-197.685) * (-206.496) [-198.523] (-200.961) (-206.915) -- 0:02:08
79500 -- [-194.796] (-199.718) (-198.255) (-201.374) * (-207.547) [-195.105] (-215.338) (-202.034) -- 0:02:18
80000 -- (-206.856) [-198.415] (-194.782) (-198.982) * (-201.295) [-199.898] (-204.616) (-202.230) -- 0:02:18
Average standard deviation of split frequencies: 0.033115
80500 -- [-195.593] (-202.657) (-199.365) (-194.943) * (-204.698) (-206.262) [-209.267] (-207.160) -- 0:02:17
81000 -- (-197.913) [-199.070] (-208.849) (-198.849) * (-212.197) (-198.406) [-208.326] (-200.141) -- 0:02:16
81500 -- (-197.115) (-205.757) (-204.956) [-202.515] * [-207.778] (-201.957) (-200.791) (-199.843) -- 0:02:15
82000 -- (-200.087) [-196.160] (-210.618) (-207.227) * (-207.232) (-211.859) [-204.608] (-211.794) -- 0:02:14
82500 -- [-200.643] (-200.230) (-204.368) (-202.478) * (-207.210) (-203.389) [-205.704] (-202.127) -- 0:02:13
83000 -- (-195.270) (-196.098) [-194.585] (-200.233) * (-203.571) (-211.192) (-211.992) [-204.233] -- 0:02:12
83500 -- (-194.726) [-195.871] (-204.090) (-204.868) * (-204.989) (-205.506) (-209.451) [-196.484] -- 0:02:11
84000 -- [-193.211] (-201.713) (-201.729) (-209.927) * (-206.068) (-198.002) (-209.970) [-197.040] -- 0:02:10
84500 -- (-195.812) (-205.874) [-199.651] (-199.893) * (-204.217) (-210.422) (-205.384) [-196.691] -- 0:02:10
85000 -- [-203.768] (-205.799) (-199.216) (-198.544) * (-208.521) [-194.227] (-200.155) (-207.325) -- 0:02:09
Average standard deviation of split frequencies: 0.029234
85500 -- [-201.510] (-200.698) (-207.293) (-200.564) * (-199.825) [-200.770] (-202.132) (-207.867) -- 0:02:08
86000 -- (-202.373) (-198.655) [-198.545] (-206.585) * [-204.871] (-202.577) (-216.967) (-206.888) -- 0:02:07
86500 -- (-193.684) (-211.058) [-199.286] (-205.931) * (-209.676) (-198.602) [-206.260] (-204.811) -- 0:02:06
87000 -- [-201.813] (-201.146) (-197.277) (-204.045) * (-203.288) (-197.259) [-205.809] (-200.312) -- 0:02:16
87500 -- (-193.391) (-203.109) (-197.667) [-203.844] * [-196.411] (-201.550) (-203.447) (-206.278) -- 0:02:15
88000 -- [-194.839] (-197.066) (-212.388) (-197.320) * (-200.515) [-198.789] (-203.856) (-205.379) -- 0:02:14
88500 -- (-212.238) (-201.911) (-209.412) [-194.599] * (-204.994) (-207.510) (-206.179) [-194.212] -- 0:02:13
89000 -- (-202.021) (-210.845) (-200.759) [-196.846] * [-198.304] (-202.505) (-200.681) (-199.832) -- 0:02:13
89500 -- (-202.154) [-201.296] (-206.978) (-197.403) * (-199.386) (-203.709) [-194.179] (-205.540) -- 0:02:12
90000 -- (-205.926) (-194.362) (-200.310) [-199.816] * (-205.143) (-203.867) [-196.573] (-202.032) -- 0:02:11
Average standard deviation of split frequencies: 0.030907
90500 -- (-198.902) (-195.132) (-206.098) [-202.840] * (-198.538) [-197.606] (-196.442) (-204.771) -- 0:02:10
91000 -- (-200.857) [-197.420] (-198.342) (-203.709) * (-203.131) (-205.941) [-191.150] (-199.045) -- 0:02:09
91500 -- (-200.907) (-193.912) [-196.476] (-198.595) * (-208.180) (-204.059) [-205.705] (-203.408) -- 0:02:09
92000 -- (-205.132) (-203.083) (-205.940) [-197.863] * (-198.873) (-203.991) [-203.544] (-200.114) -- 0:02:08
92500 -- (-200.250) [-193.712] (-200.718) (-213.454) * [-198.657] (-204.780) (-208.440) (-194.518) -- 0:02:07
93000 -- [-199.357] (-191.800) (-206.478) (-198.908) * (-203.548) (-201.027) [-195.813] (-201.913) -- 0:02:06
93500 -- (-195.943) [-196.399] (-203.047) (-207.105) * (-201.292) (-204.124) [-199.147] (-201.377) -- 0:02:06
94000 -- [-195.279] (-204.542) (-205.899) (-211.049) * [-198.308] (-206.707) (-203.538) (-202.415) -- 0:02:05
94500 -- (-196.527) (-206.302) (-201.469) [-198.568] * (-212.960) (-207.334) [-199.516] (-202.410) -- 0:02:14
95000 -- (-195.808) (-209.624) (-210.927) [-199.839] * [-199.341] (-201.731) (-196.461) (-203.052) -- 0:02:13
Average standard deviation of split frequencies: 0.030554
95500 -- (-199.090) (-199.104) [-196.504] (-208.863) * (-204.310) (-205.060) (-201.795) [-206.922] -- 0:02:12
96000 -- [-196.923] (-201.331) (-205.950) (-207.763) * (-205.743) (-201.775) [-196.206] (-199.973) -- 0:02:11
96500 -- (-201.745) [-200.430] (-205.981) (-201.614) * [-199.486] (-201.368) (-206.226) (-197.035) -- 0:02:11
97000 -- [-201.953] (-206.397) (-215.045) (-200.346) * (-198.798) (-211.557) [-199.667] (-199.916) -- 0:02:10
97500 -- (-203.044) (-208.479) (-202.763) [-200.940] * [-201.151] (-203.185) (-202.772) (-200.286) -- 0:02:09
98000 -- (-207.131) [-200.772] (-198.590) (-209.323) * [-201.125] (-203.144) (-200.147) (-204.943) -- 0:02:08
98500 -- (-207.272) (-208.830) [-202.269] (-209.217) * (-202.912) (-198.299) (-212.824) [-202.546] -- 0:02:08
99000 -- (-205.830) (-205.449) (-200.684) [-198.260] * (-197.104) (-200.786) (-198.127) [-194.575] -- 0:02:07
99500 -- (-209.467) (-204.448) [-201.902] (-197.208) * [-200.195] (-207.666) (-199.937) (-198.051) -- 0:02:06
100000 -- (-205.474) (-208.724) [-201.229] (-210.562) * (-202.446) [-200.021] (-203.674) (-203.561) -- 0:02:05
Average standard deviation of split frequencies: 0.028357
100500 -- (-206.494) (-206.834) [-203.829] (-204.746) * (-202.079) (-200.832) [-203.378] (-203.341) -- 0:02:05
101000 -- (-199.046) [-202.649] (-202.439) (-203.711) * (-206.380) (-212.626) (-200.495) [-196.640] -- 0:02:04
101500 -- (-208.141) [-206.458] (-202.976) (-202.682) * (-202.298) [-196.318] (-203.187) (-202.224) -- 0:02:12
102000 -- (-205.589) (-197.409) (-200.582) [-198.831] * [-198.890] (-206.155) (-198.704) (-202.695) -- 0:02:12
102500 -- (-202.385) (-204.720) (-204.074) [-196.647] * [-196.558] (-199.238) (-198.579) (-198.790) -- 0:02:11
103000 -- [-204.118] (-199.683) (-203.177) (-207.963) * [-199.610] (-208.892) (-198.540) (-197.245) -- 0:02:10
103500 -- (-198.990) (-206.309) (-206.904) [-193.006] * (-191.580) [-205.772] (-198.721) (-211.600) -- 0:02:09
104000 -- (-200.213) (-197.893) (-201.143) [-192.386] * (-206.776) (-203.011) (-209.044) [-199.441] -- 0:02:09
104500 -- (-207.393) (-200.513) (-205.139) [-202.598] * (-203.761) [-201.843] (-205.736) (-209.394) -- 0:02:08
105000 -- (-207.856) [-202.252] (-210.246) (-202.038) * (-203.162) (-200.255) [-204.402] (-214.664) -- 0:02:07
Average standard deviation of split frequencies: 0.029154
105500 -- (-204.368) (-200.486) [-201.730] (-199.836) * (-195.909) [-201.267] (-204.772) (-209.087) -- 0:02:07
106000 -- (-201.835) [-194.988] (-217.010) (-202.769) * (-203.283) [-200.473] (-204.886) (-197.010) -- 0:02:06
106500 -- [-193.554] (-201.203) (-205.572) (-200.542) * (-207.973) (-203.475) (-209.450) [-201.319] -- 0:02:05
107000 -- [-197.958] (-201.069) (-204.918) (-209.937) * (-205.797) (-197.874) [-191.686] (-206.690) -- 0:02:05
107500 -- (-213.781) (-201.363) (-208.588) [-195.836] * (-212.000) [-202.734] (-203.435) (-195.909) -- 0:02:04
108000 -- (-213.905) [-191.769] (-209.223) (-195.091) * [-199.901] (-204.858) (-205.493) (-202.855) -- 0:02:03
108500 -- (-202.895) (-196.108) [-196.696] (-199.547) * [-196.829] (-202.103) (-201.916) (-208.538) -- 0:02:03
109000 -- (-201.875) (-200.342) [-200.303] (-195.917) * [-201.140] (-199.320) (-200.555) (-200.658) -- 0:02:10
109500 -- (-198.594) [-204.899] (-199.376) (-200.699) * (-195.344) (-199.914) (-202.808) [-195.178] -- 0:02:10
110000 -- (-208.275) (-205.333) [-199.347] (-197.659) * (-203.528) (-212.204) (-204.672) [-197.360] -- 0:02:09
Average standard deviation of split frequencies: 0.023192
110500 -- (-208.921) (-204.213) (-197.551) [-205.939] * [-198.078] (-207.280) (-202.105) (-201.505) -- 0:02:08
111000 -- (-202.903) (-204.072) (-199.709) [-193.643] * (-211.181) (-198.638) (-206.775) [-198.164] -- 0:02:08
111500 -- (-196.809) (-203.024) (-205.300) [-198.541] * (-199.451) [-204.277] (-196.668) (-202.346) -- 0:02:07
112000 -- (-200.937) (-204.497) [-194.619] (-196.476) * (-205.589) (-212.797) [-200.814] (-207.738) -- 0:02:06
112500 -- [-195.026] (-213.545) (-197.152) (-196.723) * [-194.549] (-209.673) (-196.334) (-205.155) -- 0:02:06
113000 -- (-195.589) (-202.071) [-195.000] (-203.296) * (-204.020) (-209.129) (-204.813) [-198.682] -- 0:02:05
113500 -- (-199.602) [-204.529] (-193.254) (-204.325) * (-205.007) (-211.458) (-201.445) [-195.479] -- 0:02:04
114000 -- (-200.353) (-210.683) (-207.185) [-200.762] * (-193.966) (-207.975) [-199.581] (-201.622) -- 0:02:04
114500 -- (-202.936) (-213.558) [-196.258] (-204.939) * (-199.726) (-212.096) (-200.511) [-194.922] -- 0:02:03
115000 -- (-208.267) (-206.313) [-200.359] (-198.464) * [-196.272] (-202.595) (-206.526) (-198.288) -- 0:02:03
Average standard deviation of split frequencies: 0.023706
115500 -- (-202.595) (-209.025) [-212.511] (-207.931) * (-211.253) (-203.798) [-198.811] (-209.254) -- 0:02:02
116000 -- (-210.646) [-196.201] (-206.498) (-206.163) * (-198.182) [-201.007] (-202.268) (-202.126) -- 0:02:09
116500 -- [-200.470] (-202.099) (-207.130) (-205.361) * [-207.524] (-207.714) (-212.517) (-202.487) -- 0:02:08
117000 -- [-201.535] (-200.004) (-199.690) (-202.520) * (-200.470) [-207.934] (-218.730) (-202.059) -- 0:02:08
117500 -- (-211.226) (-195.747) [-200.655] (-195.504) * (-203.644) (-214.266) [-195.979] (-193.681) -- 0:02:07
118000 -- (-216.283) [-197.201] (-207.918) (-201.096) * (-208.505) [-209.242] (-201.822) (-203.844) -- 0:02:07
118500 -- [-200.853] (-199.653) (-203.194) (-196.988) * [-201.064] (-211.980) (-202.797) (-194.989) -- 0:02:06
119000 -- (-199.033) (-204.236) [-206.847] (-205.908) * (-211.402) (-210.362) [-210.131] (-194.624) -- 0:02:05
119500 -- [-205.775] (-207.030) (-207.422) (-201.921) * (-202.538) [-203.660] (-217.167) (-190.183) -- 0:02:05
120000 -- (-207.301) (-201.388) [-199.990] (-207.616) * (-213.959) (-202.932) [-199.344] (-202.338) -- 0:02:04
Average standard deviation of split frequencies: 0.019316
120500 -- (-199.009) (-200.440) [-201.453] (-206.327) * (-201.495) (-211.215) (-198.447) [-193.331] -- 0:02:04
121000 -- (-204.401) (-201.060) (-210.035) [-207.847] * (-197.385) (-205.584) (-202.271) [-198.674] -- 0:02:03
121500 -- (-200.556) [-201.645] (-205.634) (-208.872) * (-205.944) (-202.447) [-202.395] (-206.449) -- 0:02:02
122000 -- [-205.476] (-199.784) (-212.413) (-209.333) * (-204.838) (-200.656) (-201.879) [-199.311] -- 0:02:02
122500 -- (-202.116) [-200.651] (-206.577) (-210.148) * (-201.198) (-212.298) (-198.597) [-199.294] -- 0:02:01
123000 -- [-204.533] (-200.566) (-204.819) (-203.201) * (-210.584) [-201.214] (-217.193) (-202.100) -- 0:02:01
123500 -- (-204.220) (-199.123) (-206.689) [-200.102] * (-202.761) [-198.561] (-214.322) (-197.532) -- 0:02:07
124000 -- [-198.837] (-197.728) (-207.752) (-200.638) * (-209.300) (-205.412) (-207.181) [-199.302] -- 0:02:07
124500 -- [-201.217] (-206.257) (-212.877) (-197.394) * (-218.187) (-203.862) [-199.239] (-205.155) -- 0:02:06
125000 -- (-201.790) [-196.886] (-201.026) (-201.911) * (-212.259) (-208.495) (-205.913) [-197.021] -- 0:02:06
Average standard deviation of split frequencies: 0.019330
125500 -- [-194.880] (-195.201) (-205.193) (-202.390) * (-211.374) (-208.421) [-206.452] (-202.020) -- 0:02:05
126000 -- (-203.307) [-197.679] (-206.358) (-196.414) * (-218.355) (-212.277) [-195.420] (-196.383) -- 0:02:04
126500 -- (-202.553) (-203.569) [-202.065] (-201.400) * (-207.363) (-203.064) (-207.451) [-204.546] -- 0:02:04
127000 -- (-198.736) (-206.326) (-199.509) [-198.512] * [-198.632] (-202.091) (-194.116) (-204.876) -- 0:02:03
127500 -- (-211.555) (-206.712) [-196.870] (-196.391) * (-211.223) (-196.829) [-197.353] (-205.081) -- 0:02:03
128000 -- (-206.470) (-198.074) [-199.710] (-200.816) * (-204.387) [-200.044] (-206.275) (-197.005) -- 0:02:02
128500 -- (-201.264) (-202.366) [-203.036] (-215.824) * [-206.020] (-198.215) (-203.083) (-200.517) -- 0:02:02
129000 -- (-201.807) (-200.367) [-203.927] (-206.071) * (-211.351) (-197.148) (-215.070) [-201.321] -- 0:02:01
129500 -- (-207.826) [-198.313] (-205.869) (-201.619) * (-215.736) [-201.479] (-202.724) (-198.642) -- 0:02:00
130000 -- [-202.556] (-207.054) (-204.357) (-200.724) * [-212.696] (-197.531) (-209.057) (-196.519) -- 0:02:00
Average standard deviation of split frequencies: 0.017036
130500 -- (-209.521) [-205.187] (-198.338) (-200.313) * (-207.195) (-203.835) [-200.036] (-201.792) -- 0:02:06
131000 -- (-200.927) (-199.858) (-205.070) [-198.587] * (-215.343) (-199.811) [-198.760] (-203.720) -- 0:02:06
131500 -- (-215.269) (-194.190) [-193.458] (-199.530) * (-204.396) (-205.336) [-200.596] (-213.177) -- 0:02:05
132000 -- (-203.650) [-197.742] (-198.250) (-193.486) * (-208.620) [-202.793] (-203.972) (-203.315) -- 0:02:04
132500 -- (-195.715) (-198.787) [-198.923] (-208.943) * (-207.193) (-201.862) [-196.897] (-204.514) -- 0:02:04
133000 -- (-213.735) (-197.162) [-194.932] (-209.174) * (-207.726) [-200.575] (-198.731) (-205.307) -- 0:02:03
133500 -- (-205.275) [-193.795] (-199.752) (-200.517) * (-205.720) [-203.511] (-208.401) (-199.299) -- 0:02:03
134000 -- (-196.359) [-197.553] (-194.688) (-200.059) * (-200.028) (-200.621) (-202.225) [-199.921] -- 0:02:02
134500 -- [-200.058] (-208.353) (-204.627) (-198.198) * (-201.055) (-204.430) [-199.048] (-202.847) -- 0:02:02
135000 -- (-199.236) (-206.893) [-196.911] (-205.974) * (-209.698) (-199.372) [-199.662] (-199.863) -- 0:02:01
Average standard deviation of split frequencies: 0.017524
135500 -- [-194.781] (-207.684) (-200.614) (-208.593) * (-199.802) (-204.081) (-195.583) [-195.826] -- 0:02:01
136000 -- (-203.972) [-206.076] (-198.492) (-208.251) * (-204.594) (-202.386) [-196.704] (-203.251) -- 0:02:00
136500 -- [-200.181] (-205.213) (-205.985) (-197.559) * (-209.874) (-207.318) [-203.383] (-200.821) -- 0:02:00
137000 -- (-205.383) (-196.977) (-199.396) [-207.782] * (-205.471) (-209.521) [-202.043] (-207.412) -- 0:01:59
137500 -- [-199.292] (-200.736) (-199.020) (-209.570) * [-208.357] (-206.615) (-203.192) (-207.637) -- 0:01:59
138000 -- [-206.962] (-202.704) (-194.638) (-206.222) * (-203.659) (-204.934) [-202.211] (-203.252) -- 0:02:04
138500 -- [-200.449] (-196.604) (-205.663) (-202.335) * (-207.348) [-206.724] (-202.446) (-197.970) -- 0:02:04
139000 -- [-202.436] (-212.884) (-200.955) (-200.238) * (-203.733) [-199.629] (-203.201) (-204.714) -- 0:02:03
139500 -- (-207.167) (-223.698) [-195.084] (-196.304) * (-216.777) (-196.007) (-206.113) [-199.052] -- 0:02:03
140000 -- (-204.632) (-216.940) (-193.855) [-205.628] * (-200.398) [-193.244] (-197.408) (-209.377) -- 0:02:02
Average standard deviation of split frequencies: 0.018136
140500 -- (-204.540) (-222.114) (-201.371) [-197.011] * (-199.784) (-198.630) (-199.021) [-204.435] -- 0:02:02
141000 -- (-205.007) (-208.896) (-192.109) [-202.888] * (-210.552) [-209.173] (-205.330) (-208.351) -- 0:02:01
141500 -- (-207.587) (-203.397) [-195.257] (-206.723) * (-214.961) (-218.064) (-214.983) [-202.634] -- 0:02:01
142000 -- (-211.215) (-204.547) [-195.392] (-201.732) * (-212.976) [-196.928] (-202.474) (-200.927) -- 0:02:00
142500 -- (-206.941) (-202.885) [-192.919] (-198.761) * (-207.721) (-204.473) [-202.592] (-196.921) -- 0:02:00
143000 -- (-211.838) (-194.091) [-195.151] (-203.068) * (-202.574) (-199.931) (-209.816) [-202.272] -- 0:01:59
143500 -- (-197.143) (-201.909) (-201.254) [-199.347] * [-207.185] (-203.460) (-204.023) (-203.846) -- 0:01:59
144000 -- (-198.278) (-195.643) [-199.713] (-200.008) * (-204.243) (-198.246) (-203.106) [-210.791] -- 0:01:58
144500 -- (-201.322) (-194.585) [-201.326] (-203.868) * (-208.576) (-194.487) [-196.534] (-207.104) -- 0:01:58
145000 -- (-196.510) (-196.892) [-198.218] (-216.582) * (-212.070) (-191.555) (-201.313) [-197.471] -- 0:01:57
Average standard deviation of split frequencies: 0.018423
145500 -- [-199.094] (-202.543) (-200.491) (-202.799) * [-208.940] (-200.588) (-210.938) (-202.588) -- 0:02:03
146000 -- [-198.153] (-198.630) (-205.901) (-197.265) * (-199.741) (-193.194) [-203.633] (-205.109) -- 0:02:02
146500 -- [-209.747] (-199.077) (-205.002) (-207.146) * [-202.119] (-200.586) (-210.093) (-202.212) -- 0:02:02
147000 -- (-197.433) (-197.089) (-212.433) [-197.331] * (-196.916) (-199.205) (-197.814) [-202.324] -- 0:02:01
147500 -- (-197.039) (-195.133) (-209.903) [-203.213] * (-203.316) [-187.894] (-193.768) (-207.126) -- 0:02:01
148000 -- (-216.311) (-199.692) (-208.266) [-197.238] * (-202.538) [-193.535] (-203.869) (-205.301) -- 0:02:00
148500 -- (-205.249) (-202.124) [-206.563] (-206.966) * (-206.101) (-201.546) (-206.917) [-202.267] -- 0:02:00
149000 -- [-195.114] (-203.055) (-204.760) (-205.464) * (-203.079) [-195.985] (-204.257) (-211.789) -- 0:01:59
149500 -- [-197.161] (-205.753) (-202.434) (-210.338) * [-201.226] (-197.597) (-205.957) (-205.039) -- 0:01:59
150000 -- (-198.940) [-193.601] (-207.642) (-202.421) * (-209.421) [-199.321] (-202.376) (-206.311) -- 0:01:58
Average standard deviation of split frequencies: 0.017116
150500 -- (-200.937) (-193.059) (-194.500) [-207.871] * (-202.940) [-196.148] (-205.247) (-205.212) -- 0:01:58
151000 -- [-198.410] (-207.656) (-201.266) (-208.395) * (-208.919) (-200.858) [-199.421] (-209.522) -- 0:02:03
151500 -- [-198.308] (-200.432) (-199.710) (-214.455) * (-208.902) (-201.273) [-200.697] (-208.161) -- 0:02:03
152000 -- (-200.962) [-204.242] (-198.405) (-208.285) * (-206.137) (-204.743) [-197.895] (-205.730) -- 0:02:02
152500 -- (-199.319) [-207.225] (-201.619) (-211.874) * [-197.933] (-204.596) (-193.626) (-207.753) -- 0:02:02
153000 -- (-194.329) (-201.099) [-195.576] (-207.694) * (-205.937) (-205.861) [-200.447] (-208.165) -- 0:02:01
153500 -- (-195.612) [-198.195] (-197.179) (-217.808) * (-208.529) [-201.047] (-199.875) (-206.014) -- 0:02:01
154000 -- (-198.509) (-198.503) [-191.599] (-201.540) * [-203.365] (-205.242) (-212.829) (-203.195) -- 0:02:00
154500 -- [-197.039] (-201.820) (-200.853) (-208.203) * [-200.152] (-207.190) (-200.147) (-220.770) -- 0:02:00
155000 -- (-198.562) (-207.424) (-197.601) [-198.570] * [-200.199] (-207.441) (-208.396) (-204.860) -- 0:01:59
Average standard deviation of split frequencies: 0.017598
155500 -- (-198.741) (-214.605) [-201.680] (-202.858) * (-202.890) (-201.317) [-202.259] (-207.680) -- 0:01:59
156000 -- (-204.708) [-201.841] (-202.176) (-205.938) * (-208.823) (-215.797) [-197.865] (-208.186) -- 0:01:59
156500 -- (-209.794) (-200.574) (-197.886) [-199.699] * [-207.679] (-206.593) (-197.161) (-213.289) -- 0:02:03
157000 -- (-208.799) (-195.971) (-197.552) [-204.337] * (-198.030) (-206.265) [-199.002] (-203.893) -- 0:02:03
157500 -- [-198.290] (-203.698) (-204.559) (-216.524) * (-197.677) (-210.535) [-198.827] (-210.176) -- 0:02:03
158000 -- (-204.537) (-204.263) [-203.330] (-205.483) * (-201.739) (-201.614) [-196.279] (-200.750) -- 0:02:02
158500 -- (-209.152) (-207.558) [-196.323] (-199.372) * (-196.815) (-199.970) [-191.785] (-208.582) -- 0:02:02
159000 -- (-195.012) (-207.873) (-208.970) [-197.487] * (-195.797) (-200.785) [-198.540] (-206.995) -- 0:02:01
159500 -- (-209.066) (-204.698) (-200.171) [-206.085] * (-199.167) (-210.746) (-196.591) [-198.490] -- 0:02:01
160000 -- (-209.443) (-211.518) [-201.095] (-207.732) * [-201.664] (-202.531) (-200.686) (-202.409) -- 0:02:00
Average standard deviation of split frequencies: 0.018093
160500 -- (-198.457) (-203.466) (-200.717) [-199.654] * (-200.370) (-201.027) [-201.811] (-202.622) -- 0:02:00
161000 -- (-204.985) (-201.776) (-200.533) [-199.475] * (-200.150) [-191.984] (-207.940) (-203.119) -- 0:01:59
161500 -- [-199.309] (-201.847) (-204.704) (-198.448) * (-195.649) [-195.053] (-212.809) (-206.847) -- 0:02:04
162000 -- (-211.676) (-207.241) (-202.097) [-198.164] * (-196.583) (-197.774) [-201.318] (-211.742) -- 0:02:04
162500 -- (-208.289) (-209.103) (-197.861) [-199.501] * [-196.513] (-210.202) (-206.062) (-198.984) -- 0:02:03
163000 -- (-222.279) (-210.382) (-203.661) [-197.114] * (-198.780) [-198.659] (-199.470) (-207.515) -- 0:02:03
163500 -- (-201.387) [-205.509] (-197.489) (-199.783) * [-200.714] (-201.117) (-209.018) (-204.424) -- 0:02:02
164000 -- (-202.544) (-212.396) [-204.381] (-201.430) * (-205.559) [-193.694] (-205.051) (-207.293) -- 0:02:02
164500 -- [-200.911] (-208.206) (-206.349) (-200.765) * (-203.991) [-197.930] (-194.518) (-214.683) -- 0:02:01
165000 -- (-200.545) (-198.181) [-197.974] (-207.261) * (-198.677) (-204.499) [-201.349] (-207.787) -- 0:02:01
Average standard deviation of split frequencies: 0.014514
165500 -- [-203.489] (-205.895) (-198.125) (-206.990) * (-196.839) [-199.046] (-208.383) (-206.325) -- 0:02:01
166000 -- (-202.996) (-206.309) [-196.352] (-204.526) * (-196.859) (-201.434) (-205.436) [-205.319] -- 0:02:00
166500 -- (-205.679) (-201.127) [-192.306] (-208.123) * [-202.203] (-205.743) (-204.145) (-205.206) -- 0:02:00
167000 -- (-199.967) (-200.605) [-205.244] (-210.764) * [-193.838] (-201.558) (-215.071) (-206.328) -- 0:01:59
167500 -- [-201.031] (-214.888) (-196.881) (-216.001) * (-201.340) (-212.267) [-196.185] (-215.500) -- 0:01:59
168000 -- (-212.989) (-209.778) [-192.509] (-207.523) * [-191.577] (-207.396) (-196.344) (-198.791) -- 0:01:58
168500 -- (-211.219) (-209.106) [-203.449] (-207.184) * [-200.503] (-204.180) (-198.108) (-203.093) -- 0:02:03
169000 -- [-195.760] (-207.165) (-194.381) (-213.361) * (-204.053) [-201.632] (-207.679) (-199.076) -- 0:02:02
169500 -- (-213.704) [-199.664] (-199.647) (-199.969) * (-206.456) (-198.208) (-204.958) [-196.004] -- 0:02:02
170000 -- (-203.968) (-205.828) (-198.474) [-197.776] * (-216.093) (-201.036) [-210.240] (-202.771) -- 0:02:02
Average standard deviation of split frequencies: 0.013350
170500 -- (-208.123) (-213.219) [-203.922] (-200.977) * (-203.987) (-197.380) (-209.873) [-200.949] -- 0:02:01
171000 -- (-211.389) [-206.134] (-198.448) (-200.752) * [-191.286] (-205.680) (-204.967) (-211.080) -- 0:02:01
171500 -- (-206.160) (-198.420) [-197.837] (-210.943) * (-209.001) (-199.182) [-200.890] (-207.949) -- 0:02:00
172000 -- [-209.322] (-199.069) (-200.758) (-206.066) * (-210.863) [-195.608] (-206.048) (-201.635) -- 0:02:00
172500 -- (-204.004) [-204.860] (-199.965) (-212.973) * (-195.965) (-203.603) (-207.197) [-200.686] -- 0:01:59
173000 -- (-202.371) (-205.171) (-199.250) [-203.301] * (-197.392) (-202.150) (-198.419) [-200.791] -- 0:01:59
173500 -- (-206.019) (-209.523) (-212.742) [-207.174] * (-208.917) [-200.411] (-196.034) (-199.378) -- 0:01:59
174000 -- [-199.119] (-200.318) (-207.398) (-208.340) * (-199.114) (-202.990) [-195.611] (-203.491) -- 0:02:03
174500 -- (-202.483) [-202.497] (-202.642) (-210.011) * [-205.279] (-203.705) (-197.965) (-210.208) -- 0:02:02
175000 -- (-206.727) (-200.061) [-196.418] (-208.501) * (-202.483) (-197.761) [-207.092] (-212.049) -- 0:02:02
Average standard deviation of split frequencies: 0.014338
175500 -- (-205.888) (-209.904) (-196.982) [-202.779] * (-200.145) (-200.217) [-205.814] (-203.556) -- 0:02:02
176000 -- (-206.781) (-202.949) [-203.415] (-210.065) * (-197.669) (-199.718) [-196.508] (-206.201) -- 0:02:01
176500 -- (-210.261) (-197.994) [-194.884] (-211.465) * (-208.810) (-193.118) [-203.367] (-209.480) -- 0:02:01
177000 -- (-206.692) (-199.525) (-210.222) [-208.290] * [-196.673] (-207.803) (-201.564) (-212.239) -- 0:02:00
177500 -- (-197.724) [-199.842] (-200.435) (-200.355) * (-203.064) [-192.956] (-202.527) (-201.504) -- 0:02:00
178000 -- (-200.035) [-196.887] (-201.975) (-205.184) * (-198.228) (-201.293) [-196.808] (-207.597) -- 0:02:00
178500 -- (-204.635) [-199.585] (-201.360) (-206.046) * [-200.947] (-203.862) (-197.453) (-220.292) -- 0:01:59
179000 -- [-204.365] (-206.542) (-202.782) (-206.961) * [-202.502] (-201.404) (-202.741) (-212.629) -- 0:01:59
179500 -- (-205.093) [-204.159] (-204.950) (-206.572) * [-198.814] (-208.018) (-208.987) (-205.810) -- 0:01:58
180000 -- (-203.488) (-206.094) (-201.559) [-204.019] * [-200.074] (-205.366) (-205.492) (-201.845) -- 0:01:58
Average standard deviation of split frequencies: 0.015809
180500 -- (-208.023) [-205.497] (-212.318) (-207.194) * (-202.494) (-202.830) [-202.255] (-200.375) -- 0:02:02
181000 -- (-209.283) (-201.519) [-201.797] (-198.188) * (-198.651) (-202.709) [-198.394] (-206.232) -- 0:02:02
181500 -- (-206.188) (-204.421) (-206.428) [-193.351] * [-200.727] (-212.992) (-198.153) (-203.863) -- 0:02:01
182000 -- (-206.903) (-208.123) (-201.835) [-200.127] * [-197.844] (-205.226) (-207.223) (-200.671) -- 0:02:01
182500 -- (-202.614) (-206.001) [-202.157] (-197.779) * (-199.357) (-209.358) (-204.531) [-196.197] -- 0:02:00
183000 -- [-206.331] (-201.848) (-204.779) (-201.488) * (-203.620) [-207.271] (-212.184) (-195.596) -- 0:02:00
183500 -- (-200.327) [-197.040] (-201.607) (-198.435) * (-196.890) (-210.021) (-201.510) [-202.770] -- 0:02:00
184000 -- (-208.786) (-197.207) (-210.419) [-200.052] * (-201.398) (-203.789) (-202.052) [-200.451] -- 0:01:59
184500 -- (-205.890) [-203.047] (-200.659) (-194.586) * (-205.103) (-208.286) [-198.215] (-206.187) -- 0:01:59
185000 -- (-204.000) (-207.567) (-207.431) [-199.590] * (-200.705) (-207.032) (-210.101) [-200.839] -- 0:01:58
Average standard deviation of split frequencies: 0.015654
185500 -- (-200.895) [-197.550] (-208.909) (-197.632) * (-213.728) (-207.335) (-199.699) [-197.801] -- 0:01:58
186000 -- (-199.374) (-199.782) (-202.161) [-204.696] * (-211.035) [-203.166] (-199.084) (-205.967) -- 0:01:58
186500 -- (-209.663) (-203.520) [-203.136] (-204.272) * (-208.918) (-197.398) [-200.430] (-209.682) -- 0:01:57
187000 -- (-205.171) [-198.185] (-203.328) (-196.070) * (-202.859) [-200.112] (-201.478) (-201.146) -- 0:01:57
187500 -- [-198.945] (-214.173) (-203.123) (-204.234) * (-210.214) [-196.687] (-204.076) (-200.216) -- 0:02:01
188000 -- [-204.372] (-200.151) (-205.455) (-206.022) * [-200.135] (-206.032) (-206.869) (-202.085) -- 0:02:00
188500 -- [-197.725] (-201.877) (-204.117) (-205.847) * (-204.882) (-205.463) (-203.473) [-201.715] -- 0:02:00
189000 -- (-199.605) [-194.922] (-211.724) (-210.615) * (-199.855) (-212.438) [-199.720] (-206.269) -- 0:02:00
189500 -- (-206.660) (-199.627) (-210.088) [-203.336] * (-211.838) [-204.934] (-206.222) (-209.152) -- 0:01:59
190000 -- [-199.082] (-200.174) (-212.550) (-205.339) * [-202.298] (-201.563) (-198.317) (-205.996) -- 0:01:59
Average standard deviation of split frequencies: 0.014834
190500 -- [-209.770] (-203.588) (-219.937) (-203.850) * (-200.597) [-201.084] (-207.856) (-207.623) -- 0:01:58
191000 -- (-203.656) (-209.432) (-210.395) [-196.514] * [-197.395] (-208.343) (-215.675) (-194.875) -- 0:01:58
191500 -- (-200.455) (-205.115) (-203.054) [-201.095] * (-207.872) (-203.514) (-201.395) [-197.378] -- 0:01:58
192000 -- [-204.102] (-207.461) (-199.866) (-197.802) * (-198.472) (-209.025) (-202.448) [-200.722] -- 0:01:57
192500 -- (-203.301) (-208.290) (-206.301) [-199.005] * (-198.444) (-202.399) (-208.223) [-198.393] -- 0:01:57
193000 -- (-202.315) (-205.968) (-199.807) [-204.309] * [-197.525] (-200.215) (-197.506) (-206.477) -- 0:01:57
193500 -- [-198.168] (-202.534) (-202.724) (-199.582) * (-204.157) (-204.524) (-201.389) [-211.974] -- 0:01:56
194000 -- (-199.577) (-212.516) (-199.003) [-197.787] * (-204.616) (-200.976) (-201.786) [-202.952] -- 0:01:56
194500 -- (-209.682) (-196.435) (-207.015) [-195.389] * (-206.545) [-196.335] (-206.556) (-199.997) -- 0:02:00
195000 -- (-202.791) (-206.134) (-204.024) [-202.304] * [-197.866] (-206.517) (-206.039) (-200.579) -- 0:01:59
Average standard deviation of split frequencies: 0.015280
195500 -- [-205.170] (-206.887) (-210.901) (-203.974) * (-202.027) (-205.812) (-199.168) [-205.862] -- 0:01:59
196000 -- [-202.041] (-200.435) (-208.145) (-197.871) * (-208.111) (-194.828) (-197.346) [-202.512] -- 0:01:58
196500 -- (-202.669) [-207.329] (-212.590) (-197.424) * (-197.485) [-199.662] (-207.439) (-209.851) -- 0:01:58
197000 -- (-197.887) (-207.314) (-213.007) [-196.129] * (-202.385) (-200.038) (-203.069) [-200.907] -- 0:01:58
197500 -- (-204.512) [-199.079] (-207.781) (-201.292) * (-203.704) (-201.138) (-206.259) [-207.326] -- 0:01:57
198000 -- (-206.100) (-213.303) (-200.405) [-204.559] * [-197.195] (-196.705) (-199.663) (-208.158) -- 0:01:57
198500 -- (-201.360) (-207.190) (-200.331) [-203.780] * [-201.387] (-202.665) (-197.815) (-200.200) -- 0:01:57
199000 -- [-196.528] (-205.016) (-206.195) (-200.734) * (-206.725) (-202.988) [-199.833] (-211.438) -- 0:01:56
199500 -- (-195.890) (-213.843) (-202.472) [-206.660] * [-210.222] (-202.798) (-199.374) (-200.501) -- 0:01:56
200000 -- (-203.528) (-200.047) [-203.198] (-208.020) * (-209.509) (-199.774) [-199.306] (-200.336) -- 0:01:59
Average standard deviation of split frequencies: 0.014356
200500 -- (-192.421) (-209.088) [-205.528] (-204.896) * (-210.421) (-202.089) [-198.502] (-203.398) -- 0:01:59
201000 -- (-199.484) (-206.093) (-201.843) [-211.370] * (-218.100) [-199.715] (-205.498) (-198.193) -- 0:01:59
201500 -- (-198.396) [-204.147] (-200.082) (-210.112) * (-197.966) (-196.862) (-200.224) [-197.174] -- 0:01:58
202000 -- (-202.174) [-204.864] (-200.730) (-208.067) * (-198.947) (-201.981) (-207.631) [-194.222] -- 0:01:58
202500 -- (-199.161) (-202.132) [-197.601] (-209.821) * (-205.385) [-209.512] (-206.392) (-208.749) -- 0:01:58
203000 -- [-203.757] (-211.458) (-203.668) (-198.519) * (-197.809) (-212.055) [-199.379] (-206.968) -- 0:01:57
203500 -- [-203.686] (-207.338) (-206.503) (-208.959) * (-199.768) (-198.342) (-200.756) [-210.429] -- 0:01:57
204000 -- (-198.418) (-216.079) [-197.060] (-202.103) * (-210.241) (-193.867) (-204.747) [-203.038] -- 0:01:57
204500 -- (-205.678) (-205.536) [-197.323] (-201.801) * (-205.565) (-207.993) (-206.163) [-203.755] -- 0:01:56
205000 -- (-207.016) (-198.822) [-203.580] (-200.195) * (-200.675) (-204.336) [-199.155] (-207.824) -- 0:01:56
Average standard deviation of split frequencies: 0.013476
205500 -- (-205.049) (-204.298) [-200.969] (-195.383) * (-206.285) (-201.341) (-202.375) [-208.752] -- 0:01:55
206000 -- (-203.034) (-204.370) [-203.287] (-204.909) * (-208.003) [-198.701] (-199.836) (-212.068) -- 0:01:55
206500 -- (-203.585) (-200.333) [-199.109] (-203.586) * [-201.498] (-200.193) (-197.954) (-202.979) -- 0:01:59
207000 -- (-195.869) [-204.438] (-209.222) (-204.998) * (-209.898) (-195.603) [-199.885] (-203.726) -- 0:01:58
207500 -- (-215.901) (-198.018) [-200.380] (-213.171) * [-200.901] (-205.874) (-197.606) (-202.626) -- 0:01:58
208000 -- (-209.618) (-208.685) [-195.910] (-207.233) * (-201.313) (-204.309) (-199.509) [-199.638] -- 0:01:58
208500 -- (-201.466) [-201.797] (-205.388) (-207.848) * (-205.249) (-209.891) [-199.731] (-201.284) -- 0:01:57
209000 -- (-196.568) [-199.897] (-213.308) (-208.389) * (-208.043) (-201.763) [-197.670] (-199.106) -- 0:01:57
209500 -- (-204.644) [-200.265] (-217.161) (-199.458) * [-197.493] (-211.156) (-203.497) (-207.581) -- 0:01:56
210000 -- (-201.699) (-204.110) (-211.781) [-193.497] * (-199.633) (-204.650) [-195.743] (-197.137) -- 0:01:56
Average standard deviation of split frequencies: 0.014421
210500 -- (-200.526) [-195.956] (-204.527) (-206.547) * (-206.042) (-213.268) (-202.172) [-194.928] -- 0:01:56
211000 -- (-204.496) (-200.561) (-205.265) [-199.262] * [-197.907] (-194.852) (-196.029) (-209.087) -- 0:01:55
211500 -- (-202.551) (-207.723) [-197.722] (-195.635) * (-217.556) [-195.377] (-201.908) (-208.709) -- 0:01:55
212000 -- (-211.219) [-203.955] (-207.875) (-207.450) * (-198.802) (-203.006) (-199.452) [-199.909] -- 0:01:58
212500 -- (-198.482) (-212.281) [-203.279] (-209.445) * (-202.599) (-209.484) (-201.958) [-202.394] -- 0:01:58
213000 -- (-203.072) (-204.330) (-211.332) [-197.214] * [-193.372] (-201.922) (-195.699) (-198.054) -- 0:01:58
213500 -- (-198.005) (-211.545) (-203.889) [-197.083] * (-210.709) (-200.649) (-205.734) [-199.475] -- 0:01:57
214000 -- [-196.613] (-204.056) (-207.034) (-195.937) * (-209.463) [-200.668] (-206.739) (-200.286) -- 0:01:57
214500 -- (-198.016) (-200.126) (-201.930) [-201.123] * (-202.052) (-207.170) (-199.887) [-192.882] -- 0:01:57
215000 -- (-192.768) (-211.514) [-202.973] (-202.431) * (-199.281) (-201.543) (-212.495) [-193.550] -- 0:01:56
Average standard deviation of split frequencies: 0.014913
215500 -- (-198.355) (-205.493) (-208.835) [-201.117] * (-199.164) (-205.094) (-200.218) [-195.814] -- 0:01:56
216000 -- (-206.223) (-205.636) (-201.165) [-199.130] * (-206.231) (-210.339) (-205.334) [-193.259] -- 0:01:56
216500 -- (-202.399) [-194.444] (-205.858) (-198.173) * (-205.640) (-207.279) [-200.890] (-195.189) -- 0:01:55
217000 -- (-198.311) (-206.751) (-205.113) [-201.702] * [-198.637] (-200.546) (-200.057) (-195.483) -- 0:01:55
217500 -- (-201.690) (-196.730) [-209.509] (-209.560) * (-210.751) (-202.059) (-203.650) [-195.073] -- 0:01:55
218000 -- [-203.287] (-202.287) (-197.835) (-200.244) * (-210.409) (-205.780) (-203.284) [-192.179] -- 0:01:54
218500 -- (-204.865) [-202.053] (-210.990) (-206.390) * [-201.806] (-206.625) (-203.764) (-205.848) -- 0:01:58
219000 -- [-195.399] (-193.134) (-202.255) (-202.557) * (-197.780) (-198.867) [-201.816] (-199.102) -- 0:01:57
219500 -- [-204.280] (-193.551) (-199.164) (-194.067) * (-204.460) [-201.143] (-210.590) (-201.615) -- 0:01:57
220000 -- (-213.555) [-198.690] (-198.299) (-201.500) * (-203.180) [-200.528] (-205.715) (-205.757) -- 0:01:56
Average standard deviation of split frequencies: 0.015429
220500 -- [-201.095] (-202.352) (-196.361) (-196.788) * (-210.756) [-200.836] (-207.964) (-197.863) -- 0:01:56
221000 -- (-207.406) (-192.933) [-197.510] (-209.119) * (-204.151) (-200.962) (-201.980) [-193.541] -- 0:01:56
221500 -- (-202.677) [-201.375] (-202.838) (-207.357) * (-198.319) (-201.800) (-200.053) [-196.806] -- 0:01:55
222000 -- (-196.268) (-192.393) [-197.409] (-206.878) * [-195.802] (-199.674) (-206.790) (-200.910) -- 0:01:55
222500 -- [-194.184] (-202.163) (-196.304) (-197.158) * (-199.020) (-209.179) (-205.108) [-196.210] -- 0:01:55
223000 -- [-203.873] (-194.831) (-196.362) (-202.013) * [-202.942] (-203.750) (-191.969) (-196.441) -- 0:01:54
223500 -- [-201.453] (-202.865) (-204.270) (-201.330) * (-204.774) (-211.451) (-208.860) [-193.381] -- 0:01:54
224000 -- (-202.355) [-202.438] (-201.338) (-201.911) * (-212.816) (-198.230) (-202.614) [-193.673] -- 0:01:54
224500 -- (-199.905) (-196.492) (-205.962) [-203.696] * (-199.532) [-193.261] (-207.228) (-198.325) -- 0:01:53
225000 -- [-201.728] (-194.390) (-193.082) (-208.395) * (-203.704) [-197.451] (-200.729) (-198.347) -- 0:01:53
Average standard deviation of split frequencies: 0.015412
225500 -- (-204.861) (-198.288) (-207.882) [-199.552] * (-200.941) (-206.186) (-206.371) [-195.292] -- 0:01:56
226000 -- (-209.842) [-191.980] (-214.834) (-204.725) * (-201.688) (-204.728) (-201.632) [-192.321] -- 0:01:56
226500 -- (-199.189) [-196.787] (-211.421) (-204.077) * (-205.945) (-199.940) [-205.678] (-200.356) -- 0:01:56
227000 -- (-201.963) [-195.823] (-208.087) (-202.513) * (-199.588) [-204.242] (-206.318) (-201.882) -- 0:01:55
227500 -- (-195.300) [-197.647] (-204.577) (-196.215) * (-201.943) [-202.844] (-212.948) (-199.067) -- 0:01:55
228000 -- [-197.775] (-199.802) (-207.017) (-196.038) * (-199.203) (-199.352) (-203.034) [-195.972] -- 0:01:55
228500 -- (-198.111) (-197.509) (-208.754) [-195.765] * (-198.206) [-202.799] (-207.871) (-197.328) -- 0:01:54
229000 -- [-195.527] (-200.294) (-210.929) (-207.795) * [-196.586] (-207.376) (-202.460) (-203.885) -- 0:01:54
229500 -- (-197.501) [-198.716] (-199.302) (-205.220) * (-198.663) (-207.733) [-202.395] (-198.159) -- 0:01:54
230000 -- (-203.706) [-194.037] (-201.383) (-199.899) * (-196.644) (-207.679) (-198.997) [-200.000] -- 0:01:53
Average standard deviation of split frequencies: 0.014419
230500 -- (-211.749) [-193.912] (-204.026) (-198.652) * [-196.976] (-194.149) (-203.644) (-205.434) -- 0:01:53
231000 -- (-206.700) [-198.349] (-198.338) (-209.502) * [-199.035] (-202.691) (-200.918) (-197.919) -- 0:01:53
231500 -- (-203.954) [-199.174] (-202.538) (-198.984) * (-202.011) [-191.520] (-202.169) (-203.475) -- 0:01:56
232000 -- [-195.797] (-205.172) (-200.532) (-204.301) * (-198.161) (-198.252) [-198.796] (-206.440) -- 0:01:55
232500 -- (-206.351) (-203.414) (-203.658) [-201.068] * (-199.259) (-202.719) [-197.134] (-202.189) -- 0:01:55
233000 -- (-210.749) [-195.533] (-197.511) (-197.585) * (-202.596) (-199.903) [-199.303] (-211.101) -- 0:01:55
233500 -- (-201.239) [-200.847] (-202.242) (-196.935) * [-201.512] (-205.489) (-204.520) (-207.295) -- 0:01:54
234000 -- (-207.045) (-202.430) (-209.724) [-197.991] * [-194.276] (-202.649) (-200.878) (-213.125) -- 0:01:54
234500 -- (-202.507) (-200.888) (-202.943) [-200.735] * [-196.448] (-196.631) (-204.976) (-204.064) -- 0:01:54
235000 -- (-200.565) (-199.881) (-205.110) [-203.183] * [-196.324] (-201.883) (-203.123) (-198.862) -- 0:01:53
Average standard deviation of split frequencies: 0.015536
235500 -- [-200.390] (-207.751) (-205.189) (-198.470) * [-195.320] (-201.645) (-210.302) (-194.687) -- 0:01:53
236000 -- (-202.790) [-201.513] (-196.072) (-204.158) * (-195.540) [-201.855] (-204.696) (-210.474) -- 0:01:53
236500 -- (-202.817) [-202.990] (-203.519) (-200.119) * (-203.229) [-196.100] (-199.172) (-211.887) -- 0:01:52
237000 -- (-206.442) (-201.022) (-211.159) [-196.313] * (-204.832) (-203.387) [-200.349] (-205.430) -- 0:01:52
237500 -- (-200.945) [-199.793] (-216.904) (-202.912) * (-202.440) [-195.540] (-200.609) (-204.371) -- 0:01:52
238000 -- (-201.558) (-205.195) (-204.970) [-203.482] * (-198.849) (-197.778) [-195.758] (-203.131) -- 0:01:55
238500 -- [-200.587] (-204.881) (-199.445) (-201.169) * [-197.450] (-204.417) (-207.598) (-208.108) -- 0:01:54
239000 -- [-196.408] (-201.013) (-207.165) (-203.443) * (-210.312) (-215.443) (-198.029) [-198.838] -- 0:01:54
239500 -- (-204.466) (-199.775) (-205.247) [-194.476] * (-202.695) (-205.538) (-196.157) [-205.032] -- 0:01:54
240000 -- (-197.353) (-199.611) (-204.100) [-200.938] * (-209.423) [-196.177] (-208.554) (-216.685) -- 0:01:53
Average standard deviation of split frequencies: 0.012297
240500 -- (-201.303) (-205.201) (-209.399) [-200.961] * [-196.865] (-200.426) (-211.544) (-212.044) -- 0:01:53
241000 -- (-206.820) (-214.892) [-202.076] (-196.795) * (-200.430) (-200.847) (-202.482) [-213.760] -- 0:01:53
241500 -- (-201.467) (-200.929) (-204.208) [-195.831] * [-195.741] (-200.602) (-201.476) (-200.099) -- 0:01:53
242000 -- (-201.409) [-197.006] (-201.373) (-204.103) * (-205.283) [-196.699] (-203.518) (-206.032) -- 0:01:52
242500 -- [-196.775] (-206.499) (-216.089) (-201.948) * [-194.901] (-198.813) (-199.727) (-209.587) -- 0:01:52
243000 -- (-205.320) (-197.912) [-207.676] (-201.066) * (-196.851) [-192.039] (-205.693) (-206.185) -- 0:01:52
243500 -- [-194.359] (-207.793) (-206.627) (-204.997) * (-203.481) [-191.604] (-200.278) (-199.697) -- 0:01:51
244000 -- (-193.957) (-201.903) (-202.863) [-203.188] * [-194.858] (-197.970) (-207.691) (-207.300) -- 0:01:51
244500 -- [-201.708] (-204.417) (-199.694) (-201.759) * (-201.477) (-199.203) [-202.077] (-201.002) -- 0:01:51
245000 -- (-206.615) (-202.794) [-197.487] (-209.737) * (-206.017) (-196.341) [-196.773] (-195.518) -- 0:01:54
Average standard deviation of split frequencies: 0.013307
245500 -- (-200.090) (-206.561) [-200.082] (-202.596) * (-194.262) (-202.662) (-197.690) [-197.052] -- 0:01:53
246000 -- [-202.738] (-204.688) (-209.806) (-202.271) * [-197.317] (-203.142) (-196.119) (-203.156) -- 0:01:53
246500 -- (-202.114) (-202.662) (-208.984) [-197.678] * (-205.685) (-201.077) [-195.717] (-197.574) -- 0:01:53
247000 -- (-201.174) [-201.480] (-191.783) (-205.201) * (-202.342) (-209.070) (-204.641) [-202.440] -- 0:01:52
247500 -- (-203.997) (-195.739) (-201.354) [-191.937] * (-200.931) (-202.555) (-202.203) [-204.051] -- 0:01:52
248000 -- (-201.044) [-200.976] (-199.706) (-204.581) * [-200.456] (-207.051) (-207.199) (-198.352) -- 0:01:52
248500 -- (-211.696) (-200.177) (-200.869) [-192.966] * [-198.125] (-197.879) (-207.234) (-196.346) -- 0:01:51
249000 -- (-208.808) (-206.714) (-199.994) [-197.941] * (-205.137) [-194.590] (-208.242) (-204.584) -- 0:01:51
249500 -- [-203.537] (-216.933) (-198.849) (-205.871) * (-203.521) (-205.081) (-204.632) [-191.551] -- 0:01:51
250000 -- (-203.511) (-202.535) (-203.354) [-197.335] * (-205.031) (-206.360) [-194.264] (-192.430) -- 0:01:51
Average standard deviation of split frequencies: 0.012955
250500 -- [-207.349] (-201.109) (-206.811) (-208.818) * (-200.296) (-201.131) (-203.437) [-200.647] -- 0:01:50
251000 -- (-197.630) (-213.418) (-196.462) [-199.604] * (-214.041) (-196.193) [-194.635] (-203.163) -- 0:01:50
251500 -- (-200.187) (-205.502) [-200.704] (-202.559) * [-204.560] (-201.426) (-200.804) (-211.687) -- 0:01:50
252000 -- (-207.148) (-202.212) (-203.245) [-202.126] * (-205.956) [-201.173] (-205.783) (-198.533) -- 0:01:52
252500 -- (-209.488) (-198.760) (-206.918) [-196.742] * (-198.900) (-205.985) (-208.293) [-196.773] -- 0:01:52
253000 -- (-201.611) (-204.053) [-204.964] (-205.298) * (-214.312) [-199.272] (-202.743) (-194.453) -- 0:01:52
253500 -- (-214.332) (-206.299) [-200.146] (-194.715) * [-199.385] (-207.227) (-203.893) (-202.580) -- 0:01:51
254000 -- [-204.240] (-206.310) (-205.537) (-199.950) * [-203.043] (-201.972) (-204.376) (-199.075) -- 0:01:51
254500 -- [-202.260] (-203.798) (-205.109) (-202.630) * (-204.866) (-195.627) (-203.287) [-198.045] -- 0:01:51
255000 -- (-199.700) [-199.620] (-198.947) (-196.069) * (-206.819) (-203.333) [-198.921] (-199.995) -- 0:01:51
Average standard deviation of split frequencies: 0.013708
255500 -- (-208.979) (-196.906) (-224.086) [-200.787] * (-199.845) [-198.012] (-196.113) (-206.053) -- 0:01:50
256000 -- (-202.081) (-197.398) (-209.284) [-199.872] * (-209.016) [-198.002] (-201.036) (-199.549) -- 0:01:50
256500 -- (-206.553) (-210.609) (-203.811) [-197.507] * (-204.447) (-193.056) (-202.651) [-200.750] -- 0:01:50
257000 -- (-199.613) (-204.601) [-202.544] (-197.474) * (-206.694) [-195.093] (-199.065) (-210.986) -- 0:01:49
257500 -- (-202.073) [-200.859] (-206.951) (-199.198) * (-214.037) (-207.571) [-207.970] (-216.868) -- 0:01:49
258000 -- [-202.164] (-200.787) (-206.463) (-201.341) * [-202.237] (-202.598) (-200.228) (-199.153) -- 0:01:49
258500 -- (-196.582) [-201.159] (-213.183) (-197.720) * (-205.177) (-202.253) (-200.863) [-192.500] -- 0:01:51
259000 -- (-202.230) (-206.795) (-208.559) [-197.401] * (-197.640) (-195.721) (-198.933) [-199.074] -- 0:01:51
259500 -- (-200.463) (-199.160) (-216.931) [-198.797] * (-214.205) (-196.014) (-199.957) [-202.338] -- 0:01:51
260000 -- (-196.167) [-199.947] (-202.414) (-203.528) * (-213.428) (-206.074) [-195.684] (-201.112) -- 0:01:50
Average standard deviation of split frequencies: 0.012659
260500 -- (-197.996) [-200.697] (-202.823) (-204.145) * (-205.305) (-211.652) (-200.573) [-206.811] -- 0:01:50
261000 -- [-202.642] (-197.517) (-216.967) (-198.814) * (-202.125) [-205.849] (-199.732) (-203.720) -- 0:01:50
261500 -- [-200.399] (-201.053) (-204.258) (-210.087) * (-193.562) (-203.382) (-198.309) [-197.013] -- 0:01:50
262000 -- (-205.646) (-194.870) (-201.041) [-199.083] * (-202.860) (-206.282) (-203.427) [-197.009] -- 0:01:49
262500 -- (-198.479) (-207.238) (-201.462) [-201.144] * (-201.360) (-208.480) (-223.417) [-196.591] -- 0:01:49
263000 -- (-208.308) [-197.263] (-200.555) (-202.444) * (-205.116) (-215.289) [-209.002] (-201.691) -- 0:01:49
263500 -- [-196.781] (-205.637) (-198.884) (-204.257) * (-198.159) (-200.600) (-205.674) [-195.827] -- 0:01:49
264000 -- (-194.267) (-208.853) [-199.899] (-201.994) * [-195.098] (-203.224) (-209.415) (-198.174) -- 0:01:48
264500 -- (-201.044) (-203.912) [-199.232] (-203.382) * (-199.425) (-201.257) (-207.436) [-197.330] -- 0:01:48
265000 -- (-210.160) (-201.425) (-203.248) [-203.200] * (-201.861) (-206.596) (-201.897) [-199.028] -- 0:01:48
Average standard deviation of split frequencies: 0.014276
265500 -- (-205.870) (-199.257) [-200.871] (-198.186) * (-194.727) (-209.508) (-205.879) [-201.183] -- 0:01:50
266000 -- [-207.845] (-199.531) (-204.687) (-202.280) * (-202.468) (-199.141) [-200.349] (-199.245) -- 0:01:50
266500 -- [-203.196] (-207.291) (-204.085) (-217.778) * (-201.118) [-196.296] (-202.316) (-199.211) -- 0:01:50
267000 -- [-198.922] (-196.808) (-207.114) (-211.815) * (-202.593) (-199.503) [-197.153] (-197.922) -- 0:01:49
267500 -- (-214.227) (-202.939) [-201.171] (-206.947) * (-202.541) [-205.359] (-198.812) (-204.386) -- 0:01:49
268000 -- (-210.044) (-201.467) (-201.820) [-204.972] * (-210.293) (-208.020) [-203.823] (-205.584) -- 0:01:49
268500 -- (-205.573) [-195.140] (-206.266) (-199.390) * [-200.935] (-204.822) (-208.145) (-202.046) -- 0:01:48
269000 -- (-202.635) [-202.995] (-211.132) (-215.510) * (-210.567) (-203.784) [-204.080] (-203.044) -- 0:01:48
269500 -- (-198.703) [-204.217] (-195.997) (-199.820) * (-204.564) (-210.189) [-194.277] (-200.319) -- 0:01:48
270000 -- (-213.319) [-192.534] (-200.280) (-202.505) * (-204.064) (-204.435) [-197.709] (-200.460) -- 0:01:48
Average standard deviation of split frequencies: 0.014804
270500 -- (-205.448) (-199.806) [-197.493] (-203.441) * (-194.366) [-200.481] (-194.351) (-203.968) -- 0:01:47
271000 -- (-204.803) [-200.664] (-202.289) (-204.065) * (-200.161) (-201.488) [-199.753] (-205.640) -- 0:01:50
271500 -- (-218.422) (-201.301) [-193.985] (-204.898) * (-202.157) (-203.601) [-196.959] (-199.331) -- 0:01:50
272000 -- (-205.892) [-199.257] (-207.970) (-207.735) * (-205.965) (-199.793) (-201.716) [-200.379] -- 0:01:49
272500 -- (-201.359) [-202.715] (-206.650) (-212.745) * (-198.101) [-198.517] (-201.257) (-203.516) -- 0:01:49
273000 -- [-194.623] (-208.553) (-203.347) (-212.392) * (-201.162) [-198.280] (-202.747) (-204.761) -- 0:01:49
273500 -- (-206.321) [-200.250] (-205.098) (-200.436) * [-199.047] (-202.749) (-215.376) (-199.685) -- 0:01:48
274000 -- [-197.632] (-206.384) (-206.012) (-211.245) * (-202.964) (-206.833) (-198.798) [-200.925] -- 0:01:48
274500 -- (-200.045) [-200.411] (-203.266) (-208.977) * (-193.348) (-218.797) [-201.316] (-205.261) -- 0:01:48
275000 -- (-208.096) (-205.116) (-201.398) [-202.394] * (-198.291) (-207.391) (-212.329) [-202.876] -- 0:01:48
Average standard deviation of split frequencies: 0.015087
275500 -- (-199.192) [-200.738] (-206.207) (-201.972) * (-200.341) (-207.354) (-207.601) [-201.950] -- 0:01:47
276000 -- [-200.318] (-201.157) (-209.542) (-197.694) * [-197.601] (-203.043) (-207.026) (-203.782) -- 0:01:47
276500 -- (-198.984) (-197.404) [-201.384] (-205.725) * [-205.729] (-200.488) (-208.651) (-203.160) -- 0:01:47
277000 -- (-197.374) [-197.256] (-207.864) (-197.548) * [-195.372] (-203.906) (-202.456) (-197.056) -- 0:01:47
277500 -- [-201.762] (-207.326) (-204.474) (-203.652) * [-205.729] (-201.154) (-198.041) (-205.391) -- 0:01:49
278000 -- [-200.207] (-202.625) (-199.714) (-213.972) * (-194.768) (-199.876) [-198.427] (-206.271) -- 0:01:49
278500 -- [-209.458] (-210.739) (-205.876) (-202.638) * (-196.902) (-204.061) (-207.061) [-196.392] -- 0:01:48
279000 -- (-200.890) [-200.968] (-206.094) (-205.791) * [-203.999] (-197.478) (-203.261) (-206.721) -- 0:01:48
279500 -- [-203.675] (-199.900) (-203.056) (-213.615) * [-197.557] (-208.895) (-206.003) (-206.229) -- 0:01:48
280000 -- (-201.421) [-203.444] (-205.465) (-201.869) * (-200.871) (-203.519) (-204.262) [-199.400] -- 0:01:47
Average standard deviation of split frequencies: 0.013530
280500 -- [-200.978] (-200.985) (-219.988) (-204.492) * [-201.328] (-198.182) (-210.290) (-205.206) -- 0:01:47
281000 -- (-200.414) (-204.907) (-199.314) [-203.474] * (-203.520) [-198.462] (-203.034) (-203.322) -- 0:01:47
281500 -- (-202.473) (-203.005) [-203.368] (-206.483) * (-202.585) [-201.352] (-214.324) (-196.446) -- 0:01:47
282000 -- (-199.551) [-197.399] (-199.318) (-200.612) * (-203.353) (-200.753) [-203.719] (-198.248) -- 0:01:46
282500 -- [-200.323] (-201.958) (-209.076) (-206.547) * (-197.344) (-201.845) (-208.702) [-194.399] -- 0:01:46
283000 -- [-199.902] (-202.824) (-207.526) (-207.551) * (-196.381) (-206.035) (-213.734) [-196.103] -- 0:01:46
283500 -- (-194.846) (-200.005) [-199.416] (-214.164) * (-200.177) [-202.394] (-210.516) (-200.641) -- 0:01:48
284000 -- (-202.555) (-197.387) (-202.224) [-201.931] * (-208.262) (-201.982) (-207.331) [-207.431] -- 0:01:48
284500 -- [-195.136] (-201.060) (-202.973) (-202.482) * (-202.101) (-203.095) [-206.158] (-207.090) -- 0:01:48
285000 -- (-196.728) (-205.692) [-204.509] (-207.962) * (-200.971) [-202.198] (-205.865) (-209.139) -- 0:01:47
Average standard deviation of split frequencies: 0.013278
285500 -- (-203.083) (-209.394) [-204.187] (-207.079) * (-208.528) (-199.401) (-196.233) [-203.821] -- 0:01:47
286000 -- [-198.094] (-209.112) (-197.462) (-207.435) * [-199.037] (-206.459) (-199.458) (-202.211) -- 0:01:47
286500 -- [-201.718] (-198.089) (-198.017) (-205.966) * (-201.527) [-201.190] (-202.893) (-203.240) -- 0:01:47
287000 -- (-210.448) (-202.344) (-195.601) [-207.932] * (-204.110) (-204.805) (-197.041) [-195.666] -- 0:01:46
287500 -- (-203.132) [-204.718] (-202.516) (-206.201) * (-202.481) (-211.169) (-201.697) [-200.934] -- 0:01:46
288000 -- (-205.963) (-209.569) (-202.556) [-205.716] * (-205.331) [-203.509] (-205.523) (-195.483) -- 0:01:46
288500 -- (-208.185) (-209.187) [-209.687] (-210.977) * (-195.551) (-201.008) (-200.373) [-193.559] -- 0:01:46
289000 -- (-205.243) (-198.790) (-205.816) [-202.201] * (-197.293) (-201.183) (-207.855) [-195.018] -- 0:01:48
289500 -- [-199.026] (-199.549) (-205.362) (-206.918) * (-207.592) [-201.496] (-205.714) (-199.911) -- 0:01:47
290000 -- (-195.935) [-204.380] (-207.264) (-204.525) * (-201.630) (-207.738) (-198.454) [-201.493] -- 0:01:47
Average standard deviation of split frequencies: 0.012974
290500 -- (-196.270) (-202.148) [-200.722] (-207.720) * (-196.754) (-204.199) (-202.492) [-205.062] -- 0:01:47
291000 -- (-199.781) (-210.195) (-203.160) [-208.390] * (-203.537) [-205.632] (-204.450) (-202.392) -- 0:01:47
291500 -- [-199.724] (-201.372) (-216.073) (-205.036) * [-191.606] (-206.259) (-197.372) (-203.104) -- 0:01:46
292000 -- (-210.720) (-206.183) (-208.220) [-200.149] * (-202.461) [-200.558] (-204.958) (-201.921) -- 0:01:46
292500 -- (-204.621) (-199.411) [-205.077] (-205.963) * [-204.861] (-204.531) (-211.975) (-209.816) -- 0:01:46
293000 -- (-211.556) [-197.379] (-204.908) (-207.682) * (-196.659) [-195.464] (-209.262) (-203.528) -- 0:01:46
293500 -- (-204.117) (-201.435) [-204.097] (-203.965) * [-201.425] (-204.467) (-204.049) (-202.329) -- 0:01:45
294000 -- [-197.376] (-197.537) (-204.776) (-206.216) * [-196.747] (-202.031) (-206.385) (-208.542) -- 0:01:45
294500 -- [-199.965] (-203.307) (-204.693) (-202.166) * (-204.302) (-206.397) [-198.119] (-208.664) -- 0:01:45
295000 -- (-202.484) [-201.342] (-198.879) (-202.638) * [-203.663] (-200.576) (-207.355) (-207.722) -- 0:01:45
Average standard deviation of split frequencies: 0.012564
295500 -- (-199.650) (-203.456) [-203.381] (-200.364) * (-204.634) [-198.405] (-203.570) (-205.356) -- 0:01:47
296000 -- [-200.085] (-200.812) (-203.814) (-201.136) * [-207.722] (-209.548) (-207.646) (-204.939) -- 0:01:47
296500 -- [-204.661] (-206.115) (-204.469) (-196.466) * [-196.053] (-215.785) (-202.049) (-207.692) -- 0:01:46
297000 -- (-214.288) (-207.816) [-200.879] (-196.922) * [-196.207] (-205.689) (-200.093) (-200.187) -- 0:01:46
297500 -- [-200.576] (-204.339) (-199.268) (-204.396) * [-200.715] (-212.777) (-199.161) (-215.959) -- 0:01:46
298000 -- (-210.135) (-205.371) [-199.094] (-205.761) * [-198.682] (-202.937) (-201.427) (-212.008) -- 0:01:46
298500 -- (-203.733) [-200.971] (-196.590) (-205.476) * (-200.711) (-205.290) (-209.893) [-202.006] -- 0:01:45
299000 -- (-218.268) (-195.881) (-199.660) [-205.651] * [-197.742] (-206.358) (-199.948) (-208.312) -- 0:01:45
299500 -- [-211.727] (-211.715) (-197.424) (-195.380) * (-201.821) (-203.296) (-206.446) [-202.863] -- 0:01:45
300000 -- (-207.742) (-209.472) (-196.425) [-196.340] * (-203.357) (-202.947) (-202.582) [-202.920] -- 0:01:44
Average standard deviation of split frequencies: 0.010975
300500 -- [-202.605] (-204.114) (-201.310) (-199.765) * (-197.429) [-197.626] (-198.336) (-203.821) -- 0:01:44
301000 -- (-200.951) (-201.487) (-210.142) [-198.379] * (-200.343) (-203.031) (-200.738) [-200.630] -- 0:01:44
301500 -- (-207.972) (-199.938) (-197.148) [-197.395] * (-202.658) (-201.290) [-201.188] (-204.199) -- 0:01:44
302000 -- (-198.510) (-196.356) (-196.796) [-198.738] * (-215.347) (-196.210) [-194.743] (-200.286) -- 0:01:44
302500 -- [-203.295] (-209.013) (-194.256) (-201.319) * [-203.756] (-204.334) (-206.219) (-196.990) -- 0:01:46
303000 -- (-200.098) (-212.667) (-198.755) [-198.005] * (-206.570) [-196.410] (-207.498) (-193.733) -- 0:01:45
303500 -- (-199.081) [-200.243] (-199.755) (-199.503) * (-204.400) [-194.176] (-201.773) (-194.079) -- 0:01:45
304000 -- [-204.528] (-202.483) (-198.019) (-199.570) * [-201.476] (-206.945) (-207.263) (-205.512) -- 0:01:45
304500 -- [-201.756] (-203.866) (-204.378) (-204.405) * (-195.396) (-201.837) (-201.234) [-202.912] -- 0:01:45
305000 -- (-210.195) (-197.114) [-199.511] (-201.931) * (-203.995) (-205.962) [-197.065] (-201.637) -- 0:01:44
Average standard deviation of split frequencies: 0.010955
305500 -- [-207.211] (-211.693) (-206.661) (-205.518) * (-200.413) (-206.180) (-206.643) [-199.094] -- 0:01:44
306000 -- (-215.101) (-206.307) [-200.945] (-194.425) * (-199.837) [-204.182] (-206.350) (-205.780) -- 0:01:44
306500 -- (-209.361) (-205.535) (-195.939) [-199.326] * [-201.439] (-217.310) (-205.417) (-207.236) -- 0:01:44
307000 -- (-213.379) [-192.043] (-204.619) (-195.927) * (-204.085) (-197.992) (-205.566) [-199.934] -- 0:01:43
307500 -- (-207.942) (-198.412) (-209.098) [-210.219] * (-199.587) [-192.697] (-197.793) (-206.336) -- 0:01:43
308000 -- (-199.816) (-209.516) [-201.411] (-206.051) * (-202.879) (-200.036) (-213.606) [-200.240] -- 0:01:43
308500 -- (-208.412) (-208.054) [-197.969] (-203.624) * (-208.083) [-200.851] (-212.540) (-200.959) -- 0:01:43
309000 -- (-200.958) (-208.759) [-198.561] (-195.939) * (-208.541) (-204.827) [-201.962] (-202.771) -- 0:01:42
309500 -- (-203.014) (-205.052) (-202.173) [-193.243] * (-207.513) (-198.095) (-210.190) [-203.161] -- 0:01:44
310000 -- [-196.493] (-211.038) (-210.400) (-198.790) * (-217.465) (-203.252) [-202.462] (-200.856) -- 0:01:44
Average standard deviation of split frequencies: 0.012561
310500 -- (-201.372) (-201.121) [-200.357] (-203.010) * (-202.053) (-201.088) [-194.972] (-216.386) -- 0:01:44
311000 -- (-203.279) (-212.642) [-203.366] (-200.861) * (-199.696) (-204.252) [-202.532] (-202.840) -- 0:01:44
311500 -- (-203.444) (-199.303) [-200.363] (-200.237) * (-197.460) [-196.145] (-203.283) (-213.321) -- 0:01:43
312000 -- [-194.925] (-207.005) (-202.319) (-199.657) * (-194.970) (-202.872) [-193.474] (-206.790) -- 0:01:43
312500 -- [-194.646] (-197.036) (-207.165) (-202.905) * (-205.446) (-204.856) (-199.009) [-202.612] -- 0:01:43
313000 -- [-199.289] (-207.929) (-202.677) (-207.676) * (-208.608) (-200.403) (-198.588) [-203.662] -- 0:01:43
313500 -- (-197.308) [-198.521] (-206.057) (-214.225) * (-195.158) [-196.927] (-198.108) (-213.072) -- 0:01:42
314000 -- (-205.826) (-206.091) [-198.130] (-204.526) * (-199.692) (-198.277) (-209.251) [-197.897] -- 0:01:42
314500 -- [-198.977] (-206.050) (-196.332) (-207.542) * [-204.618] (-194.971) (-205.692) (-216.831) -- 0:01:42
315000 -- (-209.337) (-193.941) [-193.106] (-202.209) * (-208.456) (-198.819) [-193.272] (-203.038) -- 0:01:42
Average standard deviation of split frequencies: 0.012100
315500 -- [-203.125] (-202.626) (-197.217) (-205.988) * (-206.297) (-198.794) [-201.367] (-204.027) -- 0:01:41
316000 -- (-212.488) (-199.424) [-208.783] (-207.497) * (-208.736) (-199.371) (-193.392) [-201.141] -- 0:01:41
316500 -- (-202.457) (-211.522) [-204.159] (-204.984) * [-210.210] (-196.414) (-198.007) (-207.814) -- 0:01:43
317000 -- (-204.739) (-204.080) [-196.277] (-198.876) * (-216.706) [-196.838] (-206.397) (-207.220) -- 0:01:43
317500 -- (-199.059) [-205.817] (-203.755) (-203.638) * (-214.064) (-204.528) [-200.607] (-203.270) -- 0:01:43
318000 -- (-189.900) (-203.575) (-203.119) [-206.170] * (-223.900) [-202.950] (-194.694) (-202.729) -- 0:01:42
318500 -- (-198.901) (-208.335) (-200.213) [-205.288] * (-209.435) [-195.871] (-202.895) (-203.473) -- 0:01:42
319000 -- (-198.995) (-200.227) [-197.945] (-202.464) * (-203.761) (-210.127) (-201.119) [-200.317] -- 0:01:42
319500 -- (-207.494) (-203.607) [-196.558] (-201.775) * (-206.132) (-199.838) [-193.503] (-212.341) -- 0:01:42
320000 -- [-200.632] (-212.604) (-200.513) (-199.878) * (-208.411) (-200.610) [-198.719] (-196.890) -- 0:01:41
Average standard deviation of split frequencies: 0.012577
320500 -- [-204.695] (-202.249) (-203.769) (-199.363) * [-197.174] (-207.000) (-205.704) (-205.368) -- 0:01:41
321000 -- (-195.677) [-206.178] (-201.618) (-196.986) * [-201.864] (-196.642) (-203.013) (-205.306) -- 0:01:41
321500 -- (-192.929) (-200.663) [-201.216] (-200.589) * (-198.462) [-202.177] (-205.632) (-199.782) -- 0:01:41
322000 -- (-197.699) (-207.224) [-200.680] (-206.257) * (-201.364) (-205.633) (-210.517) [-195.541] -- 0:01:41
322500 -- [-206.103] (-205.894) (-202.716) (-208.403) * (-202.637) [-195.756] (-210.958) (-197.487) -- 0:01:40
323000 -- (-203.282) [-196.990] (-201.331) (-205.419) * (-201.380) (-192.834) (-201.436) [-197.700] -- 0:01:42
323500 -- (-198.939) (-204.177) [-197.322] (-216.929) * (-205.744) (-207.330) (-199.576) [-195.525] -- 0:01:42
324000 -- [-200.345] (-202.298) (-207.583) (-204.642) * (-202.258) (-205.419) [-199.778] (-202.504) -- 0:01:42
324500 -- [-195.619] (-209.778) (-204.141) (-201.125) * (-199.785) (-211.809) [-191.214] (-194.443) -- 0:01:42
325000 -- (-204.362) (-203.449) (-194.382) [-201.001] * (-213.557) (-205.274) [-198.798] (-201.238) -- 0:01:41
Average standard deviation of split frequencies: 0.012532
325500 -- [-194.199] (-201.501) (-203.898) (-207.235) * (-205.961) (-203.040) [-201.016] (-206.359) -- 0:01:41
326000 -- (-202.136) (-214.016) (-201.374) [-211.809] * (-199.616) [-197.483] (-197.395) (-197.446) -- 0:01:41
326500 -- [-198.279] (-208.144) (-191.173) (-194.284) * (-200.330) (-202.371) (-208.545) [-199.084] -- 0:01:41
327000 -- (-207.401) (-216.220) (-200.898) [-199.523] * [-196.648] (-208.067) (-211.676) (-201.771) -- 0:01:40
327500 -- (-208.389) (-207.446) (-198.717) [-207.013] * (-197.511) (-207.220) (-197.819) [-198.897] -- 0:01:40
328000 -- (-203.969) (-213.550) [-192.977] (-209.091) * (-197.561) [-197.298] (-196.283) (-210.563) -- 0:01:40
328500 -- (-207.487) (-202.805) (-197.351) [-200.702] * (-206.864) (-195.571) [-194.092] (-213.124) -- 0:01:40
329000 -- (-202.709) [-201.761] (-201.374) (-197.996) * (-197.306) (-204.877) [-193.811] (-208.826) -- 0:01:39
329500 -- (-199.241) (-212.395) (-205.915) [-196.771] * [-199.812] (-208.976) (-197.435) (-204.940) -- 0:01:39
330000 -- (-205.789) (-208.355) [-206.148] (-198.636) * (-194.529) (-209.619) (-202.978) [-204.723] -- 0:01:41
Average standard deviation of split frequencies: 0.012355
330500 -- [-206.082] (-210.097) (-204.781) (-201.278) * (-198.768) (-213.496) [-198.647] (-206.476) -- 0:01:41
331000 -- (-207.592) (-204.856) (-203.631) [-199.311] * (-199.265) (-213.537) [-199.655] (-203.248) -- 0:01:41
331500 -- (-204.633) (-200.382) (-195.822) [-201.661] * (-195.452) [-198.691] (-198.743) (-208.095) -- 0:01:40
332000 -- (-208.609) (-203.418) (-205.731) [-192.154] * (-201.152) [-198.347] (-199.801) (-203.846) -- 0:01:40
332500 -- (-197.165) (-198.122) (-196.344) [-200.393] * (-200.819) (-195.226) [-195.386] (-201.717) -- 0:01:40
333000 -- (-212.926) (-207.489) [-198.875] (-205.871) * [-200.410] (-201.100) (-200.476) (-199.225) -- 0:01:40
333500 -- (-200.768) (-194.573) [-199.627] (-204.028) * [-198.198] (-204.075) (-205.105) (-207.078) -- 0:01:39
334000 -- (-203.082) (-200.713) [-206.993] (-203.880) * (-197.406) (-208.108) (-200.287) [-201.478] -- 0:01:39
334500 -- (-207.861) (-204.213) (-202.794) [-202.831] * [-203.378] (-209.970) (-207.982) (-201.751) -- 0:01:39
335000 -- [-199.763] (-200.227) (-197.153) (-203.510) * (-207.796) [-201.180] (-199.491) (-201.869) -- 0:01:39
Average standard deviation of split frequencies: 0.011925
335500 -- (-198.423) (-202.764) [-199.572] (-194.458) * (-207.265) [-195.334] (-205.354) (-201.870) -- 0:01:39
336000 -- (-205.972) [-207.889] (-202.285) (-196.465) * (-202.475) (-211.599) (-201.409) [-204.355] -- 0:01:38
336500 -- (-211.004) (-209.592) (-195.777) [-197.644] * [-202.637] (-201.658) (-204.156) (-201.898) -- 0:01:38
337000 -- (-207.086) (-202.212) [-200.241] (-195.770) * (-199.624) (-202.196) (-206.456) [-196.802] -- 0:01:40
337500 -- (-200.281) (-200.801) (-204.711) [-203.297] * [-200.386] (-203.952) (-196.393) (-207.348) -- 0:01:40
338000 -- (-195.378) (-214.614) (-202.788) [-201.461] * (-202.323) [-203.300] (-205.220) (-203.559) -- 0:01:39
338500 -- (-200.211) (-204.530) (-196.031) [-193.660] * (-198.091) (-202.572) [-191.550] (-204.909) -- 0:01:39
339000 -- (-210.008) (-197.905) [-197.180] (-203.438) * (-204.255) (-203.745) (-203.801) [-204.907] -- 0:01:39
339500 -- (-199.049) [-204.866] (-203.726) (-198.773) * [-196.548] (-215.367) (-207.528) (-206.716) -- 0:01:39
340000 -- (-201.134) (-198.961) (-202.797) [-210.587] * (-198.670) (-200.342) (-208.079) [-196.066] -- 0:01:38
Average standard deviation of split frequencies: 0.012146
340500 -- [-204.152] (-200.939) (-196.212) (-211.559) * (-202.207) [-203.923] (-196.680) (-200.737) -- 0:01:38
341000 -- (-201.381) (-205.530) [-198.154] (-207.314) * (-196.364) (-208.154) [-199.148] (-200.154) -- 0:01:38
341500 -- [-193.830] (-213.432) (-204.404) (-201.314) * [-204.740] (-203.693) (-200.905) (-210.425) -- 0:01:38
342000 -- (-204.315) (-203.570) [-196.126] (-204.401) * (-204.370) [-198.850] (-197.973) (-209.603) -- 0:01:38
342500 -- (-200.722) (-203.041) [-199.007] (-203.660) * (-207.288) (-200.962) [-194.211] (-199.656) -- 0:01:37
343000 -- (-207.815) (-202.013) [-200.757] (-210.699) * (-205.770) [-200.145] (-206.872) (-201.708) -- 0:01:37
343500 -- (-194.602) (-201.945) [-197.763] (-200.928) * (-204.178) (-216.994) [-198.471] (-197.301) -- 0:01:37
344000 -- (-199.403) (-204.152) [-197.216] (-198.318) * (-207.472) (-206.735) (-200.128) [-195.721] -- 0:01:39
344500 -- (-194.574) (-207.963) [-195.671] (-201.541) * [-198.927] (-202.170) (-199.722) (-201.331) -- 0:01:38
345000 -- [-212.215] (-208.099) (-216.105) (-200.003) * [-204.616] (-199.584) (-200.162) (-208.402) -- 0:01:38
Average standard deviation of split frequencies: 0.011429
345500 -- (-206.850) [-199.451] (-200.399) (-200.894) * [-208.139] (-202.327) (-209.635) (-210.857) -- 0:01:38
346000 -- (-206.398) [-200.391] (-223.526) (-207.001) * (-207.767) (-203.296) [-201.611] (-206.885) -- 0:01:38
346500 -- [-200.137] (-207.943) (-207.834) (-211.736) * (-199.162) (-206.264) [-201.992] (-200.265) -- 0:01:38
347000 -- [-194.836] (-201.948) (-213.982) (-205.014) * (-206.725) (-209.547) [-193.629] (-196.657) -- 0:01:37
347500 -- (-192.156) (-200.971) (-203.587) [-201.610] * (-202.058) [-202.089] (-200.854) (-199.883) -- 0:01:37
348000 -- [-203.099] (-203.212) (-204.942) (-200.062) * [-208.723] (-198.934) (-203.573) (-209.455) -- 0:01:37
348500 -- (-192.653) [-206.683] (-202.049) (-210.301) * (-199.028) (-199.550) [-201.027] (-206.136) -- 0:01:37
349000 -- (-196.794) [-201.158] (-201.762) (-202.851) * (-205.678) (-199.226) (-200.518) [-198.951] -- 0:01:36
349500 -- (-200.311) (-212.078) [-200.542] (-205.187) * (-206.608) (-204.644) [-196.614] (-206.692) -- 0:01:36
350000 -- (-203.220) (-200.241) [-202.049] (-210.993) * [-211.334] (-202.976) (-196.276) (-206.998) -- 0:01:36
Average standard deviation of split frequencies: 0.010157
350500 -- (-198.365) (-198.782) (-198.962) [-202.659] * [-200.603] (-212.440) (-199.330) (-199.999) -- 0:01:36
351000 -- (-196.185) (-206.938) (-198.303) [-197.887] * (-208.575) (-208.843) (-204.114) [-193.687] -- 0:01:37
351500 -- (-201.220) (-208.117) [-195.736] (-214.660) * [-202.342] (-203.556) (-203.932) (-211.662) -- 0:01:37
352000 -- (-199.842) (-197.390) [-198.565] (-203.392) * [-204.107] (-207.005) (-212.094) (-204.510) -- 0:01:37
352500 -- (-199.162) (-198.453) (-202.655) [-201.083] * (-199.607) (-201.629) (-202.934) [-192.595] -- 0:01:37
353000 -- [-194.586] (-207.047) (-216.022) (-201.309) * (-199.074) (-199.308) [-200.430] (-210.150) -- 0:01:37
353500 -- (-199.003) [-200.161] (-199.522) (-204.603) * (-207.767) [-200.287] (-196.787) (-208.918) -- 0:01:36
354000 -- [-200.338] (-200.475) (-202.157) (-205.954) * [-198.362] (-207.845) (-199.660) (-200.685) -- 0:01:36
354500 -- (-204.731) (-202.244) [-199.432] (-207.487) * [-195.952] (-200.050) (-218.862) (-202.481) -- 0:01:36
355000 -- (-200.201) (-198.557) (-207.705) [-196.461] * (-196.850) (-216.595) [-202.538] (-198.248) -- 0:01:36
Average standard deviation of split frequencies: 0.010373
355500 -- (-199.619) (-206.146) (-201.405) [-200.605] * (-206.101) [-196.568] (-203.005) (-195.145) -- 0:01:36
356000 -- [-199.850] (-204.191) (-205.180) (-218.642) * (-209.051) (-200.781) (-208.222) [-200.704] -- 0:01:35
356500 -- [-197.416] (-203.093) (-204.285) (-201.105) * [-197.294] (-197.686) (-207.149) (-202.855) -- 0:01:35
357000 -- [-199.100] (-206.316) (-207.009) (-209.841) * (-195.300) (-199.904) [-200.769] (-199.260) -- 0:01:35
357500 -- (-208.365) (-196.695) (-200.163) [-201.762] * [-195.434] (-204.703) (-206.193) (-202.428) -- 0:01:37
358000 -- (-210.967) (-196.433) (-207.404) [-200.445] * (-197.606) (-204.806) (-205.687) [-200.096] -- 0:01:36
358500 -- (-210.438) (-204.348) (-203.684) [-199.173] * (-194.674) (-197.695) [-200.095] (-207.108) -- 0:01:36
359000 -- (-207.883) [-203.515] (-198.914) (-201.104) * (-207.134) (-199.660) [-201.793] (-206.768) -- 0:01:36
359500 -- (-200.171) (-203.287) [-199.275] (-208.618) * (-199.456) (-211.888) (-196.338) [-197.061] -- 0:01:36
360000 -- (-207.820) (-205.379) [-210.605] (-207.844) * [-198.682] (-215.837) (-210.139) (-202.106) -- 0:01:35
Average standard deviation of split frequencies: 0.010166
360500 -- (-204.097) (-198.838) (-201.455) [-198.720] * (-204.949) (-211.054) (-199.141) [-201.658] -- 0:01:35
361000 -- (-202.636) (-204.066) (-199.471) [-201.524] * [-196.227] (-206.592) (-213.514) (-200.599) -- 0:01:35
361500 -- (-193.060) (-212.751) [-197.295] (-203.252) * (-199.682) (-202.275) [-202.398] (-202.068) -- 0:01:35
362000 -- (-211.480) (-204.233) [-201.244] (-200.196) * [-196.370] (-201.015) (-203.122) (-200.626) -- 0:01:35
362500 -- (-199.962) (-209.295) (-204.106) [-204.713] * (-204.914) (-207.879) (-206.228) [-199.794] -- 0:01:34
363000 -- (-196.575) (-211.499) [-197.806] (-204.077) * [-196.431] (-201.420) (-204.112) (-198.473) -- 0:01:34
363500 -- (-194.101) (-201.403) [-205.304] (-211.626) * (-204.619) [-203.531] (-204.951) (-200.821) -- 0:01:34
364000 -- [-203.506] (-196.512) (-198.820) (-215.230) * [-204.783] (-198.532) (-213.613) (-211.719) -- 0:01:34
364500 -- (-199.476) (-197.352) [-193.064] (-215.551) * [-198.569] (-214.066) (-211.394) (-198.270) -- 0:01:35
365000 -- (-203.591) (-196.010) (-200.548) [-209.706] * (-201.270) [-202.055] (-203.254) (-201.248) -- 0:01:35
Average standard deviation of split frequencies: 0.010590
365500 -- (-194.855) (-197.601) (-206.929) [-200.704] * [-203.199] (-213.878) (-211.292) (-197.788) -- 0:01:35
366000 -- (-197.847) (-207.432) [-203.416] (-208.073) * (-195.460) [-202.893] (-201.194) (-205.201) -- 0:01:35
366500 -- (-201.179) [-204.927] (-201.922) (-204.630) * (-204.638) (-199.539) [-204.974] (-210.382) -- 0:01:35
367000 -- (-204.940) (-195.514) [-197.396] (-210.888) * [-197.456] (-208.050) (-204.066) (-200.981) -- 0:01:34
367500 -- (-200.291) (-196.099) (-208.050) [-195.706] * (-199.137) [-202.361] (-202.458) (-204.651) -- 0:01:34
368000 -- (-212.347) [-201.365] (-203.065) (-199.873) * (-207.617) (-214.316) (-201.934) [-202.955] -- 0:01:34
368500 -- [-200.229] (-209.385) (-206.377) (-204.316) * [-194.376] (-212.563) (-203.370) (-196.424) -- 0:01:34
369000 -- (-199.374) [-201.608] (-200.183) (-211.134) * (-207.841) [-208.846] (-200.747) (-201.949) -- 0:01:34
369500 -- (-198.757) (-203.507) [-200.018] (-205.217) * (-208.643) (-206.712) [-197.062] (-200.486) -- 0:01:33
370000 -- (-192.285) (-208.742) [-197.256] (-202.531) * (-213.504) (-202.109) (-203.931) [-200.320] -- 0:01:33
Average standard deviation of split frequencies: 0.011587
370500 -- (-199.037) (-196.604) (-204.326) [-198.995] * (-218.795) [-203.482] (-199.506) (-202.157) -- 0:01:33
371000 -- [-206.956] (-214.646) (-213.766) (-204.427) * (-207.636) [-200.384] (-205.871) (-200.521) -- 0:01:33
371500 -- (-206.767) (-201.697) [-199.210] (-207.264) * (-206.137) (-205.770) (-205.294) [-198.515] -- 0:01:34
372000 -- (-211.370) [-199.830] (-207.067) (-202.716) * (-206.650) [-206.171] (-209.994) (-202.019) -- 0:01:34
372500 -- [-203.315] (-205.853) (-200.935) (-194.446) * [-195.910] (-203.002) (-212.906) (-204.147) -- 0:01:34
373000 -- (-201.955) (-204.478) [-203.254] (-201.096) * (-209.884) (-200.667) (-205.818) [-199.062] -- 0:01:34
373500 -- (-200.161) [-198.024] (-207.619) (-204.301) * [-200.450] (-199.663) (-208.641) (-206.512) -- 0:01:33
374000 -- (-208.942) [-199.884] (-199.904) (-206.243) * (-207.709) (-200.257) (-204.377) [-201.017] -- 0:01:33
374500 -- (-201.407) (-198.666) [-196.450] (-203.254) * (-195.330) [-196.514] (-209.804) (-205.309) -- 0:01:33
375000 -- (-205.007) (-198.355) (-201.351) [-199.489] * (-198.499) (-208.567) [-205.500] (-200.926) -- 0:01:33
Average standard deviation of split frequencies: 0.011423
375500 -- (-203.658) (-203.779) [-199.027] (-195.122) * [-197.949] (-211.963) (-201.358) (-200.712) -- 0:01:33
376000 -- (-204.757) [-200.172] (-198.781) (-210.011) * (-197.764) (-209.729) [-203.005] (-197.548) -- 0:01:32
376500 -- [-205.160] (-206.685) (-197.291) (-201.124) * [-200.878] (-206.935) (-202.247) (-193.732) -- 0:01:32
377000 -- [-198.864] (-201.643) (-203.577) (-202.314) * (-200.255) (-200.999) [-193.811] (-210.809) -- 0:01:32
377500 -- (-206.007) [-199.451] (-206.471) (-198.784) * (-201.948) [-199.027] (-203.035) (-217.523) -- 0:01:32
378000 -- (-209.818) (-202.292) [-199.863] (-199.010) * (-205.330) [-205.355] (-204.635) (-206.294) -- 0:01:32
378500 -- (-203.637) [-200.594] (-201.344) (-206.983) * (-201.457) (-200.495) [-208.560] (-200.492) -- 0:01:33
379000 -- (-202.138) (-199.546) (-202.617) [-193.759] * (-197.085) [-206.389] (-207.956) (-201.740) -- 0:01:33
379500 -- (-206.148) (-194.087) [-199.885] (-209.563) * [-198.847] (-209.874) (-204.424) (-208.428) -- 0:01:33
380000 -- (-203.174) [-192.754] (-200.461) (-208.621) * [-193.142] (-201.982) (-207.266) (-206.700) -- 0:01:32
Average standard deviation of split frequencies: 0.011902
380500 -- (-203.846) [-198.702] (-195.457) (-197.665) * (-201.318) [-202.502] (-206.223) (-200.305) -- 0:01:32
381000 -- (-209.909) (-200.513) (-200.063) [-198.020] * [-200.455] (-213.575) (-207.842) (-198.490) -- 0:01:32
381500 -- (-213.242) [-193.252] (-205.027) (-203.033) * (-201.376) (-200.027) (-207.318) [-199.070] -- 0:01:32
382000 -- (-204.232) [-199.302] (-198.022) (-201.988) * (-201.555) (-207.508) (-205.833) [-194.239] -- 0:01:32
382500 -- (-204.305) [-199.000] (-203.524) (-212.150) * (-199.065) (-204.650) (-201.482) [-205.585] -- 0:01:32
383000 -- (-201.769) (-200.081) (-200.790) [-203.148] * (-196.787) (-209.067) [-206.670] (-202.565) -- 0:01:31
383500 -- (-202.100) (-197.960) [-198.659] (-199.662) * (-195.296) (-206.731) (-203.414) [-195.112] -- 0:01:31
384000 -- (-203.345) [-203.872] (-194.823) (-204.987) * (-204.706) (-202.395) (-198.853) [-193.599] -- 0:01:31
384500 -- (-199.228) [-196.346] (-195.886) (-208.749) * (-211.741) (-204.701) (-191.936) [-206.610] -- 0:01:31
385000 -- (-200.171) (-207.199) [-197.971] (-209.693) * (-210.567) [-199.687] (-205.991) (-201.697) -- 0:01:31
Average standard deviation of split frequencies: 0.012145
385500 -- (-203.777) (-205.041) [-201.357] (-207.537) * (-203.920) [-208.053] (-201.675) (-206.110) -- 0:01:32
386000 -- [-194.623] (-201.025) (-211.153) (-208.114) * (-200.316) (-205.679) (-199.762) [-210.568] -- 0:01:32
386500 -- (-196.483) (-205.628) [-200.725] (-209.856) * (-205.953) (-207.564) (-199.379) [-199.886] -- 0:01:32
387000 -- (-209.922) (-206.515) [-205.458] (-201.323) * (-205.043) (-203.854) (-203.067) [-197.497] -- 0:01:31
387500 -- [-198.061] (-210.188) (-198.401) (-206.492) * (-201.909) [-202.975] (-216.856) (-211.343) -- 0:01:31
388000 -- (-204.094) [-198.916] (-199.503) (-210.579) * (-197.756) (-207.388) (-200.828) [-193.294] -- 0:01:31
388500 -- (-199.287) (-203.576) [-196.981] (-204.215) * (-199.772) (-204.598) (-205.893) [-200.597] -- 0:01:31
389000 -- (-195.888) [-194.889] (-204.196) (-216.527) * (-208.842) (-204.889) (-200.044) [-206.087] -- 0:01:31
389500 -- (-206.802) [-193.406] (-203.696) (-214.341) * (-201.679) (-201.656) (-200.868) [-200.548] -- 0:01:30
390000 -- (-203.320) [-197.284] (-202.267) (-209.526) * (-195.724) (-199.715) [-201.196] (-201.251) -- 0:01:30
Average standard deviation of split frequencies: 0.012000
390500 -- [-200.896] (-206.741) (-205.887) (-211.340) * (-199.887) (-205.692) (-205.138) [-199.867] -- 0:01:30
391000 -- (-204.416) (-199.202) [-198.776] (-212.445) * (-206.711) [-198.403] (-200.221) (-201.318) -- 0:01:30
391500 -- (-203.300) [-208.414] (-199.758) (-208.967) * (-211.646) [-196.828] (-196.402) (-200.485) -- 0:01:30
392000 -- (-203.590) (-205.171) [-195.812] (-205.534) * (-208.277) [-196.637] (-205.566) (-196.100) -- 0:01:29
392500 -- [-194.968] (-207.381) (-199.718) (-194.498) * (-205.941) (-211.251) [-198.066] (-203.445) -- 0:01:31
393000 -- (-198.862) (-200.291) [-195.591] (-195.601) * (-208.676) [-200.316] (-197.854) (-200.304) -- 0:01:31
393500 -- (-196.224) (-201.506) (-203.478) [-196.790] * (-204.589) [-205.570] (-198.327) (-198.485) -- 0:01:30
394000 -- [-198.701] (-206.747) (-197.958) (-204.386) * (-200.716) [-201.381] (-207.052) (-213.832) -- 0:01:30
394500 -- [-202.692] (-203.687) (-194.760) (-197.069) * (-203.133) (-208.847) [-202.306] (-193.953) -- 0:01:30
395000 -- [-203.254] (-204.180) (-198.407) (-196.304) * (-199.446) [-204.935] (-203.199) (-200.548) -- 0:01:30
Average standard deviation of split frequencies: 0.013227
395500 -- [-195.639] (-202.047) (-203.430) (-198.292) * (-204.556) (-211.523) [-199.175] (-200.226) -- 0:01:30
396000 -- (-199.254) (-199.646) [-194.228] (-199.029) * (-204.930) (-212.594) [-197.431] (-211.071) -- 0:01:29
396500 -- (-209.675) (-203.893) [-198.096] (-200.104) * (-204.229) (-206.381) [-209.372] (-198.369) -- 0:01:29
397000 -- (-197.064) (-199.855) (-199.016) [-198.311] * (-207.082) (-206.591) (-204.354) [-202.530] -- 0:01:29
397500 -- (-200.073) (-202.932) (-199.051) [-196.550] * (-195.279) [-201.461] (-201.776) (-214.568) -- 0:01:29
398000 -- [-196.453] (-209.657) (-204.464) (-198.713) * [-204.526] (-205.156) (-205.082) (-207.947) -- 0:01:29
398500 -- (-207.192) (-199.671) [-201.529] (-203.390) * (-202.726) [-201.408] (-206.322) (-197.484) -- 0:01:29
399000 -- [-202.250] (-205.091) (-200.808) (-209.499) * (-200.782) (-203.628) [-199.026] (-202.334) -- 0:01:28
399500 -- (-206.489) [-203.887] (-205.495) (-202.141) * (-211.435) [-198.779] (-201.311) (-201.767) -- 0:01:30
400000 -- (-200.007) (-200.419) [-198.356] (-208.278) * [-200.402] (-210.403) (-206.788) (-196.537) -- 0:01:29
Average standard deviation of split frequencies: 0.013269
400500 -- [-198.422] (-199.253) (-199.882) (-207.320) * (-198.450) [-200.034] (-197.593) (-201.156) -- 0:01:29
401000 -- [-205.706] (-202.688) (-205.175) (-202.648) * [-202.169] (-200.387) (-204.201) (-202.112) -- 0:01:29
401500 -- (-209.742) [-196.345] (-209.992) (-203.514) * [-202.183] (-205.233) (-198.533) (-202.997) -- 0:01:29
402000 -- [-202.864] (-202.742) (-213.870) (-205.288) * (-210.938) (-206.780) [-200.889] (-205.795) -- 0:01:29
402500 -- (-208.281) (-208.057) (-199.978) [-206.787] * [-200.718] (-202.318) (-202.220) (-218.377) -- 0:01:29
403000 -- (-212.020) (-201.275) (-198.258) [-203.990] * (-196.122) (-202.722) (-196.020) [-199.638] -- 0:01:28
403500 -- (-207.651) (-203.888) [-190.187] (-193.836) * (-198.126) [-197.044] (-203.647) (-207.080) -- 0:01:28
404000 -- (-209.551) (-216.477) (-206.212) [-199.977] * (-214.320) (-194.068) [-203.646] (-203.698) -- 0:01:28
404500 -- [-199.569] (-206.047) (-197.173) (-201.267) * (-204.700) (-198.005) [-207.236] (-206.458) -- 0:01:28
405000 -- (-194.704) (-207.827) (-198.263) [-200.042] * (-200.199) (-196.515) [-203.492] (-211.401) -- 0:01:28
Average standard deviation of split frequencies: 0.013030
405500 -- (-208.852) (-207.435) [-196.658] (-206.411) * (-212.689) (-207.647) [-197.611] (-195.351) -- 0:01:27
406000 -- (-198.817) (-206.443) [-200.816] (-201.979) * (-198.551) [-195.065] (-198.852) (-205.076) -- 0:01:29
406500 -- (-208.193) (-215.068) [-203.181] (-194.926) * (-200.365) (-205.686) (-211.815) [-195.973] -- 0:01:29
407000 -- (-208.325) (-208.407) (-200.529) [-199.409] * (-205.166) (-205.686) [-199.299] (-209.800) -- 0:01:28
407500 -- (-209.380) (-213.650) (-197.595) [-197.773] * (-198.092) (-203.426) [-203.606] (-205.672) -- 0:01:28
408000 -- [-204.699] (-205.378) (-205.387) (-194.724) * [-194.495] (-210.669) (-201.767) (-212.116) -- 0:01:28
408500 -- (-197.699) [-202.758] (-203.823) (-205.958) * [-192.201] (-207.962) (-201.314) (-201.267) -- 0:01:28
409000 -- (-201.575) [-200.981] (-207.393) (-204.574) * [-191.191] (-198.969) (-208.773) (-196.676) -- 0:01:28
409500 -- (-204.403) [-200.331] (-206.905) (-197.210) * (-199.991) (-200.622) (-208.474) [-196.804] -- 0:01:27
410000 -- (-203.677) [-198.993] (-206.217) (-209.035) * (-204.981) (-197.255) (-198.839) [-202.810] -- 0:01:27
Average standard deviation of split frequencies: 0.013392
410500 -- [-214.881] (-211.185) (-205.989) (-207.065) * (-199.320) [-201.200] (-205.708) (-198.372) -- 0:01:27
411000 -- (-202.269) (-210.412) (-209.371) [-196.315] * (-203.778) (-202.455) (-198.395) [-202.546] -- 0:01:27
411500 -- (-205.188) (-210.349) (-199.719) [-202.025] * (-200.784) [-201.190] (-196.812) (-209.775) -- 0:01:27
412000 -- [-195.824] (-210.233) (-200.057) (-205.485) * (-196.612) (-196.593) [-198.732] (-199.818) -- 0:01:27
412500 -- (-199.545) (-203.746) (-201.967) [-203.946] * [-203.710] (-204.856) (-195.793) (-200.945) -- 0:01:26
413000 -- [-197.594] (-213.493) (-200.755) (-206.353) * (-203.172) (-197.756) (-201.429) [-199.247] -- 0:01:28
413500 -- [-196.446] (-209.219) (-211.848) (-197.702) * (-201.915) (-194.274) [-194.053] (-204.185) -- 0:01:27
414000 -- (-205.651) [-197.158] (-208.988) (-199.429) * (-202.878) (-191.685) [-203.229] (-213.368) -- 0:01:27
414500 -- [-199.981] (-197.743) (-211.124) (-203.608) * (-195.664) [-202.301] (-198.542) (-206.838) -- 0:01:27
415000 -- (-203.755) [-199.972] (-201.011) (-196.701) * (-205.183) [-194.802] (-192.980) (-201.035) -- 0:01:27
Average standard deviation of split frequencies: 0.013346
415500 -- (-216.881) (-211.415) [-200.160] (-199.245) * (-203.412) (-197.330) [-198.850] (-199.232) -- 0:01:27
416000 -- (-201.035) (-202.728) [-196.388] (-207.582) * (-213.151) (-200.849) [-204.791] (-203.737) -- 0:01:27
416500 -- [-206.150] (-208.452) (-208.023) (-197.664) * (-206.989) [-195.710] (-206.891) (-215.614) -- 0:01:26
417000 -- (-205.808) (-208.530) [-197.740] (-204.714) * (-209.744) (-191.874) [-194.528] (-201.824) -- 0:01:26
417500 -- (-199.745) (-198.246) [-202.476] (-205.193) * (-205.187) (-205.299) [-196.778] (-210.408) -- 0:01:26
418000 -- [-199.565] (-203.663) (-199.442) (-212.617) * [-199.679] (-201.819) (-203.551) (-203.690) -- 0:01:26
418500 -- (-209.296) [-199.744] (-203.707) (-201.397) * [-202.162] (-197.049) (-204.844) (-214.922) -- 0:01:26
419000 -- [-199.503] (-209.446) (-204.606) (-201.448) * (-207.271) (-200.167) [-191.667] (-215.409) -- 0:01:25
419500 -- (-201.469) (-209.133) (-208.097) [-198.716] * (-208.408) (-197.068) (-195.761) [-199.930] -- 0:01:27
420000 -- (-207.620) (-195.091) (-200.333) [-195.977] * (-217.386) [-193.705] (-201.644) (-214.229) -- 0:01:26
Average standard deviation of split frequencies: 0.013447
420500 -- (-202.187) (-208.909) (-203.961) [-197.438] * (-211.073) (-203.758) [-198.049] (-211.689) -- 0:01:26
421000 -- [-203.118] (-196.610) (-210.312) (-203.349) * (-209.482) (-207.743) [-196.901] (-209.602) -- 0:01:26
421500 -- (-203.761) (-208.183) (-203.543) [-195.122] * (-203.824) (-203.417) [-198.622] (-205.394) -- 0:01:26
422000 -- (-207.338) [-200.139] (-198.538) (-194.663) * (-201.900) [-198.009] (-203.964) (-204.702) -- 0:01:26
422500 -- [-200.812] (-203.568) (-206.577) (-203.917) * [-207.614] (-203.066) (-203.584) (-207.639) -- 0:01:26
423000 -- [-197.860] (-209.168) (-196.399) (-196.571) * (-204.884) [-200.294] (-199.601) (-200.480) -- 0:01:25
423500 -- (-202.004) (-214.408) (-205.735) [-200.772] * (-200.971) [-201.894] (-202.567) (-202.083) -- 0:01:25
424000 -- (-203.272) [-196.966] (-204.278) (-199.096) * (-201.285) [-199.957] (-197.521) (-211.916) -- 0:01:25
424500 -- (-202.595) (-202.284) (-202.104) [-197.669] * (-201.347) (-202.320) [-198.293] (-202.386) -- 0:01:25
425000 -- (-209.704) [-208.058] (-203.543) (-199.491) * [-202.722] (-196.437) (-202.690) (-197.019) -- 0:01:25
Average standard deviation of split frequencies: 0.013402
425500 -- (-207.136) (-207.644) (-200.565) [-198.569] * (-200.517) (-211.185) [-198.103] (-199.417) -- 0:01:26
426000 -- (-201.789) (-204.478) [-198.382] (-197.561) * (-209.191) [-196.284] (-199.291) (-208.709) -- 0:01:26
426500 -- (-196.930) (-205.161) [-200.917] (-208.987) * [-201.740] (-192.768) (-202.649) (-201.854) -- 0:01:26
427000 -- (-206.918) [-202.724] (-208.369) (-206.838) * (-209.201) (-192.065) [-200.717] (-204.319) -- 0:01:25
427500 -- (-216.388) [-203.752] (-207.483) (-195.048) * [-203.151] (-197.497) (-205.576) (-202.333) -- 0:01:25
428000 -- (-203.821) (-206.239) [-202.844] (-200.193) * (-206.107) (-205.350) (-201.693) [-206.129] -- 0:01:25
428500 -- (-202.073) (-199.939) [-203.346] (-201.635) * [-207.929] (-201.162) (-204.084) (-203.171) -- 0:01:25
429000 -- (-200.786) (-204.046) (-205.693) [-210.974] * (-214.263) (-201.366) [-195.070] (-203.465) -- 0:01:25
429500 -- (-201.094) (-201.975) [-197.305] (-203.442) * (-205.818) (-201.978) [-199.748] (-209.739) -- 0:01:25
430000 -- (-203.503) (-201.991) [-201.828] (-198.797) * (-210.782) [-199.443] (-205.749) (-210.111) -- 0:01:24
Average standard deviation of split frequencies: 0.013318
430500 -- (-203.254) (-199.353) (-202.701) [-198.097] * [-204.570] (-203.144) (-206.204) (-210.651) -- 0:01:24
431000 -- (-201.380) (-203.615) (-207.049) [-196.514] * (-207.638) (-201.831) [-202.354] (-204.576) -- 0:01:24
431500 -- (-197.479) (-208.994) [-204.351] (-196.556) * (-202.642) [-201.322] (-206.506) (-200.217) -- 0:01:24
432000 -- (-200.367) (-201.039) [-206.098] (-199.034) * (-206.213) (-202.597) [-200.752] (-205.065) -- 0:01:24
432500 -- [-195.716] (-199.495) (-203.731) (-204.973) * (-209.150) (-196.615) (-199.692) [-196.871] -- 0:01:25
433000 -- (-206.922) (-198.469) [-195.007] (-201.238) * (-211.093) (-202.923) (-200.430) [-198.871] -- 0:01:25
433500 -- [-197.940] (-201.090) (-205.659) (-201.695) * [-202.964] (-205.278) (-202.802) (-207.575) -- 0:01:24
434000 -- [-202.991] (-205.825) (-212.077) (-207.597) * (-207.508) (-215.313) (-201.395) [-202.052] -- 0:01:24
434500 -- (-201.676) (-210.525) [-192.515] (-211.157) * (-196.200) (-203.218) (-200.169) [-200.613] -- 0:01:24
435000 -- (-208.986) (-195.854) [-201.187] (-204.589) * (-206.497) (-196.116) (-201.864) [-198.347] -- 0:01:24
Average standard deviation of split frequencies: 0.012794
435500 -- (-202.768) [-199.409] (-206.329) (-196.091) * (-200.657) [-190.431] (-208.256) (-203.094) -- 0:01:24
436000 -- (-213.098) (-203.881) (-195.082) [-197.132] * (-204.946) (-194.707) (-198.600) [-196.116] -- 0:01:24
436500 -- (-201.196) (-202.985) (-197.423) [-203.666] * (-202.560) [-193.172] (-201.309) (-198.839) -- 0:01:23
437000 -- (-210.309) [-199.026] (-197.049) (-207.484) * (-203.055) [-194.277] (-205.900) (-204.051) -- 0:01:23
437500 -- (-208.457) [-198.098] (-200.946) (-197.899) * (-199.877) (-195.700) (-202.043) [-194.815] -- 0:01:23
438000 -- [-195.634] (-200.542) (-198.675) (-201.049) * (-207.039) (-209.643) [-197.154] (-190.375) -- 0:01:23
438500 -- (-207.638) [-199.991] (-203.347) (-198.799) * (-199.169) (-197.215) (-210.100) [-202.785] -- 0:01:23
439000 -- (-198.925) [-198.702] (-207.075) (-200.211) * (-199.926) (-204.563) [-201.552] (-196.111) -- 0:01:23
439500 -- (-200.469) [-203.761] (-206.910) (-209.750) * (-195.476) [-204.196] (-208.764) (-204.868) -- 0:01:24
440000 -- (-198.775) [-196.580] (-201.771) (-202.867) * [-195.531] (-202.997) (-196.843) (-197.737) -- 0:01:23
Average standard deviation of split frequencies: 0.013015
440500 -- (-199.353) [-197.250] (-204.963) (-197.967) * [-195.997] (-203.902) (-199.016) (-195.452) -- 0:01:23
441000 -- (-199.014) (-201.966) (-201.609) [-203.671] * [-197.670] (-204.008) (-206.909) (-195.673) -- 0:01:23
441500 -- (-201.397) [-193.130] (-203.153) (-210.735) * [-201.076] (-206.207) (-197.465) (-198.506) -- 0:01:23
442000 -- (-197.968) (-202.466) [-196.359] (-201.668) * (-206.454) [-197.504] (-201.696) (-202.386) -- 0:01:23
442500 -- (-201.299) [-198.859] (-200.236) (-199.996) * (-198.642) (-200.990) [-196.634] (-209.379) -- 0:01:23
443000 -- (-199.573) (-201.397) (-198.975) [-193.802] * [-206.598] (-200.245) (-207.864) (-201.929) -- 0:01:22
443500 -- (-212.799) (-212.290) [-198.523] (-201.616) * (-208.046) [-199.854] (-207.850) (-204.032) -- 0:01:22
444000 -- (-207.606) (-214.365) [-194.371] (-195.183) * (-209.739) (-206.529) (-207.092) [-197.807] -- 0:01:22
444500 -- (-202.792) (-219.208) (-210.397) [-199.163] * (-199.074) (-201.428) [-197.966] (-206.302) -- 0:01:22
445000 -- (-201.432) (-215.400) (-202.300) [-196.531] * (-199.563) (-199.344) [-192.152] (-203.341) -- 0:01:22
Average standard deviation of split frequencies: 0.012625
445500 -- (-201.119) (-210.970) [-198.531] (-201.371) * (-206.131) (-201.095) [-203.983] (-207.260) -- 0:01:22
446000 -- (-204.762) (-207.643) [-198.423] (-194.361) * (-208.601) (-195.896) [-200.500] (-201.994) -- 0:01:21
446500 -- (-201.035) (-204.853) (-197.863) [-201.983] * [-202.135] (-202.480) (-206.578) (-207.104) -- 0:01:21
447000 -- (-201.027) (-211.139) (-194.138) [-197.544] * (-203.235) [-200.323] (-201.421) (-201.957) -- 0:01:22
447500 -- [-205.209] (-215.883) (-207.749) (-200.422) * (-202.093) [-198.595] (-199.228) (-213.690) -- 0:01:22
448000 -- (-206.322) (-208.003) (-196.303) [-196.901] * (-202.717) [-193.129] (-201.114) (-197.645) -- 0:01:22
448500 -- (-202.463) (-206.181) (-202.649) [-202.169] * (-200.517) [-196.117] (-213.289) (-202.896) -- 0:01:22
449000 -- (-198.255) [-197.558] (-195.936) (-199.627) * (-209.046) (-190.269) (-202.350) [-200.799] -- 0:01:22
449500 -- (-213.839) (-209.650) [-195.747] (-199.597) * (-200.936) (-202.901) (-206.690) [-194.270] -- 0:01:22
450000 -- (-202.225) [-206.386] (-203.949) (-202.597) * (-209.919) [-196.609] (-209.710) (-202.463) -- 0:01:21
Average standard deviation of split frequencies: 0.012029
450500 -- (-205.604) (-206.036) (-199.519) [-192.444] * (-193.968) (-194.838) (-202.825) [-197.478] -- 0:01:21
451000 -- (-199.713) (-213.634) (-205.265) [-206.001] * (-201.768) (-195.924) (-212.621) [-200.076] -- 0:01:21
451500 -- (-208.923) [-201.596] (-199.775) (-204.545) * (-196.719) [-197.072] (-203.697) (-205.028) -- 0:01:21
452000 -- (-204.124) (-200.097) (-205.109) [-195.467] * (-202.071) (-205.760) (-208.501) [-201.885] -- 0:01:21
452500 -- [-201.799] (-206.639) (-208.653) (-202.292) * (-205.283) (-203.069) (-211.394) [-202.601] -- 0:01:21
453000 -- [-201.155] (-202.639) (-207.142) (-204.950) * (-206.365) [-203.564] (-216.404) (-197.554) -- 0:01:20
453500 -- [-212.938] (-201.494) (-209.207) (-206.219) * (-199.579) (-209.452) (-209.405) [-198.793] -- 0:01:21
454000 -- [-196.398] (-203.756) (-197.154) (-209.414) * (-202.937) (-199.037) (-206.820) [-195.531] -- 0:01:21
454500 -- (-209.429) [-207.014] (-207.129) (-211.545) * (-209.857) (-214.197) (-199.796) [-201.116] -- 0:01:21
455000 -- (-205.657) (-202.094) (-210.937) [-202.570] * (-196.230) (-201.030) (-200.443) [-195.490] -- 0:01:21
Average standard deviation of split frequencies: 0.012291
455500 -- (-214.989) (-205.895) (-202.344) [-201.379] * (-208.588) [-199.325] (-200.235) (-199.890) -- 0:01:21
456000 -- (-203.101) [-198.958] (-206.305) (-196.937) * (-208.812) (-195.583) (-202.094) [-192.246] -- 0:01:21
456500 -- [-197.634] (-212.383) (-204.109) (-217.678) * [-203.617] (-206.822) (-204.859) (-203.067) -- 0:01:20
457000 -- (-200.353) (-206.029) (-205.894) [-198.508] * [-194.367] (-201.118) (-200.970) (-197.688) -- 0:01:20
457500 -- (-208.657) (-209.691) (-208.263) [-199.142] * (-206.421) [-195.299] (-198.645) (-200.930) -- 0:01:20
458000 -- (-212.541) (-208.215) (-200.063) [-204.788] * (-203.144) [-196.855] (-198.935) (-209.369) -- 0:01:20
458500 -- (-213.167) [-206.211] (-201.596) (-204.847) * (-202.908) (-198.779) (-209.134) [-200.662] -- 0:01:20
459000 -- (-205.373) [-194.691] (-204.242) (-204.888) * (-202.924) [-197.672] (-202.179) (-202.831) -- 0:01:20
459500 -- (-211.765) (-205.086) [-204.125] (-209.904) * (-204.240) (-213.406) [-202.028] (-200.392) -- 0:01:19
460000 -- (-200.679) (-203.755) (-209.841) [-202.081] * (-198.139) (-202.312) [-200.572] (-202.869) -- 0:01:19
Average standard deviation of split frequencies: 0.011825
460500 -- (-204.153) (-202.413) [-199.228] (-197.845) * (-206.643) (-205.935) [-201.467] (-208.905) -- 0:01:20
461000 -- (-204.764) [-204.751] (-205.304) (-201.088) * (-197.349) (-195.734) (-200.438) [-196.326] -- 0:01:20
461500 -- (-203.920) [-201.429] (-200.025) (-200.220) * (-207.635) (-205.882) (-203.288) [-199.253] -- 0:01:20
462000 -- (-205.572) (-210.938) [-196.746] (-198.059) * (-196.791) [-200.037] (-204.256) (-213.439) -- 0:01:20
462500 -- (-201.365) (-215.802) [-195.041] (-207.898) * [-196.130] (-198.149) (-203.090) (-203.071) -- 0:01:20
463000 -- (-207.837) (-198.716) [-210.023] (-208.116) * (-202.933) (-198.220) [-200.992] (-202.912) -- 0:01:20
463500 -- (-213.418) [-204.626] (-204.550) (-206.462) * (-193.293) (-204.388) [-201.978] (-208.966) -- 0:01:19
464000 -- [-196.423] (-217.120) (-200.872) (-200.523) * [-196.738] (-202.909) (-204.747) (-210.788) -- 0:01:19
464500 -- (-201.273) (-203.837) (-204.063) [-196.814] * [-194.874] (-195.700) (-203.740) (-208.153) -- 0:01:19
465000 -- (-198.320) [-204.383] (-205.255) (-197.921) * (-198.077) (-207.529) (-201.487) [-203.517] -- 0:01:19
Average standard deviation of split frequencies: 0.012139
465500 -- [-205.573] (-201.878) (-199.931) (-198.139) * (-203.122) (-202.604) (-206.826) [-197.138] -- 0:01:19
466000 -- (-206.963) (-208.111) [-202.068] (-199.132) * (-198.699) (-204.340) (-203.734) [-197.659] -- 0:01:19
466500 -- (-192.580) [-201.610] (-211.346) (-210.016) * (-203.364) [-200.863] (-209.439) (-208.755) -- 0:01:18
467000 -- (-200.916) (-198.056) (-201.991) [-202.511] * (-204.895) (-201.839) (-203.748) [-203.265] -- 0:01:18
467500 -- (-194.407) [-196.292] (-197.806) (-207.181) * (-203.052) [-211.088] (-213.794) (-202.330) -- 0:01:19
468000 -- [-199.766] (-206.218) (-206.613) (-195.177) * [-207.336] (-201.017) (-209.509) (-200.490) -- 0:01:19
468500 -- (-197.265) (-204.113) [-197.989] (-205.207) * (-202.684) [-195.118] (-206.811) (-199.448) -- 0:01:19
469000 -- (-205.942) [-198.715] (-206.028) (-205.943) * (-209.107) (-199.065) [-200.164] (-204.559) -- 0:01:19
469500 -- (-195.878) (-204.258) (-199.887) [-209.775] * (-212.941) (-201.242) [-201.786] (-200.911) -- 0:01:19
470000 -- (-203.534) (-206.794) (-204.302) [-195.336] * (-195.578) (-204.843) [-203.051] (-205.557) -- 0:01:18
Average standard deviation of split frequencies: 0.012575
470500 -- (-203.115) (-206.413) [-197.901] (-203.817) * (-197.003) (-196.857) [-193.372] (-202.303) -- 0:01:18
471000 -- [-197.777] (-205.387) (-209.371) (-198.720) * (-199.457) (-204.323) (-204.633) [-198.493] -- 0:01:18
471500 -- (-201.196) (-209.659) [-200.060] (-207.263) * (-208.229) (-193.641) (-200.835) [-195.149] -- 0:01:18
472000 -- (-204.495) (-203.754) (-210.132) [-202.086] * (-202.186) (-204.053) (-205.457) [-196.397] -- 0:01:18
472500 -- (-205.832) [-196.907] (-201.931) (-204.578) * [-195.283] (-201.074) (-193.667) (-193.790) -- 0:01:18
473000 -- (-213.266) (-198.461) (-205.597) [-194.337] * (-196.772) [-197.002] (-203.897) (-198.451) -- 0:01:17
473500 -- (-204.460) (-191.640) (-202.877) [-195.123] * [-197.098] (-202.736) (-196.870) (-203.983) -- 0:01:17
474000 -- (-199.486) [-195.688] (-209.482) (-200.992) * (-197.272) [-198.513] (-195.839) (-197.987) -- 0:01:17
474500 -- (-205.614) (-193.608) (-206.653) [-195.704] * [-203.194] (-197.750) (-208.152) (-196.256) -- 0:01:18
475000 -- (-200.598) (-201.754) (-210.348) [-198.426] * (-201.457) [-202.293] (-200.137) (-201.296) -- 0:01:18
Average standard deviation of split frequencies: 0.011554
475500 -- (-205.215) [-194.318] (-203.466) (-205.624) * (-206.321) (-196.455) [-202.837] (-198.851) -- 0:01:18
476000 -- (-200.230) (-201.081) (-201.203) [-196.801] * (-214.509) [-194.811] (-199.332) (-194.640) -- 0:01:18
476500 -- [-202.585] (-203.358) (-198.800) (-203.221) * [-201.018] (-202.827) (-198.786) (-203.610) -- 0:01:18
477000 -- (-212.421) (-202.830) (-204.800) [-198.819] * (-199.931) (-203.382) (-203.719) [-195.102] -- 0:01:17
477500 -- (-221.746) [-203.208] (-202.155) (-201.787) * (-205.936) (-201.408) [-206.065] (-203.363) -- 0:01:17
478000 -- (-207.286) (-204.273) (-200.445) [-201.956] * (-206.389) [-202.018] (-215.029) (-191.159) -- 0:01:17
478500 -- (-216.745) [-198.578] (-196.445) (-196.296) * (-200.429) (-203.767) (-204.312) [-194.896] -- 0:01:17
479000 -- (-211.546) (-211.124) (-202.310) [-199.265] * (-200.039) (-213.466) (-202.289) [-200.505] -- 0:01:17
479500 -- (-200.010) (-203.901) [-193.946] (-209.968) * [-204.491] (-199.062) (-197.428) (-200.030) -- 0:01:17
480000 -- [-201.481] (-208.654) (-205.447) (-204.385) * (-211.080) [-204.507] (-205.860) (-201.245) -- 0:01:16
Average standard deviation of split frequencies: 0.011060
480500 -- (-208.708) [-202.085] (-201.549) (-205.086) * (-196.082) [-204.511] (-206.642) (-204.219) -- 0:01:17
481000 -- (-203.729) (-205.078) [-198.166] (-210.194) * (-200.394) [-196.206] (-201.531) (-212.692) -- 0:01:17
481500 -- (-205.019) (-207.306) (-203.705) [-206.143] * (-197.605) [-195.483] (-203.706) (-208.652) -- 0:01:17
482000 -- [-207.623] (-196.701) (-192.556) (-211.655) * [-202.435] (-199.338) (-204.385) (-204.420) -- 0:01:17
482500 -- (-212.110) (-198.994) [-200.457] (-207.885) * (-200.750) [-197.609] (-206.455) (-204.719) -- 0:01:17
483000 -- (-210.886) [-194.427] (-201.332) (-209.882) * (-211.911) (-216.565) (-199.666) [-204.113] -- 0:01:17
483500 -- (-215.673) (-219.284) [-205.681] (-201.156) * (-198.571) [-199.646] (-209.409) (-198.225) -- 0:01:16
484000 -- (-200.977) (-202.595) (-194.500) [-196.549] * (-205.671) [-203.421] (-204.889) (-196.311) -- 0:01:16
484500 -- [-207.393] (-206.673) (-202.483) (-204.604) * (-201.897) (-206.680) (-199.210) [-193.758] -- 0:01:16
485000 -- (-211.455) (-214.862) [-196.960] (-196.053) * [-198.881] (-200.251) (-201.119) (-205.819) -- 0:01:16
Average standard deviation of split frequencies: 0.011047
485500 -- (-210.308) (-205.733) (-205.811) [-192.026] * (-207.544) (-203.071) [-205.215] (-200.434) -- 0:01:16
486000 -- (-213.238) (-204.959) (-206.182) [-195.978] * (-206.695) [-196.302] (-201.100) (-206.358) -- 0:01:16
486500 -- [-206.720] (-199.736) (-206.097) (-198.939) * (-200.215) (-202.136) (-200.714) [-196.395] -- 0:01:17
487000 -- (-209.178) (-200.522) (-202.770) [-197.775] * (-197.935) (-216.570) [-204.289] (-204.574) -- 0:01:16
487500 -- (-204.192) (-205.951) [-196.269] (-203.996) * (-203.991) (-213.324) [-202.780] (-198.950) -- 0:01:16
488000 -- (-206.943) (-204.614) [-198.895] (-199.119) * [-207.137] (-207.683) (-204.390) (-210.415) -- 0:01:16
488500 -- (-207.659) (-201.801) [-203.473] (-202.047) * (-201.220) (-199.962) [-194.261] (-213.568) -- 0:01:16
489000 -- (-199.420) (-207.352) (-207.580) [-199.647] * (-198.042) (-206.769) [-198.063] (-207.465) -- 0:01:16
489500 -- (-206.408) [-197.749] (-199.612) (-200.439) * [-205.506] (-204.328) (-201.900) (-203.312) -- 0:01:16
490000 -- (-207.513) [-207.150] (-204.386) (-208.804) * [-200.523] (-202.486) (-202.714) (-217.036) -- 0:01:15
Average standard deviation of split frequencies: 0.010728
490500 -- (-216.353) (-203.874) [-198.052] (-204.470) * (-202.572) [-200.292] (-199.581) (-203.298) -- 0:01:15
491000 -- (-199.250) (-211.888) (-200.160) [-197.969] * (-208.487) (-205.313) (-202.530) [-199.219] -- 0:01:15
491500 -- (-213.287) [-199.627] (-202.125) (-201.895) * (-198.642) (-207.282) (-210.883) [-198.635] -- 0:01:15
492000 -- (-207.456) [-196.750] (-210.373) (-203.672) * (-202.557) (-196.050) (-202.692) [-198.142] -- 0:01:16
492500 -- (-197.420) [-193.784] (-202.233) (-204.132) * (-207.348) [-198.609] (-201.707) (-203.691) -- 0:01:16
493000 -- (-204.952) (-205.675) [-199.965] (-198.229) * (-204.527) [-199.759] (-207.094) (-203.453) -- 0:01:16
493500 -- (-206.357) [-192.627] (-203.238) (-205.193) * (-211.720) [-210.152] (-204.051) (-200.152) -- 0:01:15
494000 -- (-204.392) (-203.450) (-205.845) [-194.032] * (-205.074) (-200.369) (-201.503) [-194.523] -- 0:01:15
494500 -- (-210.041) [-200.758] (-205.562) (-201.149) * (-200.664) [-200.917] (-209.827) (-195.356) -- 0:01:15
495000 -- (-207.790) [-200.160] (-207.953) (-210.796) * (-205.486) [-192.259] (-211.553) (-206.660) -- 0:01:15
Average standard deviation of split frequencies: 0.010402
495500 -- (-203.696) [-191.462] (-202.785) (-202.322) * (-207.789) (-196.016) [-200.031] (-197.653) -- 0:01:15
496000 -- (-204.705) [-192.822] (-215.975) (-204.749) * (-217.041) (-198.373) [-199.996] (-201.567) -- 0:01:15
496500 -- (-207.467) [-196.943] (-208.189) (-210.919) * (-207.961) (-195.770) (-206.195) [-196.915] -- 0:01:15
497000 -- (-202.649) (-204.481) (-205.287) [-206.861] * (-202.641) (-205.876) (-210.926) [-197.302] -- 0:01:14
497500 -- (-201.650) (-195.100) (-199.421) [-194.641] * (-201.363) (-199.587) (-201.322) [-194.583] -- 0:01:15
498000 -- [-202.981] (-194.144) (-203.242) (-197.155) * [-198.638] (-201.277) (-207.881) (-198.861) -- 0:01:15
498500 -- (-198.689) (-198.237) (-201.113) [-202.352] * [-200.633] (-199.566) (-210.299) (-202.992) -- 0:01:15
499000 -- (-207.194) [-200.448] (-203.440) (-212.462) * (-203.679) [-193.338] (-201.174) (-199.143) -- 0:01:15
499500 -- (-203.532) (-207.640) (-199.810) [-200.640] * (-201.959) [-199.946] (-205.900) (-207.610) -- 0:01:15
500000 -- [-202.853] (-193.134) (-207.967) (-200.633) * (-199.687) [-205.418] (-201.941) (-202.936) -- 0:01:15
Average standard deviation of split frequencies: 0.009782
500500 -- (-201.203) (-196.698) (-214.247) [-202.111] * (-199.329) (-202.205) (-207.817) [-199.193] -- 0:01:14
501000 -- [-200.816] (-205.084) (-207.236) (-204.758) * (-205.018) [-199.698] (-199.308) (-200.252) -- 0:01:14
501500 -- [-202.654] (-199.209) (-203.425) (-207.205) * (-197.885) (-204.051) [-200.153] (-202.385) -- 0:01:14
502000 -- [-193.892] (-200.117) (-208.225) (-202.236) * (-206.880) [-205.956] (-202.501) (-204.693) -- 0:01:14
502500 -- (-207.840) (-194.023) [-203.275] (-196.664) * (-202.868) (-204.005) [-207.322] (-206.737) -- 0:01:14
503000 -- [-196.208] (-204.340) (-200.886) (-200.659) * (-206.326) (-204.702) (-202.673) [-200.513] -- 0:01:15
503500 -- (-207.136) (-199.519) [-200.148] (-203.575) * (-202.331) (-202.878) [-201.642] (-202.179) -- 0:01:14
504000 -- (-210.286) [-197.731] (-201.191) (-206.973) * (-195.657) (-207.454) (-205.758) [-201.819] -- 0:01:14
504500 -- (-196.112) (-201.560) (-205.102) [-202.109] * (-205.543) [-200.092] (-200.401) (-204.172) -- 0:01:14
505000 -- (-204.595) (-196.949) (-206.879) [-202.056] * [-199.706] (-202.070) (-213.796) (-209.933) -- 0:01:14
Average standard deviation of split frequencies: 0.010144
505500 -- (-213.380) (-204.812) [-201.935] (-202.000) * [-194.237] (-207.670) (-200.732) (-205.864) -- 0:01:14
506000 -- [-201.825] (-201.358) (-218.824) (-213.661) * (-199.813) (-205.122) [-198.884] (-204.902) -- 0:01:14
506500 -- (-202.056) (-206.513) [-199.596] (-198.731) * (-207.249) [-204.831] (-212.913) (-198.917) -- 0:01:14
507000 -- (-202.498) (-204.964) (-199.261) [-197.857] * (-204.960) (-203.959) [-194.527] (-207.207) -- 0:01:13
507500 -- (-203.345) (-200.400) [-200.993] (-208.769) * (-212.251) (-203.944) (-200.409) [-200.132] -- 0:01:13
508000 -- (-199.363) [-197.669] (-198.099) (-210.018) * (-200.905) (-207.682) [-190.391] (-206.080) -- 0:01:13
508500 -- (-205.372) (-195.097) (-198.959) [-202.309] * (-202.989) [-204.980] (-205.640) (-201.327) -- 0:01:14
509000 -- (-210.014) (-197.256) [-199.305] (-193.885) * [-200.011] (-196.647) (-200.831) (-197.236) -- 0:01:14
509500 -- (-199.537) [-197.664] (-197.590) (-206.255) * [-197.158] (-196.655) (-207.947) (-203.604) -- 0:01:14
510000 -- [-197.761] (-194.555) (-201.598) (-212.698) * (-205.865) (-203.067) [-202.465] (-209.939) -- 0:01:13
Average standard deviation of split frequencies: 0.009590
510500 -- (-200.089) (-200.891) [-204.254] (-203.658) * [-194.503] (-197.250) (-198.151) (-205.796) -- 0:01:13
511000 -- [-195.678] (-199.032) (-206.536) (-207.523) * [-193.953] (-206.535) (-199.428) (-204.009) -- 0:01:13
511500 -- [-202.374] (-200.937) (-205.141) (-204.785) * (-205.477) (-206.511) (-203.861) [-203.901] -- 0:01:13
512000 -- (-211.044) (-208.995) (-202.068) [-201.041] * (-208.580) (-191.174) [-207.149] (-209.394) -- 0:01:13
512500 -- [-199.734] (-205.668) (-202.023) (-206.646) * (-207.997) [-194.800] (-195.157) (-206.172) -- 0:01:13
513000 -- (-209.811) (-209.063) [-203.017] (-196.476) * (-206.619) [-200.692] (-197.957) (-207.434) -- 0:01:13
513500 -- (-207.889) (-200.975) (-203.884) [-194.400] * (-212.286) [-201.709] (-205.666) (-202.362) -- 0:01:12
514000 -- (-216.693) (-203.381) [-200.789] (-201.906) * (-205.490) [-199.740] (-202.297) (-201.051) -- 0:01:12
514500 -- (-200.666) (-203.827) [-199.183] (-201.215) * (-202.496) (-205.036) [-198.529] (-201.528) -- 0:01:12
515000 -- (-204.942) [-202.420] (-198.197) (-204.709) * (-200.417) [-199.229] (-195.328) (-195.710) -- 0:01:13
Average standard deviation of split frequencies: 0.008983
515500 -- (-211.694) (-196.924) (-198.920) [-197.451] * (-202.465) (-206.612) (-194.174) [-195.309] -- 0:01:13
516000 -- (-199.729) (-203.670) (-207.293) [-197.157] * (-208.154) [-199.709] (-200.187) (-199.450) -- 0:01:13
516500 -- (-209.750) (-199.507) [-196.355] (-203.426) * (-209.849) (-206.386) [-193.498] (-202.843) -- 0:01:13
517000 -- (-215.891) (-201.745) (-208.691) [-200.398] * (-204.364) (-221.567) [-199.788] (-201.949) -- 0:01:12
517500 -- (-197.269) (-199.841) [-202.228] (-204.623) * (-207.430) (-203.579) (-201.658) [-194.877] -- 0:01:12
518000 -- (-203.730) (-211.712) (-201.718) [-191.807] * (-204.485) [-198.195] (-205.328) (-201.863) -- 0:01:12
518500 -- [-195.918] (-203.482) (-205.105) (-196.546) * (-208.981) (-205.054) [-195.024] (-209.084) -- 0:01:12
519000 -- [-203.492] (-199.556) (-201.348) (-213.611) * (-197.623) (-203.133) [-201.420] (-205.650) -- 0:01:12
519500 -- (-207.948) (-206.421) [-195.543] (-198.676) * [-198.766] (-203.755) (-206.760) (-201.353) -- 0:01:12
520000 -- (-206.888) (-201.110) (-209.129) [-193.051] * [-198.017] (-203.954) (-202.528) (-201.012) -- 0:01:12
Average standard deviation of split frequencies: 0.008802
520500 -- (-210.784) (-201.980) (-211.481) [-201.962] * [-194.679] (-201.513) (-204.366) (-203.839) -- 0:01:12
521000 -- (-203.944) (-204.175) (-200.664) [-199.114] * (-201.965) (-205.326) [-203.973] (-200.962) -- 0:01:12
521500 -- (-207.667) (-202.349) (-216.422) [-203.133] * (-203.664) (-199.779) (-204.906) [-200.429] -- 0:01:12
522000 -- (-208.322) (-200.240) [-197.754] (-201.731) * (-204.576) [-196.566] (-205.542) (-218.084) -- 0:01:12
522500 -- (-207.301) (-210.724) (-203.006) [-204.344] * (-202.432) [-204.509] (-200.619) (-200.853) -- 0:01:12
523000 -- (-210.460) [-198.947] (-196.410) (-214.979) * (-203.693) (-202.332) (-209.284) [-201.129] -- 0:01:12
523500 -- (-204.405) (-206.586) (-197.564) [-196.970] * [-201.663] (-203.323) (-201.481) (-195.534) -- 0:01:11
524000 -- (-210.168) (-201.523) (-198.968) [-198.396] * (-204.555) (-205.452) [-207.478] (-201.814) -- 0:01:11
524500 -- (-205.410) (-203.769) (-194.014) [-197.051] * (-198.089) (-203.293) (-201.300) [-201.165] -- 0:01:11
525000 -- (-203.870) (-196.675) [-202.878] (-199.073) * (-200.947) (-200.303) [-195.762] (-193.277) -- 0:01:11
Average standard deviation of split frequencies: 0.008813
525500 -- (-208.471) [-192.334] (-192.948) (-201.866) * (-212.859) (-207.237) [-196.869] (-200.980) -- 0:01:11
526000 -- (-204.551) (-205.637) [-202.455] (-205.202) * [-204.471] (-205.405) (-198.005) (-203.986) -- 0:01:11
526500 -- (-209.051) [-199.111] (-212.121) (-202.675) * (-203.358) (-204.647) (-203.195) [-198.800] -- 0:01:11
527000 -- (-201.808) [-203.613] (-211.088) (-205.784) * (-201.620) [-195.661] (-204.410) (-208.724) -- 0:01:10
527500 -- (-198.888) (-198.401) [-197.489] (-213.293) * (-208.183) [-192.109] (-204.688) (-196.704) -- 0:01:11
528000 -- (-201.869) [-202.565] (-200.434) (-195.869) * (-212.064) (-208.796) (-210.700) [-199.778] -- 0:01:11
528500 -- (-209.655) (-201.683) (-209.883) [-199.871] * [-199.819] (-212.453) (-199.736) (-199.492) -- 0:01:11
529000 -- (-202.484) (-203.547) [-195.393] (-200.222) * [-202.555] (-202.367) (-209.342) (-200.600) -- 0:01:11
529500 -- (-217.088) (-200.763) [-196.232] (-199.972) * (-208.362) (-197.091) (-205.862) [-198.864] -- 0:01:11
530000 -- (-206.577) (-195.012) [-193.206] (-202.242) * (-199.506) (-205.000) (-197.738) [-197.538] -- 0:01:10
Average standard deviation of split frequencies: 0.008291
530500 -- (-209.933) (-197.156) (-193.854) [-198.662] * (-209.708) [-203.673] (-196.541) (-198.686) -- 0:01:10
531000 -- (-201.771) (-193.424) (-199.527) [-202.042] * (-200.513) (-205.793) [-195.253] (-197.805) -- 0:01:10
531500 -- (-202.458) [-198.681] (-202.471) (-199.506) * [-191.944] (-205.505) (-200.842) (-204.008) -- 0:01:10
532000 -- (-204.342) (-197.094) (-203.084) [-199.489] * [-199.576] (-201.415) (-203.925) (-202.184) -- 0:01:10
532500 -- (-205.099) (-196.626) [-195.723] (-198.281) * [-204.635] (-201.389) (-208.004) (-197.009) -- 0:01:10
533000 -- (-196.985) (-193.470) [-203.612] (-199.493) * (-204.830) (-203.095) [-202.318] (-204.633) -- 0:01:10
533500 -- (-206.724) [-193.822] (-204.890) (-196.103) * (-204.397) (-198.028) [-206.558] (-203.649) -- 0:01:09
534000 -- (-207.890) (-198.640) (-207.482) [-198.872] * [-208.130] (-202.845) (-208.150) (-205.817) -- 0:01:10
534500 -- (-199.757) (-202.439) (-200.460) [-199.248] * (-194.230) [-195.509] (-204.162) (-205.643) -- 0:01:10
535000 -- [-204.665] (-198.831) (-202.231) (-211.159) * [-205.705] (-201.079) (-207.733) (-208.703) -- 0:01:10
Average standard deviation of split frequencies: 0.008111
535500 -- (-203.038) [-200.235] (-203.576) (-201.555) * [-195.454] (-211.001) (-201.093) (-207.441) -- 0:01:10
536000 -- (-208.372) [-199.355] (-206.439) (-203.287) * (-198.445) [-210.346] (-205.618) (-208.241) -- 0:01:10
536500 -- (-200.071) (-209.223) (-196.691) [-198.560] * (-195.964) (-212.381) [-199.422] (-206.802) -- 0:01:09
537000 -- (-201.981) (-202.131) [-195.207] (-201.935) * [-202.570] (-205.566) (-198.865) (-209.584) -- 0:01:09
537500 -- (-206.982) [-199.914] (-196.919) (-202.137) * (-208.963) (-209.067) [-203.572] (-210.601) -- 0:01:09
538000 -- (-197.318) (-209.775) (-194.488) [-197.246] * [-202.711] (-208.323) (-211.918) (-206.994) -- 0:01:09
538500 -- [-195.555] (-199.589) (-201.843) (-207.060) * (-210.216) (-212.790) [-202.499] (-203.023) -- 0:01:09
539000 -- (-203.920) (-197.527) (-203.743) [-201.229] * (-207.545) [-195.096] (-203.057) (-198.493) -- 0:01:09
539500 -- [-193.177] (-207.285) (-194.747) (-208.650) * (-202.629) [-208.331] (-197.158) (-201.812) -- 0:01:09
540000 -- [-193.171] (-202.936) (-204.063) (-204.525) * (-201.714) (-206.982) (-198.033) [-196.149] -- 0:01:09
Average standard deviation of split frequencies: 0.008816
540500 -- (-204.350) (-199.230) [-198.077] (-205.755) * (-199.007) (-205.048) (-200.488) [-200.434] -- 0:01:08
541000 -- (-204.424) [-195.134] (-194.289) (-203.070) * (-205.257) (-207.599) (-195.892) [-194.680] -- 0:01:09
541500 -- (-198.029) (-205.454) [-198.342] (-210.469) * (-196.833) (-199.938) [-196.804] (-208.476) -- 0:01:09
542000 -- (-204.225) [-205.033] (-200.128) (-204.394) * (-204.336) (-204.386) (-201.473) [-197.164] -- 0:01:09
542500 -- (-200.692) (-208.535) (-204.435) [-196.081] * (-211.083) (-207.170) (-204.587) [-199.798] -- 0:01:09
543000 -- (-202.389) (-206.603) [-197.334] (-204.589) * (-207.062) (-208.913) (-197.893) [-200.026] -- 0:01:09
543500 -- (-202.667) [-196.849] (-199.764) (-198.359) * (-215.826) (-196.178) [-200.861] (-194.686) -- 0:01:08
544000 -- (-209.596) [-197.533] (-201.538) (-198.412) * (-201.271) (-215.180) (-209.584) [-199.120] -- 0:01:08
544500 -- (-201.492) [-203.161] (-209.651) (-201.204) * (-196.955) (-199.023) [-206.370] (-197.837) -- 0:01:08
545000 -- (-211.592) (-193.491) [-198.042] (-197.646) * (-199.577) (-200.727) [-200.846] (-206.575) -- 0:01:08
Average standard deviation of split frequencies: 0.008826
545500 -- (-198.880) (-202.241) [-195.122] (-204.719) * [-197.239] (-200.498) (-209.116) (-202.295) -- 0:01:08
546000 -- (-198.894) (-210.966) [-195.398] (-200.992) * (-208.020) (-200.252) (-202.377) [-197.841] -- 0:01:08
546500 -- [-196.014] (-202.308) (-196.896) (-201.488) * (-205.156) (-199.157) (-203.069) [-202.496] -- 0:01:08
547000 -- (-198.965) (-219.456) (-205.331) [-199.986] * (-209.468) (-199.229) (-206.283) [-199.182] -- 0:01:07
547500 -- (-200.658) [-197.746] (-213.107) (-202.127) * [-200.933] (-197.118) (-199.170) (-207.197) -- 0:01:07
548000 -- (-202.867) (-201.801) [-199.151] (-198.451) * (-205.718) (-207.946) (-201.588) [-196.199] -- 0:01:08
548500 -- (-196.808) (-208.156) [-201.602] (-205.244) * (-200.707) [-197.625] (-200.739) (-208.933) -- 0:01:08
549000 -- (-200.192) (-207.623) (-199.398) [-202.620] * (-201.125) (-209.936) [-211.714] (-206.070) -- 0:01:08
549500 -- (-198.120) [-194.183] (-200.609) (-207.390) * [-198.822] (-205.323) (-205.307) (-200.759) -- 0:01:08
550000 -- (-197.521) (-206.041) [-207.343] (-203.436) * (-198.855) (-200.850) (-200.443) [-199.032] -- 0:01:07
Average standard deviation of split frequencies: 0.008180
550500 -- (-200.055) [-204.881] (-209.502) (-203.165) * (-200.934) (-215.132) [-202.615] (-202.492) -- 0:01:07
551000 -- (-198.660) (-203.603) [-196.997] (-201.204) * (-207.158) (-205.739) (-199.342) [-201.896] -- 0:01:07
551500 -- (-199.937) [-202.404] (-205.584) (-208.056) * (-202.836) (-203.694) (-205.124) [-201.393] -- 0:01:07
552000 -- (-203.553) [-197.004] (-210.135) (-196.598) * (-204.410) (-207.160) [-196.491] (-195.329) -- 0:01:07
552500 -- (-202.612) [-198.778] (-196.865) (-198.017) * (-207.575) (-214.567) (-206.382) [-205.974] -- 0:01:07
553000 -- (-204.744) (-207.278) [-198.514] (-196.377) * (-217.258) (-207.150) (-196.889) [-198.085] -- 0:01:07
553500 -- (-199.545) [-199.454] (-207.635) (-202.503) * (-199.327) (-207.606) (-200.731) [-198.830] -- 0:01:06
554000 -- (-200.457) (-197.670) (-203.025) [-203.539] * [-201.145] (-205.170) (-198.743) (-208.660) -- 0:01:06
554500 -- (-210.388) [-198.626] (-209.524) (-199.847) * (-207.745) (-216.263) (-198.886) [-195.798] -- 0:01:06
555000 -- (-203.873) [-194.798] (-216.783) (-205.581) * (-203.367) (-210.138) [-203.956] (-202.833) -- 0:01:07
Average standard deviation of split frequencies: 0.008950
555500 -- (-201.879) (-202.417) [-206.072] (-203.908) * [-203.340] (-202.527) (-203.340) (-203.927) -- 0:01:07
556000 -- (-210.920) (-203.616) [-204.511] (-200.728) * (-207.029) [-206.201] (-203.395) (-208.867) -- 0:01:07
556500 -- (-200.909) [-200.295] (-195.731) (-205.589) * (-204.113) (-206.310) [-193.018] (-199.953) -- 0:01:06
557000 -- (-199.693) [-196.804] (-195.227) (-206.006) * [-201.969] (-200.477) (-205.481) (-214.266) -- 0:01:06
557500 -- (-202.162) (-204.073) [-201.989] (-202.512) * (-200.719) (-212.224) (-197.777) [-199.210] -- 0:01:06
558000 -- (-207.417) (-205.426) [-196.009] (-218.571) * (-198.349) [-208.909] (-198.860) (-201.411) -- 0:01:06
558500 -- (-199.520) [-199.733] (-196.297) (-207.077) * (-210.180) (-207.989) [-192.243] (-198.684) -- 0:01:06
559000 -- [-202.568] (-203.676) (-207.147) (-206.660) * (-203.665) (-204.022) (-194.390) [-194.060] -- 0:01:06
559500 -- (-207.454) (-201.404) (-202.492) [-203.434] * (-208.823) (-210.250) [-196.027] (-205.097) -- 0:01:06
560000 -- [-202.740] (-210.291) (-198.936) (-201.539) * (-205.637) (-212.831) (-195.832) [-201.264] -- 0:01:06
Average standard deviation of split frequencies: 0.009482
560500 -- [-204.004] (-199.825) (-200.643) (-215.333) * (-200.061) (-200.963) [-196.532] (-198.495) -- 0:01:05
561000 -- (-207.625) [-193.857] (-197.388) (-211.658) * (-202.062) [-199.171] (-200.784) (-197.196) -- 0:01:05
561500 -- (-205.406) [-198.898] (-197.350) (-214.066) * (-198.371) [-202.090] (-203.682) (-203.447) -- 0:01:05
562000 -- (-197.900) (-201.233) [-207.605] (-207.507) * (-201.373) (-204.994) (-201.383) [-197.029] -- 0:01:06
562500 -- (-212.455) [-208.365] (-208.534) (-210.160) * (-212.146) (-202.991) (-202.454) [-200.516] -- 0:01:06
563000 -- [-205.757] (-209.476) (-198.368) (-205.767) * (-217.261) (-199.611) [-196.102] (-197.132) -- 0:01:05
563500 -- (-203.757) (-197.845) [-201.509] (-203.169) * (-206.399) (-214.394) (-208.613) [-199.685] -- 0:01:05
564000 -- (-201.289) (-205.880) (-205.030) [-201.356] * (-219.927) (-201.959) [-195.451] (-198.809) -- 0:01:05
564500 -- (-201.724) [-204.116] (-216.640) (-206.666) * (-210.454) [-197.920] (-200.038) (-199.862) -- 0:01:05
565000 -- [-201.643] (-208.205) (-202.873) (-198.168) * [-203.891] (-203.994) (-202.402) (-195.558) -- 0:01:05
Average standard deviation of split frequencies: 0.008884
565500 -- (-203.238) (-208.548) (-201.504) [-198.890] * [-204.662] (-206.718) (-211.683) (-193.889) -- 0:01:05
566000 -- (-206.561) (-200.635) [-199.725] (-198.900) * (-207.195) (-195.750) (-205.292) [-198.619] -- 0:01:05
566500 -- (-201.067) (-202.666) (-203.687) [-200.516] * (-206.722) (-195.523) (-218.318) [-192.939] -- 0:01:05
567000 -- (-202.407) (-198.602) [-199.155] (-201.210) * (-207.671) [-202.347] (-210.942) (-205.974) -- 0:01:04
567500 -- (-206.472) [-200.865] (-202.753) (-213.985) * (-202.485) (-208.450) (-207.787) [-193.416] -- 0:01:04
568000 -- (-210.709) (-194.798) [-198.798] (-205.546) * (-206.026) (-197.930) [-209.472] (-198.205) -- 0:01:04
568500 -- [-200.095] (-203.245) (-205.993) (-202.603) * (-200.792) (-209.982) [-200.690] (-206.789) -- 0:01:04
569000 -- (-214.706) [-199.029] (-211.582) (-198.558) * (-197.411) [-199.160] (-215.230) (-213.313) -- 0:01:05
569500 -- [-198.335] (-198.602) (-206.917) (-202.785) * (-196.518) (-200.239) [-201.917] (-202.983) -- 0:01:05
570000 -- (-213.000) (-205.677) (-199.361) [-198.894] * (-201.140) (-196.084) (-217.269) [-195.056] -- 0:01:04
Average standard deviation of split frequencies: 0.009546
570500 -- (-193.971) (-205.226) (-212.713) [-198.643] * (-205.529) (-209.945) [-200.883] (-196.651) -- 0:01:04
571000 -- (-201.620) (-208.746) (-201.155) [-201.383] * [-201.294] (-208.857) (-205.966) (-196.020) -- 0:01:04
571500 -- (-208.618) (-204.095) (-206.449) [-204.500] * (-206.178) [-199.222] (-198.022) (-196.105) -- 0:01:04
572000 -- (-208.420) (-201.408) (-200.094) [-199.583] * (-201.340) (-201.070) (-210.679) [-193.917] -- 0:01:04
572500 -- (-205.201) (-200.905) [-204.650] (-199.450) * (-208.066) (-205.603) [-196.992] (-206.881) -- 0:01:04
573000 -- (-203.712) (-200.182) (-203.161) [-199.094] * (-201.922) (-209.297) (-201.303) [-197.194] -- 0:01:04
573500 -- (-196.759) (-202.291) [-198.880] (-212.047) * (-208.793) [-204.489] (-210.474) (-194.496) -- 0:01:03
574000 -- (-200.354) (-200.910) (-200.177) [-199.483] * [-200.293] (-210.097) (-195.671) (-197.559) -- 0:01:03
574500 -- (-198.070) (-203.305) (-205.577) [-204.434] * (-201.455) (-216.104) (-198.995) [-204.824] -- 0:01:03
575000 -- (-198.445) (-204.993) (-200.297) [-194.536] * (-204.718) [-196.571] (-204.521) (-203.753) -- 0:01:03
Average standard deviation of split frequencies: 0.009821
575500 -- (-200.459) [-197.600] (-209.865) (-201.211) * [-199.242] (-206.572) (-193.290) (-208.530) -- 0:01:03
576000 -- [-193.575] (-201.200) (-205.096) (-208.015) * (-209.661) (-210.580) [-194.079] (-205.704) -- 0:01:04
576500 -- [-195.935] (-201.390) (-198.051) (-200.588) * [-195.141] (-197.660) (-202.024) (-206.463) -- 0:01:03
577000 -- (-203.195) (-201.780) [-202.364] (-193.605) * (-198.908) (-205.523) (-198.714) [-195.028] -- 0:01:03
577500 -- [-198.677] (-207.684) (-203.832) (-205.092) * (-193.231) (-209.473) (-201.693) [-206.375] -- 0:01:03
578000 -- [-197.409] (-193.543) (-203.928) (-203.380) * (-197.215) (-208.712) [-197.045] (-202.631) -- 0:01:03
578500 -- (-198.564) [-200.881] (-203.187) (-221.580) * (-203.304) [-201.016] (-203.576) (-207.357) -- 0:01:03
579000 -- (-201.200) (-202.827) [-199.566] (-217.520) * (-200.622) [-198.255] (-207.113) (-199.930) -- 0:01:03
579500 -- (-204.082) (-195.178) [-197.974] (-210.186) * [-199.259] (-196.084) (-204.702) (-196.207) -- 0:01:03
580000 -- (-196.675) (-197.523) [-198.973] (-208.166) * [-204.660] (-206.105) (-210.588) (-200.120) -- 0:01:02
Average standard deviation of split frequencies: 0.010373
580500 -- (-202.289) (-200.420) (-200.347) [-198.314] * (-199.277) (-208.352) (-206.138) [-203.009] -- 0:01:02
581000 -- (-200.726) (-196.706) [-198.789] (-207.809) * (-212.188) (-201.362) (-197.558) [-203.669] -- 0:01:02
581500 -- [-196.635] (-201.840) (-201.476) (-200.121) * (-203.250) (-199.886) [-195.212] (-203.716) -- 0:01:02
582000 -- [-203.142] (-196.110) (-223.713) (-201.471) * (-209.981) (-204.038) [-198.231] (-202.667) -- 0:01:02
582500 -- (-210.256) (-198.911) (-213.140) [-207.595] * (-200.574) (-200.980) (-199.295) [-198.932] -- 0:01:02
583000 -- [-201.782] (-201.117) (-206.089) (-208.576) * (-203.846) [-204.749] (-199.655) (-198.050) -- 0:01:02
583500 -- (-203.836) (-200.766) [-197.836] (-207.513) * (-197.544) (-199.011) [-199.102] (-198.012) -- 0:01:02
584000 -- [-204.897] (-199.865) (-196.786) (-209.046) * [-195.667] (-197.005) (-202.724) (-204.766) -- 0:01:02
584500 -- [-200.008] (-195.866) (-205.974) (-202.474) * [-190.459] (-201.806) (-202.523) (-195.960) -- 0:01:02
585000 -- [-202.072] (-205.920) (-203.209) (-202.835) * (-197.147) (-208.748) (-210.315) [-201.094] -- 0:01:02
Average standard deviation of split frequencies: 0.010726
585500 -- (-202.709) [-204.537] (-204.703) (-207.003) * [-197.082] (-203.276) (-207.465) (-207.032) -- 0:01:02
586000 -- (-205.641) [-204.832] (-202.108) (-214.617) * [-200.050] (-206.067) (-210.240) (-196.208) -- 0:01:02
586500 -- (-210.607) (-207.830) [-203.770] (-209.112) * (-203.486) (-200.459) (-202.030) [-201.590] -- 0:01:02
587000 -- (-208.127) [-202.211] (-202.946) (-206.518) * (-207.036) (-199.966) (-205.510) [-196.510] -- 0:01:01
587500 -- [-201.993] (-197.913) (-202.815) (-205.426) * (-214.903) (-204.126) (-201.359) [-193.936] -- 0:01:01
588000 -- (-205.761) (-210.162) [-205.341] (-192.794) * (-202.558) [-200.997] (-205.689) (-201.029) -- 0:01:01
588500 -- (-198.282) [-200.558] (-203.156) (-203.924) * (-203.261) [-202.212] (-202.885) (-200.784) -- 0:01:01
589000 -- (-211.067) [-192.197] (-197.327) (-200.614) * [-201.536] (-198.406) (-212.032) (-198.552) -- 0:01:01
589500 -- (-209.311) (-199.990) (-201.098) [-194.767] * (-212.186) [-204.254] (-207.747) (-203.497) -- 0:01:01
590000 -- (-203.732) (-202.739) [-196.897] (-198.514) * (-203.877) (-201.226) (-199.285) [-197.245] -- 0:01:01
Average standard deviation of split frequencies: 0.010686
590500 -- (-207.065) [-197.210] (-195.653) (-198.423) * (-200.031) (-208.296) [-195.546] (-203.301) -- 0:01:01
591000 -- (-205.625) (-198.368) (-202.656) [-196.807] * (-204.236) (-207.360) (-206.646) [-205.557] -- 0:01:01
591500 -- [-199.972] (-201.380) (-208.157) (-200.892) * (-198.387) (-201.436) (-203.003) [-195.340] -- 0:01:01
592000 -- (-202.002) (-202.308) (-200.132) [-196.764] * (-206.223) (-200.977) [-195.320] (-199.360) -- 0:01:01
592500 -- (-198.543) (-196.888) (-203.466) [-195.667] * (-200.844) (-204.168) (-205.571) [-197.270] -- 0:01:01
593000 -- (-195.720) (-200.065) (-201.124) [-197.443] * [-199.548] (-211.856) (-212.486) (-197.528) -- 0:01:01
593500 -- (-220.110) (-201.390) (-204.466) [-200.499] * [-197.539] (-208.103) (-204.457) (-198.828) -- 0:01:00
594000 -- (-202.639) (-202.160) (-196.274) [-195.308] * (-208.845) (-201.706) (-200.903) [-196.071] -- 0:01:00
594500 -- [-203.081] (-208.310) (-206.034) (-190.881) * (-199.896) (-203.865) [-198.786] (-206.937) -- 0:01:00
595000 -- (-207.280) (-206.432) (-198.044) [-190.483] * [-200.389] (-204.710) (-216.336) (-200.549) -- 0:01:00
Average standard deviation of split frequencies: 0.009975
595500 -- (-197.101) (-203.281) (-215.044) [-201.079] * (-199.242) (-205.451) (-202.123) [-201.541] -- 0:01:00
596000 -- [-198.641] (-196.909) (-202.613) (-204.445) * [-197.262] (-209.538) (-201.719) (-192.527) -- 0:01:00
596500 -- [-205.410] (-199.920) (-198.013) (-200.953) * (-206.734) (-206.951) (-203.905) [-196.384] -- 0:01:00
597000 -- [-199.419] (-205.954) (-206.052) (-200.800) * (-195.649) (-203.862) (-215.594) [-193.028] -- 0:01:00
597500 -- (-214.704) (-200.876) (-194.883) [-195.827] * (-202.310) [-202.065] (-204.012) (-201.088) -- 0:01:00
598000 -- (-208.530) (-204.966) (-202.707) [-199.937] * (-203.969) (-202.806) [-199.646] (-194.662) -- 0:01:00
598500 -- (-200.735) (-201.272) (-206.016) [-199.786] * (-203.192) (-212.583) (-205.720) [-202.538] -- 0:01:00
599000 -- [-206.678] (-205.605) (-202.112) (-203.531) * (-201.281) [-197.808] (-202.225) (-207.480) -- 0:01:00
599500 -- (-196.418) [-193.098] (-196.532) (-208.436) * (-208.363) (-205.191) (-205.240) [-199.202] -- 0:01:00
600000 -- (-203.158) (-201.087) (-199.129) [-201.275] * (-201.397) (-206.536) (-199.298) [-197.876] -- 0:00:59
Average standard deviation of split frequencies: 0.010115
600500 -- (-198.895) [-196.235] (-197.038) (-195.893) * (-199.604) [-195.456] (-211.135) (-198.375) -- 0:00:59
601000 -- (-211.505) (-196.502) [-199.124] (-199.059) * (-197.474) (-206.886) [-197.410] (-202.444) -- 0:00:59
601500 -- [-203.236] (-199.952) (-210.532) (-198.074) * (-193.549) (-203.003) [-199.024] (-201.988) -- 0:00:59
602000 -- (-201.522) (-203.543) (-195.352) [-201.773] * [-194.206] (-202.529) (-192.977) (-201.244) -- 0:00:59
602500 -- (-206.907) (-201.015) (-203.546) [-190.384] * (-196.918) [-197.324] (-198.005) (-215.106) -- 0:00:59
603000 -- [-200.291] (-198.480) (-195.863) (-202.664) * (-199.528) (-211.035) (-198.028) [-198.941] -- 0:00:59
603500 -- (-198.585) [-198.333] (-209.938) (-208.229) * (-199.482) [-197.937] (-200.468) (-198.126) -- 0:00:59
604000 -- (-206.792) (-197.132) [-207.333] (-203.350) * [-202.897] (-204.990) (-198.051) (-200.695) -- 0:00:59
604500 -- [-198.581] (-200.560) (-205.355) (-201.509) * (-200.462) (-199.768) (-202.337) [-195.391] -- 0:00:59
605000 -- [-210.049] (-209.486) (-200.745) (-199.506) * (-202.335) (-205.163) (-201.227) [-199.406] -- 0:00:59
Average standard deviation of split frequencies: 0.010113
605500 -- [-198.468] (-198.616) (-198.162) (-201.301) * (-199.870) (-204.320) [-204.713] (-200.883) -- 0:00:59
606000 -- (-205.607) (-201.186) (-197.202) [-196.216] * [-199.040] (-202.208) (-194.354) (-199.123) -- 0:00:59
606500 -- (-203.436) (-208.606) (-198.611) [-203.203] * [-200.328] (-191.959) (-201.324) (-202.954) -- 0:00:59
607000 -- (-209.550) [-194.813] (-205.102) (-207.819) * [-198.987] (-204.603) (-203.226) (-209.085) -- 0:00:58
607500 -- (-200.423) (-210.503) [-191.616] (-204.254) * (-205.643) (-199.624) (-202.847) [-199.085] -- 0:00:58
608000 -- (-207.552) [-203.036] (-202.373) (-204.899) * (-196.473) (-207.570) (-197.850) [-206.801] -- 0:00:58
608500 -- (-201.885) (-201.713) (-199.347) [-205.012] * [-197.261] (-207.761) (-208.233) (-204.061) -- 0:00:58
609000 -- (-206.099) (-203.150) [-197.212] (-204.383) * (-196.949) [-198.428] (-213.581) (-207.415) -- 0:00:58
609500 -- (-199.983) [-197.472] (-203.469) (-205.550) * [-197.641] (-198.160) (-200.312) (-207.607) -- 0:00:58
610000 -- [-195.521] (-197.752) (-215.257) (-209.161) * (-199.344) (-195.256) (-194.564) [-202.087] -- 0:00:58
Average standard deviation of split frequencies: 0.010207
610500 -- [-200.562] (-197.699) (-200.390) (-219.289) * (-206.894) (-205.916) [-199.818] (-213.138) -- 0:00:58
611000 -- [-201.460] (-210.371) (-205.573) (-197.404) * (-215.264) (-203.994) [-200.335] (-209.558) -- 0:00:57
611500 -- [-199.190] (-200.856) (-208.649) (-207.038) * (-204.202) (-204.039) [-203.259] (-202.353) -- 0:00:57
612000 -- (-197.713) (-199.364) (-201.184) [-206.052] * (-202.312) [-195.533] (-204.875) (-205.862) -- 0:00:58
612500 -- (-201.722) (-194.952) (-215.709) [-197.269] * (-199.429) [-195.524] (-208.561) (-205.648) -- 0:00:58
613000 -- (-201.842) [-192.072] (-205.690) (-209.131) * (-212.475) (-199.893) [-198.572] (-210.463) -- 0:00:58
613500 -- (-202.168) [-194.959] (-198.096) (-201.712) * (-209.588) (-213.129) [-196.205] (-204.432) -- 0:00:57
614000 -- [-204.785] (-201.985) (-205.553) (-216.951) * (-202.655) (-195.315) (-198.840) [-211.067] -- 0:00:57
614500 -- [-201.310] (-204.273) (-204.987) (-202.806) * (-203.929) (-198.646) [-200.714] (-205.865) -- 0:00:57
615000 -- (-204.096) (-213.750) [-200.970] (-214.419) * (-207.594) (-212.483) (-204.101) [-199.654] -- 0:00:57
Average standard deviation of split frequencies: 0.009693
615500 -- (-203.056) (-199.319) [-204.523] (-208.660) * (-200.758) (-207.933) (-206.332) [-202.426] -- 0:00:57
616000 -- (-210.149) (-206.096) [-199.097] (-201.781) * [-199.230] (-203.651) (-196.293) (-204.067) -- 0:00:57
616500 -- (-210.777) (-201.601) (-201.269) [-200.649] * (-194.297) [-198.544] (-209.777) (-207.242) -- 0:00:57
617000 -- [-201.891] (-201.731) (-216.887) (-200.786) * [-201.958] (-205.182) (-202.219) (-197.829) -- 0:00:57
617500 -- (-201.345) (-200.231) [-199.235] (-205.198) * [-200.394] (-211.512) (-204.104) (-205.841) -- 0:00:56
618000 -- (-204.623) (-202.508) (-198.955) [-198.554] * [-198.827] (-208.839) (-198.979) (-203.455) -- 0:00:56
618500 -- (-198.380) [-193.522] (-202.750) (-201.676) * (-198.818) [-201.317] (-201.980) (-206.043) -- 0:00:56
619000 -- [-194.207] (-212.681) (-199.055) (-206.082) * (-205.698) [-199.282] (-205.668) (-203.422) -- 0:00:57
619500 -- [-199.388] (-201.445) (-194.946) (-210.485) * [-195.259] (-208.065) (-203.962) (-201.993) -- 0:00:57
620000 -- (-202.124) (-206.076) [-198.125] (-204.482) * [-201.750] (-203.784) (-204.218) (-223.319) -- 0:00:56
Average standard deviation of split frequencies: 0.009241
620500 -- [-196.628] (-202.017) (-209.269) (-206.637) * [-202.169] (-195.974) (-201.421) (-205.824) -- 0:00:56
621000 -- [-201.810] (-202.977) (-213.832) (-205.139) * (-209.015) (-198.857) (-198.400) [-194.910] -- 0:00:56
621500 -- (-202.883) [-196.027] (-197.277) (-196.155) * (-208.608) [-198.541] (-199.026) (-192.841) -- 0:00:56
622000 -- (-195.073) (-196.051) [-201.505] (-200.225) * (-202.842) [-200.650] (-204.536) (-205.415) -- 0:00:56
622500 -- (-199.437) [-201.383] (-213.662) (-209.014) * (-206.724) (-207.923) (-211.663) [-203.663] -- 0:00:56
623000 -- (-197.394) (-200.568) (-208.543) [-198.694] * (-200.982) [-198.295] (-209.035) (-197.199) -- 0:00:56
623500 -- (-201.728) (-207.267) (-202.369) [-203.909] * (-206.157) [-194.166] (-206.148) (-199.748) -- 0:00:56
624000 -- (-207.000) [-201.183] (-211.863) (-201.132) * [-200.906] (-196.708) (-211.663) (-198.227) -- 0:00:56
624500 -- [-197.676] (-205.628) (-204.091) (-203.817) * (-211.062) (-201.849) (-197.015) [-194.857] -- 0:00:55
625000 -- (-206.218) (-206.861) (-206.706) [-192.703] * (-205.610) (-201.585) [-205.023] (-198.081) -- 0:00:55
Average standard deviation of split frequencies: 0.009162
625500 -- (-210.823) [-194.765] (-219.845) (-196.949) * (-222.310) (-199.854) (-203.163) [-198.828] -- 0:00:55
626000 -- (-199.616) (-192.893) [-202.238] (-201.657) * (-205.026) [-199.937] (-206.367) (-208.548) -- 0:00:56
626500 -- [-217.186] (-198.252) (-207.283) (-201.741) * (-210.240) (-202.787) [-203.121] (-200.893) -- 0:00:56
627000 -- (-213.886) [-195.757] (-212.224) (-200.317) * [-201.019] (-205.753) (-199.663) (-203.982) -- 0:00:55
627500 -- [-198.141] (-199.857) (-213.870) (-201.697) * (-212.246) [-200.114] (-203.139) (-197.394) -- 0:00:55
628000 -- (-215.985) [-196.615] (-203.256) (-198.785) * (-201.877) (-200.593) (-202.516) [-197.249] -- 0:00:55
628500 -- (-205.005) [-199.660] (-210.702) (-203.403) * (-205.059) [-195.998] (-195.361) (-207.539) -- 0:00:55
629000 -- (-203.130) [-202.731] (-205.401) (-206.668) * (-215.586) (-201.006) (-205.827) [-204.310] -- 0:00:55
629500 -- (-200.785) (-198.277) [-204.635] (-205.724) * (-207.764) [-196.831] (-207.298) (-206.640) -- 0:00:55
630000 -- (-208.800) [-197.083] (-210.298) (-202.071) * (-203.846) [-204.853] (-196.705) (-208.525) -- 0:00:55
Average standard deviation of split frequencies: 0.009966
630500 -- [-200.437] (-198.773) (-201.792) (-208.157) * (-200.694) (-201.004) [-193.541] (-209.434) -- 0:00:55
631000 -- (-200.239) (-202.399) [-203.885] (-204.051) * [-203.448] (-204.445) (-202.471) (-197.550) -- 0:00:54
631500 -- (-211.283) (-199.080) (-206.289) [-201.833] * (-198.612) (-211.154) (-200.221) [-199.281] -- 0:00:54
632000 -- (-207.245) (-199.370) (-203.154) [-206.049] * [-196.558] (-207.337) (-194.100) (-206.452) -- 0:00:54
632500 -- (-204.189) [-202.572] (-197.902) (-208.727) * [-201.176] (-209.309) (-214.343) (-202.051) -- 0:00:54
633000 -- [-203.199] (-200.170) (-205.557) (-207.855) * (-204.171) (-215.000) (-199.578) [-200.251] -- 0:00:55
633500 -- (-199.723) (-200.873) [-194.722] (-208.988) * (-210.223) (-220.628) (-194.861) [-205.061] -- 0:00:54
634000 -- (-205.637) [-196.719] (-199.082) (-201.386) * (-200.035) (-209.733) [-197.869] (-212.240) -- 0:00:54
634500 -- [-203.733] (-209.075) (-196.600) (-198.073) * (-205.360) (-210.836) [-196.193] (-205.281) -- 0:00:54
635000 -- (-202.396) (-206.194) [-198.784] (-199.190) * [-195.610] (-207.158) (-201.669) (-207.831) -- 0:00:54
Average standard deviation of split frequencies: 0.009224
635500 -- (-209.143) [-199.199] (-206.147) (-203.631) * (-210.244) [-199.679] (-201.539) (-203.423) -- 0:00:54
636000 -- (-200.538) (-205.231) [-201.561] (-199.854) * (-206.463) (-201.745) (-199.470) [-204.143] -- 0:00:54
636500 -- [-206.104] (-206.576) (-202.543) (-208.939) * [-200.285] (-199.686) (-203.912) (-201.608) -- 0:00:54
637000 -- (-208.400) (-210.368) (-200.219) [-197.837] * [-204.807] (-195.653) (-209.953) (-201.623) -- 0:00:54
637500 -- (-204.958) (-200.368) [-198.038] (-208.601) * (-200.533) (-216.772) [-205.771] (-202.701) -- 0:00:54
638000 -- (-205.773) [-197.406] (-200.473) (-204.770) * (-205.983) (-206.170) (-200.563) [-202.088] -- 0:00:53
638500 -- (-202.301) (-209.118) [-199.336] (-206.545) * (-204.590) (-201.148) (-203.273) [-208.154] -- 0:00:53
639000 -- (-212.842) [-199.070] (-214.291) (-208.071) * [-195.800] (-200.722) (-205.237) (-206.354) -- 0:00:53
639500 -- (-206.665) [-193.578] (-213.977) (-207.872) * (-196.060) (-212.788) [-195.128] (-198.174) -- 0:00:53
640000 -- (-200.657) (-200.155) [-204.449] (-210.162) * (-209.126) [-202.861] (-200.913) (-202.722) -- 0:00:53
Average standard deviation of split frequencies: 0.009361
640500 -- (-208.115) (-192.250) [-198.951] (-208.724) * (-201.670) (-207.571) (-199.448) [-195.205] -- 0:00:53
641000 -- (-208.472) (-202.779) [-202.572] (-214.669) * (-197.590) (-202.731) (-206.100) [-193.482] -- 0:00:53
641500 -- (-190.589) (-206.396) (-205.578) [-201.531] * (-195.386) [-196.279] (-213.083) (-204.811) -- 0:00:53
642000 -- (-201.917) (-204.589) [-201.132] (-200.731) * (-206.822) (-197.128) [-203.077] (-196.434) -- 0:00:53
642500 -- (-207.147) [-196.787] (-196.112) (-194.336) * (-206.616) (-200.488) [-202.135] (-196.497) -- 0:00:53
643000 -- (-205.596) (-194.605) [-196.169] (-203.216) * (-198.877) [-195.127] (-201.332) (-196.611) -- 0:00:53
643500 -- [-200.920] (-205.599) (-201.681) (-203.836) * (-195.265) [-203.574] (-197.683) (-196.997) -- 0:00:53
644000 -- (-208.318) [-202.853] (-201.055) (-211.236) * (-209.045) (-196.274) [-199.613] (-195.397) -- 0:00:53
644500 -- (-203.437) (-207.609) [-205.364] (-203.232) * (-196.101) [-192.470] (-198.236) (-193.813) -- 0:00:52
645000 -- [-196.607] (-200.104) (-206.109) (-203.268) * [-202.048] (-200.460) (-198.039) (-199.428) -- 0:00:52
Average standard deviation of split frequencies: 0.009000
645500 -- [-194.117] (-203.940) (-202.817) (-203.279) * (-202.769) (-199.396) [-198.995] (-202.988) -- 0:00:52
646000 -- (-198.975) (-206.571) (-205.424) [-198.500] * (-200.151) (-207.507) (-203.552) [-197.973] -- 0:00:52
646500 -- [-195.697] (-203.452) (-199.735) (-199.271) * [-197.721] (-202.294) (-197.181) (-199.830) -- 0:00:52
647000 -- (-197.717) [-202.978] (-206.188) (-198.966) * [-206.663] (-209.902) (-201.691) (-201.171) -- 0:00:52
647500 -- (-202.982) [-203.287] (-205.411) (-200.955) * (-215.076) (-214.147) [-204.869] (-195.909) -- 0:00:52
648000 -- (-207.842) [-202.216] (-210.241) (-197.012) * (-204.771) (-213.491) [-200.098] (-201.447) -- 0:00:52
648500 -- (-203.854) (-199.417) [-200.651] (-205.780) * (-205.155) (-201.331) [-201.982] (-198.062) -- 0:00:52
649000 -- [-202.494] (-201.556) (-204.645) (-207.795) * (-202.221) (-204.612) [-199.996] (-200.139) -- 0:00:52
649500 -- [-198.274] (-201.807) (-208.969) (-205.310) * (-204.613) [-203.537] (-204.885) (-199.543) -- 0:00:52
650000 -- (-211.711) [-191.610] (-199.585) (-213.939) * [-197.760] (-204.172) (-196.564) (-203.268) -- 0:00:52
Average standard deviation of split frequencies: 0.008734
650500 -- (-198.070) [-198.622] (-202.931) (-205.823) * (-205.774) (-205.923) (-195.650) [-195.628] -- 0:00:52
651000 -- [-210.931] (-200.211) (-203.875) (-202.311) * (-205.265) (-212.296) [-193.553] (-208.351) -- 0:00:52
651500 -- [-204.225] (-196.700) (-208.858) (-209.365) * (-212.911) [-198.405] (-204.194) (-205.329) -- 0:00:51
652000 -- (-210.050) (-195.970) (-202.056) [-202.463] * (-203.151) [-198.037] (-205.007) (-200.572) -- 0:00:51
652500 -- (-204.181) (-209.628) [-195.084] (-211.135) * (-206.832) (-210.237) [-197.100] (-207.254) -- 0:00:51
653000 -- (-204.526) (-197.872) [-201.527] (-209.864) * (-198.050) (-199.744) (-203.937) [-195.178] -- 0:00:51
653500 -- (-200.618) (-196.162) [-196.736] (-205.382) * (-202.431) (-201.332) [-198.239] (-202.551) -- 0:00:51
654000 -- (-208.683) (-214.025) (-203.657) [-201.975] * (-199.894) (-205.884) [-198.154] (-199.716) -- 0:00:51
654500 -- [-203.737] (-210.606) (-195.374) (-209.171) * (-197.756) (-200.294) [-190.662] (-201.646) -- 0:00:51
655000 -- (-208.190) [-203.242] (-197.317) (-206.926) * (-213.294) (-207.173) (-207.010) [-195.146] -- 0:00:51
Average standard deviation of split frequencies: 0.008424
655500 -- (-206.258) (-208.080) [-207.380] (-198.653) * (-202.279) (-197.952) [-194.502] (-198.161) -- 0:00:51
656000 -- (-196.541) (-201.251) [-195.674] (-209.237) * (-200.999) [-200.669] (-205.912) (-195.819) -- 0:00:51
656500 -- (-212.942) [-202.479] (-201.680) (-203.180) * (-204.753) (-204.887) [-204.819] (-204.601) -- 0:00:51
657000 -- [-205.708] (-206.887) (-212.677) (-196.068) * (-202.412) (-193.141) (-199.623) [-205.551] -- 0:00:51
657500 -- (-213.414) (-198.941) (-201.901) [-198.533] * (-212.169) [-194.281] (-196.461) (-201.523) -- 0:00:51
658000 -- (-204.159) [-198.549] (-209.141) (-202.974) * (-200.815) [-199.750] (-216.547) (-200.047) -- 0:00:50
658500 -- (-202.210) [-199.297] (-204.101) (-202.378) * (-205.928) [-195.547] (-202.843) (-200.621) -- 0:00:50
659000 -- [-206.375] (-196.633) (-201.820) (-195.347) * (-203.820) [-203.807] (-207.577) (-198.066) -- 0:00:50
659500 -- (-197.565) (-195.947) (-209.377) [-192.912] * (-197.819) [-199.393] (-196.963) (-202.382) -- 0:00:50
660000 -- (-198.412) (-198.644) [-197.992] (-203.486) * [-204.451] (-203.742) (-200.801) (-199.631) -- 0:00:50
Average standard deviation of split frequencies: 0.008245
660500 -- (-201.142) (-199.034) (-206.192) [-202.966] * (-199.576) (-195.696) (-196.616) [-195.854] -- 0:00:50
661000 -- (-202.194) (-199.166) [-201.975] (-206.749) * (-210.826) [-201.675] (-198.201) (-193.484) -- 0:00:50
661500 -- (-206.835) (-193.007) (-221.065) [-206.904] * (-208.928) (-194.036) [-198.376] (-208.091) -- 0:00:50
662000 -- (-206.269) [-198.057] (-221.025) (-202.781) * (-200.267) (-191.695) (-197.255) [-191.575] -- 0:00:50
662500 -- (-199.811) (-201.740) (-208.711) [-195.501] * [-200.807] (-213.436) (-197.744) (-204.534) -- 0:00:50
663000 -- (-195.157) (-199.081) [-202.937] (-198.276) * (-196.276) (-212.679) (-203.762) [-199.578] -- 0:00:50
663500 -- (-196.784) (-204.334) [-199.445] (-195.121) * (-206.583) [-205.221] (-206.158) (-210.716) -- 0:00:50
664000 -- (-202.203) (-193.456) (-207.779) [-198.479] * (-207.892) [-201.081] (-201.764) (-210.188) -- 0:00:50
664500 -- [-192.823] (-201.875) (-197.785) (-207.528) * (-197.331) (-199.131) (-201.999) [-201.233] -- 0:00:49
665000 -- [-195.205] (-200.504) (-199.519) (-202.634) * [-193.411] (-202.270) (-206.974) (-199.302) -- 0:00:49
Average standard deviation of split frequencies: 0.008297
665500 -- [-197.749] (-193.965) (-202.517) (-200.584) * (-208.883) [-199.422] (-208.963) (-202.082) -- 0:00:49
666000 -- [-195.859] (-201.666) (-206.719) (-196.479) * [-203.943] (-206.669) (-201.923) (-207.477) -- 0:00:49
666500 -- [-199.603] (-207.170) (-207.630) (-201.292) * [-200.452] (-199.653) (-208.633) (-199.470) -- 0:00:49
667000 -- [-205.098] (-211.283) (-205.371) (-197.943) * (-203.831) (-208.199) [-194.528] (-201.733) -- 0:00:49
667500 -- (-198.548) (-204.261) (-209.447) [-194.333] * (-203.173) (-203.023) [-202.051] (-202.852) -- 0:00:49
668000 -- [-196.535] (-208.086) (-201.083) (-199.918) * (-205.909) (-213.225) [-196.823] (-200.396) -- 0:00:49
668500 -- (-202.982) (-208.024) [-201.077] (-200.120) * (-207.704) (-201.912) [-199.490] (-202.771) -- 0:00:49
669000 -- (-202.125) (-203.657) (-211.415) [-198.561] * (-203.207) (-196.763) [-196.674] (-208.676) -- 0:00:49
669500 -- (-212.439) (-202.432) [-196.926] (-209.298) * (-207.911) (-204.532) [-197.530] (-205.228) -- 0:00:49
670000 -- (-213.419) (-212.884) [-194.279] (-201.836) * (-207.187) (-199.802) (-206.268) [-199.289] -- 0:00:49
Average standard deviation of split frequencies: 0.007849
670500 -- [-204.685] (-200.797) (-197.096) (-205.010) * (-206.820) (-201.056) [-193.886] (-200.317) -- 0:00:49
671000 -- [-199.157] (-201.250) (-204.806) (-201.059) * (-199.420) (-210.847) [-196.533] (-205.507) -- 0:00:49
671500 -- (-205.886) (-205.721) (-212.335) [-192.650] * (-206.872) (-198.963) (-206.325) [-205.577] -- 0:00:48
672000 -- [-196.695] (-206.342) (-210.950) (-192.416) * (-202.225) (-209.800) [-198.584] (-201.543) -- 0:00:48
672500 -- (-206.122) (-206.120) (-205.197) [-196.810] * (-199.009) (-210.454) [-199.895] (-206.250) -- 0:00:48
673000 -- (-202.243) [-196.876] (-202.240) (-203.925) * (-215.575) (-215.919) [-199.343] (-201.662) -- 0:00:48
673500 -- (-202.367) (-203.578) (-205.088) [-199.051] * (-201.656) (-204.985) [-201.745] (-214.837) -- 0:00:48
674000 -- [-208.374] (-207.390) (-203.138) (-199.619) * (-207.400) (-207.518) [-199.530] (-203.486) -- 0:00:48
674500 -- (-206.455) (-205.090) (-197.051) [-198.601] * [-213.585] (-195.512) (-202.798) (-210.072) -- 0:00:48
675000 -- (-197.431) (-198.549) [-205.589] (-214.416) * (-198.100) (-204.192) (-207.510) [-194.726] -- 0:00:48
Average standard deviation of split frequencies: 0.007826
675500 -- (-203.967) (-214.872) [-204.152] (-206.579) * (-196.538) (-213.396) (-200.843) [-197.758] -- 0:00:48
676000 -- (-203.842) (-206.274) [-203.239] (-201.680) * (-202.055) [-193.819] (-206.249) (-201.354) -- 0:00:48
676500 -- (-209.208) (-199.339) (-200.306) [-197.055] * (-200.092) [-195.735] (-202.817) (-200.952) -- 0:00:48
677000 -- [-208.204] (-199.536) (-195.626) (-202.197) * (-200.204) [-195.676] (-210.771) (-203.057) -- 0:00:48
677500 -- (-204.799) [-198.205] (-210.774) (-199.482) * (-200.550) (-198.137) (-209.345) [-203.190] -- 0:00:48
678000 -- (-203.129) (-201.024) (-204.113) [-197.579] * (-214.104) (-203.210) (-203.334) [-194.733] -- 0:00:47
678500 -- [-199.265] (-203.662) (-209.960) (-203.101) * (-206.708) (-203.796) (-203.598) [-194.738] -- 0:00:47
679000 -- [-197.392] (-203.482) (-210.694) (-209.945) * (-204.598) [-204.885] (-200.928) (-202.124) -- 0:00:47
679500 -- (-202.314) (-205.200) [-203.984] (-206.836) * (-204.016) [-196.498] (-204.587) (-204.965) -- 0:00:47
680000 -- (-202.057) (-210.651) [-206.331] (-204.618) * (-206.611) (-209.510) [-199.334] (-210.670) -- 0:00:47
Average standard deviation of split frequencies: 0.008388
680500 -- (-200.792) [-201.467] (-205.894) (-204.962) * [-204.566] (-203.000) (-204.997) (-206.969) -- 0:00:47
681000 -- (-215.992) (-202.197) (-203.495) [-193.948] * (-208.587) (-198.016) (-211.370) [-196.980] -- 0:00:47
681500 -- (-205.629) [-201.892] (-212.828) (-201.144) * (-203.933) [-206.942] (-205.603) (-194.865) -- 0:00:47
682000 -- (-200.979) (-200.097) (-203.310) [-203.793] * (-193.772) [-199.946] (-201.056) (-199.282) -- 0:00:47
682500 -- [-195.206] (-202.540) (-201.147) (-204.577) * [-199.494] (-196.059) (-207.586) (-198.028) -- 0:00:46
683000 -- (-201.222) (-195.443) [-196.970] (-201.994) * [-195.039] (-196.694) (-196.720) (-207.621) -- 0:00:47
683500 -- (-203.740) (-200.611) (-204.881) [-204.868] * [-193.232] (-199.918) (-203.547) (-204.068) -- 0:00:47
684000 -- [-193.267] (-201.466) (-202.104) (-210.256) * (-204.999) (-203.066) (-203.617) [-194.663] -- 0:00:47
684500 -- (-212.631) (-204.645) (-203.377) [-203.232] * (-200.220) (-203.344) [-198.759] (-206.520) -- 0:00:47
685000 -- (-204.473) (-200.175) [-197.749] (-208.668) * [-203.532] (-200.609) (-207.715) (-196.501) -- 0:00:46
Average standard deviation of split frequencies: 0.008399
685500 -- (-205.196) (-197.179) (-206.645) [-200.186] * (-204.751) [-205.127] (-200.022) (-204.845) -- 0:00:46
686000 -- (-209.065) (-202.919) (-198.492) [-195.047] * (-202.454) (-209.643) [-195.008] (-204.136) -- 0:00:46
686500 -- (-196.676) [-207.561] (-208.191) (-198.405) * (-203.241) (-202.519) (-200.809) [-202.499] -- 0:00:46
687000 -- [-198.023] (-203.939) (-192.747) (-197.245) * (-202.410) (-207.520) [-203.781] (-204.076) -- 0:00:46
687500 -- (-201.532) (-209.977) (-209.600) [-202.987] * (-204.769) (-207.439) [-197.880] (-206.924) -- 0:00:46
688000 -- (-210.301) (-204.513) [-197.471] (-200.213) * (-207.113) (-202.574) (-198.086) [-196.143] -- 0:00:46
688500 -- [-205.487] (-210.644) (-200.149) (-202.379) * (-208.866) (-197.749) [-192.478] (-212.548) -- 0:00:46
689000 -- (-203.638) [-192.209] (-198.565) (-204.006) * (-208.233) (-204.229) (-200.922) [-205.140] -- 0:00:46
689500 -- (-209.115) [-197.320] (-197.577) (-208.858) * (-201.735) [-208.211] (-201.290) (-208.771) -- 0:00:45
690000 -- (-204.053) [-197.369] (-209.893) (-209.975) * (-203.683) [-204.477] (-205.229) (-208.505) -- 0:00:46
Average standard deviation of split frequencies: 0.008418
690500 -- (-198.269) [-195.501] (-208.949) (-208.855) * [-200.980] (-210.402) (-207.172) (-204.644) -- 0:00:46
691000 -- [-197.513] (-197.262) (-209.460) (-203.799) * (-196.736) (-207.619) [-203.520] (-208.676) -- 0:00:46
691500 -- (-207.597) (-196.488) (-213.675) [-196.652] * (-196.049) (-204.073) (-207.785) [-197.652] -- 0:00:45
692000 -- [-197.542] (-207.477) (-209.289) (-202.735) * (-201.375) (-198.373) (-208.097) [-193.198] -- 0:00:45
692500 -- (-199.551) [-201.530] (-204.507) (-203.562) * (-204.593) [-194.539] (-206.339) (-201.272) -- 0:00:45
693000 -- (-201.496) (-194.368) (-210.546) [-210.355] * (-209.469) (-203.525) (-208.227) [-198.945] -- 0:00:45
693500 -- (-202.181) (-203.172) (-196.084) [-198.992] * [-197.085] (-212.928) (-202.607) (-204.129) -- 0:00:45
694000 -- (-199.979) [-197.618] (-193.580) (-215.505) * (-208.104) (-209.179) [-206.211] (-204.706) -- 0:00:45
694500 -- (-208.097) (-201.363) [-203.520] (-202.113) * (-201.150) (-212.243) (-208.194) [-202.945] -- 0:00:45
695000 -- (-205.987) (-197.772) [-195.210] (-210.045) * [-201.549] (-210.050) (-204.476) (-195.975) -- 0:00:45
Average standard deviation of split frequencies: 0.008504
695500 -- (-205.745) (-195.492) (-206.529) [-198.733] * [-204.541] (-201.601) (-203.576) (-199.367) -- 0:00:45
696000 -- (-199.963) (-199.429) (-201.616) [-199.457] * [-196.265] (-204.056) (-212.305) (-202.568) -- 0:00:44
696500 -- (-209.165) [-191.477] (-202.902) (-202.568) * [-195.893] (-210.401) (-201.010) (-199.440) -- 0:00:44
697000 -- (-206.960) (-204.532) [-194.603] (-202.278) * (-204.008) (-207.196) (-206.862) [-200.252] -- 0:00:45
697500 -- (-204.738) (-195.899) [-199.622] (-209.999) * [-199.211] (-206.166) (-217.537) (-196.075) -- 0:00:45
698000 -- (-208.296) [-194.959] (-204.388) (-201.324) * (-209.671) (-214.473) (-206.212) [-200.515] -- 0:00:44
698500 -- [-199.975] (-201.451) (-204.614) (-200.960) * [-199.577] (-206.703) (-207.227) (-208.675) -- 0:00:44
699000 -- (-211.580) (-200.292) [-197.905] (-202.999) * (-200.129) (-204.044) (-201.575) [-204.021] -- 0:00:44
699500 -- (-212.815) [-196.080] (-194.209) (-205.934) * [-200.165] (-210.279) (-199.124) (-211.670) -- 0:00:44
700000 -- (-205.744) (-195.811) [-194.526] (-204.090) * [-197.370] (-203.859) (-210.967) (-206.666) -- 0:00:44
Average standard deviation of split frequencies: 0.008298
700500 -- (-208.425) (-199.295) [-202.116] (-205.230) * (-200.170) [-204.615] (-200.253) (-202.926) -- 0:00:44
701000 -- (-207.496) (-197.174) [-197.779] (-205.420) * (-208.477) (-207.017) (-199.108) [-196.398] -- 0:00:44
701500 -- (-205.848) [-203.976] (-207.757) (-202.278) * (-203.357) (-206.234) [-209.577] (-198.270) -- 0:00:44
702000 -- (-201.707) (-202.957) (-205.614) [-203.139] * (-202.353) (-203.911) [-194.862] (-202.353) -- 0:00:44
702500 -- (-202.124) (-209.653) (-198.693) [-200.291] * (-206.443) (-209.570) [-199.254] (-195.009) -- 0:00:44
703000 -- (-213.578) (-205.205) (-199.528) [-198.018] * (-202.891) (-206.062) [-201.976] (-197.438) -- 0:00:43
703500 -- (-208.161) (-204.865) (-197.719) [-199.997] * (-209.539) (-200.480) (-207.925) [-203.768] -- 0:00:43
704000 -- (-208.078) [-203.481] (-193.039) (-199.328) * (-214.388) [-201.666] (-201.453) (-203.365) -- 0:00:43
704500 -- (-204.361) [-200.251] (-206.369) (-204.774) * [-205.498] (-205.081) (-200.043) (-200.495) -- 0:00:44
705000 -- (-201.770) [-200.120] (-199.397) (-201.607) * (-199.444) (-209.026) (-198.951) [-209.246] -- 0:00:43
Average standard deviation of split frequencies: 0.008161
705500 -- (-205.226) [-200.608] (-195.677) (-197.888) * [-197.604] (-209.561) (-200.118) (-197.941) -- 0:00:43
706000 -- (-201.388) (-198.826) (-198.560) [-191.721] * [-193.172] (-207.152) (-201.498) (-208.690) -- 0:00:43
706500 -- (-206.641) [-192.648] (-195.949) (-203.259) * [-202.228] (-208.932) (-198.500) (-202.033) -- 0:00:43
707000 -- (-210.957) [-194.149] (-199.039) (-201.582) * [-195.999] (-203.094) (-205.642) (-193.110) -- 0:00:43
707500 -- (-208.459) [-200.208] (-202.503) (-203.007) * [-197.109] (-208.574) (-204.470) (-202.983) -- 0:00:43
708000 -- [-194.262] (-203.613) (-205.735) (-198.489) * (-206.971) (-204.039) (-206.869) [-200.060] -- 0:00:43
708500 -- (-197.699) (-200.055) (-209.975) [-195.275] * (-209.684) (-195.389) (-203.880) [-204.068] -- 0:00:43
709000 -- [-198.771] (-204.280) (-201.277) (-198.783) * [-201.080] (-201.536) (-197.049) (-201.013) -- 0:00:43
709500 -- (-198.844) (-200.635) (-205.243) [-199.620] * [-195.375] (-201.307) (-206.805) (-200.187) -- 0:00:42
710000 -- (-197.511) (-201.678) (-206.092) [-202.859] * (-195.783) (-209.125) [-205.566] (-197.792) -- 0:00:42
Average standard deviation of split frequencies: 0.008808
710500 -- [-195.245] (-204.398) (-198.829) (-201.019) * (-196.941) [-199.598] (-203.418) (-198.015) -- 0:00:42
711000 -- [-195.194] (-194.907) (-211.552) (-200.228) * (-210.511) (-192.419) (-209.080) [-201.031] -- 0:00:42
711500 -- (-214.770) [-194.735] (-200.627) (-195.715) * (-198.900) (-202.940) [-194.952] (-203.582) -- 0:00:42
712000 -- (-213.741) (-207.498) (-206.715) [-205.084] * (-198.484) [-207.539] (-202.569) (-206.323) -- 0:00:42
712500 -- (-202.676) [-205.213] (-197.606) (-204.436) * (-201.075) (-199.234) (-208.024) [-201.153] -- 0:00:42
713000 -- (-213.413) (-208.412) [-200.213] (-208.589) * (-200.464) [-201.701] (-210.803) (-205.298) -- 0:00:42
713500 -- (-213.009) (-210.069) [-198.913] (-202.843) * (-195.018) (-208.430) [-196.470] (-208.475) -- 0:00:42
714000 -- [-202.382] (-202.943) (-203.111) (-201.826) * [-192.849] (-200.689) (-195.794) (-201.035) -- 0:00:42
714500 -- (-198.776) [-207.963] (-203.055) (-205.737) * (-201.717) (-200.370) [-196.590] (-198.225) -- 0:00:42
715000 -- (-195.644) [-196.002] (-212.408) (-203.422) * (-196.478) [-201.468] (-200.877) (-194.889) -- 0:00:42
Average standard deviation of split frequencies: 0.008925
715500 -- [-196.477] (-205.102) (-214.764) (-208.987) * (-207.800) [-197.766] (-203.152) (-210.826) -- 0:00:42
716000 -- [-192.010] (-202.158) (-196.930) (-201.690) * [-203.993] (-198.001) (-198.262) (-216.510) -- 0:00:42
716500 -- (-207.403) [-193.407] (-200.810) (-206.004) * [-203.087] (-204.052) (-192.937) (-208.862) -- 0:00:41
717000 -- (-201.685) [-197.477] (-204.137) (-200.787) * (-199.262) (-203.106) [-190.328] (-204.556) -- 0:00:41
717500 -- [-200.090] (-198.367) (-205.787) (-198.410) * (-197.088) (-202.449) [-194.446] (-213.098) -- 0:00:41
718000 -- [-197.674] (-198.105) (-206.643) (-195.819) * [-197.044] (-204.575) (-199.696) (-216.728) -- 0:00:41
718500 -- (-199.322) [-201.508] (-204.397) (-204.590) * [-192.538] (-201.754) (-206.304) (-217.485) -- 0:00:41
719000 -- [-193.305] (-206.084) (-194.574) (-205.240) * [-198.461] (-202.008) (-209.103) (-208.619) -- 0:00:41
719500 -- [-201.462] (-214.327) (-201.570) (-210.805) * (-201.918) [-199.995] (-208.129) (-210.243) -- 0:00:41
720000 -- (-193.787) [-197.777] (-205.628) (-207.295) * [-196.089] (-210.702) (-209.083) (-203.315) -- 0:00:41
Average standard deviation of split frequencies: 0.009230
720500 -- (-206.269) [-191.911] (-203.018) (-202.175) * (-200.548) (-207.455) [-204.745] (-205.049) -- 0:00:41
721000 -- (-210.025) (-197.478) [-198.769] (-209.049) * (-203.214) [-194.491] (-206.389) (-201.497) -- 0:00:41
721500 -- (-197.544) (-204.697) [-194.823] (-206.386) * (-199.641) (-206.440) (-207.110) [-204.002] -- 0:00:41
722000 -- (-195.309) [-202.768] (-202.508) (-206.870) * (-194.920) [-198.044] (-203.331) (-204.785) -- 0:00:41
722500 -- (-209.475) [-197.507] (-193.755) (-198.335) * (-195.029) [-202.811] (-206.585) (-201.432) -- 0:00:41
723000 -- (-200.018) (-206.755) (-205.183) [-198.005] * [-204.447] (-201.363) (-207.660) (-202.693) -- 0:00:40
723500 -- (-211.049) (-203.119) (-206.641) [-203.906] * [-209.201] (-202.331) (-197.846) (-209.322) -- 0:00:40
724000 -- (-202.755) (-198.737) (-205.797) [-205.434] * (-206.041) [-197.132] (-195.636) (-208.121) -- 0:00:40
724500 -- [-201.853] (-207.566) (-197.796) (-205.681) * (-198.158) (-200.929) (-202.230) [-203.274] -- 0:00:40
725000 -- (-202.847) (-212.954) [-197.220] (-202.594) * [-195.834] (-208.966) (-200.716) (-198.662) -- 0:00:40
Average standard deviation of split frequencies: 0.009812
725500 -- (-200.327) (-201.949) [-203.793] (-206.607) * (-200.491) (-202.907) (-200.680) [-201.148] -- 0:00:40
726000 -- (-206.753) (-200.731) [-200.925] (-203.806) * (-215.114) [-201.427] (-199.308) (-200.697) -- 0:00:40
726500 -- (-206.887) [-192.785] (-202.153) (-208.606) * (-212.902) (-199.697) [-209.049] (-207.469) -- 0:00:40
727000 -- (-204.557) (-199.635) [-198.401] (-202.228) * (-202.059) [-200.533] (-204.322) (-208.746) -- 0:00:40
727500 -- (-214.884) [-199.899] (-199.962) (-208.787) * [-194.979] (-215.910) (-200.850) (-197.789) -- 0:00:40
728000 -- (-205.182) (-200.966) (-206.810) [-195.252] * (-206.514) [-196.377] (-193.999) (-199.605) -- 0:00:40
728500 -- [-195.910] (-203.387) (-203.314) (-202.468) * (-205.045) (-202.955) (-209.564) [-203.193] -- 0:00:40
729000 -- [-196.363] (-197.478) (-205.902) (-206.079) * (-206.883) (-197.572) (-202.159) [-198.233] -- 0:00:40
729500 -- (-200.249) (-197.534) (-207.763) [-200.640] * (-202.284) (-206.186) (-201.395) [-198.632] -- 0:00:40
730000 -- (-198.534) [-200.878] (-208.993) (-203.504) * (-197.875) [-204.708] (-198.193) (-196.221) -- 0:00:39
Average standard deviation of split frequencies: 0.010108
730500 -- (-200.081) (-207.264) [-203.875] (-212.623) * [-201.289] (-202.682) (-201.908) (-196.599) -- 0:00:39
731000 -- (-197.081) (-201.777) [-199.254] (-202.508) * (-206.109) (-206.883) (-195.326) [-197.230] -- 0:00:39
731500 -- [-193.337] (-200.344) (-200.684) (-204.568) * (-214.953) [-198.349] (-202.008) (-208.069) -- 0:00:39
732000 -- [-203.602] (-210.802) (-201.787) (-200.648) * (-200.656) (-205.453) (-211.542) [-201.037] -- 0:00:39
732500 -- (-204.144) (-221.350) [-206.634] (-209.531) * (-205.974) (-203.045) (-209.156) [-202.860] -- 0:00:39
733000 -- (-201.300) (-203.809) (-203.010) [-195.400] * (-209.700) (-204.476) [-204.964] (-202.340) -- 0:00:39
733500 -- (-209.166) (-199.893) (-210.925) [-197.334] * (-203.198) (-195.778) (-201.144) [-196.367] -- 0:00:39
734000 -- (-198.036) [-197.584] (-201.830) (-203.778) * (-197.846) [-202.077] (-213.133) (-207.017) -- 0:00:39
734500 -- [-206.360] (-211.882) (-201.163) (-203.395) * (-194.645) (-199.867) (-203.120) [-198.939] -- 0:00:39
735000 -- [-199.836] (-199.486) (-223.696) (-201.011) * (-206.975) (-207.867) [-196.482] (-202.658) -- 0:00:39
Average standard deviation of split frequencies: 0.009714
735500 -- [-198.019] (-198.743) (-202.621) (-209.961) * (-205.066) [-199.264] (-203.688) (-193.682) -- 0:00:39
736000 -- [-198.417] (-197.238) (-199.626) (-208.064) * [-206.453] (-205.464) (-211.847) (-204.056) -- 0:00:39
736500 -- (-205.442) (-194.044) [-198.766] (-200.018) * (-200.765) (-204.904) [-199.118] (-196.354) -- 0:00:38
737000 -- (-201.921) [-198.216] (-198.680) (-202.393) * (-202.493) (-206.203) (-200.874) [-197.251] -- 0:00:38
737500 -- (-195.545) (-207.976) [-200.076] (-203.353) * [-201.498] (-207.147) (-198.921) (-207.712) -- 0:00:38
738000 -- (-213.877) (-210.330) [-199.601] (-211.505) * [-203.606] (-204.236) (-200.514) (-201.843) -- 0:00:38
738500 -- (-198.752) (-206.382) [-199.900] (-203.726) * (-213.129) [-215.972] (-198.860) (-203.041) -- 0:00:38
739000 -- [-200.113] (-208.144) (-196.889) (-207.967) * (-205.237) [-204.377] (-204.753) (-208.949) -- 0:00:38
739500 -- (-195.937) (-206.794) (-197.225) [-197.001] * (-193.654) (-217.749) [-198.263] (-204.235) -- 0:00:38
740000 -- (-195.981) (-205.645) [-193.730] (-204.488) * (-193.890) (-201.567) [-201.191] (-205.143) -- 0:00:38
Average standard deviation of split frequencies: 0.009794
740500 -- (-215.733) (-202.553) (-199.751) [-196.037] * (-206.455) [-198.356] (-208.097) (-200.199) -- 0:00:38
741000 -- [-196.639] (-198.009) (-199.419) (-199.548) * (-201.072) [-195.096] (-205.405) (-214.893) -- 0:00:38
741500 -- (-198.606) (-197.216) [-196.814] (-203.105) * (-209.474) (-201.224) [-201.371] (-200.041) -- 0:00:38
742000 -- (-204.578) (-209.128) [-197.332] (-203.577) * (-204.816) (-197.953) [-199.522] (-197.123) -- 0:00:38
742500 -- (-197.530) [-202.444] (-201.303) (-201.667) * (-212.221) (-205.963) [-198.684] (-203.570) -- 0:00:38
743000 -- (-205.546) (-204.156) (-204.252) [-196.253] * (-202.778) [-197.843] (-210.933) (-208.407) -- 0:00:38
743500 -- (-195.043) [-202.235] (-201.705) (-193.483) * (-202.376) (-201.023) [-201.991] (-200.081) -- 0:00:37
744000 -- [-190.868] (-198.411) (-209.858) (-201.015) * (-211.976) [-195.134] (-202.166) (-203.029) -- 0:00:37
744500 -- (-203.847) [-203.373] (-200.126) (-204.791) * (-205.772) (-202.168) [-201.576] (-194.694) -- 0:00:37
745000 -- [-202.268] (-196.627) (-197.763) (-209.693) * (-208.837) (-196.636) [-191.698] (-201.642) -- 0:00:37
Average standard deviation of split frequencies: 0.009689
745500 -- [-194.573] (-205.242) (-202.873) (-193.594) * (-205.955) (-207.719) [-194.434] (-201.893) -- 0:00:37
746000 -- [-193.512] (-204.618) (-203.495) (-202.810) * (-206.498) (-214.459) [-193.187] (-205.722) -- 0:00:37
746500 -- [-199.085] (-202.304) (-206.737) (-205.954) * (-210.320) (-201.780) (-205.456) [-201.621] -- 0:00:37
747000 -- (-203.713) (-199.820) (-197.137) [-201.471] * (-207.008) [-193.991] (-193.156) (-204.700) -- 0:00:37
747500 -- (-200.638) (-200.994) (-206.086) [-207.102] * (-201.940) (-199.440) (-211.598) [-202.998] -- 0:00:37
748000 -- [-194.116] (-203.651) (-200.075) (-198.135) * (-199.303) [-199.133] (-207.371) (-204.866) -- 0:00:37
748500 -- (-198.629) (-197.196) (-203.301) [-203.928] * (-212.961) [-199.638] (-199.228) (-197.173) -- 0:00:37
749000 -- [-191.455] (-201.969) (-196.276) (-204.739) * (-213.396) (-202.607) [-199.414] (-200.967) -- 0:00:37
749500 -- [-198.719] (-211.709) (-206.904) (-194.570) * (-210.449) [-198.817] (-200.114) (-196.624) -- 0:00:37
750000 -- (-202.282) [-201.936] (-200.493) (-200.233) * (-216.394) (-202.818) (-202.791) [-196.211] -- 0:00:37
Average standard deviation of split frequencies: 0.009664
750500 -- (-202.021) (-203.800) (-196.774) [-200.865] * [-199.637] (-209.001) (-209.342) (-204.977) -- 0:00:36
751000 -- (-202.719) (-202.267) (-202.160) [-199.082] * (-205.224) (-208.217) (-195.461) [-194.187] -- 0:00:36
751500 -- [-200.321] (-197.950) (-206.982) (-211.345) * [-202.446] (-209.900) (-195.743) (-202.430) -- 0:00:36
752000 -- (-209.941) (-199.485) [-209.247] (-206.392) * (-201.565) (-212.825) [-201.695] (-204.354) -- 0:00:36
752500 -- (-192.631) (-200.240) [-199.088] (-200.767) * (-206.409) (-203.731) [-199.220] (-198.200) -- 0:00:36
753000 -- (-208.126) (-202.730) (-198.845) [-195.772] * (-206.581) (-206.785) (-203.546) [-197.882] -- 0:00:36
753500 -- (-207.293) (-202.274) [-196.784] (-195.053) * (-207.588) [-202.461] (-204.622) (-210.432) -- 0:00:36
754000 -- (-195.536) [-198.162] (-198.061) (-199.897) * [-201.603] (-196.664) (-196.749) (-196.974) -- 0:00:36
754500 -- (-202.741) (-204.086) (-199.008) [-200.912] * (-204.342) (-207.213) [-206.872] (-209.264) -- 0:00:36
755000 -- (-203.097) [-199.375] (-202.965) (-201.122) * (-206.061) (-206.707) (-203.463) [-200.425] -- 0:00:36
Average standard deviation of split frequencies: 0.009908
755500 -- [-200.140] (-203.775) (-208.639) (-208.601) * (-199.264) (-194.685) (-199.128) [-194.722] -- 0:00:36
756000 -- (-199.593) (-197.653) (-202.565) [-201.149] * [-203.122] (-202.068) (-205.845) (-201.668) -- 0:00:36
756500 -- (-198.146) [-200.851] (-204.363) (-202.714) * (-203.559) [-197.295] (-210.616) (-205.495) -- 0:00:36
757000 -- (-203.467) [-211.865] (-199.647) (-211.879) * (-200.417) (-203.742) (-209.843) [-201.195] -- 0:00:35
757500 -- (-199.492) (-205.401) [-203.006] (-201.806) * (-210.749) (-200.825) [-201.491] (-200.144) -- 0:00:35
758000 -- (-215.023) (-201.228) [-200.337] (-205.859) * (-203.861) (-202.936) [-205.722] (-203.131) -- 0:00:36
758500 -- (-202.466) (-199.212) [-200.561] (-207.803) * (-209.060) (-199.364) [-201.951] (-207.751) -- 0:00:35
759000 -- (-199.563) (-201.803) (-208.671) [-192.403] * (-203.204) (-197.352) (-202.412) [-197.622] -- 0:00:35
759500 -- (-203.774) [-194.068] (-202.744) (-198.697) * [-194.823] (-199.521) (-203.766) (-201.866) -- 0:00:35
760000 -- (-211.445) [-193.630] (-208.647) (-201.554) * [-203.054] (-202.683) (-221.366) (-207.607) -- 0:00:35
Average standard deviation of split frequencies: 0.010122
760500 -- [-205.285] (-214.578) (-201.179) (-209.829) * (-202.099) [-204.473] (-206.618) (-199.612) -- 0:00:35
761000 -- (-200.795) (-202.989) [-199.624] (-206.778) * (-200.928) [-196.670] (-196.906) (-206.374) -- 0:00:35
761500 -- (-209.008) (-204.948) (-198.125) [-200.199] * (-203.628) [-196.321] (-202.826) (-205.836) -- 0:00:35
762000 -- (-206.977) (-208.349) [-197.304] (-200.625) * (-198.834) [-199.355] (-201.681) (-198.681) -- 0:00:35
762500 -- (-206.387) (-207.817) [-198.390] (-202.798) * (-200.234) (-203.476) [-197.175] (-202.133) -- 0:00:35
763000 -- (-204.852) [-195.576] (-192.926) (-198.369) * [-200.122] (-199.273) (-211.238) (-202.814) -- 0:00:35
763500 -- (-204.930) (-195.321) [-195.141] (-196.005) * (-202.269) (-205.524) (-201.476) [-198.444] -- 0:00:35
764000 -- (-205.335) [-194.684] (-202.948) (-196.998) * (-204.350) [-202.218] (-202.671) (-198.931) -- 0:00:35
764500 -- [-202.776] (-201.195) (-197.984) (-199.013) * [-196.811] (-205.299) (-203.532) (-205.425) -- 0:00:35
765000 -- (-202.021) (-199.679) [-196.438] (-194.299) * [-201.861] (-206.672) (-193.831) (-202.452) -- 0:00:35
Average standard deviation of split frequencies: 0.010291
765500 -- [-202.764] (-201.543) (-198.504) (-200.490) * (-213.033) [-201.246] (-197.860) (-197.545) -- 0:00:34
766000 -- (-203.174) (-201.080) [-203.407] (-204.652) * [-194.649] (-200.814) (-203.833) (-211.039) -- 0:00:34
766500 -- (-207.829) (-202.119) (-203.506) [-196.734] * [-193.475] (-202.689) (-196.679) (-198.633) -- 0:00:34
767000 -- (-201.294) (-202.978) [-206.632] (-199.946) * (-199.235) (-199.987) [-201.875] (-208.297) -- 0:00:34
767500 -- (-202.574) (-211.648) (-200.339) [-195.027] * (-200.014) (-203.645) [-196.124] (-208.151) -- 0:00:34
768000 -- (-196.174) (-194.196) (-201.338) [-196.924] * (-201.029) (-198.991) [-193.676] (-200.736) -- 0:00:34
768500 -- (-202.014) (-196.077) [-196.739] (-206.202) * (-197.118) [-200.786] (-207.543) (-208.912) -- 0:00:34
769000 -- [-195.980] (-207.515) (-202.055) (-203.777) * [-194.433] (-198.810) (-191.901) (-214.415) -- 0:00:34
769500 -- (-209.237) (-209.663) [-203.597] (-199.064) * (-215.075) [-196.617] (-196.094) (-208.285) -- 0:00:34
770000 -- [-201.593] (-202.651) (-205.302) (-204.767) * [-198.895] (-202.486) (-199.558) (-203.459) -- 0:00:34
Average standard deviation of split frequencies: 0.010569
770500 -- (-208.716) (-203.345) [-201.158] (-196.638) * (-202.953) [-195.214] (-202.896) (-210.133) -- 0:00:34
771000 -- (-211.457) [-198.509] (-198.019) (-207.725) * [-201.429] (-196.945) (-196.319) (-217.571) -- 0:00:34
771500 -- (-212.178) (-203.701) [-198.769] (-207.182) * (-205.212) (-200.992) [-197.206] (-206.709) -- 0:00:34
772000 -- (-207.009) (-211.770) [-197.267] (-198.367) * (-208.565) (-207.994) [-198.447] (-210.674) -- 0:00:33
772500 -- (-203.441) (-202.625) [-197.772] (-206.046) * [-201.800] (-204.918) (-200.958) (-203.505) -- 0:00:33
773000 -- (-215.421) (-202.595) (-203.106) [-197.932] * (-210.709) [-199.060] (-195.920) (-206.143) -- 0:00:33
773500 -- (-205.873) [-199.498] (-196.216) (-210.146) * (-211.992) [-207.298] (-198.762) (-206.967) -- 0:00:33
774000 -- (-216.454) (-205.266) (-201.088) [-202.347] * [-204.469] (-198.347) (-194.593) (-203.508) -- 0:00:33
774500 -- [-211.465] (-205.329) (-199.448) (-199.785) * (-203.267) [-200.210] (-194.303) (-207.170) -- 0:00:33
775000 -- (-219.259) [-208.016] (-203.567) (-202.575) * (-203.112) (-198.333) (-204.322) [-204.423] -- 0:00:33
Average standard deviation of split frequencies: 0.011103
775500 -- (-208.148) (-196.516) (-202.431) [-194.606] * (-200.376) (-207.144) (-212.061) [-200.417] -- 0:00:33
776000 -- (-199.173) (-213.345) [-199.221] (-206.955) * [-193.883] (-195.363) (-206.750) (-199.302) -- 0:00:33
776500 -- [-195.078] (-207.967) (-205.570) (-200.655) * [-192.960] (-203.579) (-203.366) (-206.726) -- 0:00:33
777000 -- (-199.867) [-197.042] (-203.343) (-199.360) * [-202.037] (-206.586) (-204.052) (-206.010) -- 0:00:33
777500 -- (-209.951) (-201.781) (-211.275) [-200.101] * (-197.309) (-204.237) [-197.936] (-206.690) -- 0:00:33
778000 -- [-197.550] (-202.231) (-210.206) (-204.745) * (-204.589) [-201.298] (-201.977) (-215.018) -- 0:00:33
778500 -- [-207.661] (-199.483) (-202.368) (-204.854) * (-198.517) (-204.445) (-210.623) [-208.932] -- 0:00:33
779000 -- (-198.654) [-197.913] (-207.175) (-203.699) * (-200.274) (-207.078) [-203.130] (-212.327) -- 0:00:32
779500 -- (-211.892) (-193.461) (-205.186) [-201.627] * (-194.878) (-211.335) [-204.109] (-214.510) -- 0:00:32
780000 -- [-200.592] (-202.590) (-207.442) (-200.698) * (-198.283) [-206.513] (-199.756) (-206.068) -- 0:00:32
Average standard deviation of split frequencies: 0.010668
780500 -- (-202.407) (-196.800) [-198.512] (-198.724) * [-198.710] (-200.839) (-207.647) (-200.069) -- 0:00:32
781000 -- (-199.036) (-205.864) (-196.856) [-194.535] * (-199.069) (-208.155) (-207.915) [-199.539] -- 0:00:32
781500 -- (-204.999) (-206.044) [-197.626] (-201.025) * [-202.538] (-207.830) (-199.433) (-206.755) -- 0:00:32
782000 -- [-206.094] (-220.448) (-202.052) (-207.460) * [-198.562] (-205.571) (-196.389) (-198.589) -- 0:00:32
782500 -- (-212.217) (-203.814) [-197.005] (-204.621) * (-200.149) (-200.200) [-210.920] (-202.744) -- 0:00:32
783000 -- (-206.352) [-195.416] (-209.757) (-207.094) * (-190.799) (-203.728) (-199.987) [-197.386] -- 0:00:32
783500 -- (-202.223) [-200.376] (-205.656) (-212.042) * [-200.392] (-203.907) (-207.814) (-192.194) -- 0:00:32
784000 -- [-197.640] (-195.781) (-216.219) (-201.636) * [-194.282] (-201.008) (-207.748) (-206.150) -- 0:00:32
784500 -- (-202.424) [-201.806] (-202.263) (-206.764) * [-202.996] (-213.794) (-205.918) (-199.566) -- 0:00:32
785000 -- (-205.169) (-207.393) (-200.703) [-198.791] * (-196.027) [-206.471] (-211.633) (-200.978) -- 0:00:32
Average standard deviation of split frequencies: 0.010962
785500 -- (-207.106) (-200.505) [-203.150] (-204.589) * (-214.766) (-209.264) [-201.200] (-202.248) -- 0:00:31
786000 -- (-204.088) (-203.084) (-206.116) [-197.712] * (-200.512) (-205.518) [-201.476] (-209.057) -- 0:00:31
786500 -- (-211.288) (-202.856) [-207.694] (-207.771) * (-197.938) (-201.818) [-199.377] (-206.754) -- 0:00:31
787000 -- (-213.452) (-210.794) [-197.254] (-201.843) * (-204.407) (-202.078) [-205.130] (-209.412) -- 0:00:31
787500 -- [-198.215] (-214.003) (-199.068) (-197.873) * (-205.335) [-202.068] (-198.540) (-214.074) -- 0:00:31
788000 -- (-193.852) (-208.816) [-196.155] (-203.063) * (-213.022) (-202.530) [-190.140] (-205.056) -- 0:00:31
788500 -- (-198.337) (-209.348) [-200.655] (-202.317) * (-193.156) (-207.430) (-200.205) [-198.077] -- 0:00:31
789000 -- (-211.271) [-201.927] (-202.708) (-199.295) * (-210.813) (-209.031) (-201.594) [-195.049] -- 0:00:31
789500 -- (-205.403) (-203.359) [-196.064] (-201.222) * (-205.110) [-200.134] (-199.756) (-202.047) -- 0:00:31
790000 -- (-195.501) (-202.702) [-198.533] (-205.378) * (-211.478) (-203.634) (-198.885) [-198.064] -- 0:00:31
Average standard deviation of split frequencies: 0.011096
790500 -- (-196.289) (-211.283) [-197.526] (-206.214) * (-207.430) [-194.846] (-206.086) (-200.968) -- 0:00:31
791000 -- (-203.054) (-212.017) (-204.498) [-206.412] * (-202.987) (-205.740) [-194.535] (-205.708) -- 0:00:31
791500 -- [-198.429] (-204.540) (-203.464) (-204.992) * (-204.890) [-198.917] (-210.728) (-198.780) -- 0:00:31
792000 -- [-202.398] (-199.256) (-196.429) (-199.674) * (-205.300) (-199.522) [-203.428] (-206.036) -- 0:00:30
792500 -- (-195.485) (-203.862) [-202.683] (-198.007) * (-202.576) [-195.706] (-203.801) (-208.695) -- 0:00:30
793000 -- (-204.160) (-207.792) (-198.869) [-197.236] * (-200.029) [-198.503] (-205.253) (-210.522) -- 0:00:30
793500 -- (-210.514) (-202.078) (-207.348) [-197.014] * (-201.349) [-195.761] (-209.350) (-208.276) -- 0:00:30
794000 -- (-205.969) (-198.660) (-200.347) [-197.181] * [-199.575] (-203.168) (-197.847) (-203.287) -- 0:00:30
794500 -- [-196.564] (-198.560) (-201.710) (-201.158) * [-205.009] (-198.169) (-197.087) (-203.944) -- 0:00:30
795000 -- (-208.024) (-197.297) (-206.837) [-194.317] * (-202.534) (-199.059) (-210.117) [-197.593] -- 0:00:30
Average standard deviation of split frequencies: 0.011482
795500 -- (-209.684) (-200.602) [-200.377] (-200.146) * (-207.122) (-206.250) (-200.883) [-195.711] -- 0:00:30
796000 -- (-204.694) [-197.939] (-201.090) (-194.779) * (-203.166) (-208.713) [-199.384] (-201.856) -- 0:00:30
796500 -- (-205.774) [-201.082] (-203.548) (-196.292) * (-207.409) (-199.670) [-202.800] (-197.644) -- 0:00:30
797000 -- (-202.184) (-209.217) (-203.819) [-192.228] * (-206.483) (-210.102) [-203.427] (-196.949) -- 0:00:30
797500 -- (-206.857) (-201.403) (-200.009) [-198.435] * [-203.172] (-202.628) (-201.781) (-202.820) -- 0:00:30
798000 -- (-211.090) [-202.578] (-209.502) (-198.123) * (-202.200) (-198.526) (-200.424) [-195.341] -- 0:00:30
798500 -- (-204.786) (-202.482) (-199.052) [-196.670] * (-197.793) (-204.542) [-201.217] (-203.934) -- 0:00:30
799000 -- [-196.355] (-198.999) (-197.461) (-202.029) * [-199.575] (-204.296) (-206.703) (-203.448) -- 0:00:29
799500 -- [-202.725] (-199.158) (-198.025) (-213.610) * (-207.909) [-205.431] (-199.693) (-194.847) -- 0:00:29
800000 -- [-201.750] (-207.023) (-201.962) (-205.252) * (-201.700) (-216.520) (-206.491) [-197.615] -- 0:00:29
Average standard deviation of split frequencies: 0.011481
800500 -- (-200.191) (-205.877) [-198.662] (-201.359) * (-204.036) [-199.299] (-202.626) (-205.856) -- 0:00:29
801000 -- (-200.601) (-209.732) [-204.795] (-203.947) * (-206.863) (-207.096) (-206.505) [-197.442] -- 0:00:29
801500 -- (-202.159) (-193.490) [-201.645] (-209.403) * (-198.771) (-208.027) (-213.026) [-202.969] -- 0:00:29
802000 -- (-198.068) [-196.129] (-204.948) (-211.597) * (-198.991) (-202.784) [-205.643] (-202.791) -- 0:00:29
802500 -- (-210.043) [-195.206] (-203.987) (-197.369) * (-204.142) (-207.409) [-200.907] (-199.876) -- 0:00:29
803000 -- [-200.525] (-199.907) (-205.218) (-205.343) * (-200.140) (-216.654) (-194.418) [-196.268] -- 0:00:29
803500 -- [-199.442] (-205.784) (-205.825) (-196.167) * (-202.034) [-195.266] (-203.253) (-200.949) -- 0:00:29
804000 -- (-194.756) (-196.245) (-215.236) [-193.980] * (-200.692) [-197.289] (-207.402) (-197.254) -- 0:00:29
804500 -- (-204.859) (-209.519) [-199.626] (-204.241) * [-195.559] (-212.803) (-198.291) (-210.104) -- 0:00:29
805000 -- [-199.611] (-208.450) (-210.661) (-196.870) * [-200.908] (-219.905) (-207.464) (-216.424) -- 0:00:29
Average standard deviation of split frequencies: 0.011242
805500 -- (-211.534) (-206.662) [-197.119] (-198.717) * [-201.611] (-204.222) (-210.393) (-203.813) -- 0:00:28
806000 -- (-203.421) [-194.800] (-201.621) (-192.176) * (-210.076) [-200.025] (-212.518) (-198.783) -- 0:00:28
806500 -- (-203.357) [-192.379] (-202.336) (-202.312) * (-206.837) (-205.974) [-204.289] (-204.006) -- 0:00:28
807000 -- (-205.318) (-195.883) [-204.719] (-208.021) * (-198.810) (-200.450) [-197.391] (-205.012) -- 0:00:28
807500 -- (-210.753) [-194.407] (-203.422) (-196.880) * (-215.963) (-201.858) [-199.099] (-206.988) -- 0:00:28
808000 -- (-212.015) (-196.572) (-204.219) [-194.992] * (-212.119) [-203.334] (-213.516) (-207.210) -- 0:00:28
808500 -- (-199.419) (-206.014) (-196.437) [-203.117] * [-211.883] (-213.725) (-215.264) (-203.470) -- 0:00:28
809000 -- (-203.862) (-201.687) (-204.576) [-205.823] * (-205.254) [-204.739] (-206.426) (-196.975) -- 0:00:28
809500 -- (-198.464) (-206.529) (-202.431) [-199.925] * [-210.055] (-203.756) (-208.192) (-203.751) -- 0:00:28
810000 -- (-209.869) (-198.526) (-201.727) [-192.959] * [-199.760] (-211.271) (-202.871) (-196.864) -- 0:00:28
Average standard deviation of split frequencies: 0.011856
810500 -- (-197.496) (-208.621) [-199.708] (-197.610) * (-202.624) (-202.384) (-208.835) [-200.242] -- 0:00:28
811000 -- (-207.376) [-197.520] (-209.579) (-199.849) * [-201.256] (-208.179) (-203.788) (-208.568) -- 0:00:28
811500 -- (-205.192) [-195.125] (-195.610) (-198.360) * (-200.497) (-208.406) [-197.723] (-202.013) -- 0:00:28
812000 -- (-199.495) (-204.038) (-201.033) [-197.028] * [-198.160] (-205.454) (-197.684) (-202.218) -- 0:00:28
812500 -- (-202.984) (-200.751) (-204.215) [-199.322] * [-204.459] (-214.612) (-200.719) (-208.841) -- 0:00:27
813000 -- (-205.028) (-198.817) (-203.430) [-201.165] * (-211.110) (-208.549) (-195.794) [-202.724] -- 0:00:28
813500 -- (-205.740) [-194.713] (-202.381) (-213.612) * (-198.992) (-206.003) (-209.312) [-198.902] -- 0:00:27
814000 -- (-203.551) [-193.650] (-197.322) (-201.734) * (-203.409) [-200.965] (-200.615) (-208.077) -- 0:00:27
814500 -- (-200.186) [-196.377] (-207.833) (-204.916) * (-203.535) (-201.023) [-212.715] (-197.634) -- 0:00:27
815000 -- [-206.727] (-212.976) (-202.051) (-214.234) * (-218.886) [-197.983] (-208.516) (-205.953) -- 0:00:27
Average standard deviation of split frequencies: 0.011458
815500 -- (-198.964) [-201.527] (-206.211) (-204.698) * (-217.667) [-199.853] (-206.015) (-199.523) -- 0:00:27
816000 -- (-200.644) [-205.693] (-202.036) (-202.628) * (-203.804) (-197.496) (-204.873) [-196.490] -- 0:00:27
816500 -- (-205.008) (-210.502) (-204.412) [-202.107] * (-210.747) (-196.952) (-195.155) [-206.448] -- 0:00:27
817000 -- (-210.259) (-201.746) (-202.624) [-197.273] * (-204.136) (-199.171) (-198.625) [-201.806] -- 0:00:27
817500 -- (-207.274) (-211.331) [-196.511] (-205.489) * (-208.803) (-209.263) (-196.189) [-201.262] -- 0:00:27
818000 -- [-206.898] (-202.197) (-201.589) (-205.890) * (-202.656) [-193.875] (-202.777) (-196.608) -- 0:00:27
818500 -- (-202.441) (-197.760) [-196.706] (-200.565) * (-205.809) (-205.990) (-202.158) [-191.237] -- 0:00:27
819000 -- [-200.368] (-204.197) (-196.082) (-203.711) * (-204.186) (-204.221) (-204.972) [-197.596] -- 0:00:27
819500 -- (-207.987) [-200.189] (-202.062) (-204.809) * (-214.262) (-194.226) [-194.908] (-203.405) -- 0:00:27
820000 -- (-207.997) (-205.093) (-197.557) [-199.494] * [-199.703] (-199.194) (-200.274) (-211.497) -- 0:00:26
Average standard deviation of split frequencies: 0.011807
820500 -- (-197.626) (-209.096) (-196.108) [-201.067] * [-197.709] (-219.597) (-200.746) (-202.909) -- 0:00:26
821000 -- (-200.964) (-209.359) (-200.898) [-198.421] * (-200.334) [-203.160] (-201.868) (-199.327) -- 0:00:26
821500 -- (-206.785) (-199.748) (-201.728) [-193.003] * (-205.165) (-204.411) [-196.306] (-207.409) -- 0:00:26
822000 -- [-201.011] (-206.553) (-199.763) (-201.046) * [-197.744] (-199.559) (-203.228) (-205.952) -- 0:00:26
822500 -- (-201.298) (-205.628) [-205.613] (-200.483) * (-198.662) (-204.664) (-207.136) [-203.648] -- 0:00:26
823000 -- (-206.001) [-202.196] (-200.384) (-195.455) * (-201.174) (-200.291) (-199.931) [-199.625] -- 0:00:26
823500 -- (-200.680) (-200.279) [-198.515] (-198.838) * (-203.856) (-201.463) [-199.370] (-205.756) -- 0:00:26
824000 -- (-203.260) (-202.055) [-196.594] (-212.068) * (-199.640) (-205.039) (-214.790) [-204.551] -- 0:00:26
824500 -- (-206.330) (-200.687) [-204.305] (-209.332) * (-210.442) (-208.966) [-199.630] (-197.174) -- 0:00:26
825000 -- (-203.680) [-202.002] (-206.263) (-202.723) * (-203.708) (-210.655) [-208.307] (-202.577) -- 0:00:26
Average standard deviation of split frequencies: 0.011731
825500 -- (-196.919) (-207.790) [-199.335] (-192.320) * [-200.074] (-198.536) (-203.305) (-198.901) -- 0:00:26
826000 -- [-200.161] (-208.112) (-214.489) (-205.231) * (-194.950) (-196.991) [-200.999] (-209.439) -- 0:00:26
826500 -- (-195.308) [-194.480] (-207.292) (-209.487) * (-204.930) (-199.068) [-196.607] (-212.293) -- 0:00:26
827000 -- (-199.258) (-211.640) (-207.900) [-195.966] * (-202.364) (-200.155) (-197.430) [-202.869] -- 0:00:25
827500 -- (-202.855) (-202.982) [-196.348] (-206.414) * (-198.514) (-212.604) [-204.146] (-209.465) -- 0:00:25
828000 -- [-199.355] (-199.127) (-208.260) (-211.474) * (-201.456) [-202.118] (-208.007) (-200.351) -- 0:00:25
828500 -- (-208.253) (-201.614) (-208.036) [-202.165] * (-200.205) (-210.816) (-197.989) [-194.265] -- 0:00:25
829000 -- (-202.483) (-208.509) (-204.287) [-199.150] * (-197.631) (-206.973) [-201.371] (-205.917) -- 0:00:25
829500 -- (-200.707) (-208.324) (-211.173) [-196.876] * [-197.963] (-208.340) (-208.709) (-204.561) -- 0:00:25
830000 -- (-201.408) [-201.036] (-212.913) (-201.152) * (-206.059) [-197.872] (-213.264) (-202.692) -- 0:00:25
Average standard deviation of split frequencies: 0.011823
830500 -- [-203.227] (-205.968) (-202.038) (-200.891) * (-209.454) (-206.576) [-200.665] (-200.902) -- 0:00:25
831000 -- (-199.319) (-209.640) (-193.603) [-196.544] * (-199.873) [-200.605] (-206.194) (-208.594) -- 0:00:25
831500 -- [-202.489] (-199.288) (-209.777) (-195.331) * (-199.486) [-197.892] (-195.432) (-201.480) -- 0:00:25
832000 -- (-210.858) (-199.172) (-196.891) [-196.853] * (-215.319) (-195.015) (-200.188) [-198.344] -- 0:00:25
832500 -- (-202.313) (-204.712) (-204.279) [-196.499] * (-198.181) [-198.947] (-206.727) (-208.052) -- 0:00:25
833000 -- (-196.774) (-202.133) [-201.685] (-203.809) * [-208.955] (-203.484) (-198.869) (-206.636) -- 0:00:25
833500 -- (-200.738) (-208.819) [-200.461] (-197.411) * (-209.411) (-206.475) [-199.688] (-204.528) -- 0:00:24
834000 -- (-205.389) [-193.809] (-214.088) (-192.518) * (-206.087) (-202.627) [-193.482] (-209.506) -- 0:00:24
834500 -- (-202.837) (-208.927) (-206.159) [-203.817] * (-203.826) [-198.636] (-208.254) (-209.595) -- 0:00:24
835000 -- (-194.380) (-211.644) [-198.385] (-196.788) * [-204.734] (-201.516) (-201.447) (-204.932) -- 0:00:24
Average standard deviation of split frequencies: 0.011403
835500 -- [-195.966] (-212.729) (-197.122) (-202.766) * (-202.849) (-195.602) (-202.150) [-202.407] -- 0:00:24
836000 -- (-195.963) (-198.662) (-198.188) [-203.400] * (-203.260) [-194.605] (-208.607) (-200.874) -- 0:00:24
836500 -- (-198.120) [-195.322] (-211.327) (-201.803) * [-196.781] (-198.091) (-196.805) (-202.588) -- 0:00:24
837000 -- (-203.470) (-210.142) [-192.368] (-210.185) * (-208.293) (-207.869) [-200.154] (-202.703) -- 0:00:24
837500 -- (-204.894) (-200.476) [-194.956] (-202.834) * [-206.231] (-200.558) (-203.899) (-202.700) -- 0:00:24
838000 -- (-195.422) (-199.134) (-204.975) [-201.134] * [-199.983] (-199.557) (-198.500) (-201.451) -- 0:00:24
838500 -- (-200.245) (-204.965) (-194.719) [-195.405] * (-206.886) (-199.497) (-213.699) [-201.440] -- 0:00:24
839000 -- [-194.583] (-198.456) (-197.386) (-201.023) * [-197.630] (-194.097) (-204.069) (-201.577) -- 0:00:24
839500 -- [-201.724] (-201.246) (-206.995) (-197.129) * (-206.873) (-199.739) (-207.862) [-200.103] -- 0:00:24
840000 -- (-203.143) (-200.402) (-214.089) [-202.490] * (-207.488) (-198.826) (-206.380) [-199.308] -- 0:00:23
Average standard deviation of split frequencies: 0.011433
840500 -- (-199.906) (-204.402) [-194.332] (-203.826) * (-202.909) (-208.241) (-200.492) [-196.896] -- 0:00:23
841000 -- (-197.855) (-202.574) (-199.014) [-200.521] * (-197.612) (-197.103) [-196.373] (-216.000) -- 0:00:23
841500 -- (-201.127) [-198.460] (-199.955) (-195.222) * (-208.551) [-192.163] (-206.013) (-201.237) -- 0:00:23
842000 -- [-194.771] (-211.298) (-202.331) (-197.993) * (-212.925) (-213.856) (-194.802) [-200.977] -- 0:00:23
842500 -- (-205.861) (-206.394) (-205.075) [-203.245] * (-204.587) (-203.281) [-196.693] (-202.672) -- 0:00:23
843000 -- (-208.856) [-209.406] (-206.282) (-203.002) * (-208.354) (-206.861) [-200.413] (-201.480) -- 0:00:23
843500 -- (-205.228) (-204.791) (-200.341) [-197.229] * (-217.628) [-195.975] (-204.489) (-207.299) -- 0:00:23
844000 -- [-202.830] (-203.515) (-201.586) (-207.519) * (-206.205) [-204.690] (-206.251) (-201.355) -- 0:00:23
844500 -- (-205.273) (-210.391) [-199.554] (-203.787) * (-212.084) (-211.353) (-207.939) [-202.866] -- 0:00:23
845000 -- [-194.467] (-208.543) (-198.819) (-203.467) * (-219.618) [-199.194] (-199.697) (-205.960) -- 0:00:23
Average standard deviation of split frequencies: 0.011547
845500 -- [-197.218] (-207.955) (-209.810) (-201.443) * [-209.433] (-206.263) (-203.774) (-208.110) -- 0:00:23
846000 -- (-194.900) (-214.338) (-203.324) [-197.133] * (-206.402) (-199.680) [-194.922] (-209.716) -- 0:00:23
846500 -- [-203.761] (-214.364) (-212.336) (-200.389) * (-210.238) [-199.856] (-208.043) (-197.802) -- 0:00:23
847000 -- [-200.103] (-204.303) (-201.978) (-208.334) * [-204.989] (-202.921) (-198.208) (-206.625) -- 0:00:22
847500 -- (-203.764) (-205.084) [-196.232] (-213.295) * (-202.056) [-196.300] (-206.227) (-211.414) -- 0:00:22
848000 -- (-199.157) (-202.123) [-200.176] (-199.201) * (-203.852) (-202.885) [-206.934] (-199.587) -- 0:00:22
848500 -- (-194.516) [-191.220] (-200.110) (-191.925) * (-208.477) (-204.030) [-191.787] (-194.245) -- 0:00:22
849000 -- [-209.669] (-204.951) (-212.828) (-200.893) * (-203.130) (-203.980) (-218.957) [-199.066] -- 0:00:22
849500 -- [-200.407] (-201.206) (-202.359) (-208.330) * (-212.362) (-203.563) (-203.517) [-198.576] -- 0:00:22
850000 -- (-205.799) [-197.045] (-205.006) (-205.638) * (-211.846) (-207.527) [-202.681] (-200.058) -- 0:00:22
Average standard deviation of split frequencies: 0.011822
850500 -- (-196.063) (-200.003) (-206.705) [-196.605] * [-201.412] (-214.139) (-206.916) (-201.350) -- 0:00:22
851000 -- (-203.772) [-197.607] (-207.909) (-208.173) * (-201.287) (-207.185) [-198.480] (-193.713) -- 0:00:22
851500 -- (-211.872) (-204.356) [-201.470] (-212.180) * (-198.765) (-204.740) [-201.502] (-196.500) -- 0:00:22
852000 -- [-200.434] (-201.530) (-204.387) (-207.079) * (-199.761) [-200.530] (-201.231) (-208.692) -- 0:00:22
852500 -- (-198.544) [-199.540] (-219.831) (-200.575) * [-192.959] (-201.972) (-197.641) (-208.957) -- 0:00:22
853000 -- [-192.459] (-201.766) (-211.022) (-204.784) * [-199.211] (-203.472) (-205.076) (-199.911) -- 0:00:22
853500 -- [-197.006] (-204.606) (-199.182) (-197.963) * (-198.423) [-196.812] (-208.530) (-204.216) -- 0:00:21
854000 -- (-199.204) (-206.595) [-201.921] (-212.853) * (-200.165) [-193.430] (-207.506) (-200.069) -- 0:00:21
854500 -- (-198.956) [-200.381] (-203.118) (-211.446) * (-196.835) [-196.816] (-201.853) (-208.736) -- 0:00:21
855000 -- [-212.116] (-196.946) (-211.945) (-203.725) * (-205.076) [-199.431] (-202.603) (-200.763) -- 0:00:21
Average standard deviation of split frequencies: 0.011993
855500 -- [-198.149] (-205.197) (-199.256) (-204.169) * [-198.430] (-211.895) (-202.409) (-205.217) -- 0:00:21
856000 -- (-215.459) [-194.652] (-206.631) (-202.212) * [-199.917] (-202.601) (-198.634) (-208.401) -- 0:00:21
856500 -- (-202.040) [-195.343] (-200.006) (-210.465) * (-200.573) (-199.031) (-204.090) [-205.216] -- 0:00:21
857000 -- (-213.231) [-201.115] (-208.622) (-208.362) * (-221.789) (-193.750) [-201.287] (-208.301) -- 0:00:21
857500 -- (-197.246) [-196.143] (-204.116) (-203.389) * (-210.265) (-196.881) [-195.987] (-203.123) -- 0:00:21
858000 -- [-197.391] (-202.064) (-208.342) (-200.188) * [-196.813] (-198.572) (-198.990) (-205.770) -- 0:00:21
858500 -- (-202.018) (-204.528) (-214.930) [-194.330] * [-194.889] (-190.535) (-202.309) (-217.599) -- 0:00:21
859000 -- (-197.367) (-214.016) (-217.622) [-196.172] * (-208.754) (-191.267) (-202.281) [-198.999] -- 0:00:21
859500 -- (-198.777) (-201.350) (-213.495) [-198.290] * (-201.350) (-203.450) [-203.585] (-209.213) -- 0:00:21
860000 -- (-204.450) [-199.768] (-208.077) (-197.962) * (-203.237) (-205.267) (-199.754) [-197.240] -- 0:00:20
Average standard deviation of split frequencies: 0.012476
860500 -- (-197.537) (-195.342) (-207.764) [-203.555] * [-201.048] (-208.682) (-209.255) (-206.108) -- 0:00:20
861000 -- (-198.620) [-197.694] (-202.015) (-205.633) * (-207.454) (-198.451) [-205.050] (-203.857) -- 0:00:20
861500 -- [-202.589] (-200.322) (-210.011) (-204.582) * (-203.091) [-200.002] (-199.289) (-207.115) -- 0:00:20
862000 -- [-194.184] (-200.461) (-207.069) (-207.553) * (-199.337) (-198.440) (-202.795) [-208.200] -- 0:00:20
862500 -- (-205.787) (-195.806) [-205.936] (-207.763) * (-193.143) (-208.491) [-194.839] (-201.919) -- 0:00:20
863000 -- (-199.486) (-200.473) (-210.845) [-200.753] * [-194.341] (-207.361) (-208.324) (-201.277) -- 0:00:20
863500 -- (-202.146) [-200.582] (-207.303) (-204.480) * (-201.979) (-206.815) [-199.395] (-204.988) -- 0:00:20
864000 -- (-207.546) (-198.051) (-196.392) [-203.566] * [-198.444] (-204.082) (-199.718) (-205.333) -- 0:00:20
864500 -- (-206.190) [-195.932] (-205.485) (-203.849) * (-200.215) (-214.079) (-206.406) [-198.776] -- 0:00:20
865000 -- (-198.820) (-195.864) [-201.695] (-205.757) * [-201.000] (-205.917) (-200.548) (-200.547) -- 0:00:20
Average standard deviation of split frequencies: 0.012429
865500 -- [-200.066] (-205.928) (-195.240) (-206.778) * (-201.834) (-206.269) (-212.788) [-198.666] -- 0:00:20
866000 -- (-199.721) [-197.727] (-199.814) (-210.141) * [-201.989] (-211.247) (-196.244) (-202.604) -- 0:00:20
866500 -- (-194.096) (-199.015) [-202.518] (-206.337) * [-206.360] (-209.905) (-201.059) (-200.809) -- 0:00:20
867000 -- (-205.524) (-194.134) [-201.059] (-197.627) * (-204.423) (-198.682) [-200.243] (-199.361) -- 0:00:19
867500 -- [-196.008] (-199.156) (-198.539) (-196.366) * (-199.064) [-205.316] (-198.024) (-211.806) -- 0:00:19
868000 -- (-204.652) (-202.359) (-200.149) [-190.958] * [-191.881] (-207.119) (-198.631) (-203.163) -- 0:00:19
868500 -- (-204.489) [-200.547] (-198.375) (-210.475) * [-202.446] (-202.894) (-196.048) (-205.102) -- 0:00:19
869000 -- (-212.562) (-191.906) (-202.658) [-201.448] * (-199.017) (-208.071) [-195.499] (-207.526) -- 0:00:19
869500 -- [-205.392] (-203.250) (-203.978) (-204.673) * (-202.526) (-210.097) [-196.270] (-201.898) -- 0:00:19
870000 -- (-206.962) [-197.680] (-198.973) (-203.664) * (-200.289) [-198.697] (-201.320) (-206.883) -- 0:00:19
Average standard deviation of split frequencies: 0.012062
870500 -- (-201.475) (-208.220) (-199.700) [-201.277] * [-198.465] (-203.544) (-212.499) (-193.730) -- 0:00:19
871000 -- (-203.650) (-206.217) (-203.750) [-205.258] * (-200.518) [-193.473] (-199.136) (-208.602) -- 0:00:19
871500 -- (-212.000) (-199.033) [-195.172] (-193.756) * [-206.199] (-206.171) (-204.695) (-197.276) -- 0:00:19
872000 -- (-207.847) (-198.151) (-209.197) [-203.305] * (-203.235) (-202.363) (-205.479) [-198.026] -- 0:00:19
872500 -- (-196.318) (-201.652) (-209.358) [-198.261] * (-206.231) (-205.881) (-203.742) [-199.693] -- 0:00:19
873000 -- (-196.070) [-195.505] (-202.464) (-204.592) * [-199.394] (-217.113) (-206.111) (-208.955) -- 0:00:19
873500 -- (-201.774) (-203.259) (-205.204) [-208.089] * [-203.729] (-214.019) (-209.939) (-197.258) -- 0:00:18
874000 -- (-203.497) [-196.412] (-208.741) (-204.384) * (-210.896) [-205.813] (-208.870) (-203.998) -- 0:00:18
874500 -- [-196.223] (-198.868) (-199.813) (-206.306) * (-205.600) [-207.349] (-196.989) (-203.510) -- 0:00:18
875000 -- (-206.810) [-198.985] (-202.599) (-200.423) * (-211.068) [-194.696] (-204.745) (-203.699) -- 0:00:18
Average standard deviation of split frequencies: 0.011420
875500 -- [-198.043] (-198.386) (-208.580) (-205.767) * [-202.885] (-196.299) (-210.949) (-201.688) -- 0:00:18
876000 -- (-201.537) (-200.042) [-202.820] (-207.357) * (-196.525) (-205.953) [-203.203] (-204.667) -- 0:00:18
876500 -- (-199.835) (-218.202) [-200.661] (-204.130) * [-198.295] (-200.570) (-212.456) (-197.890) -- 0:00:18
877000 -- (-209.679) (-203.444) [-203.525] (-199.300) * (-205.037) [-197.119] (-209.233) (-195.241) -- 0:00:18
877500 -- (-206.722) (-206.387) [-200.937] (-207.968) * (-205.385) [-194.077] (-206.942) (-199.032) -- 0:00:18
878000 -- (-197.073) (-204.826) [-197.487] (-199.822) * [-198.945] (-200.846) (-208.822) (-207.781) -- 0:00:18
878500 -- (-196.185) (-200.216) [-196.026] (-204.655) * [-203.721] (-203.405) (-209.502) (-201.011) -- 0:00:18
879000 -- (-200.109) [-193.836] (-198.687) (-206.591) * (-197.781) (-203.863) (-210.579) [-202.098] -- 0:00:18
879500 -- (-203.353) [-194.741] (-201.783) (-209.613) * [-194.488] (-206.035) (-210.060) (-203.534) -- 0:00:18
880000 -- (-197.145) (-193.700) (-212.206) [-196.163] * (-205.661) (-201.645) [-198.041] (-203.791) -- 0:00:18
Average standard deviation of split frequencies: 0.011538
880500 -- (-199.569) [-196.068] (-201.057) (-199.752) * (-197.716) (-206.915) [-203.661] (-207.531) -- 0:00:17
881000 -- (-212.783) [-197.105] (-195.826) (-207.901) * (-205.463) (-209.322) (-200.172) [-208.228] -- 0:00:17
881500 -- [-194.691] (-200.274) (-201.055) (-210.673) * (-200.982) (-206.116) [-201.501] (-206.243) -- 0:00:17
882000 -- (-206.750) (-203.514) [-194.147] (-221.352) * [-198.485] (-199.269) (-200.979) (-200.263) -- 0:00:17
882500 -- [-198.783] (-198.659) (-203.481) (-218.440) * [-205.078] (-199.110) (-210.340) (-195.758) -- 0:00:17
883000 -- [-196.740] (-204.749) (-205.433) (-204.961) * [-199.981] (-203.668) (-199.672) (-193.756) -- 0:00:17
883500 -- (-211.794) [-196.240] (-206.146) (-208.058) * (-194.390) (-209.466) [-199.654] (-202.993) -- 0:00:17
884000 -- [-198.880] (-207.868) (-203.072) (-207.339) * [-199.263] (-201.111) (-196.950) (-210.731) -- 0:00:17
884500 -- (-191.955) (-197.619) (-201.427) [-203.451] * (-199.664) (-201.244) [-198.101] (-211.555) -- 0:00:17
885000 -- (-198.962) (-196.997) (-212.225) [-198.556] * [-194.240] (-206.635) (-201.434) (-198.081) -- 0:00:17
Average standard deviation of split frequencies: 0.011646
885500 -- (-201.931) (-209.733) (-203.568) [-202.278] * (-200.955) (-206.848) [-202.489] (-205.377) -- 0:00:17
886000 -- (-204.938) [-208.400] (-205.829) (-202.168) * (-197.467) (-202.256) (-196.611) [-196.546] -- 0:00:17
886500 -- [-212.845] (-209.900) (-204.601) (-195.641) * (-199.520) [-199.207] (-202.600) (-198.200) -- 0:00:17
887000 -- (-200.552) [-196.868] (-198.507) (-205.049) * (-206.338) (-201.699) (-211.037) [-203.105] -- 0:00:16
887500 -- [-205.555] (-199.751) (-201.029) (-198.405) * (-199.752) [-200.295] (-208.376) (-210.725) -- 0:00:16
888000 -- [-203.628] (-195.770) (-208.746) (-197.766) * [-193.477] (-207.625) (-198.991) (-198.665) -- 0:00:16
888500 -- [-203.528] (-206.393) (-213.811) (-196.271) * (-200.588) (-206.541) [-197.899] (-210.548) -- 0:00:16
889000 -- (-201.475) (-208.547) [-198.902] (-204.370) * (-199.302) (-201.311) (-201.462) [-211.026] -- 0:00:16
889500 -- (-200.953) (-196.803) [-201.500] (-196.696) * (-202.134) [-197.710] (-208.546) (-201.455) -- 0:00:16
890000 -- (-201.271) (-199.334) (-203.941) [-196.309] * (-205.268) [-194.649] (-201.784) (-211.851) -- 0:00:16
Average standard deviation of split frequencies: 0.012056
890500 -- (-200.138) (-197.803) (-200.110) [-194.793] * (-199.790) [-207.480] (-210.418) (-209.806) -- 0:00:16
891000 -- [-204.274] (-207.003) (-200.514) (-200.708) * (-202.693) (-206.061) [-199.706] (-203.736) -- 0:00:16
891500 -- (-205.060) (-208.049) [-201.533] (-212.362) * (-199.629) (-211.206) [-202.338] (-207.474) -- 0:00:16
892000 -- [-199.769] (-206.357) (-204.246) (-206.271) * [-200.204] (-198.796) (-210.898) (-207.267) -- 0:00:16
892500 -- (-196.496) (-209.642) [-199.167] (-208.138) * (-198.373) (-211.284) (-210.165) [-201.750] -- 0:00:16
893000 -- (-211.243) (-199.193) (-199.944) [-194.117] * [-194.578] (-198.370) (-204.262) (-208.240) -- 0:00:16
893500 -- [-204.755] (-197.076) (-210.271) (-205.468) * [-201.447] (-203.148) (-200.812) (-207.558) -- 0:00:15
894000 -- (-201.512) (-200.400) [-199.081] (-201.899) * [-200.193] (-209.391) (-206.290) (-203.436) -- 0:00:15
894500 -- (-198.904) [-210.903] (-203.719) (-210.515) * [-199.185] (-204.275) (-205.445) (-202.280) -- 0:00:15
895000 -- [-196.122] (-213.347) (-211.048) (-203.723) * [-202.038] (-206.849) (-196.270) (-205.497) -- 0:00:15
Average standard deviation of split frequencies: 0.012042
895500 -- (-208.598) (-199.243) (-205.611) [-198.620] * (-200.888) (-202.878) (-204.646) [-201.498] -- 0:00:15
896000 -- (-206.985) (-203.748) [-201.335] (-194.995) * (-199.977) (-208.254) (-210.986) [-196.932] -- 0:00:15
896500 -- [-200.708] (-206.082) (-202.238) (-203.566) * (-199.893) (-206.151) [-199.087] (-202.345) -- 0:00:15
897000 -- (-203.010) (-197.873) (-200.586) [-194.862] * [-197.975] (-205.991) (-204.025) (-195.059) -- 0:00:15
897500 -- (-211.632) [-197.995] (-202.273) (-203.248) * (-202.103) (-202.279) [-194.935] (-203.204) -- 0:00:15
898000 -- (-204.514) (-211.417) [-205.204] (-199.012) * (-206.093) (-204.829) [-199.479] (-210.456) -- 0:00:15
898500 -- (-200.264) (-197.596) (-203.142) [-204.980] * [-201.478] (-208.537) (-202.721) (-200.280) -- 0:00:15
899000 -- [-198.605] (-208.920) (-205.695) (-206.560) * (-201.674) (-212.864) [-209.060] (-203.770) -- 0:00:15
899500 -- (-203.016) [-199.790] (-198.881) (-204.503) * [-189.721] (-206.126) (-206.378) (-200.863) -- 0:00:15
900000 -- (-200.490) [-194.915] (-205.534) (-202.646) * (-198.877) [-202.108] (-210.564) (-202.380) -- 0:00:14
Average standard deviation of split frequencies: 0.012154
900500 -- (-202.336) [-203.823] (-204.134) (-219.413) * [-204.314] (-204.294) (-206.898) (-204.415) -- 0:00:14
901000 -- (-201.952) (-204.521) (-197.224) [-205.646] * (-200.767) (-200.853) [-202.809] (-213.354) -- 0:00:14
901500 -- (-198.083) (-205.046) [-198.477] (-208.161) * (-200.300) [-201.514] (-202.868) (-199.110) -- 0:00:14
902000 -- (-201.803) (-197.381) (-194.684) [-192.169] * (-202.793) [-202.866] (-214.278) (-201.467) -- 0:00:14
902500 -- [-199.827] (-194.296) (-199.354) (-207.446) * (-201.461) (-208.033) [-202.844] (-204.671) -- 0:00:14
903000 -- (-204.403) (-198.048) [-195.084] (-206.807) * (-197.922) [-200.632] (-201.277) (-200.250) -- 0:00:14
903500 -- (-204.333) (-197.785) (-205.751) [-199.143] * (-203.972) (-212.791) (-203.589) [-199.211] -- 0:00:14
904000 -- (-205.141) [-198.044] (-200.094) (-209.127) * (-197.813) (-210.697) [-203.793] (-201.211) -- 0:00:14
904500 -- (-205.897) (-206.617) [-199.691] (-211.997) * (-205.587) (-208.358) (-210.434) [-199.951] -- 0:00:14
905000 -- [-204.841] (-196.352) (-206.403) (-219.306) * (-212.341) (-203.926) (-200.249) [-193.135] -- 0:00:14
Average standard deviation of split frequencies: 0.012141
905500 -- [-197.069] (-206.645) (-202.789) (-211.688) * [-199.168] (-198.336) (-203.176) (-203.436) -- 0:00:14
906000 -- (-203.157) [-197.927] (-201.266) (-206.506) * (-194.845) (-203.824) [-196.758] (-199.410) -- 0:00:14
906500 -- (-203.138) (-199.936) (-208.420) [-205.549] * [-202.235] (-203.583) (-196.888) (-207.092) -- 0:00:14
907000 -- [-197.027] (-196.310) (-209.030) (-202.478) * [-205.544] (-202.089) (-202.054) (-203.175) -- 0:00:13
907500 -- (-204.788) (-204.473) [-198.306] (-205.512) * (-200.909) (-199.712) [-203.209] (-199.663) -- 0:00:13
908000 -- (-204.870) (-202.654) (-202.374) [-201.516] * (-194.876) (-206.881) (-201.550) [-200.724] -- 0:00:13
908500 -- (-201.254) (-197.449) [-197.965] (-203.114) * (-200.936) (-212.336) (-201.134) [-195.656] -- 0:00:13
909000 -- [-197.050] (-203.275) (-198.113) (-202.382) * (-197.984) [-206.674] (-206.145) (-204.960) -- 0:00:13
909500 -- (-202.162) (-206.318) (-205.866) [-201.468] * (-205.263) (-201.863) (-195.535) [-198.774] -- 0:00:13
910000 -- (-208.547) [-197.029] (-212.855) (-201.184) * [-198.256] (-204.838) (-199.767) (-205.906) -- 0:00:13
Average standard deviation of split frequencies: 0.012193
910500 -- (-201.082) [-200.855] (-204.547) (-201.044) * (-201.454) (-201.119) (-208.771) [-200.116] -- 0:00:13
911000 -- [-197.403] (-205.277) (-204.902) (-206.218) * (-202.299) [-210.338] (-203.147) (-199.239) -- 0:00:13
911500 -- (-208.113) [-198.747] (-209.135) (-201.911) * [-201.666] (-206.489) (-215.856) (-195.169) -- 0:00:13
912000 -- (-203.151) (-203.064) [-198.356] (-202.666) * (-200.894) (-202.398) (-212.611) [-198.916] -- 0:00:13
912500 -- [-202.364] (-196.652) (-196.127) (-208.942) * (-206.170) (-207.265) (-204.243) [-191.210] -- 0:00:13
913000 -- (-195.414) [-198.722] (-205.494) (-197.901) * (-199.158) [-199.238] (-202.722) (-211.808) -- 0:00:13
913500 -- (-210.011) [-194.612] (-204.401) (-207.213) * (-213.350) [-198.405] (-197.186) (-209.977) -- 0:00:12
914000 -- (-202.723) (-202.276) (-193.251) [-194.750] * (-202.541) (-209.185) [-200.132] (-202.741) -- 0:00:12
914500 -- (-199.218) [-208.047] (-201.616) (-202.877) * (-200.663) [-194.263] (-202.358) (-203.221) -- 0:00:12
915000 -- (-206.615) [-202.221] (-193.983) (-205.332) * [-197.768] (-198.476) (-198.569) (-203.572) -- 0:00:12
Average standard deviation of split frequencies: 0.012437
915500 -- (-205.046) (-205.725) (-191.102) [-196.397] * [-196.841] (-202.234) (-203.050) (-206.998) -- 0:00:12
916000 -- (-202.428) (-208.795) (-205.623) [-193.564] * (-204.946) (-205.077) [-205.731] (-202.467) -- 0:00:12
916500 -- (-204.471) [-203.698] (-205.884) (-202.524) * [-194.079] (-199.104) (-207.276) (-202.890) -- 0:00:12
917000 -- [-197.224] (-202.639) (-205.527) (-201.972) * (-214.812) (-218.332) (-203.728) [-198.336] -- 0:00:12
917500 -- [-198.191] (-210.833) (-204.738) (-203.663) * [-201.795] (-207.645) (-202.142) (-205.186) -- 0:00:12
918000 -- (-196.792) (-205.314) (-197.410) [-196.689] * [-195.490] (-205.266) (-213.240) (-203.387) -- 0:00:12
918500 -- (-200.618) (-208.028) [-197.610] (-199.501) * (-195.545) (-199.411) [-198.136] (-209.816) -- 0:00:12
919000 -- (-201.356) (-199.772) (-201.956) [-194.075] * (-194.183) [-199.972] (-206.492) (-201.930) -- 0:00:12
919500 -- (-194.803) (-200.694) (-205.315) [-204.209] * (-207.025) (-198.326) (-210.048) [-208.122] -- 0:00:12
920000 -- (-205.219) (-204.204) (-200.906) [-196.210] * (-203.905) [-204.856] (-202.753) (-201.627) -- 0:00:11
Average standard deviation of split frequencies: 0.012886
920500 -- (-208.335) (-201.244) (-209.969) [-199.643] * (-204.822) [-191.758] (-206.740) (-205.595) -- 0:00:11
921000 -- (-206.810) (-196.282) (-203.433) [-197.517] * (-203.912) [-199.562] (-203.903) (-196.839) -- 0:00:11
921500 -- (-201.465) [-199.720] (-209.808) (-199.116) * (-204.208) (-212.169) (-206.168) [-197.707] -- 0:00:11
922000 -- (-200.015) [-194.455] (-211.456) (-200.899) * (-202.355) (-207.507) (-204.729) [-196.229] -- 0:00:11
922500 -- (-204.975) (-199.761) (-202.643) [-202.086] * (-203.841) (-205.910) (-212.233) [-200.049] -- 0:00:11
923000 -- [-201.559] (-196.973) (-204.320) (-203.145) * (-211.653) (-206.470) (-213.620) [-204.188] -- 0:00:11
923500 -- (-199.076) (-207.488) (-205.564) [-199.356] * (-202.348) (-200.517) (-207.748) [-198.216] -- 0:00:11
924000 -- (-202.982) [-201.042] (-204.568) (-211.218) * [-193.154] (-208.704) (-208.869) (-204.997) -- 0:00:11
924500 -- (-202.916) [-203.565] (-202.080) (-200.200) * (-204.315) (-197.508) (-197.420) [-209.319] -- 0:00:11
925000 -- [-203.743] (-202.079) (-200.951) (-205.619) * [-200.784] (-197.964) (-206.831) (-203.287) -- 0:00:11
Average standard deviation of split frequencies: 0.013179
925500 -- (-193.991) (-202.434) [-197.988] (-206.927) * (-203.113) (-203.842) (-197.342) [-198.162] -- 0:00:11
926000 -- (-200.973) (-217.488) [-200.197] (-201.106) * [-192.169] (-200.522) (-207.509) (-201.535) -- 0:00:11
926500 -- (-204.462) (-203.452) (-202.854) [-208.327] * [-192.932] (-204.696) (-200.661) (-201.225) -- 0:00:11
927000 -- (-207.285) [-210.917] (-203.086) (-199.763) * (-206.805) [-193.907] (-207.808) (-205.251) -- 0:00:10
927500 -- (-201.462) [-201.267] (-200.837) (-207.554) * (-206.203) (-198.766) [-194.571] (-198.986) -- 0:00:10
928000 -- (-204.662) [-199.288] (-205.773) (-202.614) * (-203.821) (-203.908) (-200.771) [-207.073] -- 0:00:10
928500 -- (-202.778) (-201.405) [-206.260] (-208.718) * (-200.951) (-205.037) (-208.104) [-203.875] -- 0:00:10
929000 -- [-209.154] (-197.875) (-200.794) (-205.199) * [-203.441] (-197.689) (-202.785) (-213.191) -- 0:00:10
929500 -- (-206.411) [-196.077] (-208.024) (-199.264) * (-198.896) (-201.917) [-196.512] (-205.774) -- 0:00:10
930000 -- (-204.717) (-204.100) [-201.523] (-211.369) * [-195.460] (-206.811) (-204.799) (-204.646) -- 0:00:10
Average standard deviation of split frequencies: 0.013310
930500 -- (-198.529) (-199.811) (-215.388) [-204.208] * (-196.668) [-203.200] (-200.601) (-203.218) -- 0:00:10
931000 -- [-197.787] (-204.912) (-201.835) (-207.001) * [-202.231] (-200.889) (-203.485) (-209.920) -- 0:00:10
931500 -- (-199.618) (-197.274) [-202.910] (-201.154) * (-202.135) (-203.384) [-194.062] (-207.151) -- 0:00:10
932000 -- (-200.617) [-200.824] (-211.874) (-198.568) * (-210.828) (-204.483) (-219.930) [-198.975] -- 0:00:10
932500 -- (-210.142) (-203.881) (-205.963) [-198.558] * (-206.504) (-207.998) (-198.822) [-198.814] -- 0:00:10
933000 -- (-200.829) (-209.076) (-203.283) [-197.771] * (-201.261) (-198.815) [-205.396] (-193.860) -- 0:00:10
933500 -- (-203.822) (-209.390) [-204.620] (-210.120) * [-199.937] (-202.988) (-202.798) (-209.944) -- 0:00:09
934000 -- (-204.256) (-204.487) [-202.115] (-201.029) * (-206.581) [-196.825] (-207.119) (-201.135) -- 0:00:09
934500 -- (-209.401) (-200.854) [-202.228] (-201.546) * [-201.013] (-203.655) (-203.091) (-199.260) -- 0:00:09
935000 -- (-210.624) (-206.055) (-203.965) [-199.163] * (-201.995) (-203.237) (-199.976) [-197.244] -- 0:00:09
Average standard deviation of split frequencies: 0.013542
935500 -- [-206.255] (-201.069) (-197.282) (-199.630) * [-200.192] (-205.505) (-222.121) (-194.939) -- 0:00:09
936000 -- (-203.250) (-201.251) [-198.160] (-191.825) * (-203.657) (-212.317) [-200.984] (-199.823) -- 0:00:09
936500 -- (-208.393) (-200.444) [-197.125] (-204.822) * [-199.120] (-202.393) (-200.027) (-200.034) -- 0:00:09
937000 -- (-212.747) [-203.517] (-205.112) (-200.175) * (-204.012) (-214.762) (-205.515) [-191.790] -- 0:00:09
937500 -- (-201.666) [-194.374] (-208.367) (-201.056) * (-206.060) (-209.613) [-194.937] (-199.110) -- 0:00:09
938000 -- [-196.156] (-201.556) (-197.399) (-212.680) * (-199.153) [-205.282] (-208.343) (-202.916) -- 0:00:09
938500 -- (-204.722) (-202.050) [-203.658] (-212.733) * (-201.814) [-206.358] (-200.051) (-210.059) -- 0:00:09
939000 -- (-194.460) [-195.108] (-202.334) (-204.617) * [-196.156] (-201.424) (-204.280) (-202.248) -- 0:00:09
939500 -- (-210.504) (-197.614) [-195.561] (-202.264) * (-204.516) [-206.885] (-212.415) (-200.060) -- 0:00:09
940000 -- (-199.332) [-193.979] (-198.343) (-206.219) * [-195.779] (-199.353) (-199.823) (-199.478) -- 0:00:09
Average standard deviation of split frequencies: 0.013642
940500 -- [-203.165] (-202.867) (-210.416) (-205.072) * [-196.279] (-205.109) (-206.472) (-211.040) -- 0:00:08
941000 -- [-200.176] (-201.525) (-201.321) (-202.852) * (-202.151) (-202.128) (-200.067) [-210.000] -- 0:00:08
941500 -- (-202.083) (-200.143) [-198.631] (-204.395) * [-199.974] (-204.813) (-204.786) (-206.082) -- 0:00:08
942000 -- [-195.621] (-193.725) (-191.500) (-204.334) * (-198.015) (-204.758) (-197.434) [-199.401] -- 0:00:08
942500 -- (-197.510) (-196.898) (-204.924) [-198.195] * (-205.699) (-204.528) (-205.863) [-193.532] -- 0:00:08
943000 -- (-200.525) (-212.485) (-217.401) [-193.772] * (-201.819) [-210.955] (-208.525) (-200.764) -- 0:00:08
943500 -- (-202.719) (-196.482) (-204.512) [-198.668] * (-206.006) (-203.063) (-202.346) [-201.923] -- 0:00:08
944000 -- (-199.843) (-193.802) [-193.400] (-203.462) * (-196.530) (-206.265) [-201.717] (-204.495) -- 0:00:08
944500 -- (-208.582) (-207.885) [-197.115] (-208.920) * (-199.626) [-205.819] (-207.509) (-207.716) -- 0:00:08
945000 -- [-191.996] (-212.794) (-200.832) (-205.986) * (-203.741) (-209.795) [-198.448] (-209.847) -- 0:00:08
Average standard deviation of split frequencies: 0.013676
945500 -- [-194.257] (-203.512) (-196.579) (-208.491) * (-200.378) [-200.400] (-206.903) (-202.864) -- 0:00:08
946000 -- (-206.930) (-198.100) (-204.427) [-192.837] * (-209.399) (-205.056) (-202.893) [-199.222] -- 0:00:08
946500 -- (-208.885) [-193.442] (-200.442) (-199.151) * (-205.864) (-203.640) (-195.789) [-199.671] -- 0:00:08
947000 -- (-205.376) (-201.452) (-203.717) [-198.354] * (-214.527) (-203.155) (-210.822) [-197.687] -- 0:00:07
947500 -- (-194.900) (-198.658) (-205.462) [-200.520] * (-214.633) (-195.124) (-197.671) [-190.636] -- 0:00:07
948000 -- [-191.509] (-197.691) (-200.697) (-203.788) * (-219.124) (-194.017) [-196.174] (-198.242) -- 0:00:07
948500 -- (-211.473) (-203.776) (-204.039) [-199.672] * (-201.500) [-201.713] (-206.581) (-201.095) -- 0:00:07
949000 -- [-198.530] (-197.647) (-194.853) (-197.033) * (-218.149) (-201.861) [-197.297] (-202.459) -- 0:00:07
949500 -- [-205.484] (-203.125) (-206.395) (-204.765) * (-201.245) (-212.209) [-201.554] (-209.105) -- 0:00:07
950000 -- (-204.642) (-208.228) [-201.633] (-199.960) * [-198.850] (-199.037) (-205.708) (-193.945) -- 0:00:07
Average standard deviation of split frequencies: 0.013636
950500 -- [-196.512] (-206.014) (-199.008) (-209.158) * [-198.947] (-206.068) (-208.556) (-206.231) -- 0:00:07
951000 -- (-209.123) (-210.909) [-200.096] (-206.971) * [-200.414] (-205.863) (-203.998) (-204.295) -- 0:00:07
951500 -- (-200.917) (-207.363) (-208.728) [-202.010] * (-198.418) (-204.546) (-206.954) [-202.046] -- 0:00:07
952000 -- (-197.737) (-207.822) (-209.442) [-202.055] * [-194.471] (-202.145) (-198.595) (-202.326) -- 0:00:07
952500 -- (-204.606) (-209.808) [-197.633] (-205.720) * [-197.383] (-209.441) (-196.920) (-196.712) -- 0:00:07
953000 -- (-196.384) (-214.507) (-203.798) [-199.942] * (-205.607) [-203.726] (-207.748) (-199.795) -- 0:00:07
953500 -- (-200.162) [-202.247] (-198.145) (-208.694) * (-202.790) [-204.039] (-200.483) (-207.902) -- 0:00:06
954000 -- (-203.051) [-201.127] (-210.232) (-204.371) * (-202.196) (-201.881) [-196.998] (-204.485) -- 0:00:06
954500 -- (-194.818) [-196.991] (-212.845) (-211.345) * [-196.981] (-204.574) (-203.116) (-196.769) -- 0:00:06
955000 -- (-206.749) (-204.537) [-201.840] (-214.588) * [-202.209] (-205.113) (-203.744) (-203.562) -- 0:00:06
Average standard deviation of split frequencies: 0.013889
955500 -- (-204.089) (-204.479) [-205.513] (-202.917) * (-207.529) (-205.741) [-193.045] (-200.778) -- 0:00:06
956000 -- [-196.094] (-200.669) (-204.558) (-200.717) * (-215.474) (-214.360) [-201.756] (-208.546) -- 0:00:06
956500 -- [-202.309] (-202.334) (-205.268) (-201.537) * [-200.682] (-212.743) (-202.361) (-196.031) -- 0:00:06
957000 -- [-199.685] (-201.504) (-207.290) (-205.251) * (-199.647) (-210.384) [-196.076] (-200.628) -- 0:00:06
957500 -- (-199.139) [-203.538] (-200.258) (-201.839) * (-200.533) [-207.292] (-199.200) (-208.324) -- 0:00:06
958000 -- [-200.367] (-204.213) (-199.668) (-202.466) * (-201.889) (-201.402) (-203.006) [-205.971] -- 0:00:06
958500 -- [-199.351] (-205.512) (-210.731) (-198.683) * (-197.994) (-204.085) [-198.067] (-206.428) -- 0:00:06
959000 -- [-199.770] (-202.674) (-205.564) (-201.413) * [-207.137] (-201.031) (-199.017) (-199.759) -- 0:00:06
959500 -- (-202.390) (-202.344) [-200.430] (-205.720) * (-215.104) [-198.429] (-200.429) (-198.940) -- 0:00:06
960000 -- [-197.909] (-212.738) (-194.194) (-193.933) * (-205.053) [-196.110] (-204.086) (-213.367) -- 0:00:05
Average standard deviation of split frequencies: 0.013603
960500 -- [-195.118] (-203.805) (-200.904) (-200.544) * (-204.266) (-202.093) (-207.083) [-202.941] -- 0:00:05
961000 -- (-202.063) (-204.380) (-196.116) [-198.253] * [-202.331] (-203.331) (-206.152) (-203.946) -- 0:00:05
961500 -- (-205.009) (-204.916) (-200.912) [-200.592] * (-200.141) (-200.000) (-200.700) [-199.985] -- 0:00:05
962000 -- (-199.460) [-201.699] (-197.899) (-208.294) * [-200.487] (-201.384) (-200.086) (-199.211) -- 0:00:05
962500 -- (-202.252) (-203.565) [-194.526] (-213.078) * (-206.647) [-199.237] (-204.086) (-200.008) -- 0:00:05
963000 -- (-196.882) (-206.517) [-204.171] (-210.255) * [-202.998] (-200.204) (-198.272) (-199.638) -- 0:00:05
963500 -- [-196.675] (-204.571) (-206.666) (-207.003) * (-216.507) (-201.229) [-200.985] (-200.946) -- 0:00:05
964000 -- (-202.266) [-202.929] (-201.625) (-199.951) * [-195.274] (-204.642) (-197.375) (-197.027) -- 0:00:05
964500 -- [-200.189] (-204.974) (-206.303) (-206.420) * (-206.139) (-200.965) [-200.622] (-206.400) -- 0:00:05
965000 -- (-199.557) [-201.226] (-200.629) (-213.100) * (-210.251) [-197.171] (-210.594) (-199.903) -- 0:00:05
Average standard deviation of split frequencies: 0.013176
965500 -- [-199.055] (-198.006) (-208.784) (-207.736) * (-199.654) [-199.832] (-195.500) (-195.178) -- 0:00:05
966000 -- (-200.870) (-201.375) (-209.389) [-195.743] * [-200.321] (-203.745) (-207.646) (-202.521) -- 0:00:05
966500 -- [-196.217] (-199.499) (-206.453) (-200.540) * (-215.525) (-203.330) [-209.854] (-200.730) -- 0:00:05
967000 -- (-201.701) (-200.341) [-198.720] (-201.814) * [-199.919] (-205.623) (-197.454) (-198.058) -- 0:00:04
967500 -- [-199.857] (-195.926) (-198.514) (-202.335) * (-209.912) [-194.855] (-206.269) (-206.701) -- 0:00:04
968000 -- (-205.405) (-203.136) (-197.988) [-201.221] * (-194.574) (-203.033) (-212.320) [-210.357] -- 0:00:04
968500 -- (-204.383) [-210.914] (-201.537) (-196.572) * (-204.744) [-198.955] (-206.125) (-209.903) -- 0:00:04
969000 -- [-203.318] (-208.014) (-201.269) (-199.416) * [-196.961] (-200.683) (-196.840) (-207.366) -- 0:00:04
969500 -- (-203.746) (-203.076) (-198.782) [-202.489] * [-196.681] (-202.370) (-206.958) (-216.719) -- 0:00:04
970000 -- (-206.472) (-205.067) (-202.265) [-196.801] * (-195.036) [-196.148] (-207.018) (-208.379) -- 0:00:04
Average standard deviation of split frequencies: 0.012870
970500 -- (-208.347) [-199.927] (-203.243) (-200.258) * (-196.000) [-204.654] (-205.091) (-208.170) -- 0:00:04
971000 -- (-207.129) [-201.989] (-207.241) (-198.126) * (-200.829) (-204.432) (-203.537) [-199.169] -- 0:00:04
971500 -- (-207.447) [-200.369] (-205.311) (-200.019) * (-205.002) [-203.421] (-208.617) (-198.817) -- 0:00:04
972000 -- [-206.594] (-204.057) (-203.896) (-202.747) * [-201.238] (-215.800) (-204.378) (-206.275) -- 0:00:04
972500 -- [-203.201] (-205.735) (-201.697) (-207.803) * [-199.160] (-206.463) (-201.908) (-208.741) -- 0:00:04
973000 -- [-201.091] (-206.364) (-201.567) (-201.583) * (-210.624) (-218.347) (-208.349) [-198.419] -- 0:00:04
973500 -- (-203.058) (-202.316) [-193.897] (-199.385) * (-198.524) (-206.358) (-202.077) [-195.231] -- 0:00:03
974000 -- (-204.205) (-204.570) (-195.650) [-202.615] * (-207.631) (-208.371) (-202.276) [-201.711] -- 0:00:03
974500 -- [-197.003] (-216.317) (-201.761) (-201.406) * [-195.177] (-205.892) (-207.303) (-206.068) -- 0:00:03
975000 -- [-195.208] (-209.405) (-200.982) (-208.887) * [-196.958] (-212.270) (-209.218) (-204.542) -- 0:00:03
Average standard deviation of split frequencies: 0.012826
975500 -- [-195.275] (-206.867) (-198.574) (-203.909) * [-200.426] (-209.397) (-201.284) (-205.788) -- 0:00:03
976000 -- (-200.082) [-207.150] (-211.924) (-201.903) * [-203.695] (-201.138) (-207.835) (-197.445) -- 0:00:03
976500 -- (-200.830) (-203.984) [-197.397] (-207.736) * [-194.327] (-208.675) (-198.614) (-199.115) -- 0:00:03
977000 -- [-197.304] (-202.082) (-201.962) (-197.376) * (-195.964) (-199.897) (-205.579) [-194.794] -- 0:00:03
977500 -- (-203.360) (-202.320) [-194.041] (-209.306) * (-202.460) (-202.121) [-199.045] (-197.213) -- 0:00:03
978000 -- [-196.270] (-206.126) (-204.427) (-211.544) * [-194.973] (-205.461) (-198.125) (-198.783) -- 0:00:03
978500 -- (-202.735) [-192.278] (-202.818) (-201.425) * [-201.761] (-207.853) (-210.065) (-208.488) -- 0:00:03
979000 -- (-210.425) [-194.955] (-200.413) (-206.102) * (-201.948) (-207.309) (-205.716) [-196.020] -- 0:00:03
979500 -- [-191.535] (-203.817) (-202.923) (-216.732) * (-205.555) (-220.413) [-201.828] (-205.281) -- 0:00:03
980000 -- [-201.480] (-210.745) (-214.594) (-200.404) * [-201.369] (-204.799) (-205.998) (-203.014) -- 0:00:02
Average standard deviation of split frequencies: 0.012578
980500 -- [-203.946] (-210.480) (-202.528) (-202.433) * [-209.126] (-211.318) (-207.074) (-211.458) -- 0:00:02
981000 -- (-206.314) (-202.699) [-204.177] (-200.962) * (-207.855) [-204.996] (-212.254) (-214.935) -- 0:00:02
981500 -- [-201.949] (-211.749) (-202.240) (-198.189) * (-202.790) (-211.501) (-204.331) [-200.656] -- 0:00:02
982000 -- [-202.512] (-200.977) (-206.366) (-198.614) * [-206.727] (-198.527) (-205.676) (-205.457) -- 0:00:02
982500 -- (-197.911) [-202.171] (-202.873) (-209.919) * (-205.224) [-204.260] (-209.848) (-206.178) -- 0:00:02
983000 -- (-202.225) (-203.747) [-205.551] (-203.916) * (-203.063) [-206.085] (-199.213) (-205.257) -- 0:00:02
983500 -- (-208.147) (-196.832) [-196.946] (-220.048) * [-200.369] (-205.647) (-201.909) (-211.855) -- 0:00:02
984000 -- (-207.938) [-198.999] (-204.285) (-206.220) * (-205.979) (-203.149) [-205.500] (-206.047) -- 0:00:02
984500 -- [-199.875] (-199.227) (-208.356) (-212.372) * [-200.273] (-212.974) (-215.910) (-219.833) -- 0:00:02
985000 -- (-205.440) [-192.971] (-208.796) (-204.621) * (-203.638) (-204.624) [-200.506] (-218.450) -- 0:00:02
Average standard deviation of split frequencies: 0.012457
985500 -- (-201.266) (-200.510) [-199.822] (-212.329) * (-201.047) [-204.386] (-203.748) (-210.701) -- 0:00:02
986000 -- (-206.589) (-192.902) [-192.286] (-204.027) * (-202.636) (-210.813) [-197.591] (-203.113) -- 0:00:02
986500 -- (-206.107) [-199.399] (-199.384) (-204.653) * (-206.632) (-202.550) [-194.895] (-203.566) -- 0:00:02
987000 -- (-200.396) (-201.100) (-200.035) [-196.796] * (-201.057) (-203.794) [-199.646] (-205.630) -- 0:00:01
987500 -- (-204.936) (-197.246) (-206.391) [-203.543] * (-198.597) [-203.068] (-204.367) (-204.107) -- 0:00:01
988000 -- (-211.053) [-196.064] (-205.066) (-213.787) * (-198.700) (-204.922) [-194.507] (-202.326) -- 0:00:01
988500 -- (-210.972) [-193.097] (-196.748) (-207.585) * (-193.726) (-205.994) [-198.084] (-208.969) -- 0:00:01
989000 -- (-195.796) (-214.329) [-196.489] (-199.699) * (-196.799) [-203.562] (-199.836) (-203.144) -- 0:00:01
989500 -- (-208.175) [-198.707] (-207.383) (-213.058) * (-206.282) (-200.015) (-202.501) [-206.406] -- 0:00:01
990000 -- (-204.809) (-214.145) (-196.818) [-203.757] * (-201.941) [-202.777] (-202.960) (-210.393) -- 0:00:01
Average standard deviation of split frequencies: 0.012134
990500 -- (-200.052) [-197.788] (-206.967) (-211.179) * (-209.347) (-214.020) [-201.060] (-204.628) -- 0:00:01
991000 -- (-206.268) [-200.343] (-202.446) (-201.759) * [-201.285] (-205.471) (-194.117) (-199.381) -- 0:00:01
991500 -- (-211.915) [-197.197] (-213.442) (-200.791) * (-205.420) (-199.669) (-201.496) [-203.155] -- 0:00:01
992000 -- [-199.961] (-201.181) (-204.565) (-201.378) * (-217.610) (-204.726) [-191.919] (-207.440) -- 0:00:01
992500 -- (-207.081) [-201.275] (-201.184) (-208.743) * (-210.950) (-203.518) [-199.161] (-201.800) -- 0:00:01
993000 -- (-212.225) (-204.773) [-199.220] (-202.551) * (-204.247) (-203.833) [-200.871] (-194.647) -- 0:00:01
993500 -- (-209.623) [-203.977] (-201.505) (-208.614) * (-213.345) (-213.071) [-203.900] (-193.465) -- 0:00:00
994000 -- (-202.342) (-203.757) (-200.661) [-207.309] * (-210.849) (-203.648) (-214.428) [-196.915] -- 0:00:00
994500 -- (-209.340) (-199.012) [-206.558] (-199.368) * (-199.608) (-213.925) (-199.777) [-196.395] -- 0:00:00
995000 -- (-199.404) (-207.552) [-201.295] (-202.835) * (-208.587) [-200.143] (-198.646) (-204.117) -- 0:00:00
Average standard deviation of split frequencies: 0.012227
995500 -- (-198.805) [-197.988] (-204.580) (-207.008) * [-199.864] (-198.756) (-201.861) (-218.913) -- 0:00:00
996000 -- (-202.210) (-201.398) (-198.494) [-200.349] * (-202.822) (-211.008) (-201.818) [-201.272] -- 0:00:00
996500 -- [-200.323] (-201.278) (-195.131) (-202.964) * [-205.065] (-210.320) (-201.554) (-198.494) -- 0:00:00
997000 -- [-204.258] (-205.368) (-198.945) (-211.810) * (-206.345) (-206.079) [-203.042] (-208.076) -- 0:00:00
997500 -- (-205.053) [-202.252] (-203.477) (-211.247) * [-201.329] (-216.643) (-200.098) (-202.802) -- 0:00:00
998000 -- [-203.245] (-196.305) (-202.541) (-201.344) * (-202.477) (-203.676) [-200.804] (-198.540) -- 0:00:00
998500 -- (-196.299) (-218.388) [-202.383] (-203.491) * [-198.215] (-208.173) (-213.379) (-217.237) -- 0:00:00
999000 -- (-207.559) (-199.836) (-202.679) [-198.303] * (-200.518) (-195.041) [-203.308] (-204.577) -- 0:00:00
999500 -- [-198.728] (-201.045) (-206.260) (-210.147) * [-199.545] (-201.157) (-198.727) (-210.895) -- 0:00:00
1000000 -- (-209.063) (-208.540) (-196.831) [-189.965] * (-209.797) (-199.346) (-203.576) [-199.920] -- 0:00:00
Average standard deviation of split frequencies: 0.011934
Final log likelihoods and log prior probs for run 1 (stored and calculated):
Chain 1 -- -209.063093 -- 16.413734
Chain 1 -- -209.063092 -- 16.413734
Chain 2 -- -208.540230 -- 22.667562
Chain 2 -- -208.540232 -- 22.667562
Chain 3 -- -196.830617 -- 22.022033
Chain 3 -- -196.830614 -- 22.022033
Chain 4 -- -189.964805 -- 20.907175
Chain 4 -- -189.964805 -- 20.907175
Final log likelihoods and log prior probs for run 2 (stored and calculated):
Chain 1 -- -209.797333 -- 13.836714
Chain 1 -- -209.797332 -- 13.836714
Chain 2 -- -199.346348 -- 20.587250
Chain 2 -- -199.346348 -- 20.587250
Chain 3 -- -203.575707 -- 13.286399
Chain 3 -- -203.575709 -- 13.286399
Chain 4 -- -199.920498 -- 21.079465
Chain 4 -- -199.920498 -- 21.079465
Analysis completed in 2 mins 30 seconds
Analysis used 149.65 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -187.51
Likelihood of best state for "cold" chain of run 2 was -187.56
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
69.8 % ( 53 %) Dirichlet(Revmat{all})
88.9 % ( 83 %) Slider(Revmat{all})
59.3 % ( 49 %) Dirichlet(Pi{all})
55.1 % ( 30 %) Slider(Pi{all})
61.5 % ( 31 %) Multiplier(Alpha{1,2})
57.1 % ( 25 %) Multiplier(Alpha{3})
81.0 % ( 59 %) Slider(Pinvar{all})
42.5 % ( 43 %) ExtSPR(Tau{all},V{all})
20.5 % ( 19 %) ExtTBR(Tau{all},V{all})
57.9 % ( 56 %) NNI(Tau{all},V{all})
40.4 % ( 46 %) ParsSPR(Tau{all},V{all})
27.9 % ( 22 %) Multiplier(V{all})
68.7 % ( 72 %) Nodeslider(V{all})
28.9 % ( 24 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
69.5 % ( 74 %) Dirichlet(Revmat{all})
89.2 % ( 83 %) Slider(Revmat{all})
59.7 % ( 55 %) Dirichlet(Pi{all})
54.5 % ( 37 %) Slider(Pi{all})
61.6 % ( 27 %) Multiplier(Alpha{1,2})
57.0 % ( 30 %) Multiplier(Alpha{3})
81.2 % ( 66 %) Slider(Pinvar{all})
42.7 % ( 37 %) ExtSPR(Tau{all},V{all})
20.6 % ( 19 %) ExtTBR(Tau{all},V{all})
57.5 % ( 52 %) NNI(Tau{all},V{all})
40.5 % ( 28 %) ParsSPR(Tau{all},V{all})
27.8 % ( 31 %) Multiplier(V{all})
68.7 % ( 71 %) Nodeslider(V{all})
28.7 % ( 23 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.70 0.45 0.28
2 | 167105 0.72 0.49
3 | 166417 166982 0.74
4 | 166594 166503 166399
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.70 0.45 0.28
2 | 166524 0.72 0.49
3 | 166491 166444 0.74
4 | 166587 166487 167467
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p and /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p
Writing summary statistics to file /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -196.97
| 1 |
| |
| 1 2 |
| 1 1 1 1 1 1 |
| 1 22 1 1 * 2 1 1 1 1 2 |
| 22 1 2 21 2 21 11 2 2 1 1 1* |
|22 2 2 21 2 2 2 2 2 1 2 |
| 1 21 1 2 11 22 1 1 2 1 1 2 222 2 |
| 2 2 * 22 1 22 2 2 * 22 1 2* 1|
|1 2 1 1 1 1 1 1 2 1 1 2|
| 1 * 2 11 1 2 2 |
| 2 1 2 2 |
| 1 |
| 1 |
| 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -202.68
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -194.82 -210.04
2 -194.69 -208.89
--------------------------------------
TOTAL -194.75 -209.62
--------------------------------------
Model parameter summaries over the runs sampled in files
"/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.841705 0.069177 0.406774 1.365913 0.804071 1216.94 1331.18 1.000
r(A<->C){all} 0.125521 0.010805 0.000214 0.334950 0.097044 252.59 272.03 1.000
r(A<->G){all} 0.139760 0.011900 0.000027 0.349758 0.115069 200.89 263.41 1.002
r(A<->T){all} 0.098068 0.009715 0.000015 0.304714 0.065422 365.84 377.81 1.003
r(C<->G){all} 0.039385 0.001474 0.000007 0.119636 0.027758 505.39 554.30 1.000
r(C<->T){all} 0.309678 0.018920 0.063552 0.567203 0.294527 286.14 312.87 1.000
r(G<->T){all} 0.287587 0.018006 0.051869 0.537914 0.270750 243.96 263.63 1.000
pi(A){all} 0.151568 0.001302 0.078346 0.218883 0.149867 1062.38 1132.72 1.000
pi(C){all} 0.350473 0.002326 0.263175 0.452109 0.349721 1098.93 1145.53 1.000
pi(G){all} 0.170989 0.001494 0.095073 0.243612 0.168585 1104.58 1302.79 1.000
pi(T){all} 0.326971 0.002283 0.239114 0.421947 0.325968 1210.90 1235.98 1.000
alpha{1,2} 0.095950 0.005711 0.000153 0.218025 0.085720 1217.03 1234.57 1.001
alpha{3} 1.186738 0.380873 0.249396 2.435140 1.056066 1377.27 1439.14 1.000
pinvar{all} 0.348527 0.027962 0.018671 0.629413 0.354800 814.08 961.68 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a paramiter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
5 -- C5
6 -- C6
7 -- C7
8 -- C8
9 -- C9
Key to taxon bipartitions (saved to file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.parts"):
ID -- Partition
---------------
1 -- .********
2 -- .*.......
3 -- ..*......
4 -- ...*.....
5 -- ....*....
6 -- .....*...
7 -- ......*..
8 -- .......*.
9 -- ........*
10 -- .....****
11 -- ...******
12 -- ......**.
13 -- ...**....
14 -- .*.******
15 -- ..*******
16 -- .**......
17 -- ...*.****
18 -- ....*****
19 -- .....*..*
20 -- ......***
21 -- .....***.
22 -- .....**.*
23 -- .....*.**
24 -- .....**..
25 -- ......*.*
26 -- .......**
27 -- .....*.*.
---------------
Summary statistics for informative taxon bipartitions
(saved to file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
10 2956 0.984677 0.001884 0.983344 0.986009 2
11 2777 0.925050 0.006124 0.920720 0.929380 2
12 1452 0.483678 0.010364 0.476349 0.491006 2
13 1242 0.413724 0.006595 0.409061 0.418388 2
14 1057 0.352099 0.021199 0.337109 0.367089 2
15 929 0.309460 0.004240 0.306462 0.312458 2
16 929 0.309460 0.016488 0.297801 0.321119 2
17 867 0.288807 0.006124 0.284477 0.293138 2
18 836 0.278481 0.005653 0.274484 0.282478 2
19 799 0.266156 0.023083 0.249833 0.282478 2
20 753 0.250833 0.012719 0.241839 0.259827 2
21 675 0.224850 0.024968 0.207195 0.242505 2
22 444 0.147901 0.028265 0.127915 0.167888 2
23 421 0.140240 0.000471 0.139907 0.140573 2
24 374 0.124584 0.000000 0.124584 0.124584 2
25 372 0.123917 0.010364 0.116589 0.131246 2
26 359 0.119587 0.024026 0.102598 0.136576 2
27 346 0.115256 0.012248 0.106596 0.123917 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.026239 0.000845 0.000005 0.084695 0.016846 1.001 2
length{all}[2] 0.050940 0.001906 0.000052 0.132071 0.039543 1.000 2
length{all}[3] 0.026419 0.000837 0.000003 0.083120 0.017104 1.000 2
length{all}[4] 0.026995 0.000910 0.000012 0.089407 0.016973 1.000 2
length{all}[5] 0.026169 0.000872 0.000000 0.081536 0.017063 1.000 2
length{all}[6] 0.055704 0.002089 0.000156 0.144742 0.043937 1.001 2
length{all}[7] 0.066079 0.002950 0.000031 0.170970 0.052120 1.000 2
length{all}[8] 0.176758 0.009724 0.025364 0.379524 0.155598 1.000 2
length{all}[9] 0.053319 0.002016 0.000089 0.141987 0.041845 1.000 2
length{all}[10] 0.119092 0.006076 0.004014 0.273724 0.101741 1.000 2
length{all}[11] 0.077409 0.003186 0.000110 0.183708 0.063703 1.000 2
length{all}[12] 0.057451 0.002670 0.000033 0.156429 0.043660 1.000 2
length{all}[13] 0.036909 0.001381 0.000001 0.112381 0.025730 0.999 2
length{all}[14] 0.031441 0.001134 0.000005 0.099175 0.021017 0.999 2
length{all}[15] 0.027880 0.001004 0.000002 0.084953 0.017839 1.000 2
length{all}[16] 0.026896 0.000955 0.000006 0.087099 0.016820 0.999 2
length{all}[17] 0.027117 0.000970 0.000073 0.082777 0.017434 1.003 2
length{all}[18] 0.024683 0.000788 0.000019 0.080066 0.014385 0.999 2
length{all}[19] 0.035384 0.001459 0.000055 0.113750 0.022842 1.000 2
length{all}[20] 0.035664 0.001713 0.000016 0.110955 0.022786 0.999 2
length{all}[21] 0.036750 0.001651 0.000043 0.111237 0.023297 1.000 2
length{all}[22] 0.043234 0.002155 0.000011 0.125863 0.032007 0.999 2
length{all}[23] 0.036132 0.001572 0.000007 0.116609 0.022581 1.001 2
length{all}[24] 0.032772 0.001233 0.000146 0.101082 0.021205 1.000 2
length{all}[25] 0.032643 0.001039 0.000154 0.096242 0.023510 0.998 2
length{all}[26] 0.035956 0.001650 0.000091 0.124014 0.022819 0.999 2
length{all}[27] 0.028436 0.001069 0.000137 0.098919 0.017533 0.998 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.011934
Maximum standard deviation of split frequencies = 0.028265
Average PSRF for parameter values ( excluding NA and >10.0 ) = 1.000
Maximum PSRF for parameter values = 1.003
Clade credibility values:
/------------------------------------------------------------------------ C1 (1)
|
|------------------------------------------------------------------------ C2 (2)
|
|------------------------------------------------------------------------ C3 (3)
+
| /------------------------------------------------ C4 (4)
| |
| |------------------------------------------------ C5 (5)
| |
\-----------93----------+ /------------------------ C6 (6)
| |
| |------------------------ C7 (7)
\-----------98----------+
|------------------------ C8 (8)
|
\------------------------ C9 (9)
Phylogram (based on average branch lengths):
/---- C1 (1)
|
|--------- C2 (2)
|
|---- C3 (3)
+
| /---- C4 (4)
| |
| |---- C5 (5)
| |
\-------------+ /---------- C6 (6)
| |
| |------------ C7 (7)
\----------------------+
|----------------------------------- C8 (8)
|
\--------- C9 (9)
|----------| 0.050 expected changes per site
Calculating tree probabilities...
Credible sets of trees (347 trees sampled):
50 % credible set contains 34 trees
90 % credible set contains 128 trees
95 % credible set contains 197 trees
99 % credible set contains 317 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
MrBayes output code: 0
CODONML in paml version 4.8, March 2014
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 0 1 2 3 7 8
seq file is not paml/phylip format. Trying nexus format.
ns = 9 ls = 84
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Reading seq # 7: C7
Reading seq # 8: C8
Reading seq # 9: C9
Sequences read..
Counting site patterns.. 0:00
22 patterns at 28 / 28 sites (100.0%), 0:00
Counting codons..
288 bytes for distance
21472 bytes for conP
2992 bytes for fhK
5000000 bytes for space
Model 0: one-ratio
TREE # 1
(1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
32208 bytes for conP, adjusted
0.000000 0.038451 0.027862 0.068355 0.030352 0.029876 0.112513 0.045832 0.085860 0.122583 0.051493 0.300000 1.300000
ntime & nrate & np: 11 2 13
Bounds (np=13):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000100
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 999.000000
np = 13
lnL0 = -203.690407
Iterating by ming2
Initial: fx= 203.690407
x= 0.00000 0.03845 0.02786 0.06835 0.03035 0.02988 0.11251 0.04583 0.08586 0.12258 0.05149 0.30000 1.30000
1 h-m-p 0.0000 0.0000 61.9267 ++ 203.690297 m 0.0000 18 | 1/13
2 h-m-p 0.0000 0.0000 60259.4815 ++ 200.685013 m 0.0000 34 | 2/13
3 h-m-p 0.0000 0.0000 102.6550 ++ 200.489944 m 0.0000 50 | 3/13
4 h-m-p 0.0000 0.0000 1285.6879 ++ 200.476813 m 0.0000 66 | 4/13
5 h-m-p 0.0001 0.0366 2.0633 +++CCC 200.458887 2 0.0042 89 | 4/13
6 h-m-p 0.0088 0.1373 0.9822 +YCYCCC 200.204708 5 0.0512 114 | 4/13
7 h-m-p 0.0014 0.0068 20.4565 YCYCCC 199.782883 5 0.0033 147 | 4/13
8 h-m-p 0.0018 0.0089 20.6507 YCYCCC 198.953436 5 0.0048 171 | 4/13
9 h-m-p 0.0051 0.0254 4.2522 CYCCC 198.753038 4 0.0080 194 | 4/13
10 h-m-p 0.0034 0.5375 9.9570 ++CYCCC 197.112808 4 0.0392 220 | 4/13
11 h-m-p 0.0105 0.0525 2.5862 YYC 197.060914 2 0.0086 238 | 4/13
12 h-m-p 0.0194 1.1816 1.1416 +++ 178.059341 m 1.1816 255 | 4/13
13 h-m-p 0.0006 0.0032 8.8807 +YYYCCC 176.475910 5 0.0024 279 | 4/13
14 h-m-p 0.0005 0.1076 40.3858 YCYCCC 176.195007 5 0.0002 303 | 4/13
15 h-m-p 0.0679 1.5664 0.1320 +YCCCC 175.097439 4 0.5256 327 | 4/13
16 h-m-p 0.2753 1.3766 0.2073 +YCCCC 173.895742 4 0.7426 360 | 4/13
17 h-m-p 1.4625 8.0000 0.1052 YCYCCC 173.612238 5 0.6946 393 | 4/13
18 h-m-p 1.6000 8.0000 0.0423 YCCC 173.413049 3 3.5915 423 | 4/13
19 h-m-p 1.0700 5.3501 0.0658 CYCCCC 173.232174 5 1.6493 457 | 4/13
20 h-m-p 1.0514 7.4190 0.1032 +YYCCC 172.510066 4 3.4416 489 | 4/13
21 h-m-p 1.1651 5.8256 0.1758 CCCCC 171.949141 4 1.6050 522 | 4/13
22 h-m-p 1.1490 5.7449 0.0787 CYCCC 171.739811 4 0.9027 554 | 4/13
23 h-m-p 0.8230 4.1148 0.0420 CYCCC 171.593748 4 1.3462 586 | 4/13
24 h-m-p 1.6000 8.0000 0.0301 CCC 171.490050 2 1.9552 615 | 4/13
25 h-m-p 0.8056 8.0000 0.0731 +YCCC 171.401889 3 2.3646 646 | 4/13
26 h-m-p 1.6000 8.0000 0.0816 YCCC 171.319282 3 3.5126 676 | 4/13
27 h-m-p 1.6000 8.0000 0.0405 CCCC 171.266516 3 2.5768 707 | 4/13
28 h-m-p 1.6000 8.0000 0.0401 YCCC 171.173807 3 2.7804 737 | 4/13
29 h-m-p 1.6000 8.0000 0.0470 +YCCC 171.027174 3 4.4502 768 | 4/13
30 h-m-p 1.1680 8.0000 0.1792 +YCCCC 170.702564 4 3.4519 801 | 4/13
31 h-m-p 1.6000 8.0000 0.0142 +YCCC 170.092513 3 4.6262 832 | 4/13
32 h-m-p 0.3048 7.0728 0.2151 +CCCCC 169.714292 4 1.7903 866 | 4/13
33 h-m-p 0.8455 5.6081 0.4554 CYCC 169.481791 3 0.9254 896 | 4/13
34 h-m-p 1.6000 8.0000 0.0617 +YCCC 168.985179 3 4.4788 927 | 4/13
35 h-m-p 1.6000 8.0000 0.0914 CYCC 168.729133 3 2.1829 957 | 4/13
36 h-m-p 1.6000 8.0000 0.0268 YCCC 168.564858 3 3.1764 987 | 4/13
37 h-m-p 1.6000 8.0000 0.0129 CCC 168.527018 2 1.5477 1016 | 4/13
38 h-m-p 1.6000 8.0000 0.0041 CCC 168.518533 2 1.7975 1045 | 4/13
39 h-m-p 1.6000 8.0000 0.0036 YC 168.517778 1 1.2587 1071 | 4/13
40 h-m-p 1.6000 8.0000 0.0005 C 168.517753 0 1.3484 1096 | 4/13
41 h-m-p 1.6000 8.0000 0.0001 C 168.517752 0 1.4830 1121 | 4/13
42 h-m-p 0.8850 8.0000 0.0001 C 168.517752 0 1.1539 1146 | 4/13
43 h-m-p 1.6000 8.0000 0.0000 Y 168.517752 0 1.0464 1171 | 4/13
44 h-m-p 1.6000 8.0000 0.0000 Y 168.517752 0 0.4000 1196 | 4/13
45 h-m-p 1.0375 8.0000 0.0000 ----------------.. | 4/13
46 h-m-p 0.0160 8.0000 0.0001 ------------- | 4/13
47 h-m-p 0.0160 8.0000 0.0001 -------------
Out..
lnL = -168.517752
1308 lfun, 1308 eigenQcodon, 14388 P(t)
Time used: 0:03
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
0.002607 0.045743 0.000000 0.079172 0.009394 0.008062 0.127411 0.045482 0.073000 0.162482 0.041452 1.404962 0.534390 0.193110
ntime & nrate & np: 11 2 14
Bounds (np=14):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 5.356383
np = 14
lnL0 = -183.415012
Iterating by ming2
Initial: fx= 183.415012
x= 0.00261 0.04574 0.00000 0.07917 0.00939 0.00806 0.12741 0.04548 0.07300 0.16248 0.04145 1.40496 0.53439 0.19311
1 h-m-p 0.0000 0.0000 47.9682 ++ 183.414857 m 0.0000 33 | 1/14
2 h-m-p 0.0000 0.0000 44333.8963 ++ 183.176003 m 0.0000 64 | 2/14
3 h-m-p 0.0000 0.0000 2281.5508 ++ 182.762329 m 0.0000 94 | 3/14
4 h-m-p 0.0000 0.0000 1206.4769 ++ 182.699668 m 0.0000 123 | 4/14
5 h-m-p 0.0000 0.0013 254.2350 ++++ 171.438578 m 0.0013 153 | 5/14
6 h-m-p 0.0011 0.0056 59.0852 CYCCCC 170.425533 5 0.0021 189 | 5/14
7 h-m-p 0.0047 0.0237 5.5660 CYCCC 170.221747 4 0.0102 222 | 5/14
8 h-m-p 0.0064 0.0321 5.9084 CYCCC 170.090220 4 0.0103 255 | 5/14
9 h-m-p 0.0140 0.0792 4.3354 YYC 170.033546 2 0.0111 283 | 5/14
10 h-m-p 0.0176 0.3409 2.7444 YCCC 169.989564 3 0.0299 314 | 5/14
11 h-m-p 0.0888 5.9878 0.9242 --------------.. | 5/14
12 h-m-p 0.0000 0.0106 19.0473 ++++YYCYCCCC 168.456454 7 0.0069 394 | 5/14
13 h-m-p 0.0008 0.0039 31.4326 +YCYCCC 167.833187 5 0.0022 429 | 5/14
14 h-m-p 0.0027 0.0135 14.5212 CYCCC 167.488063 4 0.0049 462 | 5/14
15 h-m-p 0.0018 0.0089 14.1659 YCCCCC 167.389673 5 0.0020 497 | 5/14
16 h-m-p 0.0107 0.0534 2.3387 CCC 167.381730 2 0.0030 527 | 5/14
17 h-m-p 0.0086 0.1947 0.8085 YCCC 167.371163 3 0.0173 558 | 5/14
18 h-m-p 0.0048 0.0933 2.9290 CC 167.360109 1 0.0048 586 | 5/14
19 h-m-p 0.0071 1.3694 1.9570 YCCC 167.329867 3 0.0165 617 | 5/14
20 h-m-p 0.0365 0.6628 0.8848 +YYYYC 167.196496 4 0.1431 648 | 5/14
21 h-m-p 1.2917 8.0000 0.0980 YC 167.189809 1 0.6875 675 | 5/14
22 h-m-p 1.6000 8.0000 0.0046 YC 167.189420 1 0.9305 702 | 5/14
23 h-m-p 0.7488 8.0000 0.0057 C 167.189372 0 0.7859 728 | 5/14
24 h-m-p 1.6000 8.0000 0.0002 Y 167.189371 0 0.6937 754 | 5/14
25 h-m-p 1.1214 8.0000 0.0001 Y 167.189371 0 0.8682 780 | 5/14
26 h-m-p 1.6000 8.0000 0.0000 Y 167.189371 0 0.8644 806 | 5/14
27 h-m-p 1.6000 8.0000 0.0000 Y 167.189371 0 0.8105 832 | 5/14
28 h-m-p 1.6000 8.0000 0.0000 ---C 167.189371 0 0.0063 861
Out..
lnL = -167.189371
862 lfun, 2586 eigenQcodon, 18964 P(t)
Time used: 0:07
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
initial w for M2:NSpselection reset.
0.000657 0.065966 0.016268 0.077973 0.030117 0.000000 0.109380 0.034193 0.082239 0.123415 0.047285 1.422417 1.131355 0.291249 0.418683 2.981222
ntime & nrate & np: 11 3 16
Bounds (np=16):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 3.315059
np = 16
lnL0 = -189.795347
Iterating by ming2
Initial: fx= 189.795347
x= 0.00066 0.06597 0.01627 0.07797 0.03012 0.00000 0.10938 0.03419 0.08224 0.12341 0.04729 1.42242 1.13136 0.29125 0.41868 2.98122
1 h-m-p 0.0000 0.0000 46.8357 ++ 189.795176 m 0.0000 37 | 1/16
2 h-m-p 0.0000 0.0000 173.4163 ++ 189.747416 m 0.0000 72 | 2/16
3 h-m-p 0.0000 0.0000 581.1946 ++ 189.000540 m 0.0000 106 | 3/16
4 h-m-p 0.0000 0.0000 1245.5078 ++ 188.580423 m 0.0000 139 | 4/16
5 h-m-p 0.0004 0.0174 18.0273 ++CYYYCYCYCC 186.696459 9 0.0135 187 | 4/16
6 h-m-p 0.0001 0.0007 463.4749 ++ 181.413212 m 0.0007 218 | 5/16
7 h-m-p 0.0087 0.0434 4.6020 +YYCCCC 180.523466 5 0.0264 258 | 5/16
8 h-m-p 0.0034 0.0172 11.4548 YCYCCC 180.263446 5 0.0075 296 | 5/16
9 h-m-p 0.0108 0.0539 4.3714 CCCCC 180.173198 4 0.0127 334 | 5/16
10 h-m-p 0.0125 0.7967 4.4591 ++YYC 179.694140 2 0.1670 368 | 5/16
11 h-m-p 0.0255 0.1274 2.1737 --YC 179.694099 1 0.0007 401 | 5/16
12 h-m-p 0.0139 6.9301 0.1573 -------------.. | 5/16
13 h-m-p 0.0019 0.9686 62.1127 +CYYCC 176.725064 4 0.0051 480 | 5/16
14 h-m-p 0.0200 0.1034 15.7889 +YCCCC 172.218374 4 0.0495 518 | 5/16
15 h-m-p 0.0203 0.1017 9.2077 YCCC 171.322407 3 0.0346 553 | 5/16
16 h-m-p 0.0070 0.0349 14.0495 +YCYCCC 170.327866 5 0.0199 592 | 5/16
17 h-m-p 0.0111 0.0556 9.9438 CYCCCC 169.784943 5 0.0226 631 | 5/16
18 h-m-p 0.0122 0.0612 11.5150 CCCCC 169.378784 4 0.0191 669 | 5/16
19 h-m-p 0.0147 0.0733 11.6425 YCCCC 168.900907 4 0.0269 706 | 5/16
20 h-m-p 0.4453 2.2265 0.4972 CCC 168.759211 2 0.4691 740 | 5/16
21 h-m-p 0.0176 0.1256 13.2878 +YYCCC 168.153254 4 0.0559 777 | 5/16
22 h-m-p 0.1155 0.5773 2.9741 CCCC 167.892119 3 0.1219 813 | 5/16
23 h-m-p 0.2961 1.4804 0.6841 YCYCCC 167.374334 5 0.6855 851 | 5/16
24 h-m-p 0.4152 2.0762 0.4824 CCCCC 167.202946 4 0.5005 889 | 5/16
25 h-m-p 0.4494 2.2469 0.3254 YYYC 167.145480 3 0.4187 922 | 5/16
26 h-m-p 0.4618 6.5352 0.2951 YC 167.065784 1 1.1488 953 | 5/16
27 h-m-p 1.1870 5.9352 0.2494 YCC 167.033081 2 0.5475 986 | 5/16
28 h-m-p 0.7347 8.0000 0.1858 YCCC 167.007674 3 1.5814 1021 | 5/16
29 h-m-p 0.7823 4.9267 0.3756 CCC 166.987857 2 0.8086 1055 | 5/16
30 h-m-p 0.8577 4.6148 0.3541 CYY 166.971403 2 0.8335 1088 | 5/16
31 h-m-p 1.6000 8.0000 0.1114 CC 166.961884 1 1.6141 1120 | 5/16
32 h-m-p 1.6000 8.0000 0.0738 CC 166.959046 1 1.4381 1152 | 5/16
33 h-m-p 1.6000 8.0000 0.0637 +YC 166.953247 1 4.7570 1184 | 5/16
34 h-m-p 1.1753 8.0000 0.2580 +YC 166.935135 1 3.5755 1216 | 5/16
35 h-m-p 1.6000 8.0000 0.3438 CYC 166.924449 2 1.7266 1249 | 5/16
36 h-m-p 1.1818 8.0000 0.5023 CC 166.920012 1 1.5389 1281 | 5/16
37 h-m-p 1.6000 8.0000 0.3332 CYC 166.917578 2 1.7011 1314 | 5/16
38 h-m-p 1.2462 8.0000 0.4548 CCC 166.916251 2 1.7148 1348 | 5/16
39 h-m-p 1.6000 8.0000 0.4521 CC 166.915641 1 1.3006 1380 | 5/16
40 h-m-p 1.4154 8.0000 0.4154 YC 166.915252 1 2.1831 1411 | 5/16
41 h-m-p 1.6000 8.0000 0.3842 CC 166.915090 1 2.0492 1443 | 5/16
42 h-m-p 1.6000 8.0000 0.3889 CC 166.915022 1 2.1837 1475 | 5/16
43 h-m-p 1.6000 8.0000 0.4056 C 166.914990 0 2.1672 1505 | 5/16
44 h-m-p 1.6000 8.0000 0.3488 C 166.914977 0 2.1816 1535 | 5/16
45 h-m-p 1.6000 8.0000 0.3649 C 166.914972 0 2.3480 1565 | 5/16
46 h-m-p 1.6000 8.0000 0.3824 C 166.914969 0 1.8895 1595 | 5/16
47 h-m-p 1.6000 8.0000 0.3713 C 166.914968 0 2.3023 1625 | 5/16
48 h-m-p 1.6000 8.0000 0.3595 C 166.914967 0 2.3318 1655 | 5/16
49 h-m-p 1.6000 8.0000 0.3516 Y 166.914967 0 2.6486 1685 | 5/16
50 h-m-p 1.6000 8.0000 0.3488 C 166.914967 0 2.4144 1715 | 5/16
51 h-m-p 1.6000 8.0000 0.3491 Y 166.914967 0 2.7232 1745 | 5/16
52 h-m-p 1.6000 8.0000 0.3477 C 166.914967 0 2.3886 1775 | 5/16
53 h-m-p 1.6000 8.0000 0.3455 Y 166.914967 0 2.7573 1805 | 5/16
54 h-m-p 1.6000 8.0000 0.3500 C 166.914967 0 2.3863 1835 | 5/16
55 h-m-p 1.6000 8.0000 0.3517 Y 166.914967 0 2.8010 1865 | 5/16
56 h-m-p 1.6000 8.0000 0.3219 C 166.914967 0 2.2053 1895 | 5/16
57 h-m-p 1.6000 8.0000 0.3143 Y 166.914967 0 3.0455 1925 | 5/16
58 h-m-p 1.6000 8.0000 0.0487 Y 166.914967 0 0.9680 1955 | 5/16
59 h-m-p 0.1282 8.0000 0.3677 Y 166.914967 0 0.0320 1985 | 5/16
60 h-m-p 0.3303 8.0000 0.0357 C 166.914967 0 0.3303 2015 | 5/16
61 h-m-p 0.2916 8.0000 0.0404 --------------Y 166.914967 0 0.0000 2059 | 5/16
62 h-m-p 0.0160 8.0000 0.0000 ------------Y 166.914967 0 0.0000 2101 | 5/16
63 h-m-p 0.0160 8.0000 0.0000 -------------.. | 5/16
64 h-m-p 0.0160 8.0000 0.0000 -------------
Out..
lnL = -166.914967
2184 lfun, 8736 eigenQcodon, 72072 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal probability of data.
log(fX) = -177.369831 S = -166.491393 -4.174575
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 22 patterns 0:22
did 20 / 22 patterns 0:22
did 22 / 22 patterns 0:22
Time used: 0:22
Model 3: discrete
TREE # 1
(1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
0.000000 0.037384 0.011809 0.069824 0.015783 0.009238 0.128560 0.045403 0.073740 0.145468 0.039052 1.533443 0.960589 0.897086 0.006113 0.015726 0.021416
ntime & nrate & np: 11 4 17
Bounds (np=17):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 0.000001 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 999.000000 999.000000 999.000000
Qfactor_NS = 18.605334
np = 17
lnL0 = -170.134854
Iterating by ming2
Initial: fx= 170.134854
x= 0.00000 0.03738 0.01181 0.06982 0.01578 0.00924 0.12856 0.04540 0.07374 0.14547 0.03905 1.53344 0.96059 0.89709 0.00611 0.01573 0.02142
1 h-m-p 0.0000 0.0000 53.7767 ++ 170.134689 m 0.0000 39 | 1/17
2 h-m-p 0.0000 0.0000 36791.9984 ++ 169.298310 m 0.0000 76 | 2/17
3 h-m-p 0.0000 0.0001 114.8124 ++ 169.038751 m 0.0001 112 | 3/17
4 h-m-p 0.0000 0.0000 78.9447 ++ 168.957464 m 0.0000 147 | 4/17
5 h-m-p 0.0002 0.0125 4.2349 ++YYCC 168.904746 3 0.0035 187 | 4/17
6 h-m-p 0.0006 0.0029 4.4426 ++ 168.849667 m 0.0029 220 | 5/17
7 h-m-p 0.0053 0.0265 2.2299 CCC 168.826925 2 0.0051 257 | 5/17
8 h-m-p 0.0058 0.0290 1.2983 CCC 168.819895 2 0.0065 293 | 5/17
9 h-m-p 0.0016 0.0078 5.0503 ++ 168.732632 m 0.0078 325 | 6/17
10 h-m-p 0.0036 0.0380 10.1016 YCCC 168.717545 3 0.0015 362 | 6/17
11 h-m-p 0.0237 0.1707 0.6353 YCC 168.709886 2 0.0117 396 | 6/17
12 h-m-p 0.0065 1.0537 1.1331 ++CYC 168.531616 2 0.1217 432 | 6/17
13 h-m-p 0.0074 0.0368 12.4683 YCCC 168.445044 3 0.0052 468 | 6/17
14 h-m-p 0.4840 5.8103 0.1347 --------------Y 168.445044 0 0.0000 513 | 6/17
15 h-m-p 0.0023 1.1322 0.5528 +++CCC 168.377138 2 0.1498 551 | 6/17
16 h-m-p 1.0054 8.0000 0.0824 YC 168.304559 1 2.3674 583 | 6/17
17 h-m-p 1.0223 8.0000 0.1908 +CCCC 168.178670 3 4.8216 621 | 6/17
18 h-m-p 1.0229 8.0000 0.8992 CYC 168.072283 2 0.9842 655 | 6/17
19 h-m-p 1.4344 7.1719 0.0825 CCCCC 167.895747 4 1.6049 694 | 6/17
20 h-m-p 0.8739 8.0000 0.1515 +YCC 167.777650 2 2.4369 729 | 6/17
21 h-m-p 1.6000 8.0000 0.0699 YC 167.657752 1 3.4538 761 | 6/17
22 h-m-p 1.3989 8.0000 0.1726 CC 167.562603 1 1.7478 794 | 6/17
23 h-m-p 0.7372 8.0000 0.4092 CYC 167.536755 2 0.6902 828 | 6/17
24 h-m-p 1.6000 8.0000 0.0454 YC 167.532121 1 1.2053 860 | 6/17
25 h-m-p 1.5065 8.0000 0.0363 ++ 167.526327 m 8.0000 891 | 6/17
26 h-m-p 0.3041 8.0000 0.9559 CYCCC 167.520232 4 0.4981 929 | 6/17
27 h-m-p 1.3418 8.0000 0.3548 CCCC 167.512273 3 1.9971 966 | 6/17
28 h-m-p 1.6000 8.0000 0.3006 YC 167.506249 1 0.6838 998 | 6/17
29 h-m-p 0.4302 8.0000 0.4778 +CCCC 167.497854 3 2.6034 1036 | 6/17
30 h-m-p 1.6000 8.0000 0.6968 ++ 167.461344 m 8.0000 1067 | 6/17
31 h-m-p 0.9095 8.0000 6.1289 ++ 167.337910 m 8.0000 1098 | 6/17
32 h-m-p 0.5951 2.9757 14.7492 YCCC 167.112950 3 1.5329 1134 | 6/17
33 h-m-p 0.1497 0.7483 28.4310 ++ 167.034954 m 0.7483 1165 | 6/17
34 h-m-p -0.0000 -0.0000 58.2395
h-m-p: -0.00000000e+00 -0.00000000e+00 5.82394660e+01 167.034954
.. | 6/17
35 h-m-p 0.0001 0.0341 2.2416 ++YC 167.029006 1 0.0023 1227 | 6/17
36 h-m-p 0.0060 0.1720 0.8628 YC 167.028055 1 0.0029 1259 | 6/17
37 h-m-p 0.0036 0.3843 0.6913 +YC 167.026617 1 0.0092 1292 | 6/17
38 h-m-p 0.0047 0.7261 1.3489 +CYC 167.021562 2 0.0199 1327 | 6/17
39 h-m-p 0.0097 0.1203 2.7505 YCC 167.017883 2 0.0074 1361 | 6/17
40 h-m-p 0.0055 0.2430 3.7274 YC 167.010924 1 0.0109 1393 | 6/17
41 h-m-p 0.0100 1.0340 4.0788 +CCC 166.987221 2 0.0370 1429 | 6/17
42 h-m-p 0.0113 0.2228 13.3455 CCC 166.953772 2 0.0159 1464 | 6/17
43 h-m-p 0.7780 8.0000 0.2731 YCCC 166.917715 3 1.5921 1500 | 6/17
44 h-m-p 1.6000 8.0000 0.0613 YCC 166.915070 2 0.9993 1534 | 6/17
45 h-m-p 1.6000 8.0000 0.0212 YC 166.914969 1 1.2002 1566 | 6/17
46 h-m-p 1.6000 8.0000 0.0021 Y 166.914967 0 1.1132 1597 | 6/17
47 h-m-p 1.6000 8.0000 0.0000 Y 166.914967 0 1.1246 1628 | 6/17
48 h-m-p 1.6000 8.0000 0.0000 Y 166.914967 0 1.2531 1659 | 6/17
49 h-m-p 1.6000 8.0000 0.0000 Y 166.914967 0 1.6000 1690 | 6/17
50 h-m-p 1.6000 8.0000 0.0000 C 166.914967 0 1.6000 1721
Out..
lnL = -166.914967
1722 lfun, 6888 eigenQcodon, 56826 P(t)
Time used: 0:33
Model 7: beta
TREE # 1
(1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
0.010849 0.049344 0.002584 0.056751 0.000000 0.026655 0.108106 0.063461 0.083888 0.119847 0.030380 1.533443 0.496071 1.323761
ntime & nrate & np: 11 1 14
Bounds (np=14):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 8.394770
np = 14
lnL0 = -178.244405
Iterating by ming2
Initial: fx= 178.244405
x= 0.01085 0.04934 0.00258 0.05675 0.00000 0.02665 0.10811 0.06346 0.08389 0.11985 0.03038 1.53344 0.49607 1.32376
1 h-m-p 0.0000 0.0000 52.2485 ++ 178.244224 m 0.0000 33 | 1/14
2 h-m-p 0.0000 0.0000 252.7035 ++ 178.021907 m 0.0000 64 | 2/14
3 h-m-p 0.0000 0.0000 1317.1458 ++ 177.532882 m 0.0000 94 | 3/14
4 h-m-p 0.0000 0.0000 1328.1092 ++ 176.964939 m 0.0000 123 | 4/14
5 h-m-p 0.0003 0.0138 37.6014 ++YCYYYYCCCC 170.057902 10 0.0123 168 | 4/14
6 h-m-p 0.0005 0.0023 25.3140 CYCCCC 169.899714 5 0.0008 204 | 4/14
7 h-m-p 0.0049 0.0684 4.0482 +YYCCCCC 169.551894 6 0.0234 242 | 4/14
8 h-m-p 0.0026 0.0129 13.1608 YCYCCC 169.284429 5 0.0060 277 | 4/14
9 h-m-p 0.0029 0.0144 14.8012 YCYCCC 168.966103 5 0.0069 312 | 4/14
10 h-m-p 0.0043 0.0215 9.3224 CCCCC 168.837176 4 0.0054 347 | 4/14
11 h-m-p 0.0070 0.0349 4.5146 YCCC 168.803925 3 0.0044 379 | 4/14
12 h-m-p 0.0783 6.5424 0.2508 ++YCCC 168.451134 3 0.7868 413 | 4/14
13 h-m-p 1.0684 5.3422 0.0656 CCCCC 168.270254 4 1.6960 448 | 4/14
14 h-m-p 0.9739 8.0000 0.1142 CYC 168.216381 2 1.0589 478 | 4/14
15 h-m-p 1.6000 8.0000 0.0590 CCC 168.192802 2 1.9566 509 | 4/14
16 h-m-p 1.6000 8.0000 0.0622 CCC 168.185503 2 2.1048 540 | 4/14
17 h-m-p 1.3898 8.0000 0.0942 ++ 168.150704 m 8.0000 567 | 4/14
18 h-m-p 0.0780 0.3899 2.0445 YYCYCYCCC 168.130454 8 0.1387 606 | 4/14
19 h-m-p 0.0683 0.3413 1.5061 YYYC 168.123011 3 0.0591 636 | 4/14
20 h-m-p 0.3759 1.8797 0.2259 YCCC 168.043743 3 0.7964 668 | 4/14
21 h-m-p 0.3211 1.6057 0.0718 CCCCC 167.962028 4 0.4226 703 | 4/14
22 h-m-p 0.2059 1.9459 0.1474 +YYYYYYCYYC 167.852951 10 1.3134 744 | 4/14
23 h-m-p 1.6000 8.0000 0.0343 YYYYC 167.809807 4 1.5361 775 | 4/14
24 h-m-p 0.2008 1.0041 0.0706 ++ 167.785962 m 1.0041 802 | 5/14
25 h-m-p 1.6000 8.0000 0.0099 YYYYYCCYCY 167.776281 10 2.1335 841 | 5/14
26 h-m-p 0.2069 5.8030 0.1016 YYC 167.773113 2 0.1506 869 | 5/14
27 h-m-p 0.7731 8.0000 0.0198 YC 167.769319 1 1.8834 896 | 5/14
28 h-m-p 1.6000 8.0000 0.0086 C 167.768948 0 1.6900 922 | 5/14
29 h-m-p 1.6000 8.0000 0.0019 C 167.768935 0 1.3684 948 | 5/14
30 h-m-p 1.6000 8.0000 0.0000 Y 167.768935 0 1.0938 974 | 5/14
31 h-m-p 1.5723 8.0000 0.0000 ++ 167.768935 m 8.0000 1000 | 5/14
32 h-m-p 1.6000 8.0000 0.0001 Y 167.768935 0 3.3555 1026 | 5/14
33 h-m-p 1.6000 8.0000 0.0001 C 167.768935 0 2.0781 1052 | 5/14
34 h-m-p 1.6000 8.0000 0.0000 Y 167.768935 0 1.1098 1078 | 5/14
35 h-m-p 1.6000 8.0000 0.0000 C 167.768935 0 1.6000 1104 | 5/14
36 h-m-p 1.6000 8.0000 0.0000 C 167.768935 0 1.3104 1130 | 5/14
37 h-m-p 1.6000 8.0000 0.0000 -Y 167.768935 0 0.1000 1157
Out..
lnL = -167.768935
1158 lfun, 12738 eigenQcodon, 127380 P(t)
Time used: 0:59
Model 8: beta&w>1
TREE # 1
(1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
initial w for M8:NSbetaw>1 reset.
0.009747 0.056821 0.010511 0.088831 0.000000 0.005407 0.133388 0.042210 0.079586 0.152603 0.047821 1.463158 0.900000 0.225525 1.016293 2.374037
ntime & nrate & np: 11 2 16
Bounds (np=16):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 6.751329
np = 16
lnL0 = -177.073677
Iterating by ming2
Initial: fx= 177.073677
x= 0.00975 0.05682 0.01051 0.08883 0.00000 0.00541 0.13339 0.04221 0.07959 0.15260 0.04782 1.46316 0.90000 0.22553 1.01629 2.37404
1 h-m-p 0.0000 0.0000 57.3228 ++ 177.073380 m 0.0000 37 | 1/16
2 h-m-p 0.0000 0.0000 3350.1939 ++ 176.101754 m 0.0000 72 | 2/16
3 h-m-p 0.0000 0.0000 990.8006 ++ 175.460092 m 0.0000 106 | 3/16
4 h-m-p 0.0000 0.0000 105.4038 ++ 175.371726 m 0.0000 139 | 4/16
5 h-m-p 0.0000 0.0012 119.9465 ++++ 169.962720 m 0.0012 173 | 5/16
6 h-m-p 0.0004 0.0018 62.8222 +YYCYCCC 168.597246 6 0.0012 214 | 5/16
7 h-m-p 0.0051 0.0255 5.8718 CCCCC 168.449986 4 0.0070 252 | 4/16
8 h-m-p 0.0012 0.0307 34.0537 YCCCC 168.123078 4 0.0006 289 | 4/16
9 h-m-p 0.0037 0.0366 5.8461 CCC 168.093817 2 0.0030 324 | 4/16
10 h-m-p 0.0066 0.0724 2.6798 CCC 168.046433 2 0.0101 359 | 4/16
11 h-m-p 0.0099 0.0496 2.1324 YCCCC 168.007255 4 0.0102 397 | 4/16
12 h-m-p 0.0420 0.3274 0.5184 ++ 167.053332 m 0.3274 428
QuantileBeta(0.15, 0.00494, 1.00511) = 4.014602e-162 2000 rounds
| 5/16
13 h-m-p 0.0677 0.3387 0.9806 YCCC 167.035562 3 0.0304 464 | 5/16
14 h-m-p 0.0087 0.1374 3.4138 +YYC 166.981172 2 0.0284 497 | 5/16
15 h-m-p 0.8285 4.1423 0.0956 YYC 166.951143 2 0.6065 529 | 5/16
16 h-m-p 0.5056 8.0000 0.1146 YCCC 166.928331 3 0.9932 564 | 5/16
17 h-m-p 1.2939 8.0000 0.0880 CYC 166.916387 2 1.4394 597 | 5/16
18 h-m-p 1.6000 8.0000 0.0240 CC 166.915671 1 1.2944 629 | 5/16
19 h-m-p 1.6000 8.0000 0.0184 CC 166.915323 1 2.3705 661 | 5/16
20 h-m-p 1.6000 8.0000 0.0149 C 166.915183 0 1.6575 691 | 5/16
21 h-m-p 1.6000 8.0000 0.0014 Y 166.915179 0 1.0279 721 | 5/16
22 h-m-p 1.6000 8.0000 0.0000 C 166.915179 0 1.6562 751 | 5/16
23 h-m-p 0.6834 8.0000 0.0001 ++ 166.915179 m 8.0000 781 | 5/16
24 h-m-p 0.1611 8.0000 0.0038 ++C 166.915177 0 2.3169 813 | 5/16
25 h-m-p 1.6000 8.0000 0.0042 ++ 166.915159 m 8.0000 843 | 5/16
26 h-m-p 0.1275 8.0000 0.2645 ++
QuantileBeta(0.15, 0.00500, 3.03708) = 8.064046e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.17043) = 1.214655e-160 2000 rounds
YC 166.915006 1 4.4887 876 | 5/16
27 h-m-p 1.6000 8.0000 0.1106
QuantileBeta(0.15, 0.00500, 2.28544) = 1.138435e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.81631) = 8.821040e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24602) = 1.163470e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
C 166.914975 1 1.2420 907
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.204206e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24596) = 1.163506e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24572) = 1.163666e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.24584) = 1.163586e-160 2000 rounds
| 5/16
28 h-m-p 1.1412 8.0000 0.1204
QuantileBeta(0.15, 0.00500, 2.38323) = 1.080695e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.79540) = 8.900123e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
+ 166.914950 m 8.0000 937
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.822403e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20913) = 7.558133e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20883) = 7.558941e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.20898) = 7.558537e-161 2000 rounds
| 5/16
29 h-m-p 1.3706 8.0000 0.7027
QuantileBeta(0.15, 0.00500, 4.17212) = 5.591327e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.06153) = 3.136617e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 8.83056) = 2.471645e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
Y 166.914927 0 6.0603 968
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 3.057348e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46780) = 2.954118e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46733) = 2.954316e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.46757) = 2.954217e-161 2000 rounds
| 5/16
30 h-m-p 1.6000 8.0000 0.5671
QuantileBeta(0.15, 0.00500, 8.37486) = 2.614444e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 11.09672) = 1.943640e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
C 166.914920 0 1.4976 998
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.725782e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31703) = 2.633752e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31653) = 2.633919e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 8.31678) = 2.633836e-161 2000 rounds
| 5/16
31 h-m-p 1.2136 8.0000 0.6998
QuantileBeta(0.15, 0.00500, 9.16600) = 2.376110e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 11.71364) = 1.836806e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
+ 166.914915 m 8.0000 1028
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.589224e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91521) = 1.535577e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91453) = 1.535655e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 13.91487) = 1.535616e-161 2000 rounds
| 5/16
32 h-m-p 1.6000 8.0000 1.6292
QuantileBeta(0.15, 0.00500, 16.52154) = 1.285902e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 24.34156) = 8.642482e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
C 166.914912 0 1.9666 1058
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.282983e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11926) = 1.239676e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11848) = 1.239734e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 17.11887) = 1.239705e-161 2000 rounds
| 5/16
33 h-m-p 1.4380 8.0000 2.2281
QuantileBeta(0.15, 0.00500, 20.32286) = 1.039402e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 29.93485) = 7.000531e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 34.94392) = 4.819882e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
Y 166.914909 0 6.2500 1089
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.981737e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04518) = 6.746102e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04404) = 6.746354e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 31.04461) = 6.746228e-162 2000 rounds
| 5/16
34 h-m-p 1.6000 8.0000 4.0163
QuantileBeta(0.15, 0.00500, 37.47061) = 4.490518e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 56.74862) = 7.466919e-163 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
C 166.914907 0 2.0112 1119
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.445537e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12262) = 4.298468e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12129) = 4.298616e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 39.12195) = 4.298542e-162 2000 rounds
| 5/16
35 h-m-p 1.6000 8.0000 4.9065
QuantileBeta(0.15, 0.00500, 46.97232) = 3.572478e-162 2000 rounds
+C 166.914906 0 5.6509 1150 | 5/16
36 h-m-p 0.6826 3.4131 9.4202 +Y 166.914906 0 2.2275 1181 | 5/16
37 h-m-p 0.1964 0.9820 11.3734 ++ 166.914905 m 0.9820 1211 | 6/16
38 h-m-p 1.6000 8.0000 0.0000 Y 166.914905 0 0.9995 1241 | 6/16
39 h-m-p 1.6000 8.0000 0.0000 Y 166.914905 0 0.8149 1270
Out..
lnL = -166.914905
1271 lfun, 15252 eigenQcodon, 153791 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal probability of data.
log(fX) = -177.499323 S = -166.491415 -5.288835
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 22 patterns 1:38
did 20 / 22 patterns 1:39
did 22 / 22 patterns 1:39
Time used: 1:39
CodeML output code: -1
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=9, Len=28
D_melanogaster_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_sechellia_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_simulans_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_yakuba_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_erecta_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_takahashii_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_biarmipes_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
D_suzukii_SclA-PC MSEAQNLFTTFGILAILLFFLYLIYAVL
D_rhopaloa_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
****:***********************
>D_melanogaster_SclA-PC ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG >D_sechellia_SclA-PC ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATTCT GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG >D_simulans_SclA-PC ATGAGCGAAGCCCGCAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT GCTTTTCTTCCTCTACCTCATCTATGCCGTATTG >D_yakuba_SclA-PC ATGAGCGAAGCCCGTAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT GCTTTTCTTCCTTTACCTCATCTATGCCGTATTG >D_erecta_SclA-PC ATGAGCGAAGCCCGTAACTTGTTCACCACCTTTGGCATCCTGGCCATCCT GCTTTTCTTCCTTTACCTCATCTATGCCGTATTG >D_takahashii_SclA-PC ATGAGCGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTTGCCATCCT GCTTTTCTTCCTTTACCTCATCTATGCCGTCTTG >D_biarmipes_SclA-PC ATGAGTGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTGGCCATCCT GCTGTTCTTCCTTTACCTCATCTATGCCGTCTTG >D_suzukii_SclA-PC ATGAGTGAAGCCCAGAACCTTTTCACCACCTTCGGCATCCTGGCCATCCT TCTTTTCTTCCTTTACCTCATCTATGCCGTCTTG >D_rhopaloa_SclA-PC ATGAGCGAAGCCCGTAACCTGTTCACCACCTTCGGCATCCTGGCCATCCT GCTTTTCTTCCTTTACCTCATCTACGCCGTCTTG
>D_melanogaster_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_sechellia_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_simulans_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_yakuba_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_erecta_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_takahashii_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_biarmipes_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL >D_suzukii_SclA-PC MSEAQNLFTTFGILAILLFFLYLIYAVL >D_rhopaloa_SclA-PC MSEARNLFTTFGILAILLFFLYLIYAVL
#NEXUS
[ID: 0467114160]
begin taxa;
dimensions ntax=9;
taxlabels
D_melanogaster_SclA-PC
D_sechellia_SclA-PC
D_simulans_SclA-PC
D_yakuba_SclA-PC
D_erecta_SclA-PC
D_takahashii_SclA-PC
D_biarmipes_SclA-PC
D_suzukii_SclA-PC
D_rhopaloa_SclA-PC
;
end;
begin trees;
translate
1 D_melanogaster_SclA-PC,
2 D_sechellia_SclA-PC,
3 D_simulans_SclA-PC,
4 D_yakuba_SclA-PC,
5 D_erecta_SclA-PC,
6 D_takahashii_SclA-PC,
7 D_biarmipes_SclA-PC,
8 D_suzukii_SclA-PC,
9 D_rhopaloa_SclA-PC
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:0.01684621,2:0.03954263,3:0.01710396,(4:0.01697338,5:0.01706304,(6:0.04393694,7:0.05211968,8:0.1555978,9:0.04184494)0.985:0.1017415)0.925:0.06370289);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:0.01684621,2:0.03954263,3:0.01710396,(4:0.01697338,5:0.01706304,(6:0.04393694,7:0.05211968,8:0.1555978,9:0.04184494):0.1017415):0.06370289);
end;
Estimated marginal likelihoods for runs sampled in files
"/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -194.82 -210.04
2 -194.69 -208.89
--------------------------------------
TOTAL -194.75 -209.62
--------------------------------------
Model parameter summaries over the runs sampled in files
"/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/opt/ADOPS/383/SclA-PC/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 0.841705 0.069177 0.406774 1.365913 0.804071 1216.94 1331.18 1.000
r(A<->C){all} 0.125521 0.010805 0.000214 0.334950 0.097044 252.59 272.03 1.000
r(A<->G){all} 0.139760 0.011900 0.000027 0.349758 0.115069 200.89 263.41 1.002
r(A<->T){all} 0.098068 0.009715 0.000015 0.304714 0.065422 365.84 377.81 1.003
r(C<->G){all} 0.039385 0.001474 0.000007 0.119636 0.027758 505.39 554.30 1.000
r(C<->T){all} 0.309678 0.018920 0.063552 0.567203 0.294527 286.14 312.87 1.000
r(G<->T){all} 0.287587 0.018006 0.051869 0.537914 0.270750 243.96 263.63 1.000
pi(A){all} 0.151568 0.001302 0.078346 0.218883 0.149867 1062.38 1132.72 1.000
pi(C){all} 0.350473 0.002326 0.263175 0.452109 0.349721 1098.93 1145.53 1.000
pi(G){all} 0.170989 0.001494 0.095073 0.243612 0.168585 1104.58 1302.79 1.000
pi(T){all} 0.326971 0.002283 0.239114 0.421947 0.325968 1210.90 1235.98 1.000
alpha{1,2} 0.095950 0.005711 0.000153 0.218025 0.085720 1217.03 1234.57 1.001
alpha{3} 1.186738 0.380873 0.249396 2.435140 1.056066 1377.27 1439.14 1.000
pinvar{all} 0.348527 0.027962 0.018671 0.629413 0.354800 814.08 961.68 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
CODONML (in paml version 4.8, March 2014) /opt/ADOPS/383/SclA-PC/batch/allfiles/codeml/input.fasta.fasta.pnxs
Model: One dN/dS ratio for branches,
Codon frequency model: F3x4
Site-class models:
ns = 9 ls = 28
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 0 | Ser TCT 0 0 0 0 0 0 | Tyr TAT 1 1 1 1 1 1 | Cys TGT 0 0 0 0 0 0
TTC 3 3 3 3 3 4 | TCC 0 0 0 0 0 0 | TAC 1 1 1 1 1 1 | TGC 0 0 0 0 0 0
Leu TTA 0 0 0 0 0 0 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 2 2 2 2 2 1 | TCG 0 0 0 0 0 0 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 1 1 1 2 2 3 | Pro CCT 0 0 0 0 0 0 | His CAT 0 0 0 0 0 0 | Arg CGT 0 0 0 1 1 1
CTC 2 2 2 1 1 1 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 1 1 1 0 0 0
CTA 0 0 0 0 0 0 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 2 2 2 2 2 2 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 1 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 0 0 0 0 0 0 | Ser AGT 0 0 0 0 0 0
ATC 3 2 3 3 3 3 | ACC 2 2 2 2 2 2 | AAC 1 1 1 1 1 1 | AGC 1 1 1 1 1 1
ATA 0 0 0 0 0 0 | ACA 0 0 0 0 0 0 | Lys AAA 0 0 0 0 0 0 | Arg AGA 0 0 0 0 0 0
Met ATG 1 1 1 1 1 1 | ACG 0 0 0 0 0 0 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 0 0 0 0 0 0 | Ala GCT 0 0 0 0 0 0 | Asp GAT 0 0 0 0 0 0 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 1 | GCC 3 3 3 3 3 3 | GAC 0 0 0 0 0 0 | GGC 1 1 1 1 1 1
GTA 1 1 1 1 1 0 | GCA 0 0 0 0 0 0 | Glu GAA 1 1 1 1 1 1 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 0 | GAG 0 0 0 0 0 0 | GGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------
Phe TTT 0 0 0 | Ser TCT 0 0 0 | Tyr TAT 1 1 0 | Cys TGT 0 0 0
TTC 4 4 4 | TCC 0 0 0 | TAC 1 1 2 | TGC 0 0 0
Leu TTA 0 0 0 | TCA 0 0 0 | *** TAA 0 0 0 | *** TGA 0 0 0
TTG 1 1 1 | TCG 0 0 0 | TAG 0 0 0 | Trp TGG 0 0 0
--------------------------------------------------------------------------------------
Leu CTT 1 4 2 | Pro CCT 0 0 0 | His CAT 0 0 0 | Arg CGT 1 0 1
CTC 1 1 1 | CCC 0 0 0 | CAC 0 0 0 | CGC 0 0 0
CTA 0 0 0 | CCA 0 0 0 | Gln CAA 0 0 0 | CGA 0 0 0
CTG 4 1 3 | CCG 0 0 0 | CAG 0 1 0 | CGG 0 0 0
--------------------------------------------------------------------------------------
Ile ATT 0 0 0 | Thr ACT 0 0 0 | Asn AAT 0 0 0 | Ser AGT 1 1 0
ATC 3 3 3 | ACC 2 2 2 | AAC 1 1 1 | AGC 0 0 1
ATA 0 0 0 | ACA 0 0 0 | Lys AAA 0 0 0 | Arg AGA 0 0 0
Met ATG 1 1 1 | ACG 0 0 0 | AAG 0 0 0 | AGG 0 0 0
--------------------------------------------------------------------------------------
Val GTT 0 0 0 | Ala GCT 0 0 0 | Asp GAT 0 0 0 | Gly GGT 0 0 0
GTC 1 1 1 | GCC 3 3 3 | GAC 0 0 0 | GGC 1 1 1
GTA 0 0 0 | GCA 0 0 0 | Glu GAA 1 1 1 | GGA 0 0 0
GTG 0 0 0 | GCG 0 0 0 | GAG 0 0 0 | GGG 0 0 0
--------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: D_melanogaster_SclA-PC
position 1: T:0.28571 C:0.21429 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.10714 C:0.64286 A:0.07143 G:0.17857
Average T:0.32143 C:0.34524 A:0.16667 G:0.16667
#2: D_sechellia_SclA-PC
position 1: T:0.28571 C:0.21429 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.14286 C:0.60714 A:0.07143 G:0.17857
Average T:0.33333 C:0.33333 A:0.16667 G:0.16667
#3: D_simulans_SclA-PC
position 1: T:0.28571 C:0.21429 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.10714 C:0.64286 A:0.07143 G:0.17857
Average T:0.32143 C:0.34524 A:0.16667 G:0.16667
#4: D_yakuba_SclA-PC
position 1: T:0.28571 C:0.21429 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.17857 C:0.57143 A:0.07143 G:0.17857
Average T:0.34524 C:0.32143 A:0.16667 G:0.16667
#5: D_erecta_SclA-PC
position 1: T:0.28571 C:0.21429 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.17857 C:0.57143 A:0.07143 G:0.17857
Average T:0.34524 C:0.32143 A:0.16667 G:0.16667
#6: D_takahashii_SclA-PC
position 1: T:0.25000 C:0.25000 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.17857 C:0.64286 A:0.03571 G:0.14286
Average T:0.33333 C:0.35714 A:0.15476 G:0.15476
#7: D_biarmipes_SclA-PC
position 1: T:0.25000 C:0.25000 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.14286 C:0.60714 A:0.03571 G:0.21429
Average T:0.32143 C:0.34524 A:0.15476 G:0.17857
#8: D_suzukii_SclA-PC
position 1: T:0.25000 C:0.25000 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.17857 G:0.07143
position 3: T:0.21429 C:0.60714 A:0.03571 G:0.14286
Average T:0.34524 C:0.34524 A:0.16667 G:0.14286
#9: D_rhopaloa_SclA-PC
position 1: T:0.25000 C:0.25000 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14286 G:0.10714
position 3: T:0.10714 C:0.67857 A:0.03571 G:0.17857
Average T:0.30952 C:0.36905 A:0.15476 G:0.16667
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 5 | Ser S TCT 0 | Tyr Y TAT 8 | Cys C TGT 0
TTC 31 | TCC 0 | TAC 10 | TGC 0
Leu L TTA 0 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 14 | TCG 0 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 17 | Pro P CCT 0 | His H CAT 0 | Arg R CGT 5
CTC 12 | CCC 0 | CAC 0 | CGC 3
CTA 0 | CCA 0 | Gln Q CAA 0 | CGA 0
CTG 20 | CCG 0 | CAG 1 | CGG 0
------------------------------------------------------------------------------
Ile I ATT 1 | Thr T ACT 0 | Asn N AAT 0 | Ser S AGT 2
ATC 26 | ACC 18 | AAC 9 | AGC 7
ATA 0 | ACA 0 | Lys K AAA 0 | Arg R AGA 0
Met M ATG 9 | ACG 0 | AAG 0 | AGG 0
------------------------------------------------------------------------------
Val V GTT 0 | Ala A GCT 0 | Asp D GAT 0 | Gly G GGT 0
GTC 4 | GCC 27 | GAC 0 | GGC 9
GTA 5 | GCA 0 | Glu E GAA 9 | GGA 0
GTG 0 | GCG 0 | GAG 0 | GGG 0
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.26984 C:0.23016 A:0.28571 G:0.21429
position 2: T:0.57143 C:0.17857 A:0.14683 G:0.10317
position 3: T:0.15079 C:0.61905 A:0.05556 G:0.17460
Average T:0.33069 C:0.34259 A:0.16270 G:0.16402
Nei & Gojobori 1986. dN/dS (dN, dS)
(Note: This matrix is not used in later ML. analysis.
Use runmode = -2 for ML pairwise comparison.)
D_melanogaster_SclA-PC
D_sechellia_SclA-PC -1.0000 (0.0000 0.0503)
D_simulans_SclA-PC -1.0000 (0.0000 0.0000)-1.0000 (0.0000 0.0503)
D_yakuba_SclA-PC -1.0000 (0.0000 0.1041)-1.0000 (0.0000 0.1622)-1.0000 (0.0000 0.1041)
D_erecta_SclA-PC -1.0000 (0.0000 0.1041)-1.0000 (0.0000 0.1622)-1.0000 (0.0000 0.1041)-1.0000 (0.0000 0.0000)
D_takahashii_SclA-PC -1.0000 (0.0000 0.3664)-1.0000 (0.0000 0.4496)-1.0000 (0.0000 0.3664)-1.0000 (0.0000 0.2234)-1.0000 (0.0000 0.2234)
D_biarmipes_SclA-PC -1.0000 (0.0000 0.4396)-1.0000 (0.0000 0.5303)-1.0000 (0.0000 0.4396)-1.0000 (0.0000 0.2857)-1.0000 (0.0000 0.2857)-1.0000 (0.0000 0.1571)
D_suzukii_SclA-PC 0.0960 (0.0403 0.4195) 0.0787 (0.0403 0.5114) 0.0960 (0.0403 0.4195) 0.1192 (0.0403 0.3377) 0.1192 (0.0403 0.3377) 0.0914 (0.0239 0.2619) 0.1257 (0.0241 0.1916)
D_rhopaloa_SclA-PC -1.0000 (0.0000 0.3625)-1.0000 (0.0000 0.4445)-1.0000 (0.0000 0.3625)-1.0000 (0.0000 0.2213)-1.0000 (0.0000 0.2213)-1.0000 (0.0000 0.1019)-1.0000 (0.0000 0.1557) 0.0926 (0.0240 0.2593)
Model 0: one-ratio
TREE # 1: (1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
check convergence..
lnL(ntime: 11 np: 13): -168.517752 +0.000000
10..1 10..2 10..3 10..11 11..4 11..5 11..12 12..6 12..7 12..8 12..9
0.000004 0.035831 0.000004 0.074895 0.000004 0.000004 0.117069 0.038891 0.078130 0.252983 0.037406 1.404962 0.012227
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.63522
(1: 0.000004, 2: 0.035831, 3: 0.000004, (4: 0.000004, 5: 0.000004, (6: 0.038891, 7: 0.078130, 8: 0.252983, 9: 0.037406): 0.117069): 0.074895);
(D_melanogaster_SclA-PC: 0.000004, D_sechellia_SclA-PC: 0.035831, D_simulans_SclA-PC: 0.000004, (D_yakuba_SclA-PC: 0.000004, D_erecta_SclA-PC: 0.000004, (D_takahashii_SclA-PC: 0.038891, D_biarmipes_SclA-PC: 0.078130, D_suzukii_SclA-PC: 0.252983, D_rhopaloa_SclA-PC: 0.037406): 0.117069): 0.074895);
Detailed output identifying parameters
kappa (ts/tv) = 1.40496
omega (dN/dS) = 0.01223
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
10..1 0.000 70.2 13.8 0.0122 0.0000 0.0000 0.0 0.0
10..2 0.036 70.2 13.8 0.0122 0.0008 0.0687 0.1 0.9
10..3 0.000 70.2 13.8 0.0122 0.0000 0.0000 0.0 0.0
10..11 0.075 70.2 13.8 0.0122 0.0018 0.1435 0.1 2.0
11..4 0.000 70.2 13.8 0.0122 0.0000 0.0000 0.0 0.0
11..5 0.000 70.2 13.8 0.0122 0.0000 0.0000 0.0 0.0
11..12 0.117 70.2 13.8 0.0122 0.0027 0.2244 0.2 3.1
12..6 0.039 70.2 13.8 0.0122 0.0009 0.0745 0.1 1.0
12..7 0.078 70.2 13.8 0.0122 0.0018 0.1497 0.1 2.1
12..8 0.253 70.2 13.8 0.0122 0.0059 0.4849 0.4 6.7
12..9 0.037 70.2 13.8 0.0122 0.0009 0.0717 0.1 1.0
tree length for dN: 0.0149
tree length for dS: 1.2174
Time used: 0:03
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
lnL(ntime: 11 np: 14): -167.189371 +0.000000
10..1 10..2 10..3 10..11 11..4 11..5 11..12 12..6 12..7 12..8 12..9
0.000004 0.037230 0.000004 0.081712 0.000004 0.000004 0.135242 0.044931 0.090479 0.300822 0.043180 1.422417 0.958907 0.000001
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.73361
(1: 0.000004, 2: 0.037230, 3: 0.000004, (4: 0.000004, 5: 0.000004, (6: 0.044931, 7: 0.090479, 8: 0.300822, 9: 0.043180): 0.135242): 0.081712);
(D_melanogaster_SclA-PC: 0.000004, D_sechellia_SclA-PC: 0.037230, D_simulans_SclA-PC: 0.000004, (D_yakuba_SclA-PC: 0.000004, D_erecta_SclA-PC: 0.000004, (D_takahashii_SclA-PC: 0.044931, D_biarmipes_SclA-PC: 0.090479, D_suzukii_SclA-PC: 0.300822, D_rhopaloa_SclA-PC: 0.043180): 0.135242): 0.081712);
Detailed output identifying parameters
kappa (ts/tv) = 1.42242
dN/dS (w) for site classes (K=2)
p: 0.95891 0.04109
w: 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
10..1 0.000 70.2 13.8 0.0411 0.0000 0.0000 0.0 0.0
10..2 0.037 70.2 13.8 0.0411 0.0026 0.0625 0.2 0.9
10..3 0.000 70.2 13.8 0.0411 0.0000 0.0000 0.0 0.0
10..11 0.082 70.2 13.8 0.0411 0.0056 0.1372 0.4 1.9
11..4 0.000 70.2 13.8 0.0411 0.0000 0.0000 0.0 0.0
11..5 0.000 70.2 13.8 0.0411 0.0000 0.0000 0.0 0.0
11..12 0.135 70.2 13.8 0.0411 0.0093 0.2272 0.7 3.1
12..6 0.045 70.2 13.8 0.0411 0.0031 0.0755 0.2 1.0
12..7 0.090 70.2 13.8 0.0411 0.0062 0.1520 0.4 2.1
12..8 0.301 70.2 13.8 0.0411 0.0208 0.5053 1.5 7.0
12..9 0.043 70.2 13.8 0.0411 0.0030 0.0725 0.2 1.0
Time used: 0:07
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
check convergence..
lnL(ntime: 11 np: 16): -166.914967 +0.000000
10..1 10..2 10..3 10..11 11..4 11..5 11..12 12..6 12..7 12..8 12..9
0.000004 0.038348 0.000004 0.088300 0.000004 0.000004 0.153530 0.051132 0.103069 0.329623 0.049248 1.533443 0.962625 0.000000 0.000001 2.275855
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.81327
(1: 0.000004, 2: 0.038348, 3: 0.000004, (4: 0.000004, 5: 0.000004, (6: 0.051132, 7: 0.103069, 8: 0.329623, 9: 0.049248): 0.153530): 0.088300);
(D_melanogaster_SclA-PC: 0.000004, D_sechellia_SclA-PC: 0.038348, D_simulans_SclA-PC: 0.000004, (D_yakuba_SclA-PC: 0.000004, D_erecta_SclA-PC: 0.000004, (D_takahashii_SclA-PC: 0.051132, D_biarmipes_SclA-PC: 0.103069, D_suzukii_SclA-PC: 0.329623, D_rhopaloa_SclA-PC: 0.049248): 0.153530): 0.088300);
Detailed output identifying parameters
kappa (ts/tv) = 1.53344
dN/dS (w) for site classes (K=3)
p: 0.96262 0.00000 0.03738
w: 0.00000 1.00000 2.27585
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
10..1 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
10..2 0.038 70.0 14.0 0.0851 0.0046 0.0538 0.3 0.8
10..3 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
10..11 0.088 70.0 14.0 0.0851 0.0105 0.1239 0.7 1.7
11..4 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
11..5 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
11..12 0.154 70.0 14.0 0.0851 0.0183 0.2155 1.3 3.0
12..6 0.051 70.0 14.0 0.0851 0.0061 0.0718 0.4 1.0
12..7 0.103 70.0 14.0 0.0851 0.0123 0.1447 0.9 2.0
12..8 0.330 70.0 14.0 0.0851 0.0394 0.4627 2.8 6.5
12..9 0.049 70.0 14.0 0.0851 0.0059 0.0691 0.4 1.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_SclA-PC)
Pr(w>1) post mean +- SE for w
5 R 1.000** 2.276
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_SclA-PC)
Pr(w>1) post mean +- SE for w
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.999 0.001 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
w2: 0.134 0.132 0.122 0.110 0.099 0.090 0.084 0.079 0.076 0.074
Posterior for p0-p1 (see the ternary graph)
0.000
0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.001 0.009
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.001 0.005 0.017 0.098
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.010 0.057 0.163 0.635
sum of density on p0-p1 = 1.000000
Time used: 0:22
Model 3: discrete (3 categories)
TREE # 1: (1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
lnL(ntime: 11 np: 17): -166.914967 +0.000000
10..1 10..2 10..3 10..11 11..4 11..5 11..12 12..6 12..7 12..8 12..9
0.000004 0.038348 0.000004 0.088300 0.000004 0.000004 0.153530 0.051132 0.103069 0.329623 0.049248 1.533443 0.000000 0.962625 0.000001 0.000001 2.275855
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.81327
(1: 0.000004, 2: 0.038348, 3: 0.000004, (4: 0.000004, 5: 0.000004, (6: 0.051132, 7: 0.103069, 8: 0.329623, 9: 0.049248): 0.153530): 0.088300);
(D_melanogaster_SclA-PC: 0.000004, D_sechellia_SclA-PC: 0.038348, D_simulans_SclA-PC: 0.000004, (D_yakuba_SclA-PC: 0.000004, D_erecta_SclA-PC: 0.000004, (D_takahashii_SclA-PC: 0.051132, D_biarmipes_SclA-PC: 0.103069, D_suzukii_SclA-PC: 0.329623, D_rhopaloa_SclA-PC: 0.049248): 0.153530): 0.088300);
Detailed output identifying parameters
kappa (ts/tv) = 1.53344
dN/dS (w) for site classes (K=3)
p: 0.00000 0.96262 0.03738
w: 0.00000 0.00000 2.27585
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
10..1 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
10..2 0.038 70.0 14.0 0.0851 0.0046 0.0538 0.3 0.8
10..3 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
10..11 0.088 70.0 14.0 0.0851 0.0105 0.1239 0.7 1.7
11..4 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
11..5 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
11..12 0.154 70.0 14.0 0.0851 0.0183 0.2155 1.3 3.0
12..6 0.051 70.0 14.0 0.0851 0.0061 0.0718 0.4 1.0
12..7 0.103 70.0 14.0 0.0851 0.0123 0.1447 0.9 2.0
12..8 0.330 70.0 14.0 0.0851 0.0394 0.4627 2.8 6.5
12..9 0.049 70.0 14.0 0.0851 0.0059 0.0691 0.4 1.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_SclA-PC)
Pr(w>1) post mean +- SE for w
5 R 1.000** 2.276
Time used: 0:33
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
lnL(ntime: 11 np: 14): -167.768935 +0.000000
10..1 10..2 10..3 10..11 11..4 11..5 11..12 12..6 12..7 12..8 12..9
0.000004 0.045400 0.000004 0.099502 0.000004 0.000004 0.164700 0.054705 0.110337 0.362502 0.052554 1.463158 0.005000 0.051466
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.88971
(1: 0.000004, 2: 0.045400, 3: 0.000004, (4: 0.000004, 5: 0.000004, (6: 0.054705, 7: 0.110337, 8: 0.362502, 9: 0.052554): 0.164700): 0.099502);
(D_melanogaster_SclA-PC: 0.000004, D_sechellia_SclA-PC: 0.045400, D_simulans_SclA-PC: 0.000004, (D_yakuba_SclA-PC: 0.000004, D_erecta_SclA-PC: 0.000004, (D_takahashii_SclA-PC: 0.054705, D_biarmipes_SclA-PC: 0.110337, D_suzukii_SclA-PC: 0.362502, D_rhopaloa_SclA-PC: 0.052554): 0.164700): 0.099502);
Detailed output identifying parameters
kappa (ts/tv) = 1.46316
Parameters in M7 (beta):
p = 0.00500 q = 0.05147
dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.99999
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
10..1 0.000 70.1 13.9 0.1000 0.0000 0.0000 0.0 0.0
10..2 0.045 70.1 13.9 0.1000 0.0061 0.0609 0.4 0.8
10..3 0.000 70.1 13.9 0.1000 0.0000 0.0000 0.0 0.0
10..11 0.100 70.1 13.9 0.1000 0.0133 0.1335 0.9 1.9
11..4 0.000 70.1 13.9 0.1000 0.0000 0.0000 0.0 0.0
11..5 0.000 70.1 13.9 0.1000 0.0000 0.0000 0.0 0.0
11..12 0.165 70.1 13.9 0.1000 0.0221 0.2209 1.5 3.1
12..6 0.055 70.1 13.9 0.1000 0.0073 0.0734 0.5 1.0
12..7 0.110 70.1 13.9 0.1000 0.0148 0.1480 1.0 2.1
12..8 0.363 70.1 13.9 0.1000 0.0486 0.4862 3.4 6.7
12..9 0.053 70.1 13.9 0.1000 0.0070 0.0705 0.5 1.0
Time used: 0:59
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, (4, 5, (6, 7, 8, 9))); MP score: 14
lnL(ntime: 11 np: 16): -166.914905 +0.000000
10..1 10..2 10..3 10..11 11..4 11..5 11..12 12..6 12..7 12..8 12..9
0.000004 0.038348 0.000004 0.088300 0.000004 0.000004 0.153531 0.051132 0.103069 0.329625 0.049248 1.533438 0.962624 0.005000 99.000000 2.275841
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.81327
(1: 0.000004, 2: 0.038348, 3: 0.000004, (4: 0.000004, 5: 0.000004, (6: 0.051132, 7: 0.103069, 8: 0.329625, 9: 0.049248): 0.153531): 0.088300);
(D_melanogaster_SclA-PC: 0.000004, D_sechellia_SclA-PC: 0.038348, D_simulans_SclA-PC: 0.000004, (D_yakuba_SclA-PC: 0.000004, D_erecta_SclA-PC: 0.000004, (D_takahashii_SclA-PC: 0.051132, D_biarmipes_SclA-PC: 0.103069, D_suzukii_SclA-PC: 0.329625, D_rhopaloa_SclA-PC: 0.049248): 0.153531): 0.088300);
Detailed output identifying parameters
kappa (ts/tv) = 1.53344
Parameters in M8 (beta&w>1):
p0 = 0.96262 p = 0.00500 q = 99.00000
(p1 = 0.03738) w = 2.27584
dN/dS (w) for site classes (K=11)
p: 0.09626 0.09626 0.09626 0.09626 0.09626 0.09626 0.09626 0.09626 0.09626 0.09626 0.03738
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 2.27584
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
10..1 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
10..2 0.038 70.0 14.0 0.0851 0.0046 0.0538 0.3 0.8
10..3 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
10..11 0.088 70.0 14.0 0.0851 0.0105 0.1239 0.7 1.7
11..4 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
11..5 0.000 70.0 14.0 0.0851 0.0000 0.0000 0.0 0.0
11..12 0.154 70.0 14.0 0.0851 0.0183 0.2155 1.3 3.0
12..6 0.051 70.0 14.0 0.0851 0.0061 0.0718 0.4 1.0
12..7 0.103 70.0 14.0 0.0851 0.0123 0.1447 0.9 2.0
12..8 0.330 70.0 14.0 0.0851 0.0394 0.4627 2.8 6.5
12..9 0.049 70.0 14.0 0.0851 0.0059 0.0691 0.4 1.0
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_SclA-PC)
Pr(w>1) post mean +- SE for w
5 R 1.000** 2.276
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_SclA-PC)
Pr(w>1) post mean +- SE for w
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.004 0.076 0.920
p : 0.969 0.029 0.001 0.000 0.000 0.000 0.000 0.000 0.000 0.000
q : 0.000 0.001 0.012 0.035 0.066 0.101 0.139 0.177 0.215 0.253
ws: 0.141 0.137 0.125 0.111 0.098 0.088 0.081 0.076 0.073 0.071
Time used: 1:39
Model 1: NearlyNeutral -167.189371 Model 2: PositiveSelection -166.914967 Model 0: one-ratio -168.517752 Model 3: discrete -166.914967 Model 7: beta -167.768935 Model 8: beta&w>1 -166.914905 Model 0 vs 1 2.6567620000000147 Model 2 vs 1 0.5488080000000082 Model 8 vs 7 1.708059999999989
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
