--- EXPERIMENT NOTES
--- EXPERIMENT PROPERTIES
#Mon Nov 07 10:38:53 WET 2016
codeml.models=0 1 2 3 7 8
mrbayes.mpich=
mrbayes.ngen=1000000
tcoffee.alignMethod=CLUSTALW2
tcoffee.params=
tcoffee.maxSeqs=0
codeml.bin=codeml
mrbayes.tburnin=2500
codeml.dir=
input.sequences=
mrbayes.pburnin=2500
mrbayes.bin=mb_adops
tcoffee.bin=t_coffee_ADOPS
mrbayes.dir=/usr/bin/
tcoffee.dir=
tcoffee.minScore=3
input.fasta=/opt/ADOPS/161/CG46244-PA/input.fasta
input.names=
mrbayes.params=
codeml.params=
--- PSRF SUMMARY
Estimated marginal likelihoods for runs sampled in files
"/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -146.62 -158.03
2 -146.29 -159.66
--------------------------------------
TOTAL -146.44 -159.15
--------------------------------------
Model parameter summaries over the runs sampled in files
"/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 1.935610 0.198518 1.111090 2.837366 1.903942 1014.70 1156.25 1.000
r(A<->C){all} 0.108573 0.011164 0.000001 0.306852 0.078195 296.03 358.02 1.001
r(A<->G){all} 0.236642 0.027127 0.000356 0.546968 0.207967 209.51 223.41 1.000
r(A<->T){all} 0.042910 0.002608 0.000012 0.146012 0.025807 318.14 466.27 1.003
r(C<->G){all} 0.139977 0.017977 0.000027 0.408171 0.099930 155.84 158.35 1.002
r(C<->T){all} 0.300297 0.030618 0.029522 0.652046 0.272245 113.00 129.07 1.005
r(G<->T){all} 0.171602 0.018371 0.000343 0.438034 0.139495 266.37 294.52 1.006
pi(A){all} 0.303991 0.002556 0.204507 0.400660 0.303246 991.79 1131.80 1.000
pi(C){all} 0.173664 0.001569 0.094457 0.245215 0.170129 1091.75 1120.09 1.001
pi(G){all} 0.180034 0.001702 0.102256 0.258420 0.177207 1079.36 1244.71 1.001
pi(T){all} 0.342310 0.002720 0.243510 0.445177 0.340408 1168.26 1218.77 1.000
alpha{1,2} 0.314421 0.089594 0.004390 0.904983 0.212644 1255.95 1326.59 1.000
alpha{3} 0.357305 0.086089 0.049131 0.916327 0.270757 1394.33 1394.48 1.000
pinvar{all} 0.866638 0.004713 0.734314 0.970401 0.879896 1155.91 1199.63 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
--- CODEML SUMMARY
Model 1: NearlyNeutral -166.133028
Model 2: PositiveSelection -154.776127
Model 0: one-ratio -175.373989
Model 3: discrete -154.776127
Model 7: beta -166.137368
Model 8: beta&w>1 -154.776122
Model 0 vs 1 18.481921999999997
Model 2 vs 1 22.713801999999987
Additional information for M1 vs M2:
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 0.988* 9.485 +- 1.505
19 S 1.000** 9.588 +- 1.172
Model 8 vs 7 22.722492000000045
Additional information for M7 vs M8:
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 0.995** 9.545 +- 1.328
19 S 1.000** 9.589 +- 1.172
>C1
MMTSHLLTHLVISDDFRLSKMYLTND
>C2
MMTSHLLTRLVISDDFRLSKMYLTND
>C3
MMTSHLLTRLVISDDFRLSKMYLTND
>C4
MMTSHLLTHLVISDDFRLSKMYLTND
>C5
MMTSHLLTHLVISDDFRLSKMYLTND
>C6
MMTSHLLTHLVISDDFRLAKMYLTND
>C7
MMTSHLLTHLVISDDFRLAKMYLTND
>C8
MMTSHLLTHLVISDDFRLAKMYLTND
>C9
MMTSHLLTHLVISDDFRLSKMYLTND
>C10
MMTSHLLTRLVISDDFRLAKMYLTND
>C11
MMTSHLLTHLVISDDFRLAKMYLTND
>C12
MMTSHLLTHLVISDDFRLAKMYLTND
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=12, Len=26
C1 MMTSHLLTHLVISDDFRLSKMYLTND
C2 MMTSHLLTRLVISDDFRLSKMYLTND
C3 MMTSHLLTRLVISDDFRLSKMYLTND
C4 MMTSHLLTHLVISDDFRLSKMYLTND
C5 MMTSHLLTHLVISDDFRLSKMYLTND
C6 MMTSHLLTHLVISDDFRLAKMYLTND
C7 MMTSHLLTHLVISDDFRLAKMYLTND
C8 MMTSHLLTHLVISDDFRLAKMYLTND
C9 MMTSHLLTHLVISDDFRLSKMYLTND
C10 MMTSHLLTRLVISDDFRLAKMYLTND
C11 MMTSHLLTHLVISDDFRLAKMYLTND
C12 MMTSHLLTHLVISDDFRLAKMYLTND
********:*********:*******
PROGRAM: T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:04 - Revision 1613 - Build 427)
-full_log S [0]
-genepred_score S [0] nsd
-run_name S [0]
-mem_mode S [0] mem
-extend D [1] 1
-extend_mode S [0] very_fast_triplet
-max_n_pair D [0] 10
-seq_name_for_quadruplet S [0] all
-compact S [0] default
-clean S [0] no
-do_self FL [0] 0
-do_normalise D [0] 1000
-template_file S [0]
-setenv S [0] 0
-template_mode S [0]
-flip D [0] 0
-remove_template_file D [0] 0
-profile_template_file S [0]
-in S [0]
-seq S [0]
-aln S [0]
-method_limits S [0]
-method S [0]
-lib S [0]
-profile S [0]
-profile1 S [0]
-profile2 S [0]
-pdb S [0]
-relax_lib D [0] 1
-filter_lib D [0] 0
-shrink_lib D [0] 0
-out_lib W_F [0] no
-out_lib_mode S [0] primary
-lib_only D [0] 0
-outseqweight W_F [0] no
-dpa FL [0] 0
-seq_source S [0] ANY
-cosmetic_penalty D [0] 0
-gapopen D [0] 0
-gapext D [0] 0
-fgapopen D [0] 0
-fgapext D [0] 0
-nomatch D [0] 0
-newtree W_F [0] default
-tree W_F [0] NO
-usetree R_F [0]
-tree_mode S [0] nj
-distance_matrix_mode S [0] ktup
-distance_matrix_sim_mode S [0] idmat_sim1
-quicktree FL [0] 0
-outfile W_F [0] default
-maximise FL [1] 1
-output S [1] score_ascii html score_ascii
-len D [0] 0
-infile R_F [1] /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
-matrix S [0] default
-tg_mode D [0] 1
-profile_mode S [0] cw_profile_profile
-profile_comparison S [0] profile
-dp_mode S [0] linked_pair_wise
-ktuple D [0] 1
-ndiag D [0] 0
-diag_threshold D [0] 0
-diag_mode D [0] 0
-sim_matrix S [0] vasiliky
-transform S [0]
-extend_seq FL [0] 0
-outorder S [0] input
-inorder S [0] aligned
-seqnos S [0] off
-case S [0] keep
-cpu D [0] 0
-maxnseq D [0] 1000
-maxlen D [0] -1
-sample_dp D [0] 0
-weight S [0] default
-seq_weight S [0] no
-align FL [1] 1
-mocca FL [0] 0
-domain FL [0] 0
-start D [0] 0
-len D [0] 0
-scale D [0] 0
-mocca_interactive FL [0] 0
-method_evaluate_mode S [0] default
-evaluate_mode S [1] t_coffee_fast
-get_type FL [0] 0
-clean_aln D [0] 0
-clean_threshold D [1] 1
-clean_iteration D [1] 1
-clean_evaluate_mode S [0] t_coffee_fast
-extend_matrix FL [0] 0
-prot_min_sim D [40] 40
-prot_max_sim D [90] 90
-prot_min_cov D [40] 40
-pdb_type S [0] d
-pdb_min_sim D [35] 35
-pdb_max_sim D [100] 100
-pdb_min_cov D [50] 50
-pdb_blast_server W_F [0] EBI
-blast W_F [0]
-blast_server W_F [0] EBI
-pdb_db W_F [0] pdb
-protein_db W_F [0] uniprot
-method_log W_F [0] no
-struc_to_use S [0]
-cache W_F [0] use
-align_pdb_param_file W_F [0] no
-align_pdb_hasch_mode W_F [0] hasch_ca_trace_bubble
-external_aligner S [0] NO
-msa_mode S [0] tree
-master S [0] no
-blast_nseq D [0] 0
-lalign_n_top D [0] 10
-iterate D [1] 0
-trim D [0] 0
-split D [0] 0
-trimfile S [0] default
-split D [0] 0
-split_nseq_thres D [0] 0
-split_score_thres D [0] 0
-check_pdb_status D [0] 0
-clean_seq_name D [0] 0
-seq_to_keep S [0]
-dpa_master_aln S [0]
-dpa_maxnseq D [0] 0
-dpa_min_score1 D [0]
-dpa_min_score2 D [0]
-dpa_keep_tmpfile FL [0] 0
-dpa_debug D [0] 0
-multi_core S [0] templates_jobs_relax_msa_evaluate
-n_core D [0] 0
-max_n_proc D [0] 0
-lib_list S [0]
-prune_lib_mode S [0] 5
-tip S [0] none
-rna_lib S [0]
-no_warning D [0] 0
-run_local_script D [0] 0
-plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.alnplugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
plugins S [0] default
-proxy S [0] unset
-email S [0]
-clean_overaln D [0] 0
-overaln_param S [0]
-overaln_mode S [0]
-overaln_model S [0]
-overaln_threshold D [0] 0
-overaln_target D [0] 0
-overaln_P1 D [0] 0
-overaln_P2 D [0] 0
-overaln_P3 D [0] 0
-overaln_P4 D [0] 0
-exon_boundaries S [0]
-dump S [0] no
-display D [0] 100
INPUT FILES
Input File (S) /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Format clustal_aln
Input File (M) proba_pair
Identify Master Sequences [no]:
Master Sequences Identified
INPUT SEQUENCES: 12 SEQUENCES [PROTEIN]
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C1 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C10 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C11 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C12 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C2 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C3 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C4 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C5 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C6 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C7 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C8 Length 26 type PROTEIN Struct Unchecked
Input File /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln Seq C9 Length 26 type PROTEIN Struct Unchecked
Multi Core Mode: 72 processors:
--- Process Method/Library/Aln S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
--- Process Method/Library/Aln Mproba_pair
xxx Retrieved S/opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln
xxx Retrieved Mproba_pair
All Methods Retrieved
MANUAL PENALTIES: gapopen=0 gapext=0
Library Total Size: [3432]
Library Relaxation: Multi_proc [72]
Relaxation Summary: [3432]--->[3432]
UN-WEIGHTED MODE: EVERY SEQUENCE WEIGHTS 1
OUTPUT RESULTS
#### File Type= MSA Format= score_ascii Name= input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.score_ascii
#### File Type= MSA Format= html Name= input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.html
#### File Type= MSA Format= score_ascii Name= input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.score_ascii
# Command Line: t_coffee_ADOPS -infile /opt/ADOPS/161/CG46244-PA/batch/allfiles/tcoffee/input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln -output score_ascii -special_mode evaluate -evaluate_mode t_coffee_fast [PROGRAM:T-COFFEE]
# T-COFFEE Memory Usage: Current= 29.559 Mb, Max= 30.612 Mb
# Results Produced with T-COFFEE Version_10.00.r1613 (2013-10-22 15:49:04 - Revision 1613 - Build 427)
# T-COFFEE is available from http://www.tcoffee.org
# Register on: https://groups.google.com/group/tcoffee/
>C1
MMTSHLLTHLVISDDFRLSKMYLTND
>C2
MMTSHLLTRLVISDDFRLSKMYLTND
>C3
MMTSHLLTRLVISDDFRLSKMYLTND
>C4
MMTSHLLTHLVISDDFRLSKMYLTND
>C5
MMTSHLLTHLVISDDFRLSKMYLTND
>C6
MMTSHLLTHLVISDDFRLAKMYLTND
>C7
MMTSHLLTHLVISDDFRLAKMYLTND
>C8
MMTSHLLTHLVISDDFRLAKMYLTND
>C9
MMTSHLLTHLVISDDFRLSKMYLTND
>C10
MMTSHLLTRLVISDDFRLAKMYLTND
>C11
MMTSHLLTHLVISDDFRLAKMYLTND
>C12
MMTSHLLTHLVISDDFRLAKMYLTND
FORMAT of file /tmp/tmp1402639814474799548aln Not Supported[FATAL:T-COFFEE]
>C1
MMTSHLLTHLVISDDFRLSKMYLTND
>C2
MMTSHLLTRLVISDDFRLSKMYLTND
>C3
MMTSHLLTRLVISDDFRLSKMYLTND
>C4
MMTSHLLTHLVISDDFRLSKMYLTND
>C5
MMTSHLLTHLVISDDFRLSKMYLTND
>C6
MMTSHLLTHLVISDDFRLAKMYLTND
>C7
MMTSHLLTHLVISDDFRLAKMYLTND
>C8
MMTSHLLTHLVISDDFRLAKMYLTND
>C9
MMTSHLLTHLVISDDFRLSKMYLTND
>C10
MMTSHLLTRLVISDDFRLAKMYLTND
>C11
MMTSHLLTHLVISDDFRLAKMYLTND
>C12
MMTSHLLTHLVISDDFRLAKMYLTND
input.fasta.prot.fasta.clustalw2_rs_0_0.fasta.aln I:26 S:100 BS:26
# TC_SIMILARITY_MATRIX_FORMAT_01
# SEQ_INDEX C1 0
# SEQ_INDEX C2 1
# SEQ_INDEX C3 2
# SEQ_INDEX C4 3
# SEQ_INDEX C5 4
# SEQ_INDEX C6 5
# SEQ_INDEX C7 6
# SEQ_INDEX C8 7
# SEQ_INDEX C9 8
# SEQ_INDEX C10 9
# SEQ_INDEX C11 10
# SEQ_INDEX C12 11
# PW_SEQ_DISTANCES
BOT 0 1 96.15 C1 C2 96.15
TOP 1 0 96.15 C2 C1 96.15
BOT 0 2 96.15 C1 C3 96.15
TOP 2 0 96.15 C3 C1 96.15
BOT 0 3 100.00 C1 C4 100.00
TOP 3 0 100.00 C4 C1 100.00
BOT 0 4 100.00 C1 C5 100.00
TOP 4 0 100.00 C5 C1 100.00
BOT 0 5 96.15 C1 C6 96.15
TOP 5 0 96.15 C6 C1 96.15
BOT 0 6 96.15 C1 C7 96.15
TOP 6 0 96.15 C7 C1 96.15
BOT 0 7 96.15 C1 C8 96.15
TOP 7 0 96.15 C8 C1 96.15
BOT 0 8 100.00 C1 C9 100.00
TOP 8 0 100.00 C9 C1 100.00
BOT 0 9 92.31 C1 C10 92.31
TOP 9 0 92.31 C10 C1 92.31
BOT 0 10 96.15 C1 C11 96.15
TOP 10 0 96.15 C11 C1 96.15
BOT 0 11 96.15 C1 C12 96.15
TOP 11 0 96.15 C12 C1 96.15
BOT 1 2 100.00 C2 C3 100.00
TOP 2 1 100.00 C3 C2 100.00
BOT 1 3 96.15 C2 C4 96.15
TOP 3 1 96.15 C4 C2 96.15
BOT 1 4 96.15 C2 C5 96.15
TOP 4 1 96.15 C5 C2 96.15
BOT 1 5 92.31 C2 C6 92.31
TOP 5 1 92.31 C6 C2 92.31
BOT 1 6 92.31 C2 C7 92.31
TOP 6 1 92.31 C7 C2 92.31
BOT 1 7 92.31 C2 C8 92.31
TOP 7 1 92.31 C8 C2 92.31
BOT 1 8 96.15 C2 C9 96.15
TOP 8 1 96.15 C9 C2 96.15
BOT 1 9 96.15 C2 C10 96.15
TOP 9 1 96.15 C10 C2 96.15
BOT 1 10 92.31 C2 C11 92.31
TOP 10 1 92.31 C11 C2 92.31
BOT 1 11 92.31 C2 C12 92.31
TOP 11 1 92.31 C12 C2 92.31
BOT 2 3 96.15 C3 C4 96.15
TOP 3 2 96.15 C4 C3 96.15
BOT 2 4 96.15 C3 C5 96.15
TOP 4 2 96.15 C5 C3 96.15
BOT 2 5 92.31 C3 C6 92.31
TOP 5 2 92.31 C6 C3 92.31
BOT 2 6 92.31 C3 C7 92.31
TOP 6 2 92.31 C7 C3 92.31
BOT 2 7 92.31 C3 C8 92.31
TOP 7 2 92.31 C8 C3 92.31
BOT 2 8 96.15 C3 C9 96.15
TOP 8 2 96.15 C9 C3 96.15
BOT 2 9 96.15 C3 C10 96.15
TOP 9 2 96.15 C10 C3 96.15
BOT 2 10 92.31 C3 C11 92.31
TOP 10 2 92.31 C11 C3 92.31
BOT 2 11 92.31 C3 C12 92.31
TOP 11 2 92.31 C12 C3 92.31
BOT 3 4 100.00 C4 C5 100.00
TOP 4 3 100.00 C5 C4 100.00
BOT 3 5 96.15 C4 C6 96.15
TOP 5 3 96.15 C6 C4 96.15
BOT 3 6 96.15 C4 C7 96.15
TOP 6 3 96.15 C7 C4 96.15
BOT 3 7 96.15 C4 C8 96.15
TOP 7 3 96.15 C8 C4 96.15
BOT 3 8 100.00 C4 C9 100.00
TOP 8 3 100.00 C9 C4 100.00
BOT 3 9 92.31 C4 C10 92.31
TOP 9 3 92.31 C10 C4 92.31
BOT 3 10 96.15 C4 C11 96.15
TOP 10 3 96.15 C11 C4 96.15
BOT 3 11 96.15 C4 C12 96.15
TOP 11 3 96.15 C12 C4 96.15
BOT 4 5 96.15 C5 C6 96.15
TOP 5 4 96.15 C6 C5 96.15
BOT 4 6 96.15 C5 C7 96.15
TOP 6 4 96.15 C7 C5 96.15
BOT 4 7 96.15 C5 C8 96.15
TOP 7 4 96.15 C8 C5 96.15
BOT 4 8 100.00 C5 C9 100.00
TOP 8 4 100.00 C9 C5 100.00
BOT 4 9 92.31 C5 C10 92.31
TOP 9 4 92.31 C10 C5 92.31
BOT 4 10 96.15 C5 C11 96.15
TOP 10 4 96.15 C11 C5 96.15
BOT 4 11 96.15 C5 C12 96.15
TOP 11 4 96.15 C12 C5 96.15
BOT 5 6 100.00 C6 C7 100.00
TOP 6 5 100.00 C7 C6 100.00
BOT 5 7 100.00 C6 C8 100.00
TOP 7 5 100.00 C8 C6 100.00
BOT 5 8 96.15 C6 C9 96.15
TOP 8 5 96.15 C9 C6 96.15
BOT 5 9 96.15 C6 C10 96.15
TOP 9 5 96.15 C10 C6 96.15
BOT 5 10 100.00 C6 C11 100.00
TOP 10 5 100.00 C11 C6 100.00
BOT 5 11 100.00 C6 C12 100.00
TOP 11 5 100.00 C12 C6 100.00
BOT 6 7 100.00 C7 C8 100.00
TOP 7 6 100.00 C8 C7 100.00
BOT 6 8 96.15 C7 C9 96.15
TOP 8 6 96.15 C9 C7 96.15
BOT 6 9 96.15 C7 C10 96.15
TOP 9 6 96.15 C10 C7 96.15
BOT 6 10 100.00 C7 C11 100.00
TOP 10 6 100.00 C11 C7 100.00
BOT 6 11 100.00 C7 C12 100.00
TOP 11 6 100.00 C12 C7 100.00
BOT 7 8 96.15 C8 C9 96.15
TOP 8 7 96.15 C9 C8 96.15
BOT 7 9 96.15 C8 C10 96.15
TOP 9 7 96.15 C10 C8 96.15
BOT 7 10 100.00 C8 C11 100.00
TOP 10 7 100.00 C11 C8 100.00
BOT 7 11 100.00 C8 C12 100.00
TOP 11 7 100.00 C12 C8 100.00
BOT 8 9 92.31 C9 C10 92.31
TOP 9 8 92.31 C10 C9 92.31
BOT 8 10 96.15 C9 C11 96.15
TOP 10 8 96.15 C11 C9 96.15
BOT 8 11 96.15 C9 C12 96.15
TOP 11 8 96.15 C12 C9 96.15
BOT 9 10 96.15 C10 C11 96.15
TOP 10 9 96.15 C11 C10 96.15
BOT 9 11 96.15 C10 C12 96.15
TOP 11 9 96.15 C12 C10 96.15
BOT 10 11 100.00 C11 C12 100.00
TOP 11 10 100.00 C12 C11 100.00
AVG 0 C1 * 96.85
AVG 1 C2 * 94.76
AVG 2 C3 * 94.76
AVG 3 C4 * 96.85
AVG 4 C5 * 96.85
AVG 5 C6 * 96.85
AVG 6 C7 * 96.85
AVG 7 C8 * 96.85
AVG 8 C9 * 96.85
AVG 9 C10 * 94.76
AVG 10 C11 * 96.85
AVG 11 C12 * 96.85
TOT TOT * 96.33
CLUSTAL W (1.83) multiple sequence alignment
C1 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C2 ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG
C3 ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG
C4 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C5 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C6 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C7 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGACTTTCG
C8 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C9 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C10 ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG
C11 ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
C12 ATGATGACATCGCATTTACTAACACACCTTGTAATATCCGATGATTTTCG
*************************. ***************** *****
C1 GCTTTCGAAAATGTATTTAACGAACGAT
C2 GCTTTCGAAAATGTATTTAACGAACGAT
C3 GCTTTCGAAAATGTATTTAACGAACGAT
C4 GCTTTCGAAAATGTATTTAACGAACGAT
C5 GCTTTCGAAAATGTATTTAACGAACGAT
C6 GCTTGCGAAAATGTATTTAACGAACGAT
C7 GCTTGCGAAAATGTATTTAACGAACGAT
C8 GCTTGCGAAAATGTATTTAACGAACGAT
C9 GCTTTCGAAAATGTATTTAACGAACGAT
C10 GCTTGCGAAAATGTATTTAACGAACGAT
C11 GCTTGCGAAAATGTATTTAACGAACGAT
C12 GCTTGCGAAAATGTATTTAACGAACGAT
**** ***********************
>C1
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTTCGAAAATGTATTTAACGAACGAT
>C2
ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG
GCTTTCGAAAATGTATTTAACGAACGAT
>C3
ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG
GCTTTCGAAAATGTATTTAACGAACGAT
>C4
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTTCGAAAATGTATTTAACGAACGAT
>C5
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTTCGAAAATGTATTTAACGAACGAT
>C6
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTGCGAAAATGTATTTAACGAACGAT
>C7
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGACTTTCG
GCTTGCGAAAATGTATTTAACGAACGAT
>C8
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTGCGAAAATGTATTTAACGAACGAT
>C9
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTTCGAAAATGTATTTAACGAACGAT
>C10
ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG
GCTTGCGAAAATGTATTTAACGAACGAT
>C11
ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG
GCTTGCGAAAATGTATTTAACGAACGAT
>C12
ATGATGACATCGCATTTACTAACACACCTTGTAATATCCGATGATTTTCG
GCTTGCGAAAATGTATTTAACGAACGAT
>C1
MMTSHLLTHLVISDDFRLSKMYLTND
>C2
MMTSHLLTRLVISDDFRLSKMYLTND
>C3
MMTSHLLTRLVISDDFRLSKMYLTND
>C4
MMTSHLLTHLVISDDFRLSKMYLTND
>C5
MMTSHLLTHLVISDDFRLSKMYLTND
>C6
MMTSHLLTHLVISDDFRLAKMYLTND
>C7
MMTSHLLTHLVISDDFRLAKMYLTND
>C8
MMTSHLLTHLVISDDFRLAKMYLTND
>C9
MMTSHLLTHLVISDDFRLSKMYLTND
>C10
MMTSHLLTRLVISDDFRLAKMYLTND
>C11
MMTSHLLTHLVISDDFRLAKMYLTND
>C12
MMTSHLLTHLVISDDFRLAKMYLTND
MrBayes v3.2.2 x64
(Bayesian Analysis of Phylogeny)
Distributed under the GNU General Public License
Type "help" or "help <command>" for information
on the commands that are available.
Type "about" for authorship and general
information about the program.
Executing file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb"
UNIX line termination
Longest line length = 63
Parsing file
Expecting NEXUS formatted file
Reading data block
Allocated taxon set
Allocated matrix
Defining new matrix with 12 taxa and 78 characters
Missing data coded as ?
Data matrix is interleaved
Data is Dna
Gaps coded as -
Matching characters coded as .
Taxon 1 -> C1
Taxon 2 -> C2
Taxon 3 -> C3
Taxon 4 -> C4
Taxon 5 -> C5
Taxon 6 -> C6
Taxon 7 -> C7
Taxon 8 -> C8
Taxon 9 -> C9
Taxon 10 -> C10
Taxon 11 -> C11
Taxon 12 -> C12
Successfully read matrix
Setting default partition (does not divide up characters)
Setting model defaults
Seed (for generating default start values) = 1478514815
Setting output file names to "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run<i>.<p|t>"
Exiting data block
Reading mrbayes block
Setting autoclose to yes
Setting nowarnings to yes
Defining charset called first_pos
Defining charset called second_pos
Defining charset called third_pos
Defining partition called by_codon
Setting by_codon as the partition, dividing characters into 3 parts.
Setting model defaults
Seed (for generating default start values) = 1967028683
Setting Nst to 6 for partition 1
Setting Nst to 6 for partition 2
Setting Nst to 6 for partition 3
Setting Rates to Invgamma for partition 1
Setting Rates to Invgamma for partition 2
Setting Rates to Invgamma for partition 3
Successfully set likelihood model parameters to all
applicable data partitions
Unlinking
Setting number of generations to 1000000
Running Markov chain
MCMC stamp = 4519480281
Seed = 523642760
Swapseed = 1478514815
Model settings:
Settings for partition 1 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 2 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Settings for partition 3 --
Datatype = DNA
Nucmodel = 4by4
Nst = 6
Substitution rates, expressed as proportions
of the rate sum, have a Dirichlet prior
(1.00,1.00,1.00,1.00,1.00,1.00)
Covarion = No
# States = 4
State frequencies have a Dirichlet prior
(1.00,1.00,1.00,1.00)
Rates = Invgamma
Gamma shape parameter is exponentially
distributed with parameter (2.00).
Proportion of invariable sites is uniformly dist-
ributed on the interval (0.00,1.00).
Gamma distribution is approximated using 4 categories.
Likelihood summarized over all rate categories in each generation.
Active parameters:
Partition(s)
Parameters 1 2 3
------------------------
Revmat 1 1 1
Statefreq 2 2 2
Shape 3 3 4
Pinvar 5 5 5
Ratemultiplier 6 6 6
Topology 7 7 7
Brlens 8 8 8
------------------------
Parameters can be linked or unlinked across partitions using 'link' and 'unlink'
1 -- Parameter = Revmat{all}
Type = Rates of reversible rate matrix
Prior = Dirichlet(1.00,1.00,1.00,1.00,1.00,1.00)
Partitions = All
2 -- Parameter = Pi{all}
Type = Stationary state frequencies
Prior = Dirichlet
Partitions = All
3 -- Parameter = Alpha{1,2}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partitions = 1 and 2
4 -- Parameter = Alpha{3}
Type = Shape of scaled gamma distribution of site rates
Prior = Exponential(2.00)
Partition = 3
5 -- Parameter = Pinvar{all}
Type = Proportion of invariable sites
Prior = Uniform(0.00,1.00)
Partitions = All
6 -- Parameter = Ratemultiplier{all}
Type = Partition-specific rate multiplier
Prior = Fixed(1.0)
Partitions = All
7 -- Parameter = Tau{all}
Type = Topology
Prior = All topologies equally probable a priori
Partitions = All
Subparam. = V{all}
8 -- Parameter = V{all}
Type = Branch lengths
Prior = Unconstrained:Exponential(10.0)
Partitions = All
The MCMC sampler will use the following moves:
With prob. Chain will use move
1.06 % Dirichlet(Revmat{all})
1.06 % Slider(Revmat{all})
1.06 % Dirichlet(Pi{all})
1.06 % Slider(Pi{all})
2.13 % Multiplier(Alpha{1,2})
2.13 % Multiplier(Alpha{3})
2.13 % Slider(Pinvar{all})
10.64 % ExtSPR(Tau{all},V{all})
10.64 % ExtTBR(Tau{all},V{all})
10.64 % NNI(Tau{all},V{all})
10.64 % ParsSPR(Tau{all},V{all})
31.91 % Multiplier(V{all})
10.64 % Nodeslider(V{all})
4.26 % TLMultiplier(V{all})
Division 1 has 5 unique site patterns
Division 2 has 5 unique site patterns
Division 3 has 6 unique site patterns
Initializing conditional likelihoods
Using standard SSE likelihood calculator for division 1 (single-precision)
Using standard SSE likelihood calculator for division 2 (single-precision)
Using standard SSE likelihood calculator for division 3 (single-precision)
Initializing invariable-site conditional likelihoods
Initial log likelihoods and log prior probs for run 1:
Chain 1 -- -283.550405 -- -24.979900
Chain 2 -- -286.189296 -- -24.979900
Chain 3 -- -288.261780 -- -24.979900
Chain 4 -- -283.658426 -- -24.979900
Initial log likelihoods and log prior probs for run 2:
Chain 1 -- -280.351158 -- -24.979900
Chain 2 -- -282.943830 -- -24.979900
Chain 3 -- -286.164149 -- -24.979900
Chain 4 -- -282.979538 -- -24.979900
Using a relative burnin of 25.0 % for diagnostics
Chain results (1000000 generations requested):
0 -- [-283.550] (-286.189) (-288.262) (-283.658) * [-280.351] (-282.944) (-286.164) (-282.980)
500 -- (-154.419) (-162.068) [-153.223] (-162.859) * [-161.118] (-155.398) (-157.743) (-153.123) -- 0:00:00
1000 -- (-159.450) (-156.589) [-158.875] (-169.473) * (-167.858) (-171.573) [-160.319] (-162.745) -- 0:00:00
1500 -- (-163.270) (-153.783) [-162.171] (-164.122) * (-163.749) [-155.040] (-167.151) (-153.630) -- 0:00:00
2000 -- (-177.619) [-157.350] (-157.505) (-157.620) * (-174.875) [-153.412] (-174.393) (-158.653) -- 0:00:00
2500 -- (-171.371) [-150.775] (-153.682) (-157.157) * (-167.448) [-166.133] (-159.758) (-171.699) -- 0:00:00
3000 -- (-161.294) (-164.265) (-159.843) [-162.274] * (-163.023) [-157.673] (-159.996) (-166.611) -- 0:00:00
3500 -- (-161.633) (-162.951) [-160.342] (-160.309) * (-154.865) [-160.240] (-149.358) (-160.046) -- 0:00:00
4000 -- (-154.781) (-158.125) (-156.776) [-154.770] * (-160.782) (-169.189) [-152.104] (-166.634) -- 0:00:00
4500 -- (-164.227) (-161.794) [-152.739] (-158.044) * (-160.138) (-164.822) [-151.070] (-166.834) -- 0:03:41
5000 -- (-148.297) (-161.211) [-155.772] (-162.673) * [-158.722] (-157.173) (-155.842) (-162.723) -- 0:03:19
Average standard deviation of split frequencies: 0.080532
5500 -- (-147.595) (-160.866) [-154.616] (-156.301) * (-159.539) (-167.080) (-155.517) [-159.815] -- 0:03:00
6000 -- [-146.443] (-155.003) (-162.235) (-166.587) * (-166.340) [-162.751] (-155.333) (-169.770) -- 0:02:45
6500 -- [-145.691] (-152.929) (-150.542) (-157.346) * [-157.921] (-163.449) (-156.223) (-165.398) -- 0:02:32
7000 -- (-152.858) (-146.091) [-153.119] (-155.419) * (-164.424) (-160.738) [-157.704] (-168.117) -- 0:02:21
7500 -- (-148.538) (-158.562) (-162.004) [-157.438] * (-156.531) (-165.539) (-157.122) [-158.355] -- 0:02:12
8000 -- (-152.480) [-152.250] (-162.951) (-155.904) * [-146.064] (-163.382) (-152.829) (-166.272) -- 0:02:04
8500 -- (-153.447) (-162.284) (-155.800) [-161.459] * [-147.653] (-158.568) (-152.168) (-153.784) -- 0:01:56
9000 -- (-147.418) [-153.195] (-152.194) (-162.906) * (-153.558) (-155.475) (-150.790) [-153.298] -- 0:01:50
9500 -- [-152.112] (-145.953) (-153.663) (-150.185) * (-152.732) (-157.471) (-160.892) [-152.384] -- 0:01:44
10000 -- (-157.050) (-155.839) (-154.910) [-155.466] * (-152.808) (-159.680) [-153.121] (-154.570) -- 0:03:18
Average standard deviation of split frequencies: 0.082362
10500 -- (-153.577) [-145.804] (-159.772) (-158.069) * [-155.331] (-153.938) (-154.151) (-150.614) -- 0:03:08
11000 -- [-149.739] (-155.135) (-157.539) (-155.378) * (-160.599) (-163.392) [-142.667] (-148.921) -- 0:02:59
11500 -- (-154.641) [-156.537] (-159.486) (-164.446) * (-159.386) (-159.620) (-146.556) [-149.072] -- 0:02:51
12000 -- (-152.302) [-156.050] (-158.188) (-161.634) * [-148.810] (-156.834) (-151.895) (-161.825) -- 0:02:44
12500 -- (-152.264) (-165.418) (-160.192) [-155.220] * [-153.956] (-154.445) (-159.781) (-165.376) -- 0:02:38
13000 -- [-158.948] (-160.399) (-154.117) (-158.262) * (-149.896) (-161.259) [-150.998] (-152.318) -- 0:02:31
13500 -- (-148.165) (-154.427) [-153.703] (-154.944) * (-155.876) (-159.286) [-145.252] (-151.946) -- 0:02:26
14000 -- (-154.839) (-158.251) [-153.222] (-154.196) * [-152.211] (-158.719) (-145.128) (-147.562) -- 0:02:20
14500 -- (-148.309) (-152.696) (-164.071) [-154.600] * (-155.429) (-159.839) [-146.832] (-148.833) -- 0:02:15
15000 -- [-152.863] (-152.780) (-159.941) (-156.245) * (-149.910) (-160.445) [-152.182] (-155.065) -- 0:02:11
Average standard deviation of split frequencies: 0.076385
15500 -- (-148.364) [-147.787] (-158.176) (-161.999) * (-155.238) (-152.192) [-151.697] (-153.749) -- 0:03:10
16000 -- (-151.012) (-151.564) [-152.880] (-152.851) * (-151.759) (-160.658) (-150.905) [-153.762] -- 0:03:04
16500 -- [-148.364] (-152.867) (-152.544) (-154.681) * [-154.641] (-159.417) (-152.991) (-152.162) -- 0:02:58
17000 -- [-149.383] (-151.684) (-148.125) (-161.377) * (-154.539) [-150.129] (-154.282) (-151.431) -- 0:02:53
17500 -- (-149.847) [-155.186] (-146.846) (-156.555) * [-148.687] (-156.597) (-151.106) (-159.789) -- 0:02:48
18000 -- (-154.262) [-152.371] (-146.930) (-161.669) * (-152.525) (-153.861) [-145.797] (-155.104) -- 0:02:43
18500 -- (-150.285) (-156.495) [-157.193] (-155.804) * (-150.452) [-148.423] (-157.380) (-158.795) -- 0:02:39
19000 -- [-148.941] (-151.040) (-161.097) (-156.569) * (-150.237) [-148.600] (-155.718) (-150.405) -- 0:02:34
19500 -- [-147.999] (-159.109) (-161.095) (-162.489) * (-155.801) (-150.672) [-153.683] (-153.241) -- 0:02:30
20000 -- (-159.537) (-154.295) [-156.342] (-154.937) * [-153.343] (-154.637) (-153.088) (-150.841) -- 0:02:27
Average standard deviation of split frequencies: 0.068430
20500 -- (-155.957) [-151.150] (-161.644) (-152.089) * [-154.779] (-150.180) (-152.742) (-157.862) -- 0:02:23
21000 -- (-154.292) [-145.761] (-157.571) (-153.911) * (-154.572) [-147.709] (-150.983) (-163.740) -- 0:03:06
21500 -- (-149.450) (-157.386) [-154.760] (-157.552) * (-148.861) (-155.748) (-151.878) [-157.342] -- 0:03:02
22000 -- (-157.421) (-151.651) [-148.941] (-153.103) * (-152.528) [-147.782] (-157.629) (-152.393) -- 0:02:57
22500 -- (-149.607) (-153.491) (-153.118) [-156.394] * (-153.065) (-152.648) (-156.134) [-149.254] -- 0:02:53
23000 -- (-152.356) (-156.924) [-154.603] (-152.065) * (-158.937) [-145.897] (-152.255) (-152.907) -- 0:02:49
23500 -- (-157.649) [-160.962] (-158.881) (-148.876) * (-162.847) [-148.027] (-151.533) (-151.696) -- 0:02:46
24000 -- (-154.915) (-156.099) (-152.082) [-146.433] * [-156.575] (-151.630) (-164.650) (-152.334) -- 0:02:42
24500 -- (-157.091) (-161.118) [-146.005] (-146.321) * (-151.732) (-156.000) [-148.104] (-157.766) -- 0:02:39
25000 -- (-159.740) (-158.172) [-149.981] (-149.731) * (-152.932) [-150.513] (-154.442) (-154.821) -- 0:02:36
Average standard deviation of split frequencies: 0.051371
25500 -- (-154.980) (-155.970) [-150.245] (-151.250) * (-151.057) [-152.991] (-159.516) (-146.897) -- 0:02:32
26000 -- (-159.786) [-161.980] (-148.009) (-151.547) * (-158.657) (-156.953) [-149.967] (-150.148) -- 0:02:29
26500 -- (-159.123) (-163.789) (-148.444) [-148.630] * (-157.598) (-147.199) (-154.991) [-151.925] -- 0:03:03
27000 -- [-156.304] (-161.912) (-158.877) (-153.210) * (-154.282) [-146.146] (-159.173) (-156.863) -- 0:03:00
27500 -- [-146.765] (-157.033) (-153.580) (-153.320) * [-151.198] (-156.157) (-155.542) (-157.262) -- 0:02:56
28000 -- (-147.083) [-151.160] (-154.152) (-156.547) * [-153.835] (-149.648) (-157.696) (-159.637) -- 0:02:53
28500 -- (-152.086) (-152.450) [-148.679] (-151.240) * (-151.284) (-154.482) [-154.222] (-158.219) -- 0:02:50
29000 -- (-151.559) [-152.337] (-156.129) (-153.678) * (-157.797) (-149.608) (-155.922) [-153.984] -- 0:02:47
29500 -- [-146.628] (-149.762) (-154.686) (-152.866) * (-152.170) (-157.766) [-146.137] (-157.383) -- 0:02:44
30000 -- (-154.532) [-159.773] (-155.139) (-144.435) * (-149.686) (-158.174) [-143.335] (-149.232) -- 0:02:41
Average standard deviation of split frequencies: 0.049663
30500 -- (-154.090) (-159.961) (-148.316) [-145.839] * (-159.594) (-158.436) (-152.449) [-149.990] -- 0:02:38
31000 -- (-152.117) (-160.889) [-148.954] (-147.788) * (-155.536) [-147.861] (-148.788) (-152.318) -- 0:02:36
31500 -- (-156.736) (-155.112) (-155.235) [-150.094] * [-152.193] (-156.167) (-148.002) (-151.778) -- 0:03:04
32000 -- [-149.398] (-152.421) (-152.506) (-158.310) * (-152.889) (-154.890) [-150.691] (-152.802) -- 0:03:01
32500 -- (-163.941) (-155.450) [-146.177] (-152.199) * (-153.828) (-154.383) (-157.328) [-148.696] -- 0:02:58
33000 -- (-154.075) (-153.561) (-152.533) [-147.766] * (-160.972) [-146.865] (-156.290) (-149.699) -- 0:02:55
33500 -- (-153.601) (-150.160) [-147.122] (-155.952) * (-166.427) (-157.240) (-149.677) [-145.590] -- 0:02:53
34000 -- (-154.722) (-147.975) (-151.227) [-146.278] * [-151.580] (-150.951) (-146.730) (-150.389) -- 0:02:50
34500 -- (-153.516) (-153.715) [-150.258] (-150.902) * (-155.774) (-152.553) (-155.893) [-150.329] -- 0:02:47
35000 -- [-153.263] (-153.975) (-146.985) (-153.774) * (-156.383) (-147.161) (-152.270) [-149.408] -- 0:02:45
Average standard deviation of split frequencies: 0.039853
35500 -- (-157.686) (-159.180) (-154.603) [-154.131] * (-159.725) [-146.929] (-148.580) (-155.644) -- 0:02:43
36000 -- (-157.668) (-158.334) [-159.016] (-157.825) * (-151.335) (-154.806) [-144.917] (-156.409) -- 0:02:40
36500 -- (-153.954) [-150.480] (-153.686) (-148.663) * [-161.184] (-155.554) (-155.349) (-151.500) -- 0:02:38
37000 -- (-155.088) (-149.446) (-157.380) [-150.906] * (-151.278) (-157.605) (-154.905) [-148.839] -- 0:03:02
37500 -- (-159.638) [-153.911] (-156.419) (-152.382) * (-151.051) [-160.963] (-153.764) (-155.885) -- 0:02:59
38000 -- (-155.781) [-152.518] (-152.042) (-147.551) * [-149.113] (-156.566) (-156.521) (-154.644) -- 0:02:57
38500 -- (-154.085) [-153.427] (-158.824) (-146.383) * (-153.296) [-152.058] (-152.787) (-150.801) -- 0:02:54
39000 -- (-157.334) (-147.891) [-150.715] (-145.971) * (-149.409) (-160.138) (-152.392) [-149.618] -- 0:02:52
39500 -- (-155.173) [-148.913] (-149.166) (-157.775) * (-152.499) (-155.579) (-152.594) [-146.353] -- 0:02:50
40000 -- (-155.704) (-161.086) [-150.050] (-157.729) * [-152.358] (-149.686) (-155.218) (-151.693) -- 0:02:48
Average standard deviation of split frequencies: 0.040572
40500 -- (-159.381) (-155.978) [-148.365] (-151.000) * (-150.523) [-150.110] (-155.446) (-154.070) -- 0:02:45
41000 -- (-159.006) (-159.316) [-144.421] (-150.217) * (-159.410) (-150.086) [-149.665] (-152.450) -- 0:02:43
41500 -- (-155.819) [-149.276] (-155.650) (-149.946) * (-155.334) [-152.083] (-151.299) (-147.742) -- 0:02:41
42000 -- (-162.700) (-153.386) (-156.757) [-147.073] * (-159.780) (-144.301) [-153.504] (-154.599) -- 0:02:39
42500 -- (-160.185) (-150.936) [-149.134] (-153.233) * (-165.369) [-146.712] (-147.139) (-151.187) -- 0:03:00
43000 -- (-157.424) [-153.259] (-151.086) (-154.181) * (-159.014) (-153.889) [-148.758] (-151.738) -- 0:02:58
43500 -- [-150.407] (-157.001) (-154.409) (-155.925) * (-148.357) (-159.312) (-151.004) [-148.803] -- 0:02:55
44000 -- (-145.593) [-150.340] (-146.724) (-155.963) * [-152.352] (-154.281) (-149.966) (-155.027) -- 0:02:53
44500 -- (-148.377) (-149.310) [-153.973] (-157.517) * (-152.184) (-151.002) [-151.251] (-153.461) -- 0:02:51
45000 -- (-162.787) (-153.827) [-150.380] (-152.103) * (-154.007) [-148.789] (-148.594) (-150.530) -- 0:02:49
Average standard deviation of split frequencies: 0.041419
45500 -- (-158.431) (-149.121) (-158.572) [-149.405] * [-150.271] (-152.068) (-157.161) (-148.664) -- 0:02:47
46000 -- (-153.392) (-147.915) (-159.589) [-149.979] * (-153.958) [-147.145] (-146.304) (-149.898) -- 0:02:45
46500 -- (-152.717) [-158.245] (-157.753) (-152.076) * (-153.463) [-147.225] (-152.174) (-155.702) -- 0:02:44
47000 -- (-157.899) (-157.561) (-154.902) [-151.573] * [-153.477] (-154.846) (-165.990) (-150.397) -- 0:02:42
47500 -- (-150.071) (-147.049) (-152.827) [-145.184] * (-152.671) (-151.428) (-157.171) [-147.996] -- 0:02:40
48000 -- [-145.367] (-153.203) (-158.150) (-157.069) * (-153.317) (-150.392) [-148.835] (-147.537) -- 0:02:58
48500 -- (-146.477) (-152.734) (-159.022) [-153.440] * [-156.144] (-158.659) (-148.330) (-150.359) -- 0:02:56
49000 -- (-152.451) (-156.551) (-150.826) [-150.794] * (-160.484) [-153.037] (-145.380) (-148.531) -- 0:02:54
49500 -- (-155.509) [-152.320] (-153.424) (-152.386) * (-151.325) (-149.867) [-147.053] (-148.014) -- 0:02:52
50000 -- (-156.475) (-149.628) (-153.795) [-158.620] * (-154.348) [-147.550] (-154.132) (-151.089) -- 0:02:51
Average standard deviation of split frequencies: 0.035001
50500 -- (-155.520) (-150.392) [-154.117] (-159.962) * (-153.103) [-149.496] (-157.549) (-161.210) -- 0:02:49
51000 -- (-150.489) [-153.380] (-152.027) (-154.262) * [-146.801] (-153.100) (-158.398) (-156.931) -- 0:02:47
51500 -- (-149.024) (-151.125) (-154.704) [-160.676] * (-151.677) (-154.220) (-161.978) [-151.891] -- 0:02:45
52000 -- (-147.529) (-155.023) (-155.686) [-152.400] * (-154.557) (-158.079) (-155.951) [-149.284] -- 0:02:44
52500 -- (-156.735) (-149.168) [-149.545] (-155.294) * (-152.337) (-151.941) [-148.194] (-160.587) -- 0:02:42
53000 -- [-151.081] (-150.379) (-157.266) (-151.911) * [-151.983] (-158.092) (-154.036) (-158.544) -- 0:02:40
53500 -- [-146.115] (-156.208) (-149.789) (-156.183) * (-156.139) [-143.590] (-154.075) (-155.809) -- 0:02:56
54000 -- (-145.559) [-149.019] (-158.025) (-153.782) * (-156.041) (-154.886) [-153.853] (-157.137) -- 0:02:55
54500 -- (-147.820) (-146.913) [-148.608] (-158.977) * (-155.611) (-155.780) (-153.366) [-150.347] -- 0:02:53
55000 -- (-147.729) (-148.129) [-149.374] (-151.948) * (-153.724) [-149.572] (-149.966) (-149.143) -- 0:02:51
Average standard deviation of split frequencies: 0.034820
55500 -- (-155.920) (-149.717) (-151.649) [-154.970] * (-146.538) [-149.698] (-152.766) (-149.543) -- 0:02:50
56000 -- [-152.956] (-147.291) (-154.113) (-158.257) * (-152.787) (-153.107) (-153.023) [-153.160] -- 0:02:48
56500 -- (-150.149) (-151.356) [-151.199] (-156.209) * (-148.025) [-152.697] (-148.463) (-147.922) -- 0:02:46
57000 -- [-148.292] (-152.079) (-147.869) (-157.629) * (-146.550) (-148.086) [-154.313] (-154.284) -- 0:02:45
57500 -- (-156.326) (-150.999) (-153.450) [-152.490] * (-155.574) (-153.470) (-152.960) [-147.866] -- 0:02:43
58000 -- (-151.724) (-149.468) (-156.821) [-145.638] * (-159.558) (-153.112) [-151.478] (-148.463) -- 0:02:42
58500 -- (-151.302) (-150.529) (-152.079) [-145.737] * (-147.251) [-150.984] (-145.701) (-152.826) -- 0:02:40
59000 -- [-150.329] (-159.586) (-151.002) (-144.903) * (-151.525) (-154.488) (-156.220) [-144.744] -- 0:02:55
59500 -- (-158.839) (-155.382) (-147.412) [-148.390] * [-143.905] (-149.198) (-154.082) (-150.716) -- 0:02:53
60000 -- (-156.779) [-146.321] (-147.912) (-154.507) * (-152.160) (-151.273) [-155.194] (-158.101) -- 0:02:52
Average standard deviation of split frequencies: 0.037298
60500 -- (-156.251) (-153.077) [-144.318] (-152.483) * (-150.239) (-150.927) (-159.343) [-150.422] -- 0:02:50
61000 -- (-156.723) (-155.338) [-152.759] (-145.806) * (-149.461) [-156.018] (-148.728) (-161.675) -- 0:02:49
61500 -- (-149.631) (-154.782) (-156.372) [-152.270] * [-151.664] (-152.800) (-145.479) (-153.473) -- 0:02:47
62000 -- (-164.162) [-158.778] (-144.156) (-152.635) * (-156.858) (-160.187) (-154.714) [-153.764] -- 0:02:46
62500 -- (-154.082) (-152.079) [-148.824] (-152.561) * (-162.338) (-156.511) [-145.694] (-144.216) -- 0:02:45
63000 -- (-154.676) (-147.872) [-149.038] (-153.194) * (-151.233) (-154.443) [-152.404] (-163.433) -- 0:02:43
63500 -- [-154.988] (-152.991) (-148.000) (-150.120) * (-152.577) (-153.332) [-156.912] (-154.131) -- 0:02:42
64000 -- (-154.916) [-152.253] (-149.171) (-154.314) * (-165.061) (-152.117) [-148.773] (-149.039) -- 0:02:40
64500 -- (-160.963) [-153.838] (-157.760) (-156.933) * [-154.305] (-158.352) (-155.691) (-149.765) -- 0:02:54
65000 -- (-158.432) (-150.685) (-148.921) [-152.840] * (-147.557) (-160.316) (-155.988) [-149.879] -- 0:02:52
Average standard deviation of split frequencies: 0.034160
65500 -- [-153.238] (-151.110) (-162.438) (-149.261) * (-151.788) (-160.683) (-152.030) [-156.397] -- 0:02:51
66000 -- (-148.864) (-152.156) [-149.528] (-156.531) * (-148.656) (-150.260) (-149.466) [-147.960] -- 0:02:49
66500 -- [-151.942] (-150.584) (-151.008) (-151.371) * (-153.667) [-150.433] (-156.255) (-154.904) -- 0:02:48
67000 -- (-152.133) [-153.199] (-150.888) (-151.950) * (-150.892) (-153.564) [-150.858] (-150.199) -- 0:02:47
67500 -- (-156.435) (-145.620) [-150.004] (-153.007) * (-153.492) [-152.614] (-157.302) (-154.699) -- 0:02:45
68000 -- [-153.783] (-149.842) (-149.757) (-150.803) * (-157.636) (-156.272) (-158.542) [-150.042] -- 0:02:44
68500 -- (-154.692) (-154.099) [-144.090] (-154.221) * (-150.718) [-149.937] (-149.279) (-156.404) -- 0:02:43
69000 -- (-151.417) [-146.257] (-155.418) (-146.408) * (-150.211) (-162.448) (-150.311) [-150.575] -- 0:02:41
69500 -- (-156.820) (-151.468) [-150.273] (-149.885) * (-156.032) [-162.004] (-152.569) (-156.124) -- 0:02:54
70000 -- (-150.173) (-151.995) [-148.121] (-156.013) * (-153.559) (-158.448) (-154.955) [-148.680] -- 0:02:52
Average standard deviation of split frequencies: 0.036848
70500 -- (-149.958) (-157.439) (-156.022) [-151.068] * (-152.645) (-163.553) [-141.838] (-150.987) -- 0:02:51
71000 -- (-151.670) (-149.917) [-153.391] (-150.628) * (-155.171) (-151.763) (-148.961) [-152.796] -- 0:02:50
71500 -- (-152.085) (-151.598) [-145.369] (-151.391) * [-147.729] (-158.824) (-144.693) (-156.297) -- 0:02:48
72000 -- (-145.030) (-150.416) (-155.882) [-153.264] * [-150.830] (-156.338) (-153.185) (-158.476) -- 0:02:47
72500 -- (-158.363) (-147.720) (-147.269) [-152.697] * [-148.983] (-151.416) (-154.315) (-152.442) -- 0:02:46
73000 -- (-156.637) (-143.214) [-147.856] (-159.079) * [-149.080] (-155.353) (-154.666) (-152.015) -- 0:02:45
73500 -- (-149.326) (-152.888) (-154.967) [-150.172] * [-155.004] (-156.648) (-159.128) (-155.551) -- 0:02:43
74000 -- [-153.249] (-152.512) (-150.573) (-150.846) * (-155.055) (-148.480) (-153.598) [-151.765] -- 0:02:42
74500 -- (-151.099) (-158.685) [-151.216] (-150.017) * [-158.892] (-155.281) (-151.087) (-156.223) -- 0:02:41
75000 -- (-148.953) [-146.711] (-148.259) (-156.588) * (-153.558) (-153.464) (-156.234) [-155.866] -- 0:02:52
Average standard deviation of split frequencies: 0.038025
75500 -- (-145.326) [-148.975] (-159.259) (-143.007) * [-149.677] (-149.688) (-153.218) (-152.740) -- 0:02:51
76000 -- (-144.180) (-155.306) (-153.404) [-147.255] * [-151.121] (-148.015) (-152.752) (-148.611) -- 0:02:50
76500 -- (-151.110) (-155.706) [-148.286] (-141.864) * (-146.420) (-151.534) (-160.564) [-146.635] -- 0:02:49
77000 -- [-150.815] (-157.149) (-158.710) (-143.879) * (-158.589) [-151.695] (-158.785) (-147.588) -- 0:02:47
77500 -- (-147.223) (-156.289) (-160.751) [-148.355] * (-153.546) (-153.396) (-153.564) [-142.471] -- 0:02:46
78000 -- [-145.041] (-160.236) (-164.630) (-152.668) * [-149.759] (-148.318) (-160.397) (-154.211) -- 0:02:45
78500 -- (-152.758) (-156.119) (-149.533) [-152.577] * (-152.315) [-153.459] (-160.089) (-159.742) -- 0:02:44
79000 -- (-148.258) [-148.550] (-166.390) (-151.976) * (-151.914) (-146.007) [-150.761] (-153.065) -- 0:02:43
79500 -- (-149.205) (-157.269) [-159.185] (-156.473) * [-149.252] (-153.018) (-152.370) (-153.675) -- 0:02:42
80000 -- (-154.761) (-155.609) [-152.135] (-148.953) * (-154.516) (-151.272) (-156.783) [-150.041] -- 0:02:41
Average standard deviation of split frequencies: 0.035648
80500 -- (-155.654) (-153.325) [-147.430] (-158.840) * (-152.911) [-156.217] (-156.243) (-155.103) -- 0:02:51
81000 -- [-155.161] (-155.989) (-154.772) (-165.617) * (-150.182) (-148.258) [-146.255] (-153.626) -- 0:02:50
81500 -- (-154.830) (-162.973) [-160.030] (-155.854) * (-155.228) (-145.551) [-145.295] (-154.593) -- 0:02:49
82000 -- (-150.545) (-145.350) [-153.276] (-154.127) * (-158.841) [-145.466] (-145.752) (-147.916) -- 0:02:47
82500 -- [-152.459] (-154.555) (-155.139) (-151.965) * (-155.305) (-147.884) [-150.634] (-148.844) -- 0:02:46
83000 -- (-159.366) (-154.698) (-158.997) [-149.059] * (-156.209) (-149.487) [-148.263] (-155.028) -- 0:02:45
83500 -- (-155.176) (-150.208) [-157.195] (-152.298) * (-150.271) [-150.030] (-157.710) (-156.523) -- 0:02:44
84000 -- (-157.555) (-154.872) (-159.157) [-153.414] * (-156.673) [-156.357] (-149.027) (-153.395) -- 0:02:43
84500 -- (-152.745) (-146.782) [-150.171] (-155.649) * (-150.472) (-161.200) (-154.116) [-145.899] -- 0:02:42
85000 -- [-144.285] (-151.147) (-155.468) (-150.768) * [-147.428] (-152.147) (-151.381) (-152.921) -- 0:02:41
Average standard deviation of split frequencies: 0.033345
85500 -- [-150.345] (-156.712) (-156.493) (-150.277) * (-155.454) (-154.572) (-158.065) [-154.128] -- 0:02:40
86000 -- (-152.094) (-158.302) (-162.263) [-155.764] * (-154.208) (-156.169) [-150.485] (-155.108) -- 0:02:50
86500 -- [-152.928] (-155.481) (-156.652) (-158.866) * (-152.958) (-153.733) [-147.515] (-159.668) -- 0:02:48
87000 -- (-155.513) [-155.231] (-149.087) (-152.478) * [-148.632] (-158.173) (-157.196) (-154.280) -- 0:02:47
87500 -- (-157.138) [-157.787] (-145.783) (-153.528) * [-148.430] (-156.950) (-157.225) (-158.230) -- 0:02:46
88000 -- (-151.436) (-151.288) [-145.067] (-154.685) * (-160.555) (-152.477) [-151.172] (-154.113) -- 0:02:45
88500 -- (-158.248) (-153.477) [-149.209] (-157.273) * [-155.317] (-157.824) (-147.426) (-160.119) -- 0:02:44
89000 -- (-154.096) (-152.504) (-154.729) [-148.769] * (-157.842) [-151.067] (-149.037) (-152.567) -- 0:02:43
89500 -- [-152.069] (-152.091) (-149.264) (-160.199) * (-154.435) (-158.092) [-145.236] (-147.343) -- 0:02:42
90000 -- (-155.873) [-146.671] (-152.492) (-153.886) * (-157.844) (-151.725) (-148.253) [-145.871] -- 0:02:41
Average standard deviation of split frequencies: 0.029958
90500 -- (-153.237) (-148.226) [-147.274] (-154.193) * (-157.677) (-156.925) (-157.709) [-143.853] -- 0:02:40
91000 -- (-149.362) (-154.023) [-147.179] (-153.631) * (-154.105) (-160.167) (-154.069) [-147.473] -- 0:02:39
91500 -- (-149.607) [-146.391] (-153.408) (-150.852) * (-154.715) (-161.448) [-148.654] (-148.353) -- 0:02:48
92000 -- (-156.090) [-147.179] (-154.431) (-146.155) * (-156.970) (-160.990) [-146.799] (-154.807) -- 0:02:47
92500 -- (-153.723) (-155.490) (-153.524) [-149.014] * (-158.898) (-150.787) (-154.264) [-152.589] -- 0:02:46
93000 -- [-155.291] (-153.296) (-158.228) (-156.656) * [-155.980] (-154.648) (-158.591) (-150.504) -- 0:02:45
93500 -- (-146.904) [-145.562] (-152.622) (-151.126) * (-155.119) (-154.230) (-151.197) [-148.985] -- 0:02:44
94000 -- (-148.049) (-152.152) [-151.595] (-152.752) * (-154.110) (-157.121) (-158.079) [-151.607] -- 0:02:43
94500 -- [-147.917] (-154.295) (-147.772) (-147.905) * (-153.200) [-156.033] (-156.862) (-157.081) -- 0:02:42
95000 -- (-154.075) [-151.576] (-150.567) (-150.111) * (-158.907) [-154.142] (-152.371) (-153.515) -- 0:02:41
Average standard deviation of split frequencies: 0.029686
95500 -- (-157.059) [-154.402] (-150.211) (-154.445) * (-157.037) (-157.930) (-155.970) [-148.438] -- 0:02:41
96000 -- [-149.561] (-149.257) (-147.287) (-152.375) * (-157.653) (-157.660) (-155.075) [-156.541] -- 0:02:40
96500 -- (-144.071) [-148.819] (-159.635) (-158.193) * (-164.305) (-160.469) [-152.464] (-157.013) -- 0:02:39
97000 -- (-144.030) [-148.734] (-159.547) (-155.774) * (-163.375) [-160.406] (-150.809) (-148.841) -- 0:02:47
97500 -- (-152.153) [-150.199] (-156.982) (-153.582) * (-149.553) (-157.408) (-147.257) [-155.773] -- 0:02:46
98000 -- (-158.711) [-145.114] (-158.158) (-150.757) * (-153.972) (-158.316) [-145.140] (-149.914) -- 0:02:45
98500 -- (-157.211) (-153.312) (-159.007) [-153.762] * (-152.134) [-149.982] (-157.638) (-151.764) -- 0:02:44
99000 -- (-155.046) [-149.351] (-155.074) (-153.483) * (-150.777) (-159.604) (-152.544) [-147.913] -- 0:02:43
99500 -- (-154.386) [-155.905] (-156.278) (-153.901) * (-160.552) [-147.072] (-148.974) (-149.148) -- 0:02:42
100000 -- (-155.318) [-155.064] (-153.881) (-153.785) * [-153.337] (-156.841) (-153.926) (-147.080) -- 0:02:42
Average standard deviation of split frequencies: 0.028766
100500 -- (-157.084) (-151.726) (-152.976) [-148.465] * (-150.618) [-161.772] (-155.633) (-157.663) -- 0:02:41
101000 -- [-149.821] (-152.997) (-149.800) (-148.717) * (-159.936) (-155.187) (-157.570) [-149.533] -- 0:02:40
101500 -- (-154.035) [-148.193] (-154.682) (-153.463) * (-159.373) (-150.573) (-151.430) [-157.688] -- 0:02:39
102000 -- (-147.741) [-145.146] (-153.802) (-152.210) * (-156.026) (-157.885) [-145.496] (-150.870) -- 0:02:47
102500 -- (-149.054) (-157.054) (-160.713) [-150.477] * (-157.607) (-162.375) (-144.878) [-150.456] -- 0:02:46
103000 -- [-149.772] (-156.620) (-161.136) (-156.472) * (-157.439) [-155.176] (-150.700) (-154.796) -- 0:02:45
103500 -- (-152.355) [-148.879] (-162.085) (-149.428) * (-157.217) (-155.112) [-143.735] (-153.867) -- 0:02:44
104000 -- [-147.829] (-156.021) (-156.815) (-147.098) * (-146.365) [-146.371] (-145.820) (-148.135) -- 0:02:43
104500 -- [-155.678] (-151.517) (-159.605) (-146.239) * [-153.563] (-149.827) (-148.280) (-148.345) -- 0:02:42
105000 -- (-154.446) (-143.248) (-155.293) [-145.425] * (-147.288) [-147.728] (-157.663) (-149.647) -- 0:02:41
Average standard deviation of split frequencies: 0.024258
105500 -- (-150.712) [-142.999] (-162.155) (-162.262) * (-152.973) (-148.575) [-148.340] (-150.195) -- 0:02:41
106000 -- [-151.239] (-155.459) (-152.106) (-151.039) * (-150.139) (-157.778) [-145.527] (-150.686) -- 0:02:40
106500 -- (-152.329) (-149.375) (-162.124) [-152.207] * (-150.008) (-161.320) [-148.988] (-152.120) -- 0:02:39
107000 -- (-152.917) (-151.082) [-159.962] (-154.463) * (-152.644) (-160.242) [-147.648] (-150.795) -- 0:02:38
107500 -- [-149.514] (-154.371) (-166.480) (-152.289) * [-148.970] (-163.053) (-145.271) (-150.385) -- 0:02:46
108000 -- (-153.915) (-147.715) (-160.698) [-161.606] * (-149.847) (-157.791) [-145.185] (-149.414) -- 0:02:45
108500 -- (-147.025) (-148.580) (-156.318) [-145.307] * (-148.405) (-157.595) [-147.969] (-150.103) -- 0:02:44
109000 -- [-152.221] (-148.360) (-164.190) (-152.318) * [-156.349] (-153.746) (-146.743) (-150.431) -- 0:02:43
109500 -- (-155.942) [-147.166] (-155.871) (-153.370) * [-148.424] (-155.803) (-149.554) (-157.175) -- 0:02:42
110000 -- (-158.958) [-154.872] (-159.335) (-153.256) * (-151.563) (-159.487) (-157.048) [-149.637] -- 0:02:41
Average standard deviation of split frequencies: 0.024493
110500 -- (-155.927) [-151.602] (-161.014) (-156.416) * [-153.861] (-154.786) (-155.831) (-151.169) -- 0:02:40
111000 -- (-157.899) [-154.912] (-157.687) (-147.180) * (-148.195) (-158.502) (-152.382) [-142.716] -- 0:02:40
111500 -- (-165.043) (-158.968) [-149.327] (-145.698) * (-152.723) (-158.522) (-159.770) [-148.121] -- 0:02:39
112000 -- (-156.486) [-151.458] (-146.878) (-153.515) * (-150.723) [-157.539] (-154.094) (-151.755) -- 0:02:38
112500 -- (-150.662) [-153.243] (-154.409) (-150.956) * [-148.938] (-158.059) (-158.003) (-158.017) -- 0:02:37
113000 -- [-147.277] (-155.349) (-156.392) (-154.373) * (-147.849) (-157.185) (-145.875) [-151.669] -- 0:02:44
113500 -- (-154.084) [-151.389] (-158.159) (-150.103) * (-148.827) [-160.271] (-154.983) (-154.300) -- 0:02:44
114000 -- (-155.166) (-152.029) [-148.096] (-157.354) * (-148.821) (-157.711) (-149.874) [-146.123] -- 0:02:43
114500 -- (-152.631) (-147.227) (-156.738) [-153.651] * [-156.439] (-158.034) (-153.597) (-145.417) -- 0:02:42
115000 -- (-156.812) (-148.099) (-155.539) [-147.752] * [-151.742] (-149.467) (-153.125) (-149.930) -- 0:02:41
Average standard deviation of split frequencies: 0.022125
115500 -- (-154.490) (-151.600) (-149.885) [-146.676] * (-151.119) (-149.671) [-150.365] (-152.383) -- 0:02:40
116000 -- (-155.885) (-155.925) (-156.383) [-147.806] * (-155.022) (-155.938) [-148.570] (-158.859) -- 0:02:40
116500 -- [-151.614] (-151.962) (-152.856) (-156.698) * (-151.036) (-157.897) [-146.985] (-150.375) -- 0:02:39
117000 -- (-147.502) [-145.292] (-146.675) (-154.769) * [-144.946] (-151.158) (-154.253) (-152.168) -- 0:02:38
117500 -- [-151.405] (-148.117) (-149.149) (-150.449) * (-145.109) [-150.936] (-152.566) (-151.918) -- 0:02:37
118000 -- (-144.811) (-150.295) [-149.812] (-153.849) * (-156.345) (-151.929) [-146.146] (-151.687) -- 0:02:36
118500 -- [-153.123] (-154.247) (-151.552) (-158.615) * (-156.669) (-156.894) (-147.281) [-150.089] -- 0:02:43
119000 -- (-159.407) (-153.941) [-149.352] (-153.050) * (-154.616) (-153.430) (-158.424) [-149.036] -- 0:02:42
119500 -- (-152.784) [-145.103] (-148.137) (-157.281) * (-148.017) (-150.021) (-151.577) [-149.784] -- 0:02:42
120000 -- (-151.629) [-145.472] (-149.031) (-146.938) * (-147.323) (-154.611) [-151.771] (-150.041) -- 0:02:41
Average standard deviation of split frequencies: 0.020954
120500 -- (-155.285) (-152.587) [-145.503] (-153.832) * [-147.767] (-162.218) (-148.155) (-149.993) -- 0:02:40
121000 -- (-155.361) (-151.091) (-157.094) [-152.619] * [-153.879] (-157.919) (-154.838) (-153.479) -- 0:02:39
121500 -- (-155.061) [-146.066] (-157.404) (-151.973) * [-153.387] (-156.223) (-163.833) (-157.222) -- 0:02:39
122000 -- [-152.003] (-153.644) (-150.151) (-158.311) * [-159.012] (-151.523) (-156.175) (-153.701) -- 0:02:38
122500 -- [-151.009] (-154.446) (-149.216) (-158.819) * (-151.263) [-152.097] (-149.171) (-151.817) -- 0:02:37
123000 -- (-149.972) (-155.532) [-142.694] (-153.126) * (-154.553) (-149.788) (-158.887) [-146.867] -- 0:02:36
123500 -- [-150.900] (-153.084) (-152.481) (-155.177) * (-156.852) (-156.289) (-156.559) [-147.179] -- 0:02:36
124000 -- (-148.838) (-156.733) [-144.014] (-156.389) * [-151.429] (-153.798) (-150.987) (-150.665) -- 0:02:42
124500 -- (-151.207) (-160.090) [-148.766] (-154.445) * (-156.941) (-152.998) (-152.473) [-144.367] -- 0:02:41
125000 -- (-154.324) (-150.242) [-146.539] (-159.057) * [-157.791] (-153.987) (-151.003) (-149.618) -- 0:02:41
Average standard deviation of split frequencies: 0.022278
125500 -- (-159.316) (-156.888) [-149.299] (-155.320) * (-152.804) (-153.594) (-156.056) [-148.216] -- 0:02:40
126000 -- (-156.689) (-151.943) (-148.725) [-150.549] * (-156.460) [-148.815] (-157.225) (-155.091) -- 0:02:39
126500 -- (-160.360) (-156.798) [-147.477] (-154.055) * (-157.176) (-149.347) (-154.331) [-149.750] -- 0:02:38
127000 -- [-147.735] (-145.423) (-149.345) (-158.323) * (-149.422) (-150.984) (-148.398) [-149.001] -- 0:02:38
127500 -- (-160.068) (-143.994) (-165.212) [-153.738] * [-149.165] (-155.547) (-156.397) (-144.719) -- 0:02:37
128000 -- (-149.829) (-147.285) (-152.003) [-155.612] * (-151.757) (-151.265) [-151.448] (-149.535) -- 0:02:36
128500 -- (-153.866) [-147.484] (-150.020) (-154.634) * [-142.289] (-152.174) (-152.438) (-150.405) -- 0:02:35
129000 -- (-154.796) [-145.260] (-152.722) (-155.504) * (-151.948) (-148.902) (-153.483) [-144.662] -- 0:02:35
129500 -- (-148.314) (-155.139) (-155.326) [-149.091] * (-148.944) (-148.209) (-158.535) [-149.241] -- 0:02:41
130000 -- [-158.672] (-151.177) (-152.283) (-153.588) * (-149.727) [-153.022] (-150.162) (-152.159) -- 0:02:40
Average standard deviation of split frequencies: 0.019764
130500 -- (-156.288) (-158.163) (-156.413) [-148.312] * (-158.281) (-158.274) [-151.074] (-156.475) -- 0:02:39
131000 -- [-152.120] (-154.443) (-151.627) (-145.905) * [-153.830] (-146.652) (-155.860) (-152.562) -- 0:02:39
131500 -- (-153.056) [-154.846] (-157.342) (-148.895) * (-155.929) (-147.285) [-152.079] (-155.730) -- 0:02:38
132000 -- (-157.838) [-143.935] (-151.945) (-153.208) * (-153.224) (-152.002) [-150.398] (-150.728) -- 0:02:37
132500 -- (-153.046) (-147.274) (-154.492) [-145.517] * (-159.960) (-155.142) [-155.391] (-156.146) -- 0:02:37
133000 -- (-158.510) (-151.412) (-157.394) [-152.278] * (-156.353) (-160.631) (-152.983) [-148.279] -- 0:02:36
133500 -- (-151.333) [-159.130] (-149.810) (-152.497) * (-159.808) (-154.283) (-155.786) [-145.592] -- 0:02:35
134000 -- (-158.760) (-158.445) [-152.424] (-151.980) * (-158.345) [-150.610] (-158.456) (-156.415) -- 0:02:35
134500 -- (-156.522) (-161.567) (-156.466) [-150.381] * [-147.877] (-158.537) (-153.483) (-152.505) -- 0:02:34
135000 -- (-161.001) [-158.758] (-157.971) (-152.810) * (-148.686) (-154.975) (-159.715) [-149.161] -- 0:02:40
Average standard deviation of split frequencies: 0.018198
135500 -- (-155.855) [-155.013] (-158.871) (-146.949) * [-145.691] (-150.927) (-156.963) (-150.726) -- 0:02:39
136000 -- [-154.630] (-150.666) (-150.513) (-153.597) * [-154.262] (-153.690) (-154.027) (-152.252) -- 0:02:38
136500 -- (-149.544) (-150.547) [-149.958] (-159.757) * (-150.483) [-151.053] (-149.652) (-155.744) -- 0:02:38
137000 -- (-157.186) (-160.401) (-152.751) [-153.898] * (-150.691) [-153.674] (-159.173) (-152.948) -- 0:02:37
137500 -- (-154.710) (-146.273) [-157.859] (-153.734) * (-152.063) (-158.343) (-155.279) [-149.289] -- 0:02:36
138000 -- (-169.803) [-144.960] (-155.630) (-155.522) * (-158.708) [-147.383] (-161.264) (-156.023) -- 0:02:36
138500 -- [-152.671] (-145.789) (-152.849) (-158.450) * (-150.165) [-154.116] (-147.207) (-154.017) -- 0:02:35
139000 -- (-155.979) [-144.161] (-156.604) (-158.224) * (-150.520) (-149.568) (-154.960) [-145.250] -- 0:02:34
139500 -- [-160.268] (-146.610) (-153.087) (-153.354) * [-149.125] (-154.836) (-158.421) (-146.429) -- 0:02:34
140000 -- (-153.016) [-146.606] (-152.216) (-151.250) * [-143.560] (-146.578) (-149.104) (-154.570) -- 0:02:39
Average standard deviation of split frequencies: 0.014841
140500 -- (-151.758) (-148.650) [-143.862] (-157.904) * (-154.086) [-149.313] (-148.182) (-153.836) -- 0:02:39
141000 -- [-158.739] (-149.818) (-146.706) (-150.437) * [-148.904] (-161.493) (-151.292) (-157.313) -- 0:02:38
141500 -- (-156.365) [-149.622] (-150.302) (-151.146) * [-153.212] (-151.204) (-147.193) (-162.353) -- 0:02:37
142000 -- (-151.387) [-148.168] (-144.364) (-154.902) * [-154.750] (-149.992) (-164.482) (-159.671) -- 0:02:37
142500 -- (-153.234) (-146.509) [-147.490] (-157.516) * (-153.789) [-157.262] (-154.143) (-153.372) -- 0:02:36
143000 -- (-154.283) [-150.687] (-153.089) (-158.522) * (-154.950) [-154.390] (-151.928) (-152.046) -- 0:02:35
143500 -- [-151.816] (-152.550) (-152.250) (-151.272) * (-157.422) [-152.624] (-153.166) (-159.090) -- 0:02:35
144000 -- (-150.645) (-152.211) [-148.700] (-155.026) * [-151.990] (-150.967) (-152.869) (-146.806) -- 0:02:34
144500 -- (-157.789) (-145.564) [-141.326] (-160.203) * (-151.202) (-156.913) [-150.014] (-148.856) -- 0:02:33
145000 -- (-158.393) (-156.205) (-148.849) [-159.729] * (-154.555) (-158.499) [-152.824] (-151.241) -- 0:02:33
Average standard deviation of split frequencies: 0.015221
145500 -- (-156.693) (-154.485) [-145.833] (-155.349) * (-156.576) (-143.802) (-156.420) [-149.452] -- 0:02:38
146000 -- [-150.671] (-147.038) (-153.063) (-155.466) * (-152.663) (-143.470) (-147.806) [-144.011] -- 0:02:37
146500 -- (-148.330) [-148.513] (-155.558) (-151.729) * (-155.738) (-153.413) [-144.354] (-149.856) -- 0:02:37
147000 -- [-144.854] (-146.928) (-147.116) (-154.432) * (-155.041) (-148.660) (-156.758) [-150.291] -- 0:02:36
147500 -- (-150.815) [-143.825] (-148.194) (-155.285) * (-148.587) [-152.494] (-153.196) (-153.921) -- 0:02:36
148000 -- [-146.336] (-156.531) (-151.506) (-157.122) * (-154.858) [-146.496] (-157.957) (-145.534) -- 0:02:35
148500 -- [-148.752] (-155.235) (-153.677) (-145.896) * (-152.276) (-151.409) (-154.372) [-147.242] -- 0:02:34
149000 -- (-154.040) (-152.165) [-151.533] (-153.731) * (-153.229) [-143.059] (-154.495) (-149.136) -- 0:02:34
149500 -- (-147.636) [-148.395] (-146.631) (-158.906) * (-150.519) [-149.050] (-149.299) (-156.037) -- 0:02:33
150000 -- (-161.152) (-158.626) [-155.752] (-153.848) * [-145.808] (-156.650) (-147.656) (-157.656) -- 0:02:33
Average standard deviation of split frequencies: 0.015809
150500 -- (-155.149) (-148.936) [-147.042] (-148.913) * (-154.690) (-146.865) (-147.050) [-146.272] -- 0:02:32
151000 -- (-159.530) [-146.933] (-155.321) (-148.772) * (-156.865) (-147.039) (-145.076) [-146.341] -- 0:02:37
151500 -- (-154.919) [-152.264] (-163.058) (-151.078) * [-157.943] (-156.761) (-146.989) (-147.891) -- 0:02:36
152000 -- [-149.933] (-153.996) (-152.634) (-151.467) * (-159.242) (-150.152) [-143.106] (-147.517) -- 0:02:36
152500 -- (-153.076) [-149.246] (-145.153) (-151.742) * (-154.113) (-157.796) [-146.741] (-154.310) -- 0:02:35
153000 -- (-162.152) (-148.417) [-149.281] (-160.444) * (-147.358) (-153.811) (-150.972) [-146.378] -- 0:02:35
153500 -- [-152.360] (-157.319) (-151.871) (-152.861) * (-149.029) [-158.215] (-149.220) (-160.031) -- 0:02:34
154000 -- (-153.420) (-152.423) [-150.882] (-161.230) * [-156.178] (-152.685) (-148.410) (-146.316) -- 0:02:33
154500 -- (-148.258) (-150.804) [-153.402] (-158.158) * (-155.183) (-152.666) [-149.785] (-149.696) -- 0:02:33
155000 -- (-152.398) (-152.661) [-151.222] (-148.563) * (-156.482) [-155.701] (-152.563) (-152.715) -- 0:02:32
Average standard deviation of split frequencies: 0.016922
155500 -- (-146.812) (-154.820) [-151.252] (-155.673) * (-151.804) [-156.370] (-152.725) (-146.396) -- 0:02:32
156000 -- (-146.872) (-150.664) [-146.222] (-159.571) * (-156.239) (-156.706) [-149.683] (-151.223) -- 0:02:31
156500 -- (-152.926) [-150.917] (-153.545) (-157.461) * (-162.422) (-147.906) [-149.621] (-147.941) -- 0:02:36
157000 -- [-149.059] (-154.083) (-156.485) (-159.251) * [-155.182] (-151.613) (-147.711) (-156.428) -- 0:02:35
157500 -- (-151.467) (-154.207) (-157.321) [-155.311] * (-149.657) (-156.983) [-151.538] (-155.187) -- 0:02:35
158000 -- (-156.289) (-153.683) [-150.028] (-156.662) * (-161.128) (-152.881) [-147.080] (-143.566) -- 0:02:34
158500 -- (-152.206) (-158.815) (-156.756) [-148.834] * [-153.580] (-159.463) (-151.086) (-148.547) -- 0:02:33
159000 -- (-156.156) (-156.373) (-159.879) [-148.372] * [-152.134] (-160.752) (-148.175) (-150.177) -- 0:02:33
159500 -- (-158.501) [-150.734] (-151.592) (-152.314) * (-163.764) (-160.046) (-145.218) [-147.072] -- 0:02:32
160000 -- (-150.909) [-155.012] (-152.770) (-160.809) * (-152.699) (-153.077) (-151.056) [-147.486] -- 0:02:32
Average standard deviation of split frequencies: 0.018531
160500 -- [-151.978] (-151.496) (-145.467) (-167.775) * (-151.558) (-147.935) [-150.095] (-149.532) -- 0:02:31
161000 -- [-155.647] (-158.007) (-154.834) (-157.415) * (-162.685) (-160.780) (-154.550) [-155.702] -- 0:02:31
161500 -- (-148.624) (-149.340) [-149.355] (-148.919) * (-163.511) (-165.743) [-155.483] (-157.340) -- 0:02:30
162000 -- [-153.809] (-156.119) (-151.450) (-154.347) * (-157.594) (-159.119) (-153.514) [-156.005] -- 0:02:35
162500 -- (-151.394) (-150.740) [-147.663] (-156.045) * (-158.055) (-154.164) [-156.013] (-157.597) -- 0:02:34
163000 -- (-155.888) (-159.585) [-146.518] (-156.827) * (-163.564) [-154.015] (-157.560) (-164.226) -- 0:02:34
163500 -- (-152.885) (-158.594) (-154.338) [-146.606] * (-156.610) (-151.974) [-150.407] (-153.482) -- 0:02:33
164000 -- [-147.672] (-153.968) (-161.143) (-147.725) * [-152.584] (-150.974) (-152.024) (-158.361) -- 0:02:32
164500 -- (-165.027) [-159.731] (-153.187) (-153.980) * (-158.817) (-156.013) [-145.268] (-156.157) -- 0:02:32
165000 -- (-158.943) (-157.605) (-151.161) [-148.663] * [-148.789] (-156.867) (-143.890) (-148.799) -- 0:02:31
Average standard deviation of split frequencies: 0.018234
165500 -- (-157.729) [-147.681] (-149.423) (-147.442) * (-151.083) (-153.339) [-150.057] (-159.337) -- 0:02:31
166000 -- (-150.734) (-149.784) [-150.664] (-151.149) * (-157.899) [-147.111] (-152.638) (-147.518) -- 0:02:30
166500 -- (-158.520) (-147.762) [-145.876] (-146.360) * (-157.622) (-148.712) [-147.774] (-150.304) -- 0:02:30
167000 -- [-150.683] (-152.451) (-151.897) (-149.274) * [-157.145] (-143.442) (-159.075) (-149.406) -- 0:02:29
167500 -- (-154.950) (-155.484) [-149.938] (-149.583) * [-155.097] (-148.214) (-149.228) (-149.565) -- 0:02:34
168000 -- (-159.308) (-153.121) (-150.831) [-145.619] * (-153.574) (-151.972) (-153.613) [-153.451] -- 0:02:33
168500 -- (-151.200) (-149.235) (-157.038) [-150.873] * (-158.493) (-152.295) (-145.141) [-153.670] -- 0:02:32
169000 -- (-161.738) (-153.890) [-148.511] (-145.353) * (-163.154) [-152.686] (-153.563) (-153.548) -- 0:02:32
169500 -- (-152.450) [-153.643] (-157.722) (-146.838) * (-152.361) [-152.423] (-151.917) (-152.903) -- 0:02:31
170000 -- (-148.540) (-160.179) (-154.778) [-151.662] * [-156.381] (-147.535) (-153.767) (-157.847) -- 0:02:31
Average standard deviation of split frequencies: 0.017954
170500 -- (-149.665) (-152.154) (-145.814) [-153.555] * (-162.190) (-154.337) [-151.169] (-153.518) -- 0:02:30
171000 -- (-154.321) (-156.132) (-152.194) [-150.032] * (-155.208) (-159.939) [-145.071] (-160.738) -- 0:02:30
171500 -- (-157.944) (-151.958) [-147.328] (-146.863) * [-157.289] (-160.016) (-149.403) (-155.782) -- 0:02:29
172000 -- (-151.392) [-149.374] (-161.702) (-152.158) * (-159.114) [-153.725] (-159.263) (-150.513) -- 0:02:29
172500 -- (-153.672) (-154.921) (-153.158) [-148.586] * (-151.306) (-147.090) [-154.171] (-146.773) -- 0:02:33
173000 -- [-152.461] (-151.718) (-159.737) (-150.518) * (-149.592) (-148.076) (-152.258) [-146.685] -- 0:02:32
173500 -- (-152.519) (-151.937) (-149.010) [-155.441] * (-159.090) (-156.453) [-152.288] (-158.674) -- 0:02:32
174000 -- (-150.927) (-145.874) [-147.840] (-153.067) * (-154.263) (-149.399) (-152.271) [-146.719] -- 0:02:31
174500 -- [-152.504] (-149.700) (-150.511) (-155.878) * (-147.816) (-148.581) (-157.746) [-145.275] -- 0:02:31
175000 -- (-152.918) [-143.356] (-147.258) (-154.018) * (-151.591) (-150.141) [-150.777] (-146.752) -- 0:02:30
Average standard deviation of split frequencies: 0.018079
175500 -- (-151.113) [-145.146] (-148.999) (-155.396) * (-151.358) (-155.187) [-150.807] (-149.212) -- 0:02:30
176000 -- [-152.128] (-145.614) (-158.606) (-157.552) * (-155.580) (-155.477) (-150.778) [-151.888] -- 0:02:29
176500 -- (-159.324) (-152.671) (-151.442) [-153.787] * (-155.818) (-157.758) (-147.831) [-155.698] -- 0:02:29
177000 -- (-159.458) [-150.363] (-151.718) (-160.497) * (-155.035) (-156.390) [-151.750] (-156.450) -- 0:02:28
177500 -- (-153.985) [-149.218] (-148.168) (-160.619) * (-151.017) (-163.408) (-151.526) [-155.327] -- 0:02:28
178000 -- (-154.278) (-148.816) [-149.797] (-150.530) * (-157.548) [-158.514] (-150.167) (-158.026) -- 0:02:32
178500 -- (-155.699) [-148.738] (-156.667) (-148.653) * [-151.639] (-155.694) (-154.125) (-151.720) -- 0:02:31
179000 -- (-148.332) (-145.794) [-149.449] (-148.867) * (-153.760) (-152.400) (-157.608) [-145.949] -- 0:02:31
179500 -- (-160.321) (-154.902) (-147.738) [-159.783] * (-160.743) [-158.292] (-150.561) (-148.275) -- 0:02:30
180000 -- (-154.845) [-151.532] (-153.220) (-150.590) * (-157.466) (-163.676) [-149.694] (-145.673) -- 0:02:30
Average standard deviation of split frequencies: 0.018526
180500 -- [-158.182] (-148.770) (-148.465) (-147.350) * (-162.560) (-163.077) [-143.609] (-146.421) -- 0:02:29
181000 -- (-165.439) (-149.440) [-145.348] (-146.171) * (-151.320) (-166.301) (-150.594) [-149.829] -- 0:02:29
181500 -- (-155.288) (-155.674) [-148.134] (-148.580) * (-159.473) [-163.724] (-149.735) (-156.720) -- 0:02:28
182000 -- (-160.987) (-159.524) (-157.842) [-154.841] * (-156.280) (-164.619) [-150.627] (-150.124) -- 0:02:28
182500 -- [-155.315] (-151.040) (-151.448) (-153.205) * (-156.465) (-159.398) [-143.083] (-152.219) -- 0:02:27
183000 -- (-158.492) [-148.698] (-156.108) (-151.728) * (-163.323) (-160.510) (-155.641) [-153.086] -- 0:02:27
183500 -- [-153.339] (-150.293) (-159.290) (-151.304) * (-163.876) (-153.328) (-152.432) [-148.481] -- 0:02:31
184000 -- (-157.695) [-149.229] (-156.685) (-152.278) * (-153.243) (-152.417) (-146.547) [-146.342] -- 0:02:30
184500 -- (-155.129) (-153.174) (-150.854) [-152.793] * (-156.533) (-153.430) (-153.930) [-150.758] -- 0:02:30
185000 -- (-157.860) [-152.516] (-153.785) (-161.035) * (-152.244) (-152.796) [-149.435] (-163.470) -- 0:02:29
Average standard deviation of split frequencies: 0.018344
185500 -- [-158.157] (-149.122) (-151.390) (-161.007) * (-161.705) (-155.646) [-143.361] (-156.001) -- 0:02:29
186000 -- (-160.346) [-149.528] (-150.839) (-157.160) * (-156.871) (-161.137) (-153.600) [-145.966] -- 0:02:28
186500 -- [-150.717] (-154.212) (-149.262) (-163.386) * (-152.275) (-162.001) (-149.980) [-146.305] -- 0:02:28
187000 -- (-150.221) [-149.892] (-154.107) (-153.994) * (-150.146) (-158.281) (-144.288) [-144.472] -- 0:02:27
187500 -- (-155.172) [-149.170] (-155.903) (-157.329) * (-158.070) (-159.682) (-161.576) [-145.152] -- 0:02:27
188000 -- (-160.554) (-153.432) (-154.061) [-149.135] * (-153.718) [-156.924] (-146.957) (-152.557) -- 0:02:26
188500 -- (-152.657) (-151.331) [-146.254] (-157.051) * (-147.618) (-159.081) (-151.253) [-146.078] -- 0:02:26
189000 -- (-151.631) (-151.600) (-162.173) [-151.819] * (-159.755) (-159.710) [-147.465] (-148.451) -- 0:02:30
189500 -- [-151.091] (-153.596) (-146.191) (-156.596) * [-154.715] (-162.855) (-152.113) (-152.465) -- 0:02:29
190000 -- (-153.091) (-161.293) [-149.904] (-153.243) * (-158.340) (-155.124) (-151.461) [-144.134] -- 0:02:29
Average standard deviation of split frequencies: 0.017307
190500 -- (-155.838) (-155.360) [-150.520] (-149.943) * (-161.028) (-150.922) [-158.924] (-154.294) -- 0:02:28
191000 -- [-149.925] (-147.770) (-160.295) (-150.122) * (-158.481) (-157.095) [-164.617] (-149.245) -- 0:02:28
191500 -- (-152.569) (-148.336) (-156.106) [-148.938] * (-160.227) [-144.566] (-159.134) (-147.836) -- 0:02:27
192000 -- (-158.044) (-151.898) [-150.579] (-150.708) * (-155.456) [-153.213] (-156.703) (-150.515) -- 0:02:27
192500 -- (-161.098) (-151.462) (-155.636) [-150.606] * (-159.697) (-150.710) (-152.571) [-148.619] -- 0:02:26
193000 -- [-156.498] (-156.048) (-157.210) (-153.938) * (-149.136) [-150.200] (-150.217) (-148.757) -- 0:02:26
193500 -- (-156.919) (-157.608) [-154.044] (-152.461) * (-155.290) [-143.970] (-149.203) (-149.563) -- 0:02:25
194000 -- (-154.351) [-156.794] (-153.927) (-149.604) * (-158.698) (-154.497) [-152.132] (-144.249) -- 0:02:25
194500 -- [-154.048] (-153.538) (-147.434) (-155.519) * (-149.269) [-148.038] (-154.841) (-147.739) -- 0:02:29
195000 -- (-151.082) [-148.782] (-147.971) (-157.109) * [-151.301] (-150.800) (-162.905) (-145.272) -- 0:02:28
Average standard deviation of split frequencies: 0.017638
195500 -- (-149.063) [-143.449] (-151.693) (-153.493) * [-151.472] (-152.298) (-155.849) (-153.515) -- 0:02:28
196000 -- (-151.668) (-145.712) (-152.553) [-154.696] * (-157.281) (-150.242) (-149.069) [-148.858] -- 0:02:27
196500 -- (-156.381) [-147.699] (-149.966) (-149.009) * (-148.750) [-148.092] (-152.821) (-150.244) -- 0:02:27
197000 -- (-155.644) [-156.548] (-151.975) (-153.082) * (-161.931) [-149.539] (-155.388) (-151.680) -- 0:02:26
197500 -- (-149.596) (-150.443) (-156.211) [-153.837] * (-155.114) [-157.793] (-153.481) (-155.628) -- 0:02:26
198000 -- (-151.521) [-148.396] (-153.929) (-162.546) * (-156.389) [-158.120] (-159.775) (-150.661) -- 0:02:25
198500 -- [-150.975] (-146.846) (-149.672) (-152.479) * (-154.814) [-154.440] (-157.626) (-149.202) -- 0:02:25
199000 -- (-154.514) (-158.778) [-148.382] (-156.256) * (-160.927) (-145.069) (-162.205) [-151.348] -- 0:02:24
199500 -- (-158.802) (-148.805) (-158.573) [-147.153] * (-156.302) (-148.653) (-152.743) [-146.206] -- 0:02:28
200000 -- [-150.572] (-147.078) (-152.116) (-150.596) * (-147.581) (-150.993) [-148.934] (-149.879) -- 0:02:28
Average standard deviation of split frequencies: 0.018141
200500 -- (-156.442) (-142.981) (-160.782) [-147.854] * (-160.026) (-149.977) (-151.296) [-151.819] -- 0:02:27
201000 -- (-162.571) [-148.582] (-165.547) (-143.503) * [-156.515] (-153.887) (-156.639) (-158.222) -- 0:02:27
201500 -- (-164.551) (-152.582) (-157.375) [-149.614] * [-149.924] (-163.289) (-154.785) (-153.769) -- 0:02:26
202000 -- (-156.814) [-153.603] (-160.248) (-156.303) * (-157.406) (-152.272) [-150.194] (-152.122) -- 0:02:26
202500 -- [-157.699] (-149.047) (-159.251) (-151.802) * [-159.364] (-153.556) (-147.865) (-154.906) -- 0:02:25
203000 -- (-153.714) (-148.172) (-157.604) [-157.029] * (-156.503) [-156.089] (-147.604) (-156.675) -- 0:02:25
203500 -- (-144.203) [-147.541] (-157.967) (-156.302) * [-153.083] (-150.590) (-151.109) (-155.725) -- 0:02:24
204000 -- (-150.556) (-150.262) (-156.455) [-148.619] * (-153.930) (-157.026) [-150.585] (-157.440) -- 0:02:24
204500 -- (-152.993) (-155.435) (-155.352) [-156.009] * (-149.462) (-152.658) [-149.990] (-161.305) -- 0:02:23
205000 -- [-148.766] (-145.302) (-160.253) (-158.104) * (-149.239) (-155.166) [-151.269] (-162.152) -- 0:02:27
Average standard deviation of split frequencies: 0.017217
205500 -- (-153.673) (-147.128) (-157.808) [-145.112] * (-157.421) [-148.578] (-148.948) (-154.111) -- 0:02:26
206000 -- (-151.413) (-156.026) [-156.616] (-150.468) * (-150.652) (-162.238) (-152.823) [-146.645] -- 0:02:26
206500 -- (-159.342) (-149.468) (-154.149) [-159.406] * (-155.090) (-153.380) (-156.845) [-152.718] -- 0:02:26
207000 -- [-147.186] (-149.737) (-152.755) (-159.179) * (-156.911) (-155.055) (-154.838) [-150.722] -- 0:02:25
207500 -- (-155.000) [-146.242] (-151.792) (-154.212) * (-154.197) [-148.775] (-156.482) (-152.270) -- 0:02:25
208000 -- (-145.020) (-150.205) [-150.766] (-157.258) * (-150.839) (-158.647) [-151.621] (-146.999) -- 0:02:24
208500 -- [-148.977] (-150.569) (-154.618) (-151.225) * [-153.427] (-147.944) (-151.860) (-155.389) -- 0:02:24
209000 -- (-150.665) (-154.867) (-156.086) [-156.434] * [-159.862] (-149.147) (-155.948) (-164.474) -- 0:02:23
209500 -- (-146.955) (-151.223) (-155.116) [-151.192] * (-160.018) [-150.564] (-157.949) (-159.533) -- 0:02:23
210000 -- [-145.475] (-159.731) (-158.593) (-151.326) * (-159.687) [-149.525] (-161.727) (-153.367) -- 0:02:22
Average standard deviation of split frequencies: 0.018125
210500 -- (-149.770) [-153.700] (-160.175) (-157.403) * (-155.765) [-155.676] (-150.535) (-156.450) -- 0:02:26
211000 -- (-152.988) (-156.229) [-152.485] (-157.421) * (-161.937) [-155.349] (-146.693) (-159.886) -- 0:02:25
211500 -- (-151.006) (-161.221) [-155.306] (-157.191) * (-156.163) (-152.048) (-147.542) [-150.700] -- 0:02:25
212000 -- [-147.360] (-161.992) (-156.359) (-158.462) * (-157.061) (-148.836) (-154.880) [-150.356] -- 0:02:24
212500 -- [-150.513] (-154.998) (-154.804) (-162.945) * (-153.684) (-161.274) (-154.328) [-146.821] -- 0:02:24
213000 -- [-150.750] (-154.507) (-150.773) (-156.788) * (-154.110) (-154.770) (-153.022) [-152.877] -- 0:02:24
213500 -- (-144.674) [-152.253] (-154.198) (-159.215) * (-149.413) (-151.572) (-150.022) [-154.899] -- 0:02:23
214000 -- (-152.432) [-146.679] (-152.716) (-151.896) * (-147.029) (-152.215) (-148.555) [-146.027] -- 0:02:23
214500 -- [-149.194] (-158.631) (-147.814) (-151.748) * (-151.814) (-148.389) [-152.325] (-146.524) -- 0:02:22
215000 -- (-147.873) (-156.278) [-153.851] (-161.985) * [-154.569] (-153.722) (-159.188) (-146.009) -- 0:02:22
Average standard deviation of split frequencies: 0.019205
215500 -- (-151.494) (-155.650) [-148.296] (-154.123) * [-154.995] (-158.263) (-148.118) (-147.022) -- 0:02:21
216000 -- [-154.289] (-153.172) (-150.825) (-152.457) * [-145.893] (-151.919) (-161.190) (-151.001) -- 0:02:25
216500 -- (-158.190) [-151.805] (-159.186) (-155.082) * (-147.461) [-155.407] (-156.255) (-154.928) -- 0:02:24
217000 -- (-147.450) (-153.865) (-156.244) [-151.583] * (-151.724) (-159.282) [-144.689] (-148.509) -- 0:02:24
217500 -- (-156.499) [-147.654] (-153.734) (-154.218) * (-147.110) [-147.571] (-153.564) (-152.005) -- 0:02:23
218000 -- (-161.867) [-148.324] (-146.043) (-152.298) * (-154.494) (-145.601) [-153.490] (-155.639) -- 0:02:23
218500 -- [-152.185] (-152.467) (-156.622) (-154.746) * (-147.828) [-154.992] (-157.932) (-143.809) -- 0:02:23
219000 -- (-156.462) [-148.471] (-159.685) (-160.845) * (-146.370) [-156.249] (-153.371) (-154.790) -- 0:02:22
219500 -- (-155.025) (-151.866) (-155.702) [-162.992] * (-157.294) (-150.503) [-148.917] (-155.692) -- 0:02:22
220000 -- (-157.012) [-150.973] (-155.349) (-155.533) * [-151.735] (-155.544) (-157.454) (-147.546) -- 0:02:21
Average standard deviation of split frequencies: 0.018989
220500 -- (-155.566) (-146.847) (-162.185) [-150.885] * (-152.065) (-154.295) [-150.556] (-146.445) -- 0:02:21
221000 -- (-159.192) (-151.467) (-158.245) [-158.495] * (-153.328) [-149.410] (-158.090) (-148.799) -- 0:02:20
221500 -- (-158.505) (-162.117) (-151.044) [-153.103] * (-148.460) (-154.060) [-151.146] (-148.869) -- 0:02:24
222000 -- (-152.305) (-163.932) [-160.074] (-152.797) * (-151.215) [-153.284] (-149.820) (-152.944) -- 0:02:23
222500 -- (-149.936) (-154.586) [-151.917] (-160.911) * [-149.411] (-151.557) (-152.683) (-154.006) -- 0:02:23
223000 -- (-157.356) (-152.819) [-147.994] (-158.725) * (-145.815) (-152.449) [-145.928] (-156.437) -- 0:02:22
223500 -- (-153.737) [-162.468] (-151.465) (-152.704) * [-147.425] (-163.654) (-150.765) (-148.379) -- 0:02:22
224000 -- (-153.465) (-159.682) [-152.456] (-156.324) * (-152.197) (-155.278) (-154.230) [-153.656] -- 0:02:22
224500 -- (-155.003) (-154.714) [-148.255] (-162.994) * (-151.380) (-149.608) [-150.212] (-151.019) -- 0:02:21
225000 -- [-151.439] (-155.559) (-154.530) (-150.107) * (-152.174) [-144.804] (-149.049) (-151.073) -- 0:02:21
Average standard deviation of split frequencies: 0.018043
225500 -- [-152.382] (-156.892) (-157.847) (-154.324) * (-149.231) (-151.066) (-147.899) [-150.569] -- 0:02:20
226000 -- (-153.938) [-152.697] (-150.139) (-158.089) * (-162.332) (-157.375) [-145.373] (-154.259) -- 0:02:20
226500 -- (-149.267) (-160.144) [-149.141] (-159.418) * (-159.006) (-153.196) [-144.150] (-151.130) -- 0:02:20
227000 -- [-156.844] (-157.439) (-152.610) (-154.913) * (-157.663) [-158.203] (-150.572) (-154.370) -- 0:02:23
227500 -- (-164.129) (-150.945) [-152.430] (-155.650) * [-148.471] (-153.656) (-146.836) (-152.920) -- 0:02:22
228000 -- (-147.102) (-163.845) [-147.477] (-155.485) * (-156.063) (-159.934) [-151.057] (-148.743) -- 0:02:22
228500 -- (-157.878) (-156.728) [-151.016] (-151.911) * [-153.445] (-153.216) (-148.976) (-150.179) -- 0:02:21
229000 -- (-147.232) [-148.688] (-153.212) (-158.528) * (-159.686) (-150.873) [-150.198] (-159.017) -- 0:02:21
229500 -- [-147.435] (-153.348) (-164.367) (-159.157) * (-156.719) (-157.096) [-148.841] (-150.133) -- 0:02:21
230000 -- (-152.954) (-155.746) (-160.847) [-152.598] * [-149.433] (-156.905) (-156.811) (-157.863) -- 0:02:20
Average standard deviation of split frequencies: 0.020006
230500 -- (-153.330) (-157.738) (-150.176) [-156.126] * (-154.964) [-152.883] (-146.655) (-154.987) -- 0:02:20
231000 -- (-152.192) (-157.580) (-151.821) [-157.940] * (-148.043) [-149.893] (-152.667) (-155.716) -- 0:02:19
231500 -- (-152.212) [-148.417] (-157.335) (-154.718) * [-148.058] (-153.581) (-153.910) (-153.284) -- 0:02:19
232000 -- (-152.121) [-163.390] (-156.814) (-154.071) * (-149.732) (-147.674) (-148.243) [-151.784] -- 0:02:22
232500 -- (-155.793) (-154.234) [-151.738] (-159.880) * (-151.073) [-154.706] (-156.501) (-151.529) -- 0:02:21
233000 -- (-158.065) (-153.511) (-160.947) [-153.289] * [-143.111] (-151.546) (-152.325) (-153.651) -- 0:02:21
233500 -- (-158.950) (-154.167) [-155.764] (-162.702) * (-147.267) [-152.104] (-149.500) (-155.696) -- 0:02:21
234000 -- (-156.718) [-157.570] (-153.008) (-153.374) * (-151.418) (-156.225) [-145.643] (-154.706) -- 0:02:20
234500 -- (-148.682) [-154.795] (-153.940) (-151.920) * [-151.791] (-151.298) (-149.463) (-159.760) -- 0:02:20
235000 -- (-154.381) (-159.983) (-149.783) [-147.108] * (-151.156) (-157.994) [-149.219] (-151.930) -- 0:02:19
Average standard deviation of split frequencies: 0.019309
235500 -- (-146.746) (-159.820) (-153.635) [-156.662] * (-150.442) [-151.738] (-146.458) (-155.266) -- 0:02:19
236000 -- (-153.026) (-161.971) [-153.489] (-153.325) * (-149.350) (-149.516) [-147.737] (-154.238) -- 0:02:19
236500 -- (-154.542) (-162.606) (-154.807) [-146.865] * (-149.414) (-149.618) (-147.521) [-154.491] -- 0:02:18
237000 -- [-153.698] (-163.600) (-155.646) (-151.743) * (-147.426) [-147.804] (-150.173) (-149.622) -- 0:02:18
237500 -- (-160.921) [-156.074] (-156.168) (-152.831) * (-159.802) (-153.255) [-147.990] (-156.384) -- 0:02:21
238000 -- (-158.629) (-151.950) (-154.870) [-147.850] * (-154.017) (-155.509) [-149.849] (-152.719) -- 0:02:20
238500 -- [-148.901] (-157.202) (-152.758) (-151.834) * (-155.114) (-154.906) (-154.858) [-147.410] -- 0:02:20
239000 -- (-151.059) (-148.551) (-157.376) [-146.964] * [-157.929] (-151.869) (-149.263) (-146.946) -- 0:02:20
239500 -- (-147.076) (-157.637) (-147.597) [-150.436] * (-161.092) (-156.665) [-155.689] (-156.538) -- 0:02:19
240000 -- (-146.797) [-154.948] (-150.416) (-150.261) * [-149.996] (-155.375) (-150.516) (-146.259) -- 0:02:19
Average standard deviation of split frequencies: 0.018608
240500 -- (-151.597) (-153.882) [-146.484] (-159.169) * [-156.520] (-153.958) (-150.287) (-150.765) -- 0:02:18
241000 -- (-145.429) (-155.822) [-147.230] (-152.045) * (-145.865) (-154.555) (-155.752) [-151.830] -- 0:02:18
241500 -- (-153.310) (-158.475) [-146.049] (-154.210) * (-151.558) (-152.162) [-151.928] (-152.575) -- 0:02:18
242000 -- (-159.619) (-160.744) [-146.873] (-158.597) * (-155.262) [-155.060] (-157.066) (-147.404) -- 0:02:17
242500 -- (-156.118) (-156.106) [-145.902] (-153.328) * (-155.185) (-153.350) [-151.080] (-154.752) -- 0:02:17
243000 -- (-155.805) (-160.516) [-146.798] (-153.395) * (-145.947) [-152.371] (-152.737) (-156.749) -- 0:02:20
243500 -- (-151.093) (-146.384) (-157.768) [-149.094] * [-148.697] (-151.435) (-148.147) (-155.220) -- 0:02:19
244000 -- (-158.681) (-149.836) (-155.485) [-153.467] * (-157.875) (-152.615) [-148.123] (-160.562) -- 0:02:19
244500 -- (-151.809) (-151.822) [-149.704] (-156.360) * (-149.862) (-159.361) [-150.002] (-152.175) -- 0:02:19
245000 -- [-148.189] (-159.167) (-153.546) (-154.310) * [-151.108] (-155.688) (-154.631) (-147.900) -- 0:02:18
Average standard deviation of split frequencies: 0.019354
245500 -- (-156.764) (-151.738) [-148.071] (-161.227) * [-146.258] (-163.248) (-154.666) (-145.534) -- 0:02:18
246000 -- (-152.949) (-156.233) [-156.312] (-157.610) * (-152.268) (-153.797) (-157.227) [-146.910] -- 0:02:17
246500 -- (-148.077) (-158.368) (-161.142) [-149.438] * (-154.373) (-157.819) [-149.632] (-145.725) -- 0:02:17
247000 -- (-157.533) (-150.659) (-155.840) [-144.250] * (-158.462) (-157.328) [-153.457] (-146.554) -- 0:02:17
247500 -- (-162.284) (-155.283) (-149.808) [-146.507] * (-149.440) (-160.694) [-149.794] (-147.296) -- 0:02:16
248000 -- [-148.831] (-154.992) (-150.022) (-152.980) * [-154.756] (-157.307) (-150.385) (-150.521) -- 0:02:16
248500 -- [-149.436] (-147.650) (-152.370) (-155.755) * (-160.197) (-151.313) [-147.160] (-151.047) -- 0:02:19
249000 -- (-154.210) [-149.473] (-158.360) (-155.069) * [-144.333] (-158.541) (-153.547) (-146.251) -- 0:02:18
249500 -- (-156.294) [-148.850] (-155.544) (-158.443) * [-150.353] (-158.760) (-155.543) (-152.197) -- 0:02:18
250000 -- (-153.605) (-150.527) [-147.304] (-160.941) * (-156.621) [-150.227] (-150.899) (-156.550) -- 0:02:18
Average standard deviation of split frequencies: 0.018509
250500 -- [-146.586] (-151.718) (-146.163) (-160.069) * (-153.145) [-147.119] (-146.734) (-159.939) -- 0:02:17
251000 -- (-157.536) (-150.546) [-153.502] (-157.765) * (-166.969) (-159.456) [-148.013] (-149.531) -- 0:02:17
251500 -- (-154.582) [-151.014] (-148.245) (-155.378) * (-155.911) [-153.879] (-153.933) (-160.522) -- 0:02:16
252000 -- (-152.959) [-149.779] (-151.889) (-156.612) * (-147.246) [-150.548] (-155.897) (-154.350) -- 0:02:16
252500 -- [-151.565] (-158.730) (-155.997) (-151.686) * (-156.861) (-158.455) (-146.085) [-148.261] -- 0:02:16
253000 -- (-156.667) [-152.972] (-147.533) (-156.899) * (-160.068) (-152.407) (-150.291) [-153.438] -- 0:02:15
253500 -- (-152.766) [-146.598] (-159.430) (-158.938) * (-155.490) (-153.074) [-149.292] (-154.026) -- 0:02:15
254000 -- (-155.128) [-150.446] (-150.354) (-161.421) * (-156.987) (-159.136) (-154.537) [-147.581] -- 0:02:18
254500 -- (-149.988) (-159.862) [-152.203] (-162.762) * (-160.812) (-158.790) (-150.651) [-150.191] -- 0:02:17
255000 -- (-159.798) [-150.639] (-154.527) (-158.941) * (-156.060) (-157.508) [-146.631] (-149.764) -- 0:02:17
Average standard deviation of split frequencies: 0.019674
255500 -- (-157.857) [-151.262] (-153.132) (-156.159) * (-156.286) [-151.497] (-155.675) (-150.307) -- 0:02:16
256000 -- [-155.557] (-156.260) (-150.168) (-161.281) * (-160.326) [-151.863] (-152.886) (-147.969) -- 0:02:16
256500 -- (-150.454) [-150.372] (-159.298) (-157.328) * [-155.518] (-158.738) (-146.680) (-144.774) -- 0:02:16
257000 -- [-149.672] (-148.270) (-153.927) (-154.319) * (-155.379) [-161.089] (-153.373) (-148.641) -- 0:02:15
257500 -- [-146.311] (-146.001) (-160.145) (-162.504) * (-154.806) [-153.972] (-154.897) (-149.972) -- 0:02:15
258000 -- (-147.510) [-153.132] (-154.575) (-157.052) * (-149.221) (-156.180) [-146.042] (-153.081) -- 0:02:15
258500 -- (-151.936) [-148.258] (-146.932) (-155.833) * (-158.976) (-157.665) [-155.671] (-149.666) -- 0:02:14
259000 -- (-156.055) (-156.741) (-148.255) [-153.325] * (-154.927) (-151.334) [-153.545] (-152.600) -- 0:02:14
259500 -- (-152.802) (-152.160) [-149.681] (-156.115) * [-149.987] (-156.290) (-148.055) (-155.803) -- 0:02:16
260000 -- (-148.338) (-152.673) [-157.769] (-154.573) * [-147.123] (-158.824) (-149.335) (-155.738) -- 0:02:16
Average standard deviation of split frequencies: 0.019227
260500 -- [-148.743] (-148.634) (-160.397) (-153.581) * (-151.049) (-156.641) (-159.885) [-154.394] -- 0:02:16
261000 -- (-147.884) [-148.112] (-154.719) (-157.397) * (-152.390) (-153.298) [-146.201] (-146.676) -- 0:02:15
261500 -- (-149.336) (-149.527) (-151.817) [-152.480] * (-152.895) (-151.920) [-143.081] (-146.734) -- 0:02:15
262000 -- (-156.695) (-151.096) [-151.121] (-153.091) * (-156.325) (-154.814) (-148.675) [-150.970] -- 0:02:15
262500 -- (-150.693) (-160.602) [-158.078] (-153.238) * (-159.053) (-159.773) (-159.296) [-152.100] -- 0:02:14
263000 -- (-157.221) (-150.744) [-149.934] (-154.422) * [-156.661] (-152.760) (-154.941) (-160.428) -- 0:02:14
263500 -- [-145.780] (-153.054) (-155.784) (-154.278) * (-154.465) (-148.730) (-155.184) [-155.201] -- 0:02:14
264000 -- (-160.817) (-153.305) (-164.889) [-148.703] * [-153.169] (-154.230) (-160.240) (-157.055) -- 0:02:13
264500 -- [-160.114] (-150.512) (-160.676) (-151.678) * (-156.373) (-156.389) (-150.371) [-146.617] -- 0:02:16
265000 -- (-158.767) (-151.231) [-151.663] (-154.504) * (-154.158) (-150.275) (-149.597) [-146.023] -- 0:02:15
Average standard deviation of split frequencies: 0.018874
265500 -- [-153.190] (-145.913) (-146.444) (-153.217) * (-159.481) (-150.154) (-147.070) [-148.861] -- 0:02:15
266000 -- (-166.282) (-152.512) [-154.235] (-152.769) * [-150.913] (-152.111) (-151.826) (-151.737) -- 0:02:15
266500 -- (-147.880) (-151.739) [-151.137] (-148.701) * (-148.692) [-150.611] (-153.869) (-151.879) -- 0:02:14
267000 -- (-154.788) (-158.194) (-152.487) [-148.090] * (-152.796) (-150.231) [-144.284] (-161.497) -- 0:02:14
267500 -- (-151.568) (-149.436) (-147.903) [-149.090] * (-152.534) (-157.240) [-148.986] (-156.945) -- 0:02:14
268000 -- (-155.124) (-151.173) (-153.959) [-156.312] * (-156.873) [-150.550] (-154.898) (-147.394) -- 0:02:13
268500 -- (-147.749) [-152.013] (-151.408) (-151.423) * (-153.052) [-148.202] (-159.361) (-147.766) -- 0:02:13
269000 -- [-146.641] (-156.371) (-158.239) (-155.717) * (-157.700) (-154.230) (-160.407) [-149.258] -- 0:02:13
269500 -- (-155.196) (-156.806) (-160.428) [-158.460] * (-155.996) (-155.592) (-160.500) [-147.712] -- 0:02:12
270000 -- (-150.467) [-149.157] (-158.408) (-154.870) * (-156.363) (-153.889) (-152.379) [-146.599] -- 0:02:15
Average standard deviation of split frequencies: 0.018548
270500 -- (-151.923) (-150.718) [-148.973] (-152.118) * [-153.610] (-152.267) (-156.184) (-148.213) -- 0:02:14
271000 -- (-146.789) (-160.836) [-145.484] (-149.888) * [-150.804] (-151.128) (-154.952) (-154.585) -- 0:02:14
271500 -- (-156.082) (-159.418) [-154.998] (-151.122) * (-150.803) (-156.531) [-146.287] (-151.663) -- 0:02:14
272000 -- (-156.631) (-158.823) (-147.538) [-155.057] * (-156.547) [-150.987] (-161.913) (-151.050) -- 0:02:13
272500 -- [-145.531] (-151.875) (-153.954) (-151.763) * [-156.248] (-156.900) (-145.545) (-153.051) -- 0:02:13
273000 -- (-151.530) [-146.862] (-156.183) (-149.137) * [-151.903] (-156.019) (-155.244) (-149.539) -- 0:02:13
273500 -- [-157.013] (-149.750) (-159.364) (-160.440) * (-150.789) (-158.903) (-148.236) [-153.921] -- 0:02:12
274000 -- [-146.368] (-148.138) (-149.766) (-156.340) * (-161.394) (-153.729) (-149.125) [-152.862] -- 0:02:12
274500 -- (-154.109) [-154.547] (-156.182) (-157.954) * (-152.673) (-158.653) [-145.299] (-156.878) -- 0:02:12
275000 -- (-148.160) [-150.633] (-154.197) (-158.992) * [-150.618] (-151.178) (-157.667) (-155.597) -- 0:02:11
Average standard deviation of split frequencies: 0.017507
275500 -- [-153.743] (-150.820) (-155.204) (-153.501) * (-151.929) (-155.448) (-156.710) [-151.535] -- 0:02:14
276000 -- [-151.636] (-143.871) (-148.177) (-160.452) * [-146.489] (-157.806) (-153.595) (-153.957) -- 0:02:13
276500 -- (-149.677) [-154.836] (-150.053) (-151.500) * [-158.836] (-158.479) (-154.996) (-155.065) -- 0:02:13
277000 -- (-157.387) [-153.246] (-148.674) (-148.323) * [-149.081] (-162.087) (-158.642) (-149.112) -- 0:02:13
277500 -- (-153.068) [-152.045] (-151.707) (-147.346) * [-154.081] (-154.578) (-158.055) (-151.832) -- 0:02:12
278000 -- (-151.238) [-149.451] (-148.396) (-152.335) * (-155.212) (-154.192) (-149.024) [-149.725] -- 0:02:12
278500 -- (-154.197) [-148.271] (-154.607) (-150.834) * (-150.564) (-159.787) (-153.035) [-149.430] -- 0:02:12
279000 -- (-155.921) [-156.018] (-155.227) (-158.346) * (-156.442) (-155.014) (-158.380) [-149.832] -- 0:02:11
279500 -- [-146.119] (-154.437) (-153.410) (-155.248) * (-154.269) (-150.762) (-156.735) [-147.427] -- 0:02:11
280000 -- (-154.196) [-152.042] (-153.582) (-151.320) * (-158.694) (-155.216) [-145.654] (-150.192) -- 0:02:11
Average standard deviation of split frequencies: 0.017945
280500 -- (-156.654) (-156.658) (-151.858) [-147.965] * [-148.278] (-154.091) (-147.694) (-150.417) -- 0:02:10
281000 -- (-153.448) (-149.664) [-147.797] (-154.342) * (-163.910) (-156.836) (-151.630) [-154.127] -- 0:02:13
281500 -- [-151.492] (-153.417) (-149.936) (-157.839) * (-159.542) (-154.985) [-143.319] (-160.616) -- 0:02:12
282000 -- (-147.047) [-150.415] (-154.721) (-152.158) * (-161.432) [-150.471] (-154.435) (-154.074) -- 0:02:12
282500 -- (-154.076) (-154.971) (-151.011) [-152.293] * [-152.744] (-153.646) (-157.434) (-159.718) -- 0:02:12
283000 -- (-153.682) [-152.275] (-144.673) (-153.299) * (-150.312) (-148.639) [-150.140] (-155.599) -- 0:02:11
283500 -- (-151.174) [-151.151] (-153.012) (-155.398) * (-154.297) (-158.631) (-153.417) [-159.887] -- 0:02:11
284000 -- (-158.591) [-151.832] (-153.358) (-156.611) * (-150.189) [-149.173] (-158.618) (-155.984) -- 0:02:11
284500 -- (-150.013) (-158.985) (-154.222) [-151.524] * [-146.926] (-154.353) (-161.329) (-154.059) -- 0:02:10
285000 -- [-144.170] (-156.956) (-147.239) (-157.429) * [-149.919] (-157.816) (-156.152) (-165.355) -- 0:02:10
Average standard deviation of split frequencies: 0.016895
285500 -- (-149.580) (-156.289) [-148.488] (-151.812) * [-152.573] (-158.879) (-157.164) (-160.856) -- 0:02:10
286000 -- (-148.026) [-149.022] (-151.333) (-152.812) * (-153.130) [-151.947] (-153.171) (-157.036) -- 0:02:09
286500 -- [-154.685] (-154.266) (-153.878) (-153.147) * [-154.925] (-151.944) (-157.321) (-166.231) -- 0:02:11
287000 -- [-151.513] (-159.535) (-156.227) (-150.065) * [-153.351] (-156.329) (-149.055) (-168.237) -- 0:02:11
287500 -- (-152.572) (-158.867) (-156.780) [-147.641] * (-150.535) [-149.801] (-151.923) (-151.271) -- 0:02:11
288000 -- (-154.703) [-158.711] (-155.377) (-151.146) * (-159.234) [-154.133] (-151.897) (-162.031) -- 0:02:11
288500 -- (-154.888) (-148.099) [-149.610] (-156.384) * (-149.099) (-149.784) [-152.452] (-152.849) -- 0:02:10
289000 -- [-154.038] (-150.967) (-151.255) (-152.832) * [-150.870] (-151.280) (-156.695) (-153.817) -- 0:02:10
289500 -- (-151.558) [-150.202] (-149.753) (-162.549) * [-150.423] (-151.639) (-146.204) (-159.274) -- 0:02:10
290000 -- (-149.288) [-150.800] (-159.216) (-155.779) * (-150.178) (-154.867) [-147.232] (-159.160) -- 0:02:09
Average standard deviation of split frequencies: 0.016623
290500 -- [-149.353] (-154.228) (-158.487) (-157.401) * (-153.294) [-147.922] (-155.067) (-162.942) -- 0:02:09
291000 -- (-152.879) (-150.246) (-159.572) [-149.346] * (-153.082) (-154.349) (-149.867) [-148.911] -- 0:02:09
291500 -- [-148.590] (-148.981) (-155.337) (-150.344) * (-157.755) [-146.520] (-151.066) (-154.781) -- 0:02:08
292000 -- [-149.003] (-155.443) (-151.062) (-151.849) * (-157.717) (-155.622) [-152.656] (-155.699) -- 0:02:10
292500 -- (-151.062) [-148.962] (-153.232) (-148.427) * (-163.846) [-153.778] (-150.999) (-165.267) -- 0:02:10
293000 -- [-151.259] (-146.252) (-157.806) (-146.526) * (-163.781) (-155.084) [-152.509] (-157.754) -- 0:02:10
293500 -- (-152.782) [-144.124] (-157.244) (-155.447) * (-155.025) (-153.612) (-160.673) [-155.906] -- 0:02:09
294000 -- [-149.559] (-147.786) (-153.291) (-151.095) * (-161.249) [-144.061] (-152.366) (-156.665) -- 0:02:09
294500 -- [-152.869] (-148.534) (-151.257) (-157.191) * (-162.050) [-148.923] (-151.012) (-152.187) -- 0:02:09
295000 -- (-149.532) (-152.965) (-156.679) [-150.384] * (-158.225) [-144.405] (-158.783) (-153.676) -- 0:02:09
Average standard deviation of split frequencies: 0.016563
295500 -- (-151.344) (-158.086) [-153.476] (-148.500) * (-149.862) (-145.822) [-156.231] (-151.447) -- 0:02:08
296000 -- (-151.102) (-154.190) (-153.212) [-144.597] * (-149.660) [-147.876] (-150.409) (-161.936) -- 0:02:08
296500 -- (-149.350) (-157.516) [-151.456] (-155.890) * (-147.181) [-150.511] (-153.901) (-151.771) -- 0:02:08
297000 -- (-159.490) (-150.557) (-157.425) [-147.861] * [-146.175] (-152.926) (-150.740) (-148.963) -- 0:02:10
297500 -- (-153.666) (-149.115) (-153.447) [-148.451] * [-141.440] (-148.404) (-160.491) (-155.435) -- 0:02:09
298000 -- (-154.299) [-151.396] (-153.608) (-160.315) * (-144.491) (-152.916) [-154.722] (-154.766) -- 0:02:09
298500 -- (-149.091) [-153.933] (-151.127) (-154.748) * (-148.543) [-148.036] (-148.338) (-159.263) -- 0:02:09
299000 -- (-154.586) (-159.370) (-154.124) [-148.394] * (-149.617) [-150.149] (-158.091) (-153.495) -- 0:02:08
299500 -- (-156.750) (-150.819) (-157.615) [-149.903] * (-147.830) [-151.976] (-151.631) (-149.155) -- 0:02:08
300000 -- (-157.377) (-155.904) [-152.093] (-144.639) * (-151.203) [-146.315] (-153.689) (-159.113) -- 0:02:08
Average standard deviation of split frequencies: 0.016149
300500 -- [-150.761] (-155.891) (-153.295) (-145.130) * [-148.955] (-147.963) (-155.709) (-159.472) -- 0:02:08
301000 -- (-157.167) (-146.485) (-149.052) [-145.925] * (-153.983) [-147.925] (-157.703) (-158.324) -- 0:02:07
301500 -- [-153.288] (-154.895) (-159.250) (-152.055) * [-147.759] (-158.130) (-154.518) (-152.589) -- 0:02:07
302000 -- [-154.967] (-157.732) (-153.825) (-153.962) * (-152.305) [-156.012] (-152.774) (-150.292) -- 0:02:07
302500 -- [-152.675] (-152.518) (-156.805) (-154.579) * (-156.101) [-152.612] (-150.696) (-147.612) -- 0:02:09
303000 -- (-157.426) (-156.915) [-154.128] (-160.292) * (-146.621) (-158.317) (-156.985) [-145.916] -- 0:02:08
303500 -- (-152.804) (-149.258) (-162.377) [-152.204] * (-156.980) [-155.382] (-150.624) (-154.020) -- 0:02:08
304000 -- (-154.677) (-151.674) (-161.090) [-153.912] * (-148.560) (-149.180) (-148.071) [-157.093] -- 0:02:08
304500 -- (-147.676) (-156.752) (-156.365) [-148.586] * (-149.902) (-156.035) (-148.626) [-160.338] -- 0:02:07
305000 -- [-145.539] (-156.311) (-154.589) (-150.016) * (-156.716) (-152.482) [-148.805] (-157.714) -- 0:02:07
Average standard deviation of split frequencies: 0.017023
305500 -- (-148.185) (-153.709) (-149.706) [-152.375] * (-156.886) (-151.190) (-160.916) [-154.136] -- 0:02:07
306000 -- [-154.153] (-151.443) (-151.086) (-156.784) * (-151.027) (-153.057) [-145.489] (-155.254) -- 0:02:07
306500 -- (-145.906) [-148.144] (-154.157) (-154.288) * (-161.213) (-155.083) [-148.159] (-144.566) -- 0:02:06
307000 -- (-154.315) [-153.933] (-159.738) (-160.874) * (-154.730) (-154.365) (-154.194) [-146.391] -- 0:02:06
307500 -- (-151.292) (-157.200) [-158.296] (-155.974) * (-161.280) (-161.267) (-148.419) [-146.764] -- 0:02:06
308000 -- [-151.284] (-151.779) (-156.981) (-156.436) * (-158.121) (-155.937) [-145.469] (-149.012) -- 0:02:08
308500 -- [-155.644] (-147.968) (-157.331) (-154.386) * (-149.487) [-158.581] (-148.978) (-156.422) -- 0:02:07
309000 -- (-153.479) (-150.405) (-154.297) [-149.424] * (-148.685) (-153.677) [-154.205] (-150.449) -- 0:02:07
309500 -- (-159.288) (-155.290) (-156.641) [-154.457] * (-152.607) [-150.743] (-150.783) (-159.400) -- 0:02:07
310000 -- [-155.089] (-155.992) (-158.226) (-162.509) * (-145.149) (-156.920) (-150.663) [-151.116] -- 0:02:06
Average standard deviation of split frequencies: 0.016767
310500 -- (-154.115) (-147.466) [-147.465] (-156.131) * [-152.139] (-149.996) (-154.858) (-157.373) -- 0:02:06
311000 -- (-158.242) [-151.830] (-160.491) (-147.193) * (-154.984) [-153.728] (-156.894) (-156.916) -- 0:02:06
311500 -- (-152.747) (-155.879) (-156.213) [-149.443] * (-144.752) [-148.472] (-150.006) (-157.395) -- 0:02:05
312000 -- (-156.499) (-150.245) [-150.516] (-149.724) * [-146.885] (-156.037) (-156.485) (-152.974) -- 0:02:05
312500 -- (-154.233) (-150.539) (-156.976) [-150.929] * [-151.638] (-162.138) (-155.711) (-153.775) -- 0:02:05
313000 -- (-156.008) [-145.623] (-157.531) (-148.526) * [-153.738] (-152.551) (-154.271) (-158.580) -- 0:02:05
313500 -- (-158.030) (-151.305) (-155.724) [-147.473] * (-152.343) [-151.068] (-147.205) (-162.507) -- 0:02:07
314000 -- (-160.614) [-157.489] (-151.339) (-147.204) * (-149.899) (-151.177) (-151.099) [-156.819] -- 0:02:06
314500 -- (-157.416) (-157.724) [-152.513] (-146.163) * [-156.664] (-153.891) (-152.981) (-159.217) -- 0:02:06
315000 -- (-152.308) [-151.685] (-153.320) (-159.170) * [-151.509] (-149.458) (-152.519) (-154.288) -- 0:02:06
Average standard deviation of split frequencies: 0.017305
315500 -- (-154.954) (-161.795) (-144.456) [-148.891] * (-150.862) [-147.291] (-167.019) (-150.564) -- 0:02:05
316000 -- (-153.675) (-153.184) (-149.782) [-155.551] * (-146.316) (-148.675) (-157.282) [-152.626] -- 0:02:05
316500 -- (-165.563) (-155.843) [-155.235] (-154.200) * [-146.270] (-152.402) (-152.675) (-156.071) -- 0:02:05
317000 -- (-155.523) (-149.490) [-145.607] (-152.295) * (-153.986) [-154.450] (-150.247) (-156.036) -- 0:02:04
317500 -- (-154.711) [-152.481] (-148.621) (-147.950) * (-154.071) (-157.194) (-152.763) [-150.126] -- 0:02:04
318000 -- (-154.981) [-150.386] (-147.562) (-151.007) * (-159.848) [-148.540] (-151.969) (-163.276) -- 0:02:04
318500 -- (-154.524) [-150.893] (-158.105) (-155.869) * (-157.245) (-154.196) [-150.545] (-154.831) -- 0:02:04
319000 -- (-167.409) (-153.482) [-148.798] (-157.150) * (-153.552) [-153.468] (-151.465) (-153.032) -- 0:02:05
319500 -- (-152.656) (-153.502) (-156.608) [-147.829] * (-156.869) [-147.976] (-149.267) (-153.675) -- 0:02:05
320000 -- (-153.873) (-146.458) (-156.894) [-146.800] * (-157.678) (-150.302) [-149.428] (-151.182) -- 0:02:05
Average standard deviation of split frequencies: 0.017200
320500 -- (-158.255) [-145.154] (-152.892) (-153.248) * (-154.432) (-151.005) (-156.645) [-148.209] -- 0:02:05
321000 -- [-148.399] (-152.016) (-153.353) (-152.573) * (-153.972) (-152.430) [-154.606] (-149.916) -- 0:02:04
321500 -- [-147.415] (-156.304) (-154.501) (-146.621) * (-152.046) [-150.884] (-157.381) (-147.615) -- 0:02:04
322000 -- (-152.016) (-154.629) (-154.690) [-146.440] * [-148.976] (-152.736) (-156.476) (-152.742) -- 0:02:04
322500 -- (-156.729) [-147.199] (-149.856) (-151.990) * (-159.248) (-153.705) [-153.778] (-154.465) -- 0:02:03
323000 -- (-150.013) (-148.535) [-148.391] (-153.240) * (-152.679) [-159.528] (-156.432) (-146.943) -- 0:02:03
323500 -- [-147.860] (-154.781) (-152.228) (-155.775) * [-153.351] (-154.779) (-155.550) (-147.795) -- 0:02:03
324000 -- (-155.214) [-156.517] (-154.355) (-158.581) * (-157.492) (-161.430) [-146.734] (-143.054) -- 0:02:03
324500 -- (-152.441) (-152.715) [-151.285] (-151.837) * (-154.470) [-159.334] (-164.886) (-154.582) -- 0:02:04
325000 -- (-150.608) (-156.952) [-152.580] (-154.610) * (-157.599) (-155.553) [-145.848] (-151.197) -- 0:02:04
Average standard deviation of split frequencies: 0.016412
325500 -- [-148.936] (-155.182) (-155.057) (-157.326) * [-156.883] (-162.160) (-150.946) (-158.769) -- 0:02:04
326000 -- (-159.442) (-162.905) [-153.952] (-150.985) * (-152.492) (-160.124) [-155.820] (-154.628) -- 0:02:04
326500 -- (-150.573) (-151.144) (-153.731) [-158.867] * [-155.437] (-153.962) (-150.500) (-153.873) -- 0:02:03
327000 -- [-147.706] (-151.456) (-161.871) (-156.135) * (-152.335) [-153.385] (-148.728) (-159.148) -- 0:02:03
327500 -- [-148.767] (-146.309) (-164.412) (-157.397) * (-154.679) (-152.171) [-145.665] (-145.364) -- 0:02:03
328000 -- (-149.088) [-155.411] (-168.546) (-148.772) * (-157.099) (-157.642) [-147.818] (-149.194) -- 0:02:02
328500 -- [-149.492] (-150.713) (-164.982) (-148.998) * (-150.674) (-158.063) [-149.350] (-152.439) -- 0:02:02
329000 -- (-152.816) [-150.891] (-151.359) (-151.345) * [-150.532] (-152.801) (-153.353) (-154.239) -- 0:02:02
329500 -- (-150.458) (-159.534) (-157.741) [-150.355] * (-153.928) [-149.682] (-152.863) (-148.434) -- 0:02:04
330000 -- (-155.055) (-165.599) (-159.707) [-148.177] * (-154.662) [-157.149] (-159.032) (-156.517) -- 0:02:03
Average standard deviation of split frequencies: 0.017321
330500 -- (-153.848) [-157.482] (-158.168) (-159.695) * (-153.757) (-164.510) (-150.382) [-159.113] -- 0:02:03
331000 -- [-145.158] (-151.112) (-167.380) (-159.655) * (-154.971) (-153.095) [-151.468] (-159.847) -- 0:02:03
331500 -- (-145.878) [-152.092] (-158.310) (-153.097) * (-153.378) (-151.130) [-151.930] (-154.695) -- 0:02:03
332000 -- [-143.965] (-150.834) (-161.557) (-155.128) * (-157.718) [-151.012] (-151.476) (-152.583) -- 0:02:02
332500 -- (-153.842) [-150.819] (-157.735) (-157.535) * (-152.196) [-155.111] (-154.992) (-145.742) -- 0:02:02
333000 -- (-151.837) [-150.564] (-160.913) (-155.654) * (-159.201) (-149.932) [-147.959] (-147.371) -- 0:02:02
333500 -- (-146.837) [-146.109] (-159.621) (-156.190) * (-151.301) (-152.907) (-151.123) [-149.825] -- 0:02:01
334000 -- (-153.420) [-154.600] (-158.099) (-152.141) * [-145.631] (-155.626) (-151.599) (-152.758) -- 0:02:01
334500 -- (-158.565) (-157.894) [-159.148] (-153.484) * [-152.906] (-149.858) (-151.774) (-156.513) -- 0:02:01
335000 -- [-157.483] (-156.202) (-152.643) (-151.755) * [-146.362] (-148.615) (-157.860) (-150.331) -- 0:02:03
Average standard deviation of split frequencies: 0.016836
335500 -- (-155.897) (-154.782) [-152.346] (-154.779) * (-151.140) (-157.647) (-152.772) [-151.666] -- 0:02:02
336000 -- (-155.594) [-149.705] (-151.807) (-159.582) * [-151.491] (-163.693) (-147.791) (-156.826) -- 0:02:02
336500 -- (-160.616) [-154.551] (-156.650) (-153.508) * [-149.273] (-156.432) (-154.643) (-153.886) -- 0:02:02
337000 -- (-151.918) (-155.759) [-146.770] (-156.615) * (-153.844) [-146.773] (-159.322) (-158.288) -- 0:02:01
337500 -- [-151.500] (-156.945) (-157.200) (-161.681) * (-152.365) [-155.509] (-152.739) (-160.114) -- 0:02:01
338000 -- (-153.025) (-153.024) (-151.956) [-153.291] * [-160.933] (-156.835) (-156.792) (-161.474) -- 0:02:01
338500 -- (-166.424) [-146.524] (-158.847) (-148.797) * [-147.650] (-152.589) (-153.533) (-154.748) -- 0:02:01
339000 -- (-161.884) (-150.089) (-157.240) [-151.419] * (-154.887) [-150.165] (-159.404) (-152.257) -- 0:02:00
339500 -- [-157.445] (-150.282) (-156.372) (-155.225) * (-156.747) [-142.902] (-156.415) (-147.244) -- 0:02:00
340000 -- (-151.765) [-149.272] (-151.594) (-158.301) * (-149.821) (-151.019) [-152.466] (-155.004) -- 0:02:00
Average standard deviation of split frequencies: 0.016328
340500 -- (-149.972) [-150.209] (-151.302) (-154.684) * (-156.188) [-151.439] (-149.848) (-151.144) -- 0:02:02
341000 -- (-157.390) [-151.282] (-158.618) (-157.489) * (-158.314) (-151.951) (-154.497) [-153.510] -- 0:02:01
341500 -- [-151.871] (-156.004) (-156.007) (-161.000) * (-159.379) [-143.176] (-154.404) (-158.024) -- 0:02:01
342000 -- (-159.337) (-162.745) [-147.194] (-156.841) * (-153.826) (-147.629) [-149.739] (-155.134) -- 0:02:01
342500 -- [-150.610] (-152.422) (-157.100) (-156.550) * [-153.407] (-149.562) (-154.939) (-154.841) -- 0:02:00
343000 -- [-149.137] (-154.806) (-159.428) (-149.897) * (-152.597) (-151.016) [-151.774] (-151.807) -- 0:02:00
343500 -- [-151.257] (-149.921) (-156.619) (-157.304) * (-165.314) (-156.916) (-149.027) [-153.789] -- 0:02:00
344000 -- [-148.880] (-155.082) (-147.802) (-150.567) * (-158.057) (-154.964) [-151.935] (-156.773) -- 0:02:00
344500 -- (-153.598) [-151.749] (-149.929) (-146.416) * (-150.316) (-146.159) (-150.533) [-146.698] -- 0:01:59
345000 -- (-151.993) (-162.271) (-150.383) [-148.892] * (-153.596) [-145.436] (-156.882) (-153.921) -- 0:01:59
Average standard deviation of split frequencies: 0.016281
345500 -- (-153.060) (-152.019) [-152.039] (-147.892) * (-161.638) (-145.593) [-146.670] (-151.203) -- 0:01:59
346000 -- (-150.644) [-152.463] (-149.848) (-151.200) * (-157.386) (-151.240) (-156.622) [-150.038] -- 0:02:00
346500 -- (-154.179) [-149.561] (-148.847) (-154.600) * (-149.858) (-148.479) [-153.138] (-152.469) -- 0:02:00
347000 -- (-158.597) [-153.966] (-146.961) (-154.932) * (-157.840) (-150.075) [-147.190] (-149.671) -- 0:02:00
347500 -- (-163.503) [-154.024] (-145.674) (-155.786) * (-150.784) (-146.804) [-144.492] (-150.052) -- 0:02:00
348000 -- (-158.897) [-150.259] (-151.733) (-145.626) * (-157.368) (-149.444) (-152.866) [-152.596] -- 0:01:59
348500 -- (-158.739) (-152.299) (-147.253) [-145.068] * (-146.669) (-156.560) (-146.719) [-148.612] -- 0:01:59
349000 -- (-155.758) (-150.128) (-151.488) [-148.634] * [-153.728] (-149.509) (-148.247) (-158.425) -- 0:01:59
349500 -- (-154.417) (-144.621) (-155.307) [-155.220] * (-150.599) (-157.298) [-151.985] (-155.189) -- 0:01:59
350000 -- (-155.652) (-150.295) (-148.702) [-146.409] * (-151.753) (-156.567) [-146.910] (-153.271) -- 0:01:58
Average standard deviation of split frequencies: 0.015930
350500 -- [-147.132] (-154.955) (-152.129) (-151.637) * (-150.181) (-155.612) (-152.730) [-155.396] -- 0:01:58
351000 -- [-150.216] (-152.459) (-150.863) (-154.959) * (-154.538) [-145.916] (-148.949) (-153.984) -- 0:01:58
351500 -- (-151.675) (-157.503) [-144.761] (-158.446) * (-156.282) (-148.160) (-154.719) [-150.015] -- 0:01:59
352000 -- (-155.864) (-152.364) [-153.503] (-155.775) * (-156.006) (-154.771) (-148.235) [-144.076] -- 0:01:59
352500 -- (-148.843) [-156.578] (-156.844) (-155.560) * (-154.987) (-153.110) (-154.990) [-150.178] -- 0:01:59
353000 -- [-149.004] (-151.523) (-155.275) (-152.294) * [-150.734] (-160.511) (-149.954) (-148.130) -- 0:01:59
353500 -- (-144.587) (-156.291) [-148.391] (-156.783) * (-157.051) (-147.129) [-149.836] (-163.044) -- 0:01:58
354000 -- (-150.469) (-161.259) (-155.612) [-154.283] * (-148.561) (-157.221) [-149.409] (-151.755) -- 0:01:58
354500 -- (-154.097) (-158.038) (-151.223) [-150.555] * (-151.603) (-147.607) [-146.358] (-152.704) -- 0:01:58
355000 -- [-151.806] (-157.916) (-146.124) (-156.669) * (-150.188) (-146.907) [-144.092] (-151.070) -- 0:01:58
Average standard deviation of split frequencies: 0.016685
355500 -- (-148.000) (-155.488) (-156.341) [-158.492] * (-150.303) [-148.399] (-153.864) (-147.192) -- 0:01:57
356000 -- (-148.986) [-155.915] (-151.780) (-152.698) * (-152.322) (-154.899) [-146.308] (-153.667) -- 0:01:57
356500 -- (-150.287) [-153.606] (-153.192) (-153.734) * (-149.644) (-162.824) [-148.122] (-158.184) -- 0:01:59
357000 -- (-149.292) (-153.900) [-146.734] (-161.608) * (-150.027) (-165.483) (-146.377) [-149.006] -- 0:01:58
357500 -- (-158.678) (-146.068) [-153.777] (-159.618) * (-151.251) [-150.052] (-149.624) (-146.980) -- 0:01:58
358000 -- (-154.218) (-144.170) [-154.041] (-156.687) * (-162.139) (-152.778) [-150.073] (-149.353) -- 0:01:58
358500 -- (-154.650) (-146.750) (-153.161) [-148.921] * (-159.215) (-155.096) (-158.787) [-145.826] -- 0:01:58
359000 -- [-151.224] (-149.331) (-161.561) (-152.324) * (-156.025) [-160.684] (-162.924) (-151.553) -- 0:01:57
359500 -- (-154.185) [-148.650] (-148.707) (-156.754) * (-153.863) [-148.481] (-162.824) (-155.190) -- 0:01:57
360000 -- (-155.207) (-148.995) [-144.104] (-156.825) * (-154.846) (-153.746) [-151.374] (-155.753) -- 0:01:57
Average standard deviation of split frequencies: 0.015619
360500 -- [-153.076] (-149.415) (-152.116) (-158.105) * (-150.332) (-150.146) [-149.076] (-147.520) -- 0:01:57
361000 -- (-156.762) (-152.434) (-148.993) [-146.058] * [-150.289] (-158.481) (-150.464) (-146.998) -- 0:01:56
361500 -- (-149.414) [-153.603] (-155.636) (-154.796) * (-154.818) (-154.884) [-144.945] (-161.223) -- 0:01:56
362000 -- [-149.166] (-164.823) (-145.008) (-156.012) * (-155.296) (-153.668) (-153.569) [-145.022] -- 0:01:58
362500 -- (-157.215) [-152.882] (-155.166) (-160.082) * [-151.604] (-155.636) (-154.297) (-147.478) -- 0:01:57
363000 -- (-154.178) (-166.892) [-149.765] (-151.516) * (-151.467) (-162.807) (-154.616) [-150.244] -- 0:01:57
363500 -- (-149.641) (-164.460) [-160.413] (-154.901) * (-156.118) (-148.798) [-150.829] (-156.441) -- 0:01:57
364000 -- (-151.756) (-159.948) (-146.817) [-153.045] * (-157.000) [-152.065] (-158.371) (-157.897) -- 0:01:57
364500 -- (-156.373) [-152.564] (-150.879) (-156.913) * [-150.921] (-155.646) (-153.165) (-151.925) -- 0:01:56
365000 -- (-153.121) (-157.655) (-146.172) [-148.413] * [-146.433] (-155.614) (-156.473) (-149.327) -- 0:01:56
Average standard deviation of split frequencies: 0.015649
365500 -- (-145.268) (-159.554) [-144.386] (-150.850) * (-155.868) (-155.226) [-161.471] (-151.942) -- 0:01:56
366000 -- (-147.493) [-151.312] (-152.194) (-147.458) * (-153.350) (-151.816) [-158.842] (-149.785) -- 0:01:56
366500 -- (-156.014) (-160.227) (-151.555) [-148.325] * (-160.961) (-150.279) (-153.085) [-152.037] -- 0:01:55
367000 -- [-149.939] (-157.733) (-153.956) (-149.374) * [-148.412] (-153.889) (-152.750) (-148.638) -- 0:01:55
367500 -- (-159.069) (-150.911) (-151.677) [-147.104] * (-150.155) (-160.550) (-157.300) [-147.049] -- 0:01:57
368000 -- (-156.531) (-153.532) [-154.321] (-148.884) * (-152.473) (-155.674) (-153.419) [-143.019] -- 0:01:56
368500 -- (-147.481) [-147.829] (-159.731) (-152.813) * (-153.789) (-163.496) [-152.546] (-148.799) -- 0:01:56
369000 -- [-147.467] (-152.373) (-151.352) (-151.335) * (-158.166) (-152.368) [-150.946] (-150.508) -- 0:01:56
369500 -- (-147.223) [-146.430] (-155.165) (-155.159) * (-149.740) (-157.144) (-155.038) [-152.202] -- 0:01:56
370000 -- (-157.670) (-162.232) [-151.600] (-152.985) * (-153.312) (-157.958) (-153.976) [-153.443] -- 0:01:55
Average standard deviation of split frequencies: 0.015261
370500 -- [-147.628] (-154.388) (-153.656) (-149.259) * (-151.101) (-152.105) [-155.484] (-145.986) -- 0:01:55
371000 -- (-161.857) (-156.489) [-145.843] (-158.154) * (-152.787) [-153.070] (-157.479) (-150.956) -- 0:01:55
371500 -- [-146.230] (-154.871) (-149.308) (-151.316) * (-156.673) (-161.005) (-156.293) [-149.154] -- 0:01:55
372000 -- (-146.627) [-148.131] (-148.875) (-155.920) * (-157.649) (-159.018) (-162.251) [-152.825] -- 0:01:54
372500 -- (-145.286) [-152.248] (-154.479) (-147.987) * (-151.991) [-151.938] (-155.413) (-154.516) -- 0:01:54
373000 -- (-153.903) [-152.030] (-152.687) (-153.142) * (-150.563) (-156.363) [-149.766] (-146.998) -- 0:01:55
373500 -- [-144.105] (-157.751) (-153.511) (-158.834) * (-151.640) (-152.181) (-160.347) [-147.030] -- 0:01:55
374000 -- (-146.810) (-156.081) [-150.872] (-151.418) * (-150.192) (-148.898) [-152.739] (-154.732) -- 0:01:55
374500 -- [-148.146] (-153.578) (-150.606) (-153.041) * [-147.716] (-149.713) (-149.549) (-155.372) -- 0:01:55
375000 -- (-156.629) (-156.062) [-147.245] (-156.981) * (-151.865) (-155.804) [-151.969] (-156.758) -- 0:01:55
Average standard deviation of split frequencies: 0.015296
375500 -- (-147.476) (-161.844) [-145.792] (-156.025) * (-146.494) (-151.141) (-157.828) [-147.921] -- 0:01:54
376000 -- (-154.857) (-157.838) (-155.025) [-151.542] * [-154.180] (-156.880) (-151.004) (-162.413) -- 0:01:54
376500 -- (-152.671) (-152.689) (-150.706) [-146.314] * (-155.558) (-150.727) [-149.268] (-160.156) -- 0:01:54
377000 -- [-149.337] (-158.938) (-152.858) (-153.858) * (-156.330) (-149.944) (-150.892) [-147.433] -- 0:01:54
377500 -- (-150.567) (-159.182) [-155.674] (-156.256) * [-151.347] (-148.855) (-148.031) (-155.458) -- 0:01:53
378000 -- (-159.508) [-150.755] (-152.059) (-153.264) * [-151.075] (-158.200) (-158.146) (-164.154) -- 0:01:53
378500 -- [-150.466] (-162.624) (-167.036) (-162.294) * (-149.919) [-157.642] (-156.408) (-151.487) -- 0:01:54
379000 -- [-150.712] (-157.054) (-157.470) (-158.576) * (-147.945) (-152.656) (-155.332) [-152.501] -- 0:01:54
379500 -- (-154.070) [-152.943] (-156.823) (-155.759) * [-154.247] (-154.875) (-157.402) (-154.862) -- 0:01:54
380000 -- (-158.129) (-152.699) (-168.609) [-144.940] * (-163.514) (-155.437) [-147.801] (-145.668) -- 0:01:54
Average standard deviation of split frequencies: 0.015851
380500 -- [-148.219] (-156.411) (-168.239) (-152.991) * (-161.178) (-159.084) [-146.407] (-148.298) -- 0:01:53
381000 -- [-149.467] (-159.853) (-157.069) (-157.581) * [-157.033] (-147.901) (-150.352) (-149.332) -- 0:01:53
381500 -- (-154.197) [-153.920] (-150.070) (-150.952) * [-153.911] (-162.075) (-153.233) (-155.170) -- 0:01:53
382000 -- (-157.238) (-151.316) (-154.834) [-147.262] * (-156.659) (-157.896) [-151.676] (-156.327) -- 0:01:53
382500 -- (-154.370) [-149.401] (-152.034) (-152.648) * (-162.452) (-154.848) [-148.342] (-155.072) -- 0:01:53
383000 -- (-158.788) (-156.043) [-148.311] (-158.758) * (-148.571) (-160.154) (-154.801) [-151.486] -- 0:01:52
383500 -- (-157.077) (-156.885) [-147.189] (-158.027) * [-150.351] (-159.524) (-145.232) (-152.838) -- 0:01:52
384000 -- (-156.332) [-154.044] (-149.309) (-157.368) * [-148.552] (-153.088) (-157.209) (-157.744) -- 0:01:53
384500 -- (-152.875) [-155.276] (-149.471) (-152.539) * [-156.732] (-151.806) (-152.495) (-160.521) -- 0:01:53
385000 -- (-157.521) (-152.286) [-147.997] (-154.673) * [-150.015] (-148.960) (-151.486) (-156.015) -- 0:01:53
Average standard deviation of split frequencies: 0.015266
385500 -- [-148.770] (-157.052) (-157.425) (-155.274) * (-153.619) (-157.962) [-156.224] (-152.741) -- 0:01:53
386000 -- (-147.942) [-147.760] (-156.058) (-155.719) * [-152.463] (-154.438) (-154.377) (-154.521) -- 0:01:52
386500 -- [-154.843] (-156.359) (-156.121) (-151.213) * (-158.210) (-153.383) [-149.634] (-157.018) -- 0:01:52
387000 -- (-145.398) (-160.871) [-153.951] (-153.455) * (-158.850) (-150.058) (-153.748) [-159.353] -- 0:01:52
387500 -- [-148.222] (-153.328) (-152.559) (-154.850) * [-156.405] (-160.355) (-157.352) (-157.117) -- 0:01:52
388000 -- (-154.487) (-153.042) (-148.345) [-149.851] * [-152.020] (-157.346) (-156.336) (-153.078) -- 0:01:51
388500 -- (-156.200) (-161.370) (-148.639) [-153.634] * (-157.500) [-149.596] (-153.012) (-155.603) -- 0:01:51
389000 -- (-152.828) (-164.302) (-151.599) [-156.137] * (-153.124) (-144.629) (-156.134) [-151.020] -- 0:01:51
389500 -- [-148.832] (-151.471) (-150.488) (-160.094) * (-160.134) (-155.040) (-154.949) [-153.286] -- 0:01:52
390000 -- [-150.519] (-156.249) (-144.799) (-150.043) * (-160.040) [-156.669] (-157.940) (-154.599) -- 0:01:52
Average standard deviation of split frequencies: 0.014842
390500 -- (-148.586) (-155.275) (-156.878) [-149.032] * (-152.227) [-150.873] (-148.784) (-154.447) -- 0:01:52
391000 -- (-155.519) (-149.765) [-151.510] (-156.000) * [-146.211] (-156.212) (-159.866) (-154.840) -- 0:01:52
391500 -- (-154.843) (-156.260) [-155.474] (-154.460) * (-148.504) (-161.708) [-146.389] (-150.145) -- 0:01:51
392000 -- (-153.109) (-151.714) [-151.946] (-165.704) * (-154.593) (-149.887) [-148.478] (-151.114) -- 0:01:51
392500 -- [-144.881] (-157.227) (-155.215) (-149.881) * [-147.718] (-156.333) (-149.283) (-153.323) -- 0:01:51
393000 -- [-155.555] (-151.809) (-149.501) (-161.341) * (-150.787) (-153.282) [-150.593] (-153.386) -- 0:01:51
393500 -- [-149.743] (-153.386) (-161.573) (-154.051) * (-146.704) (-151.506) (-155.640) [-156.836] -- 0:01:50
394000 -- [-149.227] (-159.976) (-154.852) (-160.656) * (-160.370) (-153.081) (-148.342) [-145.435] -- 0:01:50
394500 -- (-156.561) [-152.413] (-155.408) (-152.469) * (-158.976) (-156.198) (-148.105) [-147.714] -- 0:01:52
395000 -- [-149.372] (-155.382) (-151.548) (-146.981) * (-149.001) [-153.661] (-152.688) (-146.217) -- 0:01:51
Average standard deviation of split frequencies: 0.015594
395500 -- (-155.905) (-156.067) [-146.752] (-158.397) * [-152.463] (-154.638) (-151.129) (-149.856) -- 0:01:51
396000 -- (-152.814) (-156.646) [-151.278] (-151.332) * [-154.465] (-162.339) (-150.789) (-145.969) -- 0:01:51
396500 -- (-160.234) [-153.258] (-155.921) (-151.176) * (-148.676) [-149.888] (-147.777) (-150.052) -- 0:01:51
397000 -- (-161.513) (-159.558) (-162.913) [-144.387] * (-153.654) (-149.331) [-146.323] (-150.311) -- 0:01:50
397500 -- (-158.459) [-149.987] (-157.829) (-160.967) * (-156.321) (-156.188) [-145.885] (-150.446) -- 0:01:50
398000 -- (-154.880) [-153.058] (-158.626) (-151.432) * (-155.389) [-154.009] (-147.149) (-155.975) -- 0:01:50
398500 -- (-150.535) [-146.788] (-157.628) (-151.478) * (-155.201) (-146.459) (-147.211) [-149.490] -- 0:01:50
399000 -- [-157.760] (-153.312) (-161.642) (-154.997) * (-160.317) (-143.665) [-147.281] (-155.228) -- 0:01:49
399500 -- [-149.736] (-154.863) (-152.703) (-150.349) * (-158.472) (-150.090) [-147.307] (-152.466) -- 0:01:49
400000 -- (-151.331) [-156.535] (-153.630) (-151.699) * (-153.257) [-149.142] (-152.584) (-145.662) -- 0:01:51
Average standard deviation of split frequencies: 0.014883
400500 -- (-158.427) [-147.313] (-150.612) (-149.930) * (-149.504) [-154.910] (-155.204) (-153.711) -- 0:01:50
401000 -- (-159.062) (-152.009) (-149.704) [-148.716] * (-158.866) (-147.518) [-149.507] (-152.967) -- 0:01:50
401500 -- (-152.604) (-155.705) (-153.985) [-154.106] * (-150.191) [-152.852] (-148.960) (-155.032) -- 0:01:50
402000 -- (-154.118) (-154.716) (-153.664) [-153.256] * (-151.450) [-150.448] (-153.789) (-152.501) -- 0:01:50
402500 -- [-148.427] (-149.965) (-153.735) (-159.197) * (-148.314) (-156.074) (-160.653) [-159.658] -- 0:01:49
403000 -- (-157.319) (-147.853) [-150.883] (-154.922) * (-148.130) (-156.161) (-159.022) [-154.278] -- 0:01:49
403500 -- (-153.641) (-149.227) [-153.702] (-149.603) * (-158.050) (-147.662) [-147.891] (-152.576) -- 0:01:49
404000 -- (-156.420) [-147.845] (-156.720) (-154.868) * (-155.652) (-154.476) (-146.402) [-152.423] -- 0:01:49
404500 -- [-150.472] (-153.400) (-160.204) (-157.725) * (-154.963) (-152.400) [-144.728] (-150.059) -- 0:01:48
405000 -- (-154.326) (-151.481) [-156.076] (-155.655) * (-153.761) (-150.713) [-149.287] (-163.974) -- 0:01:48
Average standard deviation of split frequencies: 0.014630
405500 -- (-147.335) [-148.673] (-150.235) (-151.496) * (-161.548) (-152.427) [-149.814] (-154.124) -- 0:01:49
406000 -- (-154.913) [-148.144] (-154.466) (-156.295) * (-163.736) (-162.437) (-148.847) [-147.173] -- 0:01:49
406500 -- [-154.420] (-147.496) (-159.271) (-163.383) * (-156.584) (-158.381) (-148.309) [-158.574] -- 0:01:49
407000 -- (-150.011) [-148.217] (-159.033) (-152.752) * (-155.321) [-147.205] (-149.165) (-154.215) -- 0:01:49
407500 -- (-150.055) [-149.036] (-150.799) (-158.797) * (-162.167) [-148.683] (-149.768) (-146.670) -- 0:01:49
408000 -- (-157.901) (-148.745) [-151.812] (-154.012) * (-159.466) (-153.666) [-148.607] (-160.758) -- 0:01:48
408500 -- [-145.588] (-165.270) (-160.701) (-153.232) * [-154.020] (-156.409) (-144.173) (-155.395) -- 0:01:48
409000 -- (-150.557) (-154.185) (-154.074) [-147.996] * (-159.725) (-155.035) (-153.989) [-160.664] -- 0:01:48
409500 -- (-156.024) (-158.787) (-147.036) [-146.630] * (-155.950) (-159.845) [-150.946] (-155.061) -- 0:01:48
410000 -- (-150.050) (-157.370) (-146.957) [-150.317] * (-160.826) (-155.195) (-148.879) [-144.092] -- 0:01:47
Average standard deviation of split frequencies: 0.014751
410500 -- (-156.827) (-152.365) [-147.898] (-156.298) * (-156.616) (-151.982) [-147.411] (-149.461) -- 0:01:47
411000 -- (-152.784) (-154.583) [-152.356] (-147.727) * [-148.532] (-158.449) (-146.689) (-156.630) -- 0:01:48
411500 -- [-159.654] (-155.716) (-145.085) (-151.884) * (-152.333) [-152.273] (-148.992) (-151.736) -- 0:01:48
412000 -- (-159.248) [-158.995] (-153.231) (-154.360) * [-151.345] (-153.958) (-147.248) (-155.519) -- 0:01:48
412500 -- (-154.762) (-160.535) [-159.122] (-160.647) * [-148.489] (-150.803) (-148.437) (-152.594) -- 0:01:48
413000 -- (-150.273) [-154.142] (-149.588) (-154.072) * (-150.446) [-150.856] (-151.640) (-152.044) -- 0:01:48
413500 -- (-154.733) (-158.925) [-151.175] (-156.311) * (-151.831) (-150.890) (-152.006) [-146.709] -- 0:01:47
414000 -- [-147.554] (-158.671) (-149.094) (-154.802) * [-153.199] (-161.122) (-148.373) (-155.380) -- 0:01:47
414500 -- [-153.870] (-152.251) (-153.329) (-150.294) * (-157.763) [-156.795] (-148.579) (-154.528) -- 0:01:47
415000 -- (-155.881) (-154.714) (-150.044) [-151.862] * (-157.788) (-154.948) [-148.154] (-152.234) -- 0:01:47
Average standard deviation of split frequencies: 0.015411
415500 -- (-154.019) (-158.560) [-147.353] (-157.216) * (-153.660) (-152.197) (-151.365) [-148.750] -- 0:01:46
416000 -- (-159.046) (-156.751) (-149.771) [-151.567] * [-153.289] (-157.023) (-156.144) (-155.980) -- 0:01:46
416500 -- (-156.218) (-153.556) [-147.737] (-157.918) * (-155.178) (-154.373) (-156.363) [-157.694] -- 0:01:47
417000 -- (-154.982) (-153.974) (-156.259) [-149.792] * [-147.159] (-159.591) (-155.490) (-153.589) -- 0:01:47
417500 -- [-149.377] (-153.409) (-165.751) (-157.712) * (-152.083) (-155.031) [-153.163] (-152.976) -- 0:01:47
418000 -- [-147.811] (-157.127) (-147.104) (-157.941) * (-161.284) (-151.059) (-158.754) [-147.850] -- 0:01:47
418500 -- [-153.854] (-152.733) (-147.282) (-156.684) * (-151.140) (-152.677) (-158.666) [-146.153] -- 0:01:46
419000 -- (-148.485) (-152.029) (-146.182) [-153.839] * (-154.641) (-153.894) (-158.405) [-148.420] -- 0:01:46
419500 -- [-147.356] (-155.954) (-146.373) (-151.229) * (-147.796) (-158.936) (-153.713) [-145.763] -- 0:01:46
420000 -- (-157.219) (-155.579) [-153.650] (-148.300) * [-154.583] (-161.954) (-154.077) (-151.918) -- 0:01:46
Average standard deviation of split frequencies: 0.016396
420500 -- [-153.901] (-154.467) (-148.014) (-154.472) * (-156.206) (-154.562) [-155.275] (-150.675) -- 0:01:46
421000 -- (-154.474) (-157.136) (-152.822) [-157.329] * [-150.122] (-157.612) (-150.095) (-156.203) -- 0:01:45
421500 -- (-149.549) (-161.586) (-157.717) [-152.634] * (-146.901) [-158.805] (-153.653) (-163.769) -- 0:01:45
422000 -- (-147.495) [-155.566] (-154.525) (-165.075) * (-153.119) (-167.244) (-155.101) [-153.747] -- 0:01:46
422500 -- [-158.686] (-160.669) (-161.401) (-150.165) * [-147.840] (-154.719) (-154.559) (-164.534) -- 0:01:46
423000 -- (-154.206) (-162.501) (-147.048) [-153.360] * (-152.561) [-151.653] (-157.312) (-155.569) -- 0:01:46
423500 -- (-157.920) (-157.838) (-152.165) [-144.469] * (-152.835) (-154.945) (-149.984) [-144.826] -- 0:01:46
424000 -- (-154.219) (-154.039) (-152.253) [-151.348] * [-143.985] (-150.245) (-152.333) (-153.432) -- 0:01:45
424500 -- (-158.310) (-156.071) (-149.355) [-152.066] * [-147.266] (-151.840) (-161.960) (-155.002) -- 0:01:45
425000 -- (-154.501) (-149.398) (-148.079) [-150.185] * (-152.148) (-154.327) (-157.554) [-149.002] -- 0:01:45
Average standard deviation of split frequencies: 0.015958
425500 -- (-150.648) (-153.316) [-154.277] (-152.722) * (-150.585) [-153.285] (-146.324) (-157.214) -- 0:01:45
426000 -- (-153.974) [-154.523] (-162.814) (-153.602) * (-157.258) (-146.207) [-146.180] (-161.459) -- 0:01:45
426500 -- (-157.291) (-153.420) (-150.362) [-148.308] * (-147.571) [-148.961] (-160.940) (-160.968) -- 0:01:44
427000 -- (-153.560) (-149.942) (-149.517) [-149.657] * (-152.010) (-151.437) [-153.660] (-147.424) -- 0:01:46
427500 -- (-156.018) (-155.312) (-154.333) [-146.990] * (-150.119) (-154.091) (-152.719) [-152.867] -- 0:01:45
428000 -- [-148.895] (-147.973) (-147.909) (-156.653) * [-154.097] (-150.361) (-148.542) (-156.827) -- 0:01:45
428500 -- [-146.373] (-153.958) (-159.985) (-150.712) * (-156.942) (-155.029) (-154.812) [-150.480] -- 0:01:45
429000 -- (-155.747) (-154.593) [-151.089] (-149.548) * (-156.509) [-151.325] (-151.666) (-153.340) -- 0:01:45
429500 -- [-156.339] (-148.070) (-156.504) (-153.505) * [-149.949] (-157.445) (-160.112) (-150.795) -- 0:01:44
430000 -- (-153.429) [-158.538] (-152.939) (-149.020) * (-150.632) (-150.166) (-148.614) [-147.575] -- 0:01:44
Average standard deviation of split frequencies: 0.015958
430500 -- (-151.939) (-157.356) [-147.958] (-144.406) * (-150.718) [-155.429] (-157.387) (-154.135) -- 0:01:44
431000 -- [-149.398] (-156.421) (-151.523) (-152.188) * (-156.512) (-162.255) (-156.187) [-146.477] -- 0:01:44
431500 -- (-156.200) (-156.211) (-157.186) [-144.815] * (-152.273) (-155.650) [-150.400] (-150.488) -- 0:01:44
432000 -- (-158.276) [-152.672] (-158.162) (-149.755) * [-146.388] (-162.864) (-150.701) (-154.525) -- 0:01:43
432500 -- (-156.720) (-154.792) [-154.535] (-148.962) * (-150.124) [-157.448] (-157.893) (-153.805) -- 0:01:44
433000 -- (-154.407) (-155.384) (-148.051) [-152.531] * (-158.642) (-154.552) (-153.563) [-148.981] -- 0:01:44
433500 -- [-154.387] (-161.901) (-148.199) (-152.916) * [-148.777] (-157.134) (-153.982) (-151.040) -- 0:01:44
434000 -- (-153.430) (-157.533) [-153.033] (-147.334) * (-149.449) [-150.363] (-158.825) (-147.796) -- 0:01:44
434500 -- (-157.750) (-153.577) [-144.337] (-152.247) * (-153.609) (-149.005) (-156.125) [-149.949] -- 0:01:44
435000 -- [-157.809] (-157.617) (-148.361) (-152.100) * [-150.675] (-150.954) (-158.396) (-151.315) -- 0:01:43
Average standard deviation of split frequencies: 0.015706
435500 -- (-155.505) [-149.420] (-154.302) (-149.709) * [-153.848] (-147.282) (-158.526) (-157.561) -- 0:01:43
436000 -- (-157.952) (-155.406) (-153.202) [-150.424] * (-155.353) (-151.156) [-148.392] (-148.625) -- 0:01:43
436500 -- (-156.726) [-151.061] (-154.264) (-153.192) * [-144.322] (-153.983) (-151.669) (-152.375) -- 0:01:43
437000 -- (-150.568) (-151.152) [-153.032] (-149.001) * [-150.651] (-152.206) (-156.119) (-142.302) -- 0:01:43
437500 -- (-155.389) (-158.024) (-145.413) [-158.396] * (-147.082) (-153.693) [-159.499] (-155.980) -- 0:01:42
438000 -- (-150.320) (-155.740) [-152.414] (-149.725) * (-146.628) (-154.445) (-145.178) [-149.308] -- 0:01:43
438500 -- (-155.228) (-155.267) [-148.802] (-148.481) * (-146.577) (-151.550) (-151.187) [-152.250] -- 0:01:43
439000 -- (-151.656) (-156.546) [-145.663] (-154.314) * (-153.945) [-145.622] (-154.521) (-149.755) -- 0:01:43
439500 -- (-158.066) [-149.226] (-150.701) (-151.452) * (-157.735) [-156.087] (-152.363) (-156.702) -- 0:01:43
440000 -- (-160.535) (-151.528) [-148.674] (-152.567) * (-151.116) (-158.381) [-146.459] (-149.471) -- 0:01:43
Average standard deviation of split frequencies: 0.014920
440500 -- (-161.130) [-150.271] (-151.541) (-156.448) * [-149.376] (-149.868) (-154.544) (-155.375) -- 0:01:42
441000 -- [-148.827] (-158.841) (-152.877) (-162.018) * [-147.223] (-154.237) (-153.126) (-161.063) -- 0:01:42
441500 -- (-154.166) (-156.771) [-152.401] (-161.578) * [-152.360] (-150.752) (-154.501) (-154.928) -- 0:01:42
442000 -- (-156.515) (-153.950) [-146.008] (-150.239) * (-154.247) (-154.787) [-148.168] (-155.491) -- 0:01:42
442500 -- (-158.022) [-147.985] (-155.073) (-146.682) * (-154.170) (-159.892) [-143.459] (-159.435) -- 0:01:42
443000 -- [-153.769] (-152.642) (-149.079) (-157.265) * (-152.132) (-152.205) (-153.256) [-149.738] -- 0:01:41
443500 -- (-150.329) (-157.120) [-154.959] (-154.021) * (-153.859) (-159.031) [-149.717] (-149.405) -- 0:01:42
444000 -- (-149.734) (-158.281) [-152.840] (-149.602) * (-157.166) (-147.992) [-149.846] (-151.432) -- 0:01:42
444500 -- (-152.590) (-158.665) (-150.651) [-148.333] * (-151.643) (-154.594) [-151.293] (-155.482) -- 0:01:42
445000 -- (-152.186) (-152.561) [-145.495] (-147.806) * [-145.094] (-155.985) (-154.238) (-152.704) -- 0:01:42
Average standard deviation of split frequencies: 0.014216
445500 -- (-159.680) [-147.542] (-153.295) (-156.067) * (-147.744) (-153.797) (-150.443) [-145.573] -- 0:01:42
446000 -- [-150.026] (-151.169) (-160.809) (-152.480) * (-147.310) (-158.250) [-147.891] (-147.049) -- 0:01:41
446500 -- (-156.823) (-150.385) (-148.809) [-149.991] * [-156.547] (-162.778) (-148.687) (-145.945) -- 0:01:41
447000 -- (-162.612) (-153.418) [-151.893] (-150.146) * (-162.741) [-148.255] (-153.013) (-161.772) -- 0:01:41
447500 -- (-153.521) (-155.357) [-154.217] (-152.780) * (-152.041) (-155.205) (-156.000) [-146.439] -- 0:01:41
448000 -- [-158.139] (-156.113) (-147.932) (-161.995) * [-151.461] (-150.408) (-162.129) (-154.029) -- 0:01:41
448500 -- (-148.498) (-149.353) (-149.097) [-154.274] * [-155.722] (-158.072) (-157.560) (-160.163) -- 0:01:42
449000 -- (-148.082) (-154.442) (-144.533) [-158.837] * (-145.527) [-146.282] (-154.649) (-154.052) -- 0:01:41
449500 -- [-149.337] (-154.806) (-143.840) (-156.598) * (-152.266) (-154.871) (-147.915) [-157.615] -- 0:01:41
450000 -- (-159.028) (-152.057) [-152.427] (-155.170) * (-155.293) (-155.847) [-152.903] (-153.041) -- 0:01:41
Average standard deviation of split frequencies: 0.013494
450500 -- (-157.738) (-156.428) [-149.071] (-154.018) * (-154.976) [-155.278] (-168.435) (-151.189) -- 0:01:41
451000 -- (-152.105) (-151.764) (-154.741) [-154.565] * (-151.269) (-150.808) [-149.079] (-153.764) -- 0:01:41
451500 -- (-149.202) (-149.831) (-147.648) [-156.573] * (-152.371) (-165.245) [-147.976] (-151.873) -- 0:01:40
452000 -- (-159.665) (-145.910) (-148.983) [-153.783] * (-153.803) (-158.004) [-150.361] (-156.023) -- 0:01:40
452500 -- (-151.345) (-154.983) [-152.291] (-157.834) * (-157.133) (-152.810) (-149.880) [-153.046] -- 0:01:40
453000 -- (-155.429) [-154.363] (-151.537) (-153.561) * (-152.404) (-150.491) (-152.584) [-148.155] -- 0:01:40
453500 -- (-155.227) [-147.833] (-145.766) (-149.923) * (-156.799) [-146.246] (-150.982) (-153.394) -- 0:01:40
454000 -- (-156.931) [-145.769] (-159.118) (-148.111) * [-153.105] (-149.129) (-152.229) (-157.634) -- 0:01:41
454500 -- (-151.486) (-151.745) [-158.833] (-153.192) * (-157.037) [-152.500] (-148.215) (-151.800) -- 0:01:40
455000 -- [-151.166] (-155.619) (-156.927) (-151.816) * (-158.481) [-153.741] (-153.029) (-150.266) -- 0:01:40
Average standard deviation of split frequencies: 0.012974
455500 -- (-157.875) (-153.029) (-151.958) [-149.271] * (-151.925) (-155.060) (-149.568) [-154.985] -- 0:01:40
456000 -- (-153.307) (-149.095) [-148.278] (-148.374) * (-155.981) (-153.374) [-144.831] (-147.170) -- 0:01:40
456500 -- [-150.747] (-160.185) (-153.475) (-154.850) * (-142.670) (-154.447) [-157.028] (-150.992) -- 0:01:40
457000 -- (-153.275) [-145.509] (-157.920) (-153.383) * (-153.036) (-145.243) [-150.869] (-153.974) -- 0:01:39
457500 -- (-155.189) (-152.265) (-156.949) [-150.892] * [-150.020] (-148.218) (-157.847) (-154.735) -- 0:01:39
458000 -- (-155.883) (-157.886) [-147.621] (-151.402) * (-155.143) (-156.940) (-150.171) [-151.605] -- 0:01:39
458500 -- (-149.195) (-146.332) [-156.418] (-158.577) * (-146.312) (-157.119) (-150.267) [-155.324] -- 0:01:39
459000 -- (-152.580) (-148.837) [-154.201] (-157.802) * (-149.397) (-159.337) [-149.107] (-151.079) -- 0:01:39
459500 -- (-157.051) [-148.229] (-156.823) (-156.506) * [-159.404] (-163.136) (-157.727) (-158.974) -- 0:01:39
460000 -- (-145.561) (-157.190) [-152.618] (-151.425) * (-154.129) [-156.685] (-158.083) (-152.178) -- 0:01:39
Average standard deviation of split frequencies: 0.012945
460500 -- [-149.646] (-146.665) (-150.425) (-162.757) * (-155.231) (-160.678) (-157.789) [-148.890] -- 0:01:39
461000 -- (-147.779) (-160.161) [-148.323] (-164.367) * [-159.183] (-156.836) (-154.372) (-149.065) -- 0:01:39
461500 -- (-152.146) (-161.354) [-156.204] (-154.698) * (-158.881) (-153.425) (-155.639) [-155.587] -- 0:01:39
462000 -- (-156.924) (-153.342) [-155.019] (-154.175) * [-151.541] (-149.210) (-161.681) (-152.711) -- 0:01:38
462500 -- (-155.288) [-153.432] (-154.536) (-155.371) * (-160.367) (-148.957) (-156.004) [-153.309] -- 0:01:38
463000 -- (-149.292) [-156.730] (-149.305) (-160.636) * (-152.757) [-151.887] (-153.243) (-162.167) -- 0:01:38
463500 -- (-153.795) (-151.514) [-148.602] (-160.302) * (-156.085) (-154.547) [-152.692] (-147.528) -- 0:01:38
464000 -- (-157.546) [-149.022] (-154.845) (-163.215) * [-154.233] (-154.070) (-152.751) (-158.637) -- 0:01:38
464500 -- [-146.854] (-152.588) (-145.020) (-159.782) * [-145.071] (-156.980) (-155.146) (-150.424) -- 0:01:37
465000 -- (-157.263) (-153.250) (-152.688) [-158.204] * (-153.893) (-156.098) (-162.284) [-146.753] -- 0:01:38
Average standard deviation of split frequencies: 0.012190
465500 -- (-157.015) [-150.708] (-156.522) (-150.266) * [-152.464] (-155.456) (-158.357) (-153.902) -- 0:01:38
466000 -- (-157.117) [-150.570] (-148.337) (-157.054) * (-146.233) (-148.208) (-159.119) [-158.304] -- 0:01:38
466500 -- (-153.966) [-154.283] (-151.147) (-153.512) * [-148.880] (-150.126) (-155.835) (-149.347) -- 0:01:38
467000 -- (-158.227) (-158.978) [-150.187] (-165.244) * (-154.797) (-158.469) (-158.386) [-158.216] -- 0:01:38
467500 -- [-148.658] (-147.785) (-151.229) (-152.614) * [-146.229] (-155.242) (-157.912) (-147.772) -- 0:01:37
468000 -- (-152.049) [-147.417] (-152.554) (-163.127) * (-150.910) (-150.970) [-158.411] (-156.227) -- 0:01:37
468500 -- [-154.177] (-146.719) (-149.748) (-160.180) * (-155.127) (-159.210) [-162.927] (-147.059) -- 0:01:37
469000 -- (-159.325) [-144.949] (-148.305) (-157.109) * [-148.672] (-151.258) (-150.638) (-148.909) -- 0:01:37
469500 -- [-153.132] (-147.308) (-154.193) (-149.294) * (-150.296) (-154.854) (-153.862) [-151.988] -- 0:01:37
470000 -- (-153.416) [-149.653] (-157.910) (-148.189) * [-150.014] (-154.853) (-150.080) (-149.780) -- 0:01:38
Average standard deviation of split frequencies: 0.011568
470500 -- (-148.872) [-153.301] (-156.769) (-156.370) * (-158.935) [-150.258] (-155.109) (-157.093) -- 0:01:37
471000 -- (-153.506) (-148.635) (-157.751) [-159.996] * (-158.545) [-151.112] (-153.789) (-155.251) -- 0:01:37
471500 -- (-153.589) [-145.851] (-155.929) (-168.536) * (-150.760) [-149.252] (-155.456) (-159.593) -- 0:01:37
472000 -- [-155.390] (-155.571) (-152.051) (-149.596) * (-154.306) [-153.748] (-156.098) (-152.121) -- 0:01:37
472500 -- (-158.447) (-146.259) [-148.341] (-159.446) * (-151.542) [-155.029] (-158.185) (-153.768) -- 0:01:37
473000 -- (-151.963) [-148.374] (-151.759) (-151.432) * (-152.654) (-150.288) (-158.645) [-142.794] -- 0:01:36
473500 -- [-147.110] (-152.992) (-153.091) (-152.733) * (-157.963) (-157.757) (-154.201) [-155.388] -- 0:01:36
474000 -- (-155.047) [-149.088] (-155.424) (-152.177) * [-146.917] (-163.305) (-160.803) (-154.132) -- 0:01:36
474500 -- (-160.259) (-148.430) (-154.996) [-145.527] * (-150.482) [-149.198] (-154.141) (-149.077) -- 0:01:36
475000 -- (-161.823) (-151.882) [-151.868] (-145.881) * (-152.984) (-157.862) (-157.931) [-152.206] -- 0:01:36
Average standard deviation of split frequencies: 0.012093
475500 -- (-151.651) (-154.173) [-146.116] (-151.325) * (-154.270) (-159.068) (-147.615) [-146.111] -- 0:01:37
476000 -- [-147.665] (-155.422) (-153.242) (-151.062) * (-150.491) (-162.102) [-147.110] (-157.927) -- 0:01:36
476500 -- (-152.996) (-151.669) [-149.226] (-145.646) * (-154.143) (-156.206) [-151.207] (-156.058) -- 0:01:36
477000 -- (-148.180) (-149.761) (-150.763) [-152.587] * (-156.756) (-144.963) (-149.583) [-149.933] -- 0:01:36
477500 -- [-148.957] (-155.406) (-151.560) (-159.559) * (-151.030) [-155.146] (-151.099) (-148.486) -- 0:01:36
478000 -- (-155.963) [-146.644] (-150.570) (-155.151) * (-151.891) [-155.473] (-150.445) (-148.326) -- 0:01:36
478500 -- [-145.018] (-155.682) (-155.116) (-148.941) * [-144.190] (-147.296) (-154.564) (-153.950) -- 0:01:35
479000 -- [-145.464] (-142.040) (-150.973) (-156.668) * [-149.657] (-149.014) (-154.954) (-152.163) -- 0:01:35
479500 -- (-154.150) (-154.492) [-150.331] (-151.711) * [-155.389] (-146.665) (-151.406) (-147.823) -- 0:01:35
480000 -- (-155.589) (-143.954) [-147.348] (-151.559) * [-147.096] (-146.351) (-156.138) (-157.638) -- 0:01:35
Average standard deviation of split frequencies: 0.012041
480500 -- (-150.738) (-145.931) [-145.607] (-148.841) * [-144.441] (-152.241) (-148.019) (-153.349) -- 0:01:35
481000 -- (-151.556) (-147.828) (-150.397) [-151.563] * (-156.737) [-149.865] (-150.416) (-159.140) -- 0:01:36
481500 -- (-158.785) [-153.884] (-156.121) (-150.771) * (-147.711) [-154.090] (-151.124) (-160.207) -- 0:01:35
482000 -- (-154.730) (-148.597) (-151.340) [-153.672] * (-159.871) (-160.772) [-151.196] (-157.925) -- 0:01:35
482500 -- (-155.445) [-145.309] (-149.996) (-150.225) * [-146.189] (-157.534) (-150.656) (-162.900) -- 0:01:35
483000 -- (-146.830) (-148.676) (-157.695) [-152.388] * (-151.532) [-151.770] (-156.780) (-162.729) -- 0:01:35
483500 -- [-152.309] (-155.311) (-158.187) (-156.108) * [-149.863] (-145.196) (-156.913) (-161.256) -- 0:01:35
484000 -- [-148.972] (-155.281) (-152.809) (-157.386) * (-157.280) [-147.198] (-153.317) (-163.673) -- 0:01:34
484500 -- (-155.611) (-158.351) [-148.157] (-150.297) * (-159.583) [-150.764] (-160.810) (-154.730) -- 0:01:34
485000 -- (-154.881) (-160.982) (-157.174) [-155.122] * [-149.973] (-148.630) (-160.410) (-152.706) -- 0:01:34
Average standard deviation of split frequencies: 0.012232
485500 -- (-150.061) [-156.839] (-162.399) (-158.875) * (-152.319) [-144.420] (-160.874) (-152.381) -- 0:01:34
486000 -- (-155.168) (-159.216) (-150.451) [-158.375] * (-146.882) (-154.540) [-148.525] (-147.291) -- 0:01:34
486500 -- (-145.574) (-156.986) [-152.151] (-158.037) * [-152.716] (-153.639) (-160.487) (-150.831) -- 0:01:34
487000 -- (-143.396) [-152.449] (-152.490) (-153.848) * (-151.205) (-156.700) (-158.198) [-147.390] -- 0:01:34
487500 -- (-158.420) [-148.036] (-147.756) (-153.603) * [-156.263] (-150.873) (-158.736) (-156.074) -- 0:01:34
488000 -- (-162.951) [-148.645] (-153.361) (-150.115) * (-150.758) [-151.888] (-154.334) (-157.124) -- 0:01:34
488500 -- (-149.529) (-147.850) (-150.497) [-156.672] * [-148.861] (-145.654) (-159.198) (-153.818) -- 0:01:34
489000 -- (-160.165) [-151.803] (-157.585) (-157.671) * (-148.674) [-148.764] (-159.847) (-148.204) -- 0:01:34
489500 -- (-152.315) (-147.251) (-155.086) [-154.760] * [-149.506] (-146.092) (-157.967) (-154.759) -- 0:01:33
490000 -- (-154.852) [-150.270] (-162.284) (-152.178) * (-150.045) (-152.459) [-154.748] (-156.876) -- 0:01:33
Average standard deviation of split frequencies: 0.012298
490500 -- (-151.976) [-148.163] (-157.068) (-158.304) * (-147.630) [-152.397] (-165.354) (-154.508) -- 0:01:33
491000 -- (-158.641) [-150.492] (-150.275) (-158.932) * (-153.792) [-147.689] (-159.796) (-159.291) -- 0:01:33
491500 -- [-150.345] (-158.423) (-165.851) (-146.959) * [-154.819] (-158.122) (-155.306) (-155.656) -- 0:01:33
492000 -- (-152.260) (-147.701) [-156.524] (-151.814) * (-158.877) (-151.276) (-153.658) [-144.665] -- 0:01:33
492500 -- (-150.418) (-157.582) [-159.907] (-158.201) * (-159.199) (-156.254) (-157.793) [-146.794] -- 0:01:33
493000 -- (-149.066) [-149.581] (-163.445) (-154.306) * (-154.946) [-154.252] (-151.906) (-154.614) -- 0:01:33
493500 -- [-148.962] (-156.066) (-161.130) (-148.101) * (-157.376) (-153.319) (-151.532) [-149.685] -- 0:01:33
494000 -- [-146.529] (-160.778) (-160.851) (-145.109) * (-152.346) (-156.860) [-152.553] (-155.288) -- 0:01:33
494500 -- (-151.021) [-158.415] (-163.858) (-151.708) * (-158.994) [-144.846] (-152.610) (-162.931) -- 0:01:33
495000 -- (-158.220) [-146.038] (-162.737) (-146.985) * [-150.987] (-151.879) (-153.340) (-152.948) -- 0:01:32
Average standard deviation of split frequencies: 0.011975
495500 -- (-154.124) (-159.793) [-160.748] (-149.991) * (-158.901) [-150.389] (-154.768) (-153.125) -- 0:01:32
496000 -- (-150.554) [-153.013] (-162.518) (-145.326) * (-150.631) (-148.341) (-153.206) [-145.777] -- 0:01:32
496500 -- (-155.252) (-152.924) (-167.948) [-152.965] * [-155.788] (-155.695) (-156.875) (-156.572) -- 0:01:32
497000 -- (-162.138) (-160.752) (-158.889) [-148.951] * (-156.843) (-148.711) (-154.114) [-151.113] -- 0:01:32
497500 -- (-149.965) [-146.806] (-157.611) (-144.588) * (-154.150) (-153.943) (-150.270) [-147.084] -- 0:01:32
498000 -- (-152.422) [-153.510] (-160.158) (-154.033) * (-155.574) (-151.873) (-145.618) [-146.230] -- 0:01:32
498500 -- (-151.511) [-152.471] (-154.560) (-147.757) * [-155.264] (-147.445) (-155.188) (-156.355) -- 0:01:32
499000 -- (-149.608) [-153.311] (-154.122) (-149.151) * (-148.793) (-147.415) [-153.728] (-151.485) -- 0:01:32
499500 -- [-152.113] (-160.119) (-152.381) (-152.810) * (-157.184) (-156.856) (-157.270) [-152.811] -- 0:01:32
500000 -- (-149.258) (-151.262) [-147.377] (-156.424) * (-152.743) (-150.959) (-151.520) [-155.550] -- 0:01:32
Average standard deviation of split frequencies: 0.011979
500500 -- [-151.515] (-144.923) (-152.741) (-148.198) * [-149.149] (-161.516) (-154.532) (-149.382) -- 0:01:31
501000 -- [-150.357] (-153.620) (-152.616) (-151.426) * [-152.874] (-160.166) (-155.047) (-154.478) -- 0:01:31
501500 -- [-148.839] (-150.188) (-151.234) (-149.066) * (-154.897) [-152.776] (-152.269) (-157.344) -- 0:01:31
502000 -- (-155.770) (-156.588) (-149.221) [-151.410] * [-149.441] (-148.391) (-154.143) (-153.857) -- 0:01:31
502500 -- (-156.805) (-150.029) (-149.051) [-151.277] * [-150.988] (-144.038) (-157.186) (-157.981) -- 0:01:31
503000 -- (-155.587) [-152.080] (-151.901) (-148.528) * (-152.518) [-151.625] (-154.326) (-152.600) -- 0:01:31
503500 -- (-151.537) [-151.432] (-147.144) (-157.165) * (-156.212) [-145.365] (-160.988) (-150.722) -- 0:01:31
504000 -- (-155.671) (-155.230) (-155.618) [-146.731] * (-158.503) [-148.205] (-154.839) (-154.821) -- 0:01:31
504500 -- (-154.100) (-155.135) (-162.494) [-151.284] * (-153.274) (-159.583) [-152.654] (-151.271) -- 0:01:31
505000 -- (-154.427) (-160.156) (-157.510) [-151.500] * [-148.972] (-153.699) (-154.867) (-159.598) -- 0:01:31
Average standard deviation of split frequencies: 0.011768
505500 -- (-150.322) (-157.762) [-148.660] (-153.535) * [-148.696] (-145.309) (-150.492) (-156.632) -- 0:01:30
506000 -- (-147.755) (-155.461) (-151.280) [-152.261] * (-157.221) [-151.192] (-148.695) (-151.379) -- 0:01:30
506500 -- [-148.286] (-150.278) (-151.371) (-152.662) * (-165.950) [-152.703] (-151.386) (-152.629) -- 0:01:30
507000 -- (-148.256) [-156.554] (-149.666) (-157.215) * (-153.104) (-155.296) [-146.303] (-152.685) -- 0:01:30
507500 -- (-147.086) [-150.681] (-153.646) (-160.985) * (-155.757) [-149.726] (-149.702) (-155.277) -- 0:01:30
508000 -- (-155.501) [-149.950] (-154.538) (-154.358) * [-156.490] (-146.994) (-149.272) (-151.044) -- 0:01:31
508500 -- (-161.393) (-154.665) (-150.292) [-148.314] * (-157.021) [-145.966] (-152.407) (-157.912) -- 0:01:30
509000 -- (-156.751) (-156.023) (-152.480) [-152.145] * [-154.508] (-147.274) (-153.988) (-163.553) -- 0:01:30
509500 -- (-160.679) (-153.239) [-155.938] (-154.123) * [-152.781] (-157.167) (-156.363) (-160.383) -- 0:01:30
510000 -- (-154.889) [-156.060] (-152.460) (-156.695) * (-150.368) (-148.881) [-158.589] (-156.933) -- 0:01:30
Average standard deviation of split frequencies: 0.011563
510500 -- (-155.890) [-150.508] (-150.861) (-152.992) * (-154.273) (-147.740) (-156.177) [-156.733] -- 0:01:30
511000 -- (-153.933) [-148.909] (-153.165) (-158.693) * (-149.625) [-150.741] (-163.926) (-151.668) -- 0:01:29
511500 -- (-146.308) (-150.759) (-155.978) [-150.487] * (-151.143) [-155.466] (-155.411) (-159.135) -- 0:01:29
512000 -- (-152.367) (-150.542) (-153.766) [-150.289] * [-156.248] (-152.687) (-155.507) (-157.092) -- 0:01:29
512500 -- (-152.895) (-146.083) (-148.964) [-150.656] * (-145.834) [-148.577] (-158.696) (-154.217) -- 0:01:29
513000 -- (-151.749) (-146.398) (-152.566) [-155.299] * [-147.153] (-154.730) (-152.882) (-158.978) -- 0:01:29
513500 -- (-157.684) [-146.306] (-154.717) (-157.625) * (-145.666) (-145.015) [-147.761] (-160.481) -- 0:01:30
514000 -- (-155.963) [-146.954] (-152.045) (-153.083) * (-156.290) (-144.864) (-151.795) [-159.957] -- 0:01:29
514500 -- (-150.169) (-148.177) [-145.372] (-147.096) * (-146.587) (-149.290) [-155.437] (-159.795) -- 0:01:29
515000 -- (-149.862) (-146.491) (-156.826) [-151.217] * (-151.856) [-147.271] (-162.240) (-162.828) -- 0:01:29
Average standard deviation of split frequencies: 0.011396
515500 -- (-147.138) [-146.820] (-157.621) (-159.307) * (-159.252) [-147.646] (-155.960) (-158.307) -- 0:01:29
516000 -- (-156.851) (-153.866) (-161.487) [-154.440] * (-151.795) (-159.329) (-155.121) [-161.539] -- 0:01:29
516500 -- (-157.991) (-154.747) (-152.102) [-149.880] * [-148.363] (-151.172) (-154.657) (-156.408) -- 0:01:28
517000 -- (-154.567) [-152.149] (-150.508) (-148.425) * (-154.837) (-154.993) (-153.806) [-156.987] -- 0:01:28
517500 -- [-154.278] (-149.793) (-157.614) (-155.650) * (-161.848) [-155.949] (-156.592) (-155.979) -- 0:01:28
518000 -- (-150.659) (-148.113) [-151.055] (-152.303) * (-157.469) (-153.740) (-153.497) [-155.641] -- 0:01:28
518500 -- (-150.679) [-154.569] (-156.345) (-159.073) * [-146.477] (-159.422) (-157.007) (-149.786) -- 0:01:28
519000 -- (-149.326) (-147.673) (-151.602) [-145.723] * (-149.718) (-155.021) [-153.883] (-155.160) -- 0:01:28
519500 -- (-152.813) [-145.851] (-150.050) (-147.325) * [-150.507] (-152.186) (-147.439) (-156.669) -- 0:01:28
520000 -- [-145.898] (-157.458) (-147.748) (-149.108) * (-154.883) (-156.253) (-152.244) [-148.395] -- 0:01:28
Average standard deviation of split frequencies: 0.011484
520500 -- (-155.611) [-146.871] (-148.450) (-151.411) * [-148.495] (-149.713) (-159.468) (-153.166) -- 0:01:28
521000 -- (-148.444) (-153.807) [-147.301] (-156.713) * [-147.500] (-146.713) (-156.389) (-152.282) -- 0:01:28
521500 -- (-147.190) (-148.079) [-147.928] (-154.046) * [-143.846] (-157.184) (-154.545) (-151.863) -- 0:01:28
522000 -- (-149.844) (-152.797) [-146.354] (-153.941) * (-155.870) (-153.729) (-156.602) [-155.711] -- 0:01:27
522500 -- (-147.435) (-163.153) [-151.204] (-153.392) * (-151.016) (-152.759) (-152.793) [-146.729] -- 0:01:27
523000 -- (-153.788) (-156.165) [-145.780] (-147.044) * [-150.559] (-149.255) (-150.677) (-150.361) -- 0:01:27
523500 -- (-153.897) (-156.206) (-155.941) [-145.388] * [-145.273] (-153.499) (-158.466) (-150.179) -- 0:01:27
524000 -- (-155.486) [-151.687] (-151.229) (-153.308) * [-146.434] (-158.394) (-151.328) (-154.454) -- 0:01:27
524500 -- (-156.439) (-147.986) (-154.672) [-144.960] * (-147.442) (-150.108) (-149.723) [-145.829] -- 0:01:27
525000 -- (-147.914) [-149.074] (-157.323) (-151.358) * [-148.009] (-160.460) (-146.593) (-158.408) -- 0:01:27
Average standard deviation of split frequencies: 0.011337
525500 -- (-153.972) [-151.821] (-149.045) (-153.122) * (-153.937) (-153.939) (-150.366) [-149.464] -- 0:01:27
526000 -- (-157.239) (-161.004) (-155.019) [-148.752] * [-147.220] (-155.408) (-152.995) (-148.645) -- 0:01:27
526500 -- (-164.150) (-155.792) [-153.621] (-155.294) * (-147.004) (-156.709) (-150.965) [-149.450] -- 0:01:27
527000 -- (-154.804) (-149.837) (-157.684) [-148.366] * (-149.638) (-157.446) [-146.586] (-144.429) -- 0:01:27
527500 -- (-150.920) (-147.130) [-151.142] (-156.570) * [-146.334] (-161.860) (-146.691) (-153.189) -- 0:01:26
528000 -- (-147.681) (-152.937) (-154.885) [-155.090] * [-146.190] (-154.770) (-154.420) (-154.928) -- 0:01:26
528500 -- (-153.487) (-149.775) [-151.392] (-155.959) * (-155.042) (-153.700) [-150.856] (-151.512) -- 0:01:26
529000 -- (-152.482) [-144.037] (-157.360) (-150.429) * (-154.924) [-154.664] (-149.522) (-159.327) -- 0:01:26
529500 -- (-154.153) (-151.392) (-152.551) [-156.508] * (-153.999) [-156.451] (-150.586) (-149.521) -- 0:01:26
530000 -- (-155.534) (-151.489) (-160.612) [-148.907] * (-152.510) (-157.910) (-150.534) [-144.789] -- 0:01:26
Average standard deviation of split frequencies: 0.011268
530500 -- [-148.623] (-150.400) (-157.953) (-154.320) * (-151.228) (-151.580) (-156.889) [-145.191] -- 0:01:26
531000 -- (-156.217) [-153.515] (-155.062) (-152.749) * (-160.065) (-150.556) (-154.396) [-145.662] -- 0:01:26
531500 -- (-154.086) (-151.205) [-153.905] (-153.318) * (-159.050) (-144.388) (-160.759) [-143.456] -- 0:01:26
532000 -- (-148.110) (-152.306) (-151.069) [-152.206] * (-160.738) [-149.235] (-153.387) (-148.267) -- 0:01:26
532500 -- [-149.376] (-150.467) (-161.152) (-155.068) * [-154.365] (-149.602) (-156.630) (-148.102) -- 0:01:26
533000 -- (-150.079) [-156.225] (-152.628) (-148.528) * (-152.783) [-148.690] (-154.737) (-148.159) -- 0:01:25
533500 -- [-154.381] (-158.000) (-154.832) (-151.880) * (-158.912) (-149.759) (-148.796) [-148.903] -- 0:01:25
534000 -- [-149.531] (-164.170) (-156.738) (-152.686) * (-156.607) (-145.665) [-148.480] (-150.178) -- 0:01:25
534500 -- (-160.596) [-156.553] (-151.520) (-153.669) * (-155.373) (-148.383) (-149.425) [-147.804] -- 0:01:25
535000 -- (-146.864) (-154.631) [-147.509] (-159.301) * (-153.456) [-153.020] (-154.121) (-153.915) -- 0:01:25
Average standard deviation of split frequencies: 0.011387
535500 -- [-149.615] (-147.805) (-147.986) (-149.665) * (-153.449) [-151.429] (-153.411) (-157.279) -- 0:01:25
536000 -- (-153.403) [-144.495] (-147.950) (-156.273) * [-156.217] (-153.325) (-156.701) (-162.705) -- 0:01:25
536500 -- (-151.435) [-146.212] (-150.196) (-156.904) * [-150.585] (-153.307) (-155.208) (-154.230) -- 0:01:25
537000 -- (-146.983) [-148.446] (-146.751) (-152.622) * [-144.272] (-149.650) (-144.987) (-156.996) -- 0:01:25
537500 -- (-148.885) (-157.234) (-147.888) [-149.909] * [-144.625] (-151.325) (-155.324) (-153.412) -- 0:01:25
538000 -- (-147.023) (-153.014) [-147.556] (-156.189) * [-148.276] (-145.481) (-161.445) (-150.772) -- 0:01:25
538500 -- [-150.534] (-155.723) (-154.532) (-152.168) * [-151.602] (-151.289) (-153.067) (-149.901) -- 0:01:24
539000 -- (-157.355) (-149.429) (-152.156) [-144.346] * (-147.291) (-160.680) [-152.504] (-153.712) -- 0:01:24
539500 -- (-149.270) [-153.532] (-155.688) (-149.526) * [-152.073] (-152.249) (-145.896) (-153.729) -- 0:01:24
540000 -- (-147.579) [-151.860] (-143.632) (-157.682) * [-147.999] (-157.750) (-145.964) (-148.170) -- 0:01:24
Average standard deviation of split frequencies: 0.011013
540500 -- (-150.358) [-149.622] (-147.085) (-146.972) * [-145.594] (-150.108) (-160.381) (-155.997) -- 0:01:25
541000 -- (-156.627) [-145.164] (-152.227) (-158.767) * (-149.552) (-152.449) [-152.713] (-159.537) -- 0:01:24
541500 -- (-151.899) [-147.545] (-150.895) (-146.524) * [-158.119] (-149.936) (-150.395) (-155.363) -- 0:01:24
542000 -- [-150.372] (-147.366) (-153.962) (-153.951) * (-157.728) [-156.278] (-152.734) (-151.805) -- 0:01:24
542500 -- (-149.574) [-148.561] (-152.758) (-154.491) * (-148.446) (-156.324) (-156.181) [-148.335] -- 0:01:24
543000 -- (-156.797) (-160.334) (-153.764) [-145.532] * [-149.174] (-149.697) (-155.409) (-154.491) -- 0:01:24
543500 -- (-154.397) (-157.773) [-145.998] (-157.198) * [-155.355] (-155.174) (-150.364) (-154.180) -- 0:01:23
544000 -- [-149.687] (-158.131) (-153.271) (-156.980) * [-149.889] (-154.778) (-149.348) (-154.902) -- 0:01:23
544500 -- [-155.336] (-159.510) (-153.390) (-150.032) * [-148.248] (-156.062) (-153.089) (-155.479) -- 0:01:23
545000 -- (-153.246) [-155.824] (-158.119) (-154.703) * (-154.303) [-153.685] (-148.626) (-153.471) -- 0:01:23
Average standard deviation of split frequencies: 0.010997
545500 -- (-155.953) (-158.079) (-151.369) [-152.912] * [-154.367] (-159.434) (-154.130) (-154.701) -- 0:01:23
546000 -- [-148.558] (-154.924) (-155.007) (-155.485) * (-153.688) [-148.376] (-153.712) (-146.564) -- 0:01:23
546500 -- (-152.741) (-145.775) (-149.698) [-154.035] * (-157.834) (-154.872) (-150.319) [-147.726] -- 0:01:23
547000 -- (-152.235) [-147.485] (-153.730) (-155.798) * [-149.592] (-148.510) (-153.903) (-156.454) -- 0:01:23
547500 -- (-142.680) [-151.145] (-153.128) (-161.075) * (-157.539) [-149.708] (-158.912) (-158.034) -- 0:01:23
548000 -- (-150.263) (-151.099) (-150.158) [-149.112] * [-147.100] (-158.447) (-159.850) (-149.087) -- 0:01:23
548500 -- (-153.490) (-151.422) [-148.520] (-149.913) * (-150.158) (-156.611) (-160.827) [-154.614] -- 0:01:23
549000 -- (-154.336) (-158.500) (-144.067) [-158.333] * (-145.962) [-151.052] (-151.321) (-153.963) -- 0:01:22
549500 -- [-151.351] (-144.953) (-150.284) (-154.816) * [-156.681] (-158.754) (-154.813) (-153.613) -- 0:01:22
550000 -- (-155.214) (-149.842) [-154.791] (-163.622) * (-158.852) (-157.103) (-158.700) [-147.183] -- 0:01:22
Average standard deviation of split frequencies: 0.011174
550500 -- (-150.809) (-154.865) [-154.702] (-155.686) * (-155.631) (-160.032) [-155.484] (-151.491) -- 0:01:22
551000 -- [-156.292] (-150.685) (-152.101) (-163.042) * [-145.004] (-158.244) (-148.201) (-148.560) -- 0:01:22
551500 -- (-156.306) (-158.431) [-153.399] (-159.614) * [-147.425] (-165.586) (-160.723) (-162.705) -- 0:01:22
552000 -- (-155.986) [-147.994] (-150.003) (-153.487) * (-152.251) (-158.939) (-155.195) [-149.380] -- 0:01:22
552500 -- [-153.411] (-156.195) (-151.853) (-156.987) * [-147.093] (-152.933) (-157.433) (-154.678) -- 0:01:22
553000 -- [-149.582] (-151.603) (-147.061) (-156.796) * [-153.999] (-158.552) (-148.343) (-151.418) -- 0:01:22
553500 -- [-147.503] (-154.323) (-153.951) (-161.682) * [-150.170] (-152.657) (-152.038) (-159.182) -- 0:01:22
554000 -- [-149.618] (-155.979) (-153.639) (-162.874) * [-144.239] (-146.112) (-150.218) (-156.544) -- 0:01:22
554500 -- (-148.218) [-151.948] (-151.525) (-149.097) * (-154.351) [-148.921] (-157.768) (-151.126) -- 0:01:21
555000 -- [-150.238] (-152.337) (-159.135) (-157.574) * [-145.120] (-157.735) (-148.719) (-152.899) -- 0:01:21
Average standard deviation of split frequencies: 0.011022
555500 -- (-153.144) (-162.412) [-152.714] (-148.191) * (-150.477) (-155.234) [-154.783] (-150.849) -- 0:01:21
556000 -- (-152.581) [-157.160] (-154.365) (-149.490) * [-143.614] (-151.280) (-146.251) (-150.213) -- 0:01:21
556500 -- [-152.230] (-159.083) (-155.404) (-153.709) * (-149.224) (-153.910) (-152.089) [-146.789] -- 0:01:21
557000 -- (-152.987) (-159.343) [-150.690] (-158.848) * (-149.372) (-157.125) (-152.843) [-148.322] -- 0:01:21
557500 -- (-155.733) (-154.154) [-157.931] (-152.047) * (-153.156) (-160.774) (-154.472) [-144.583] -- 0:01:21
558000 -- [-152.531] (-161.244) (-147.411) (-154.993) * (-156.571) [-157.183] (-155.524) (-152.704) -- 0:01:21
558500 -- (-154.226) (-152.528) [-155.573] (-160.190) * (-158.311) (-152.329) [-147.107] (-147.788) -- 0:01:21
559000 -- (-152.172) (-160.047) (-161.527) [-150.749] * [-152.243] (-157.544) (-150.033) (-154.357) -- 0:01:21
559500 -- (-155.533) (-159.842) (-155.189) [-150.543] * (-154.203) (-158.563) (-159.047) [-148.759] -- 0:01:21
560000 -- (-152.749) (-153.703) [-147.215] (-158.753) * (-158.542) (-156.042) [-147.591] (-154.215) -- 0:01:20
Average standard deviation of split frequencies: 0.010753
560500 -- (-155.015) [-159.894] (-155.125) (-157.734) * (-154.981) (-152.466) (-146.873) [-152.931] -- 0:01:20
561000 -- (-158.805) (-158.777) (-153.296) [-151.789] * [-153.007] (-153.560) (-153.592) (-151.952) -- 0:01:20
561500 -- (-148.213) [-150.038] (-150.216) (-147.758) * (-152.070) (-151.885) [-153.961] (-156.440) -- 0:01:20
562000 -- (-147.896) (-149.496) [-150.451] (-149.067) * (-154.438) (-157.780) [-150.139] (-159.458) -- 0:01:20
562500 -- [-147.269] (-154.643) (-151.999) (-154.171) * (-151.717) (-158.290) (-150.453) [-147.826] -- 0:01:20
563000 -- [-149.212] (-152.001) (-153.159) (-164.389) * (-151.528) (-149.430) [-156.609] (-148.864) -- 0:01:20
563500 -- (-157.455) (-164.289) [-153.076] (-156.285) * [-148.847] (-161.910) (-147.106) (-148.783) -- 0:01:20
564000 -- (-153.272) (-161.208) (-157.413) [-152.914] * (-147.822) (-154.850) (-164.472) [-148.773] -- 0:01:20
564500 -- (-148.934) (-157.149) [-151.490] (-152.700) * (-156.634) (-155.672) (-157.361) [-148.175] -- 0:01:20
565000 -- (-154.535) (-165.822) (-150.893) [-153.325] * (-147.261) [-152.081] (-151.911) (-155.540) -- 0:01:20
Average standard deviation of split frequencies: 0.011568
565500 -- [-151.284] (-163.314) (-152.956) (-149.702) * (-159.891) [-147.129] (-155.824) (-151.195) -- 0:01:19
566000 -- (-151.030) (-162.262) (-154.726) [-147.987] * (-159.347) (-158.829) [-148.739] (-144.583) -- 0:01:19
566500 -- (-148.885) [-148.446] (-155.228) (-158.283) * (-153.768) (-156.511) (-154.686) [-149.753] -- 0:01:19
567000 -- [-147.867] (-155.327) (-151.626) (-149.750) * (-153.688) [-147.380] (-159.739) (-152.309) -- 0:01:19
567500 -- [-149.598] (-157.376) (-156.793) (-155.775) * (-155.876) [-149.986] (-157.297) (-157.431) -- 0:01:19
568000 -- [-149.692] (-150.348) (-155.118) (-157.787) * (-156.727) [-153.208] (-154.356) (-147.446) -- 0:01:19
568500 -- (-158.257) (-157.193) (-151.809) [-160.590] * (-154.361) [-154.270] (-162.143) (-146.236) -- 0:01:19
569000 -- (-147.233) (-159.901) [-145.009] (-158.292) * (-155.158) [-154.156] (-156.699) (-153.293) -- 0:01:19
569500 -- (-148.692) (-154.409) (-151.373) [-146.597] * [-149.932] (-150.878) (-158.796) (-151.238) -- 0:01:19
570000 -- [-151.133] (-152.363) (-150.574) (-154.032) * (-147.670) (-149.927) [-155.053] (-149.801) -- 0:01:19
Average standard deviation of split frequencies: 0.011565
570500 -- (-150.046) (-155.619) [-149.717] (-148.280) * (-152.282) (-152.427) [-149.077] (-157.068) -- 0:01:19
571000 -- [-148.521] (-152.996) (-152.916) (-156.787) * (-155.943) (-156.379) [-158.667] (-154.527) -- 0:01:18
571500 -- (-156.066) [-146.888] (-156.082) (-155.901) * (-153.251) (-148.419) (-155.160) [-150.372] -- 0:01:18
572000 -- (-155.439) (-150.387) (-156.340) [-143.688] * (-158.902) (-153.986) (-147.634) [-149.270] -- 0:01:18
572500 -- [-150.960] (-154.816) (-158.310) (-159.064) * (-154.686) [-148.849] (-153.568) (-154.926) -- 0:01:18
573000 -- (-156.462) (-156.002) (-154.208) [-154.736] * (-155.483) (-146.250) (-150.324) [-151.335] -- 0:01:18
573500 -- [-155.935] (-152.219) (-148.623) (-149.139) * [-147.449] (-159.761) (-148.767) (-152.356) -- 0:01:18
574000 -- (-158.359) [-149.399] (-149.044) (-157.709) * (-155.073) (-150.688) [-151.819] (-149.793) -- 0:01:18
574500 -- (-152.848) (-165.384) (-155.902) [-145.238] * (-150.845) (-161.030) [-147.867] (-150.714) -- 0:01:18
575000 -- [-156.650] (-159.163) (-157.562) (-154.467) * (-151.823) (-154.254) (-152.852) [-160.708] -- 0:01:18
Average standard deviation of split frequencies: 0.011415
575500 -- (-157.116) [-152.454] (-154.888) (-151.723) * (-155.313) (-157.082) [-152.144] (-156.344) -- 0:01:18
576000 -- [-153.389] (-152.269) (-153.562) (-145.284) * (-158.422) (-158.758) (-155.824) [-149.139] -- 0:01:18
576500 -- (-152.747) (-163.660) [-153.358] (-154.460) * (-150.354) (-154.696) (-146.751) [-149.120] -- 0:01:17
577000 -- (-148.634) (-156.112) [-153.551] (-154.945) * [-145.373] (-158.509) (-150.184) (-149.632) -- 0:01:17
577500 -- (-151.215) (-163.907) (-156.010) [-148.034] * [-145.288] (-148.615) (-157.670) (-147.824) -- 0:01:17
578000 -- (-152.435) (-149.182) (-154.960) [-144.048] * (-150.556) [-147.708] (-153.497) (-144.822) -- 0:01:17
578500 -- (-150.095) (-146.909) [-149.476] (-155.671) * [-150.531] (-151.886) (-155.602) (-150.013) -- 0:01:17
579000 -- [-148.750] (-155.801) (-156.418) (-159.803) * [-149.873] (-162.126) (-159.729) (-148.595) -- 0:01:17
579500 -- (-152.142) (-161.848) [-154.480] (-160.212) * (-149.194) [-144.978] (-156.191) (-154.060) -- 0:01:17
580000 -- (-155.617) [-163.252] (-155.066) (-159.135) * (-157.563) [-145.620] (-153.360) (-150.785) -- 0:01:17
Average standard deviation of split frequencies: 0.011451
580500 -- (-153.758) (-160.346) (-156.335) [-148.595] * (-146.951) (-149.444) [-151.415] (-164.065) -- 0:01:17
581000 -- [-152.527] (-158.489) (-155.749) (-152.061) * (-154.364) (-145.809) [-141.242] (-150.694) -- 0:01:17
581500 -- [-149.403] (-157.688) (-151.384) (-154.925) * (-151.036) [-147.738] (-155.102) (-155.794) -- 0:01:17
582000 -- (-154.025) (-154.000) (-150.748) [-146.749] * (-155.560) [-143.345] (-143.879) (-154.232) -- 0:01:16
582500 -- (-149.533) (-151.034) [-152.541] (-146.927) * [-157.183] (-153.382) (-148.190) (-154.280) -- 0:01:16
583000 -- [-153.945] (-159.654) (-149.166) (-149.263) * (-152.327) (-154.080) [-147.492] (-152.180) -- 0:01:16
583500 -- [-148.361] (-148.039) (-149.229) (-156.442) * (-151.894) (-155.263) [-145.621] (-151.354) -- 0:01:16
584000 -- (-151.474) (-152.953) [-147.014] (-153.846) * [-152.025] (-156.407) (-151.565) (-158.825) -- 0:01:16
584500 -- (-154.715) [-146.138] (-148.306) (-147.143) * (-152.585) (-151.360) [-157.784] (-160.194) -- 0:01:16
585000 -- [-147.189] (-146.970) (-154.119) (-156.331) * [-149.359] (-151.405) (-155.828) (-150.130) -- 0:01:16
Average standard deviation of split frequencies: 0.011982
585500 -- (-154.362) (-156.630) [-146.300] (-154.507) * [-152.434] (-153.186) (-155.301) (-151.578) -- 0:01:16
586000 -- (-158.478) (-154.852) (-153.171) [-155.931] * [-152.918] (-156.396) (-158.981) (-147.559) -- 0:01:16
586500 -- (-156.650) (-152.994) (-154.590) [-149.647] * [-148.884] (-158.519) (-155.856) (-156.298) -- 0:01:16
587000 -- (-159.947) (-153.013) (-153.646) [-146.517] * (-160.002) (-155.041) (-153.835) [-148.102] -- 0:01:15
587500 -- [-157.117] (-150.739) (-150.354) (-151.571) * (-152.477) (-153.505) (-146.602) [-149.640] -- 0:01:15
588000 -- (-157.974) (-149.267) (-155.808) [-155.458] * (-148.742) [-151.642] (-147.285) (-157.403) -- 0:01:15
588500 -- (-159.268) (-146.885) (-151.032) [-153.872] * (-153.888) (-153.149) [-146.668] (-153.986) -- 0:01:15
589000 -- (-162.966) [-154.047] (-151.541) (-151.584) * [-153.464] (-157.511) (-152.559) (-151.176) -- 0:01:15
589500 -- (-154.454) [-157.771] (-150.964) (-146.925) * (-151.218) [-151.191] (-158.799) (-154.028) -- 0:01:15
590000 -- (-150.663) (-155.491) [-146.148] (-150.276) * (-148.967) (-155.895) [-155.535] (-159.916) -- 0:01:15
Average standard deviation of split frequencies: 0.012060
590500 -- (-150.639) (-153.759) [-151.181] (-150.343) * [-148.689] (-146.230) (-158.588) (-156.295) -- 0:01:15
591000 -- (-148.097) (-156.433) [-151.028] (-149.504) * (-150.473) [-156.739] (-155.173) (-151.448) -- 0:01:15
591500 -- [-151.727] (-160.870) (-153.263) (-148.512) * [-146.995] (-148.763) (-151.959) (-157.972) -- 0:01:15
592000 -- (-148.132) [-153.534] (-149.566) (-160.926) * (-145.024) [-152.154] (-151.252) (-163.161) -- 0:01:15
592500 -- (-159.304) (-153.248) [-154.080] (-155.297) * [-144.583] (-154.458) (-152.003) (-162.302) -- 0:01:14
593000 -- [-156.252] (-151.286) (-148.178) (-157.244) * (-144.066) (-158.648) (-157.883) [-155.857] -- 0:01:14
593500 -- (-153.693) [-153.536] (-153.072) (-153.655) * [-147.311] (-149.343) (-151.944) (-153.418) -- 0:01:14
594000 -- (-146.593) [-150.721] (-161.069) (-154.362) * (-147.066) (-151.572) [-157.148] (-148.680) -- 0:01:14
594500 -- (-149.804) [-150.181] (-153.199) (-157.437) * (-149.970) (-150.977) (-152.210) [-148.581] -- 0:01:14
595000 -- (-152.924) (-150.803) [-147.811] (-162.657) * (-151.722) [-154.410] (-161.320) (-152.771) -- 0:01:14
Average standard deviation of split frequencies: 0.012260
595500 -- [-159.433] (-152.528) (-152.400) (-153.120) * (-150.118) [-151.659] (-150.231) (-150.825) -- 0:01:14
596000 -- (-152.276) [-145.147] (-154.994) (-157.949) * [-150.014] (-150.309) (-155.923) (-155.552) -- 0:01:14
596500 -- (-153.779) [-154.188] (-154.802) (-159.339) * (-153.572) (-148.877) [-154.536] (-161.820) -- 0:01:14
597000 -- (-154.919) [-148.033] (-154.221) (-152.104) * (-149.419) (-150.514) (-157.655) [-150.998] -- 0:01:14
597500 -- (-151.235) (-154.772) (-155.343) [-151.646] * [-149.556] (-149.603) (-151.976) (-159.395) -- 0:01:14
598000 -- [-149.207] (-148.570) (-157.862) (-156.707) * (-155.702) [-159.478] (-150.275) (-155.210) -- 0:01:13
598500 -- [-151.797] (-148.827) (-155.427) (-153.129) * [-153.399] (-151.513) (-156.705) (-156.253) -- 0:01:13
599000 -- [-150.273] (-156.224) (-156.609) (-156.816) * [-161.592] (-149.043) (-158.642) (-153.618) -- 0:01:13
599500 -- [-153.112] (-151.622) (-156.937) (-164.080) * (-152.888) (-151.540) [-151.977] (-160.145) -- 0:01:13
600000 -- (-149.558) (-153.731) [-152.008] (-158.491) * (-157.779) (-159.848) [-147.659] (-151.173) -- 0:01:13
Average standard deviation of split frequencies: 0.012511
600500 -- [-144.412] (-156.343) (-152.373) (-155.480) * (-155.791) (-153.838) [-147.376] (-154.600) -- 0:01:13
601000 -- (-154.394) (-154.041) (-150.764) [-153.580] * [-158.437] (-156.136) (-148.708) (-151.794) -- 0:01:13
601500 -- (-152.052) (-153.957) [-151.489] (-153.459) * (-160.069) (-153.492) [-153.125] (-161.374) -- 0:01:13
602000 -- (-150.354) (-157.137) (-152.452) [-148.261] * (-162.229) (-154.712) [-153.989] (-145.499) -- 0:01:13
602500 -- [-147.230] (-157.302) (-150.972) (-154.372) * (-157.216) (-154.123) [-156.568] (-156.206) -- 0:01:13
603000 -- [-149.552] (-156.346) (-151.937) (-155.523) * [-161.108] (-152.582) (-152.122) (-160.741) -- 0:01:13
603500 -- [-146.551] (-154.502) (-155.234) (-157.151) * (-162.208) [-147.834] (-156.689) (-158.593) -- 0:01:12
604000 -- (-154.565) [-152.350] (-153.149) (-157.189) * (-159.376) [-150.611] (-153.730) (-155.967) -- 0:01:12
604500 -- (-143.385) (-156.571) (-148.761) [-150.087] * (-153.252) (-157.509) [-158.674] (-158.001) -- 0:01:12
605000 -- [-146.872] (-154.939) (-155.896) (-157.712) * (-156.694) (-157.367) [-147.176] (-155.865) -- 0:01:12
Average standard deviation of split frequencies: 0.011897
605500 -- [-144.762] (-147.791) (-154.195) (-154.707) * [-151.170] (-155.636) (-152.694) (-160.483) -- 0:01:12
606000 -- (-143.716) (-154.583) (-149.209) [-150.632] * (-156.315) (-147.759) [-157.501] (-152.918) -- 0:01:12
606500 -- (-147.261) (-150.473) [-153.800] (-153.458) * (-151.495) (-151.487) (-153.700) [-151.491] -- 0:01:12
607000 -- [-149.408] (-152.204) (-145.541) (-154.849) * (-151.397) (-146.505) [-154.807] (-149.399) -- 0:01:12
607500 -- (-154.995) (-146.568) (-153.180) [-151.094] * (-149.985) [-151.132] (-152.323) (-154.686) -- 0:01:12
608000 -- (-158.425) (-150.384) (-150.245) [-153.461] * (-154.597) (-145.423) (-146.590) [-151.739] -- 0:01:12
608500 -- (-151.889) (-148.576) [-147.941] (-147.376) * (-154.112) (-152.025) [-151.520] (-152.270) -- 0:01:12
609000 -- [-152.555] (-156.079) (-160.001) (-154.496) * (-159.525) (-151.646) [-155.394] (-157.171) -- 0:01:11
609500 -- (-157.706) (-158.958) [-146.543] (-165.334) * (-166.071) [-152.643] (-154.060) (-156.467) -- 0:01:11
610000 -- [-150.819] (-159.343) (-156.467) (-151.711) * (-168.834) (-154.407) [-147.710] (-153.896) -- 0:01:11
Average standard deviation of split frequencies: 0.011365
610500 -- (-150.412) [-151.449] (-151.539) (-151.966) * (-157.764) (-161.396) [-148.753] (-155.329) -- 0:01:11
611000 -- (-159.390) (-149.701) [-156.662] (-154.007) * (-153.283) [-156.075] (-158.154) (-154.352) -- 0:01:11
611500 -- (-151.217) [-153.030] (-154.512) (-153.944) * [-143.163] (-147.832) (-158.605) (-153.520) -- 0:01:11
612000 -- [-151.396] (-153.971) (-153.557) (-156.577) * [-145.752] (-154.231) (-149.313) (-164.170) -- 0:01:11
612500 -- (-155.133) [-148.595] (-153.536) (-158.766) * [-148.648] (-159.345) (-160.593) (-157.918) -- 0:01:11
613000 -- (-152.094) [-151.517] (-157.007) (-151.746) * (-152.786) (-151.071) (-147.603) [-154.119] -- 0:01:11
613500 -- [-151.027] (-149.878) (-155.975) (-160.599) * (-151.298) [-151.254] (-151.034) (-154.967) -- 0:01:11
614000 -- [-147.970] (-156.078) (-155.524) (-151.414) * (-159.264) (-155.962) [-147.287] (-151.877) -- 0:01:11
614500 -- (-156.646) [-150.959] (-158.783) (-153.921) * [-145.912] (-155.008) (-155.166) (-147.389) -- 0:01:10
615000 -- [-145.125] (-149.033) (-158.884) (-154.095) * [-150.157] (-158.531) (-152.594) (-148.797) -- 0:01:10
Average standard deviation of split frequencies: 0.011029
615500 -- (-155.350) [-151.576] (-158.240) (-156.586) * (-146.572) (-151.452) [-152.649] (-152.757) -- 0:01:10
616000 -- (-153.751) [-154.800] (-149.949) (-152.529) * [-156.507] (-159.920) (-153.825) (-153.465) -- 0:01:10
616500 -- (-160.774) [-153.148] (-149.875) (-155.843) * (-152.555) [-149.552] (-151.598) (-150.658) -- 0:01:10
617000 -- (-156.360) (-156.366) (-157.551) [-155.178] * (-149.375) (-155.378) (-154.199) [-145.893] -- 0:01:10
617500 -- [-158.234] (-155.306) (-152.065) (-157.115) * (-156.686) (-161.480) (-152.855) [-148.099] -- 0:01:10
618000 -- (-154.612) (-150.349) (-150.737) [-153.714] * [-150.695] (-150.264) (-154.043) (-153.882) -- 0:01:10
618500 -- (-160.204) (-155.220) [-153.810] (-161.827) * (-150.423) (-154.092) [-152.540] (-148.608) -- 0:01:10
619000 -- [-152.607] (-150.707) (-147.705) (-151.298) * [-149.121] (-161.291) (-156.846) (-153.960) -- 0:01:10
619500 -- [-148.592] (-152.511) (-146.634) (-154.319) * (-153.508) (-152.563) [-153.096] (-157.498) -- 0:01:10
620000 -- [-154.936] (-158.869) (-162.232) (-149.733) * [-151.686] (-152.073) (-154.196) (-156.888) -- 0:01:09
Average standard deviation of split frequencies: 0.011169
620500 -- (-148.326) (-151.902) [-149.354] (-156.962) * (-158.646) (-152.455) [-150.973] (-149.353) -- 0:01:09
621000 -- (-150.255) (-152.673) (-156.162) [-149.932] * (-157.052) [-146.269] (-149.032) (-154.825) -- 0:01:09
621500 -- (-143.005) (-156.877) (-160.611) [-154.534] * (-162.970) (-157.310) (-148.387) [-150.478] -- 0:01:09
622000 -- (-149.339) (-157.503) [-153.578] (-151.350) * (-157.512) [-154.153] (-156.336) (-154.439) -- 0:01:09
622500 -- (-157.770) [-148.463] (-150.169) (-157.264) * (-154.751) (-154.339) (-148.130) [-154.993] -- 0:01:09
623000 -- [-151.428] (-153.420) (-151.374) (-150.923) * (-151.673) (-150.080) (-158.050) [-146.948] -- 0:01:09
623500 -- [-151.683] (-154.620) (-150.998) (-157.730) * (-151.877) (-148.661) [-149.957] (-152.232) -- 0:01:09
624000 -- (-155.991) [-148.659] (-152.515) (-150.267) * [-148.022] (-158.685) (-155.204) (-149.581) -- 0:01:09
624500 -- (-156.115) (-152.393) [-147.541] (-160.307) * [-146.356] (-153.890) (-147.255) (-153.606) -- 0:01:09
625000 -- [-149.277] (-146.232) (-155.488) (-153.432) * [-149.398] (-151.543) (-150.533) (-157.279) -- 0:01:09
Average standard deviation of split frequencies: 0.011296
625500 -- (-149.059) (-150.639) [-151.421] (-156.154) * (-151.243) (-155.856) [-152.720] (-150.932) -- 0:01:08
626000 -- (-150.477) (-152.521) [-144.049] (-153.731) * (-154.587) [-148.238] (-157.630) (-155.055) -- 0:01:08
626500 -- (-151.652) (-149.850) [-153.180] (-150.511) * (-148.071) (-157.315) (-155.044) [-151.721] -- 0:01:08
627000 -- (-153.703) (-159.505) [-151.131] (-160.234) * (-152.539) [-151.222] (-159.058) (-152.958) -- 0:01:08
627500 -- (-156.392) [-149.553] (-156.833) (-156.507) * (-156.532) [-151.597] (-148.508) (-155.571) -- 0:01:08
628000 -- (-152.816) (-148.494) (-157.044) [-155.499] * (-158.060) [-150.058] (-153.250) (-157.816) -- 0:01:08
628500 -- (-153.296) (-157.649) (-154.236) [-154.989] * (-147.200) (-156.413) [-154.808] (-153.181) -- 0:01:08
629000 -- (-156.149) (-149.707) [-153.185] (-146.831) * (-153.003) (-151.166) (-148.965) [-149.539] -- 0:01:08
629500 -- (-149.602) (-150.896) (-154.667) [-150.516] * (-149.305) [-154.907] (-148.991) (-149.338) -- 0:01:08
630000 -- (-153.275) (-157.986) [-148.845] (-159.271) * (-157.025) [-152.015] (-148.032) (-153.551) -- 0:01:08
Average standard deviation of split frequencies: 0.011432
630500 -- (-156.035) [-148.353] (-150.999) (-152.393) * (-149.004) [-155.237] (-150.778) (-157.541) -- 0:01:07
631000 -- (-150.853) [-155.032] (-154.963) (-150.666) * [-153.596] (-155.664) (-154.160) (-148.970) -- 0:01:07
631500 -- [-152.081] (-152.099) (-157.141) (-151.897) * (-155.618) (-150.584) (-154.357) [-152.934] -- 0:01:07
632000 -- (-149.791) (-167.381) (-150.830) [-154.932] * (-156.068) (-156.719) (-153.992) [-153.601] -- 0:01:07
632500 -- (-152.792) (-153.033) [-152.050] (-158.325) * (-156.478) (-158.368) [-152.926] (-159.091) -- 0:01:07
633000 -- (-155.464) (-155.850) [-149.543] (-147.603) * (-148.887) (-161.791) [-146.523] (-158.162) -- 0:01:07
633500 -- (-150.258) (-155.002) (-158.842) [-145.855] * (-157.289) (-155.826) [-154.454] (-146.495) -- 0:01:07
634000 -- (-149.922) [-148.196] (-152.753) (-155.069) * (-147.078) (-149.416) [-147.893] (-155.854) -- 0:01:07
634500 -- (-153.065) [-150.512] (-163.789) (-150.891) * [-148.096] (-156.394) (-154.733) (-156.581) -- 0:01:07
635000 -- (-151.134) [-145.147] (-157.827) (-159.243) * (-153.373) (-150.906) [-153.781] (-151.532) -- 0:01:07
Average standard deviation of split frequencies: 0.011031
635500 -- (-150.652) (-149.948) (-156.338) [-148.162] * [-150.783] (-147.900) (-157.117) (-152.229) -- 0:01:07
636000 -- (-149.913) [-148.809] (-153.361) (-158.613) * [-148.394] (-151.914) (-154.196) (-153.603) -- 0:01:06
636500 -- (-155.390) [-146.233] (-154.677) (-150.719) * (-156.862) [-149.940] (-152.609) (-157.184) -- 0:01:06
637000 -- (-153.956) [-159.837] (-152.114) (-148.942) * (-151.712) (-152.237) [-149.092] (-150.355) -- 0:01:06
637500 -- [-152.180] (-156.644) (-155.842) (-149.481) * (-147.225) (-150.386) [-147.950] (-153.660) -- 0:01:06
638000 -- (-154.843) (-152.457) (-152.012) [-153.440] * (-151.256) (-148.437) [-150.965] (-160.791) -- 0:01:06
638500 -- (-152.348) [-150.467] (-155.283) (-150.485) * (-152.474) (-159.540) (-149.440) [-154.662] -- 0:01:06
639000 -- (-155.155) [-153.854] (-159.776) (-154.430) * (-158.743) (-153.155) [-146.307] (-151.289) -- 0:01:06
639500 -- (-154.595) [-148.410] (-154.177) (-151.988) * (-156.348) [-144.713] (-160.902) (-153.187) -- 0:01:06
640000 -- (-153.581) [-155.380] (-152.977) (-163.593) * (-157.223) (-148.942) [-146.423] (-155.363) -- 0:01:06
Average standard deviation of split frequencies: 0.010864
640500 -- [-147.512] (-156.172) (-151.147) (-152.955) * [-143.465] (-154.046) (-148.260) (-157.114) -- 0:01:06
641000 -- (-150.307) (-149.900) (-156.774) [-156.270] * (-144.953) (-150.609) (-146.170) [-146.645] -- 0:01:06
641500 -- (-150.121) (-152.829) [-155.456] (-146.060) * [-148.485] (-154.313) (-154.248) (-158.235) -- 0:01:05
642000 -- (-150.965) (-156.027) (-161.231) [-156.027] * [-146.771] (-148.891) (-150.008) (-151.125) -- 0:01:05
642500 -- (-152.609) [-145.805] (-157.993) (-150.677) * (-156.801) (-153.136) (-157.272) [-149.243] -- 0:01:05
643000 -- [-151.015] (-150.619) (-155.331) (-159.145) * (-151.218) [-144.996] (-150.051) (-163.343) -- 0:01:05
643500 -- (-159.773) [-148.853] (-157.148) (-155.051) * (-149.360) [-149.952] (-152.376) (-151.185) -- 0:01:05
644000 -- (-160.885) (-155.098) [-155.648] (-158.414) * (-155.901) (-155.227) [-148.185] (-158.977) -- 0:01:05
644500 -- [-157.752] (-155.320) (-153.919) (-149.820) * (-151.002) (-142.880) [-153.747] (-152.741) -- 0:01:05
645000 -- (-154.341) (-152.450) [-153.308] (-152.546) * (-156.438) [-150.124] (-156.509) (-146.847) -- 0:01:05
Average standard deviation of split frequencies: 0.010946
645500 -- (-153.611) [-145.254] (-152.200) (-158.183) * (-155.937) (-155.350) (-149.800) [-154.205] -- 0:01:05
646000 -- (-156.337) (-150.762) [-154.572] (-155.246) * (-154.125) (-147.098) (-154.315) [-156.836] -- 0:01:05
646500 -- (-159.151) [-151.729] (-148.126) (-156.605) * [-155.097] (-153.340) (-158.161) (-154.514) -- 0:01:05
647000 -- [-147.916] (-146.882) (-153.576) (-152.829) * (-158.352) (-154.133) [-160.828] (-148.411) -- 0:01:04
647500 -- (-158.722) (-157.003) (-152.460) [-145.988] * (-158.815) [-150.057] (-159.073) (-150.522) -- 0:01:04
648000 -- (-159.597) [-146.880] (-155.835) (-152.229) * (-149.592) [-150.819] (-150.789) (-158.053) -- 0:01:04
648500 -- (-150.738) (-151.493) [-149.596] (-161.617) * (-147.423) (-151.861) (-156.078) [-154.831] -- 0:01:04
649000 -- (-156.281) (-149.594) (-152.872) [-156.191] * [-146.908] (-154.730) (-150.912) (-161.160) -- 0:01:04
649500 -- [-154.586] (-150.693) (-147.184) (-151.278) * [-153.163] (-150.151) (-146.747) (-158.110) -- 0:01:04
650000 -- (-159.133) (-152.586) (-154.554) [-147.322] * (-158.825) [-144.055] (-153.160) (-155.647) -- 0:01:04
Average standard deviation of split frequencies: 0.010654
650500 -- (-162.268) (-154.633) [-160.743] (-148.096) * (-158.178) (-150.188) [-149.339] (-149.653) -- 0:01:04
651000 -- (-160.504) [-153.848] (-156.741) (-153.162) * (-154.591) [-145.287] (-163.115) (-144.548) -- 0:01:04
651500 -- (-156.063) (-153.758) (-149.218) [-157.073] * (-154.055) [-149.478] (-158.853) (-150.392) -- 0:01:04
652000 -- (-149.245) (-153.167) [-149.702] (-149.736) * [-146.466] (-156.411) (-154.165) (-150.057) -- 0:01:04
652500 -- (-150.643) (-162.395) [-149.125] (-152.160) * (-154.180) (-147.776) (-149.701) [-152.513] -- 0:01:03
653000 -- (-157.236) (-152.268) [-150.607] (-155.586) * (-153.928) (-154.947) [-147.043] (-145.639) -- 0:01:03
653500 -- [-148.826] (-154.393) (-159.180) (-158.837) * (-148.005) (-149.324) (-150.390) [-146.059] -- 0:01:03
654000 -- [-147.811] (-148.408) (-155.239) (-150.954) * (-160.198) (-148.851) (-144.572) [-146.496] -- 0:01:03
654500 -- (-148.675) [-152.498] (-153.659) (-149.795) * (-156.935) (-150.549) [-155.716] (-146.231) -- 0:01:03
655000 -- [-144.325] (-144.981) (-152.807) (-149.924) * [-152.258] (-150.222) (-148.488) (-145.621) -- 0:01:03
Average standard deviation of split frequencies: 0.010737
655500 -- (-156.087) [-152.123] (-156.918) (-156.330) * (-154.870) [-151.329] (-152.170) (-149.405) -- 0:01:03
656000 -- (-158.025) (-153.895) (-154.666) [-147.415] * (-149.219) (-161.367) (-153.222) [-148.602] -- 0:01:03
656500 -- (-160.573) (-156.712) (-150.077) [-149.867] * (-156.100) (-154.634) (-151.496) [-154.444] -- 0:01:03
657000 -- (-159.195) (-160.917) [-148.968] (-149.047) * [-154.629] (-150.836) (-155.679) (-146.722) -- 0:01:03
657500 -- (-151.878) (-157.501) [-151.532] (-153.853) * (-149.768) (-154.809) (-159.236) [-145.003] -- 0:01:03
658000 -- (-153.082) (-161.651) [-149.622] (-155.908) * (-151.839) (-147.565) [-144.331] (-146.106) -- 0:01:02
658500 -- (-151.803) (-156.220) [-144.517] (-157.700) * (-160.349) (-151.424) [-150.871] (-154.827) -- 0:01:02
659000 -- (-150.775) [-151.671] (-147.339) (-155.450) * (-149.786) [-155.339] (-157.001) (-154.972) -- 0:01:02
659500 -- (-150.132) (-157.467) [-147.004] (-154.331) * [-153.946] (-150.678) (-158.520) (-154.438) -- 0:01:02
660000 -- (-149.770) (-156.715) [-144.218] (-153.811) * (-149.440) [-152.570] (-148.163) (-147.374) -- 0:01:02
Average standard deviation of split frequencies: 0.010493
660500 -- (-151.002) (-148.155) (-151.625) [-150.325] * (-154.762) [-148.934] (-147.968) (-156.360) -- 0:01:02
661000 -- (-153.633) [-148.196] (-146.061) (-152.206) * (-157.191) (-155.583) (-153.517) [-152.550] -- 0:01:02
661500 -- (-150.054) [-149.494] (-158.160) (-151.587) * [-148.357] (-150.451) (-152.477) (-147.782) -- 0:01:02
662000 -- (-157.679) [-151.759] (-152.088) (-156.642) * (-154.841) (-153.059) [-150.137] (-150.763) -- 0:01:02
662500 -- [-147.791] (-152.050) (-153.818) (-151.730) * (-154.571) (-152.588) (-158.635) [-154.458] -- 0:01:02
663000 -- (-158.235) (-154.493) (-158.207) [-150.117] * (-162.275) (-154.261) [-146.913] (-151.921) -- 0:01:02
663500 -- [-146.625] (-156.579) (-149.403) (-150.656) * (-158.758) (-151.388) [-145.575] (-147.892) -- 0:01:01
664000 -- (-149.669) (-153.660) (-147.093) [-152.379] * (-156.629) (-148.457) (-157.254) [-147.056] -- 0:01:01
664500 -- (-151.792) (-152.152) (-150.924) [-147.594] * [-148.378] (-151.934) (-149.067) (-148.918) -- 0:01:01
665000 -- (-161.064) [-152.357] (-150.406) (-147.397) * (-150.065) (-150.696) (-149.699) [-144.156] -- 0:01:01
Average standard deviation of split frequencies: 0.011075
665500 -- (-154.313) (-152.923) (-160.440) [-149.155] * (-148.791) [-148.808] (-156.012) (-150.754) -- 0:01:01
666000 -- (-158.869) [-149.177] (-158.126) (-152.026) * (-146.261) [-148.841] (-148.834) (-150.502) -- 0:01:01
666500 -- (-150.703) [-147.566] (-154.594) (-147.629) * (-153.023) (-150.749) (-152.126) [-149.035] -- 0:01:01
667000 -- (-149.235) [-146.531] (-155.546) (-158.437) * [-154.125] (-148.776) (-147.581) (-152.328) -- 0:01:01
667500 -- (-150.821) (-148.287) (-159.727) [-149.524] * [-150.311] (-150.038) (-150.950) (-156.506) -- 0:01:01
668000 -- (-160.477) [-158.780] (-155.902) (-148.560) * (-148.778) (-146.196) [-146.775] (-154.206) -- 0:01:01
668500 -- [-149.747] (-144.388) (-154.855) (-153.646) * (-153.602) [-146.133] (-147.130) (-151.926) -- 0:01:00
669000 -- (-158.303) [-144.911] (-160.332) (-144.192) * [-146.577] (-146.047) (-155.526) (-146.468) -- 0:01:00
669500 -- (-153.434) [-145.015] (-153.204) (-145.741) * [-146.450] (-148.639) (-153.229) (-147.214) -- 0:01:00
670000 -- (-153.641) (-153.002) (-155.493) [-146.030] * (-144.372) (-149.908) (-152.589) [-151.413] -- 0:01:00
Average standard deviation of split frequencies: 0.011288
670500 -- [-152.373] (-152.009) (-151.174) (-154.910) * (-151.371) (-158.507) (-153.824) [-150.353] -- 0:01:00
671000 -- [-154.970] (-151.774) (-159.201) (-162.132) * (-147.593) [-158.623] (-154.338) (-157.355) -- 0:01:00
671500 -- (-153.765) (-155.033) [-153.220] (-157.415) * (-156.099) (-157.349) (-152.139) [-148.096] -- 0:01:00
672000 -- (-150.836) [-154.860] (-156.105) (-158.485) * (-157.740) (-153.618) (-147.097) [-159.555] -- 0:01:00
672500 -- (-147.140) [-141.760] (-156.002) (-154.834) * [-151.303] (-154.394) (-152.602) (-153.994) -- 0:01:00
673000 -- (-155.317) [-145.531] (-157.802) (-155.846) * (-150.304) (-148.098) (-152.291) [-159.980] -- 0:01:00
673500 -- (-151.384) (-144.862) (-152.453) [-149.695] * (-150.153) (-158.350) (-148.931) [-152.547] -- 0:01:00
674000 -- [-150.577] (-146.582) (-156.612) (-159.266) * (-160.124) (-155.106) (-155.767) [-144.816] -- 0:00:59
674500 -- (-155.175) [-147.176] (-152.068) (-155.937) * (-150.141) [-150.757] (-163.306) (-152.127) -- 0:00:59
675000 -- [-150.088] (-146.264) (-150.996) (-154.295) * [-149.090] (-150.792) (-154.662) (-152.687) -- 0:00:59
Average standard deviation of split frequencies: 0.011732
675500 -- [-151.460] (-150.929) (-150.039) (-150.266) * (-146.834) [-145.914] (-159.731) (-148.130) -- 0:00:59
676000 -- (-149.846) (-151.445) (-150.414) [-146.147] * (-160.801) (-154.960) (-151.300) [-149.996] -- 0:00:59
676500 -- (-158.379) (-153.297) (-154.002) [-143.054] * (-148.677) (-157.148) [-151.271] (-149.147) -- 0:00:59
677000 -- (-153.849) (-156.000) [-148.302] (-151.393) * (-149.148) (-158.549) (-150.203) [-156.006] -- 0:00:59
677500 -- (-160.954) (-149.130) [-145.198] (-158.640) * [-156.549] (-152.320) (-156.336) (-153.192) -- 0:00:59
678000 -- (-148.618) (-150.159) (-151.964) [-155.582] * (-153.067) [-152.835] (-150.769) (-147.696) -- 0:00:59
678500 -- (-149.308) (-150.351) (-159.913) [-154.361] * (-150.296) [-145.406] (-158.647) (-147.342) -- 0:00:59
679000 -- (-150.908) (-154.930) (-152.357) [-147.143] * [-151.747] (-148.935) (-159.637) (-157.938) -- 0:00:59
679500 -- [-159.037] (-155.504) (-152.658) (-159.917) * (-155.714) (-149.580) (-154.545) [-159.795] -- 0:00:58
680000 -- (-158.087) (-154.243) (-162.490) [-146.434] * [-154.604] (-150.149) (-156.879) (-150.858) -- 0:00:58
Average standard deviation of split frequencies: 0.011733
680500 -- [-153.962] (-152.980) (-157.393) (-148.124) * (-146.727) (-148.645) [-146.423] (-152.264) -- 0:00:58
681000 -- (-155.791) [-146.405] (-163.031) (-153.083) * [-151.754] (-151.757) (-150.378) (-155.370) -- 0:00:58
681500 -- (-152.366) (-148.914) [-148.387] (-146.214) * [-147.209] (-153.411) (-159.300) (-153.909) -- 0:00:58
682000 -- (-153.362) [-147.526] (-157.994) (-150.699) * [-147.363] (-150.240) (-158.842) (-157.786) -- 0:00:58
682500 -- (-154.803) (-157.274) (-158.405) [-151.177] * [-149.862] (-152.369) (-154.717) (-149.122) -- 0:00:58
683000 -- (-149.160) (-158.546) (-157.290) [-145.876] * [-156.019] (-156.578) (-156.926) (-149.283) -- 0:00:58
683500 -- (-154.606) (-146.369) (-161.311) [-144.156] * [-144.239] (-155.133) (-158.719) (-151.837) -- 0:00:58
684000 -- (-150.516) [-147.410] (-153.592) (-150.561) * (-145.882) (-157.808) (-158.055) [-151.228] -- 0:00:58
684500 -- (-147.737) (-144.750) [-146.615] (-149.130) * [-148.344] (-152.169) (-152.734) (-153.599) -- 0:00:58
685000 -- (-155.432) [-146.755] (-148.981) (-159.390) * [-150.197] (-153.132) (-151.909) (-147.550) -- 0:00:57
Average standard deviation of split frequencies: 0.011338
685500 -- [-144.502] (-145.323) (-146.277) (-146.789) * (-165.358) [-149.332] (-154.741) (-153.293) -- 0:00:57
686000 -- (-149.204) [-146.010] (-152.013) (-152.499) * (-150.748) (-147.564) [-147.984] (-152.282) -- 0:00:57
686500 -- (-151.015) (-146.798) (-161.017) [-146.251] * [-152.368] (-153.861) (-154.913) (-154.236) -- 0:00:57
687000 -- (-151.871) (-149.956) (-159.105) [-148.604] * [-150.900] (-155.372) (-150.584) (-156.303) -- 0:00:57
687500 -- (-146.970) (-147.992) (-162.404) [-153.928] * (-157.035) [-155.322] (-153.273) (-155.385) -- 0:00:57
688000 -- (-151.606) [-148.212] (-156.565) (-150.688) * (-159.460) (-156.042) (-155.293) [-157.025] -- 0:00:57
688500 -- (-149.881) (-152.192) [-154.811] (-152.405) * [-153.198] (-151.182) (-159.381) (-154.429) -- 0:00:57
689000 -- (-156.452) [-148.298] (-159.908) (-151.012) * (-154.053) (-152.434) (-159.327) [-148.288] -- 0:00:57
689500 -- (-151.718) (-145.647) (-154.060) [-148.882] * (-149.067) (-154.579) [-151.511] (-155.534) -- 0:00:57
690000 -- (-150.804) (-148.844) (-154.193) [-149.429] * (-151.492) [-150.874] (-152.884) (-150.649) -- 0:00:57
Average standard deviation of split frequencies: 0.011338
690500 -- [-148.070] (-153.619) (-159.199) (-152.715) * (-148.533) (-157.829) [-152.091] (-160.673) -- 0:00:56
691000 -- (-150.048) (-151.653) [-153.725] (-149.839) * (-149.058) (-154.138) (-155.823) [-154.520] -- 0:00:56
691500 -- (-152.083) (-153.619) [-146.550] (-155.272) * (-151.282) [-145.987] (-149.146) (-162.450) -- 0:00:56
692000 -- [-148.828] (-155.696) (-154.642) (-152.050) * (-160.199) (-150.572) [-149.664] (-161.423) -- 0:00:56
692500 -- (-150.831) (-150.709) (-156.349) [-152.827] * (-150.501) [-150.182] (-150.289) (-157.051) -- 0:00:56
693000 -- [-159.703] (-148.077) (-153.664) (-149.753) * (-155.851) (-150.393) (-150.170) [-148.425] -- 0:00:56
693500 -- (-159.073) (-156.222) [-151.129] (-152.905) * (-158.059) (-158.275) (-154.036) [-150.583] -- 0:00:56
694000 -- (-155.451) (-158.264) (-153.586) [-148.419] * [-146.891] (-154.128) (-157.981) (-148.150) -- 0:00:56
694500 -- [-149.543] (-148.851) (-158.093) (-156.384) * [-144.940] (-157.557) (-152.167) (-162.318) -- 0:00:56
695000 -- (-153.549) [-147.514] (-158.420) (-159.246) * [-146.361] (-157.769) (-145.565) (-154.153) -- 0:00:56
Average standard deviation of split frequencies: 0.011326
695500 -- (-153.072) [-148.036] (-151.099) (-157.936) * (-153.468) (-153.759) (-159.208) [-147.455] -- 0:00:56
696000 -- (-151.321) (-154.165) [-155.965] (-157.428) * (-154.200) (-148.315) [-148.907] (-155.995) -- 0:00:55
696500 -- [-151.067] (-149.672) (-157.214) (-156.781) * (-152.745) (-167.593) (-148.164) [-150.027] -- 0:00:55
697000 -- [-146.204] (-155.265) (-155.224) (-151.053) * (-164.431) (-156.619) [-150.876] (-154.582) -- 0:00:55
697500 -- (-149.983) (-146.632) (-153.508) [-146.555] * [-145.876] (-155.962) (-149.452) (-156.048) -- 0:00:55
698000 -- (-152.248) [-146.536] (-149.078) (-150.111) * (-144.489) (-155.716) [-153.959] (-152.942) -- 0:00:55
698500 -- (-161.395) (-149.263) (-155.380) [-150.989] * (-148.418) [-153.044] (-150.864) (-152.433) -- 0:00:55
699000 -- (-147.622) (-152.504) (-149.822) [-144.897] * (-148.304) (-154.341) (-152.771) [-150.275] -- 0:00:55
699500 -- (-161.255) [-148.003] (-148.316) (-151.159) * [-147.449] (-157.075) (-155.047) (-144.077) -- 0:00:55
700000 -- (-158.267) (-155.154) (-154.460) [-149.778] * [-146.602] (-156.792) (-157.834) (-150.741) -- 0:00:55
Average standard deviation of split frequencies: 0.010952
700500 -- (-156.198) [-149.880] (-151.229) (-148.644) * (-153.120) (-158.445) (-147.604) [-158.937] -- 0:00:55
701000 -- (-159.680) [-146.655] (-155.430) (-153.124) * [-158.682] (-159.573) (-147.231) (-154.280) -- 0:00:55
701500 -- [-158.377] (-153.543) (-153.691) (-153.783) * (-163.466) (-164.558) (-155.088) [-149.065] -- 0:00:54
702000 -- (-157.260) [-146.433] (-158.334) (-155.191) * (-162.444) [-152.727] (-150.701) (-157.528) -- 0:00:54
702500 -- (-153.927) (-156.512) [-155.005] (-153.663) * (-149.445) (-156.302) (-157.001) [-156.373] -- 0:00:54
703000 -- (-157.409) (-158.016) (-154.707) [-144.378] * (-157.644) (-153.827) [-155.352] (-153.902) -- 0:00:54
703500 -- (-160.568) (-154.205) [-152.671] (-149.826) * (-155.511) [-158.242] (-162.192) (-157.000) -- 0:00:54
704000 -- [-154.114] (-143.844) (-154.664) (-157.635) * (-148.123) (-155.087) [-157.077] (-153.981) -- 0:00:54
704500 -- (-157.107) [-148.174] (-161.288) (-155.785) * (-147.075) (-153.193) [-150.755] (-153.950) -- 0:00:54
705000 -- [-153.318] (-152.619) (-153.793) (-149.320) * [-151.886] (-150.734) (-162.170) (-156.887) -- 0:00:54
Average standard deviation of split frequencies: 0.010683
705500 -- (-157.208) (-154.107) [-151.591] (-150.644) * (-159.161) [-147.946] (-158.014) (-147.388) -- 0:00:54
706000 -- (-151.159) [-146.752] (-152.585) (-151.429) * [-144.353] (-149.542) (-154.727) (-153.012) -- 0:00:54
706500 -- (-155.740) (-144.119) (-151.993) [-155.512] * [-146.265] (-145.488) (-153.692) (-150.868) -- 0:00:54
707000 -- (-160.549) (-144.673) (-162.604) [-153.617] * (-155.588) (-154.735) (-156.252) [-149.298] -- 0:00:53
707500 -- (-150.663) (-156.394) (-155.684) [-149.970] * [-146.591] (-150.834) (-159.833) (-147.197) -- 0:00:53
708000 -- (-151.815) (-157.818) [-152.448] (-148.900) * (-151.367) [-149.796] (-157.741) (-147.510) -- 0:00:53
708500 -- (-150.323) (-163.755) [-153.132] (-152.704) * (-151.784) (-155.060) [-152.113] (-158.290) -- 0:00:53
709000 -- (-159.859) [-156.440] (-155.999) (-154.872) * (-155.441) [-153.699] (-154.410) (-162.280) -- 0:00:53
709500 -- (-158.898) (-152.047) (-155.594) [-154.062] * [-149.669] (-163.140) (-153.570) (-157.799) -- 0:00:53
710000 -- (-157.711) (-156.972) (-148.183) [-146.082] * [-151.222] (-160.122) (-155.589) (-154.143) -- 0:00:53
Average standard deviation of split frequencies: 0.011277
710500 -- (-157.831) (-152.266) (-152.406) [-142.711] * (-147.348) (-155.906) [-150.729] (-163.585) -- 0:00:53
711000 -- (-150.792) [-150.317] (-150.533) (-154.862) * (-148.421) (-153.860) [-144.763] (-162.264) -- 0:00:53
711500 -- (-150.988) [-146.203] (-152.765) (-156.567) * [-154.100] (-153.944) (-150.802) (-154.974) -- 0:00:53
712000 -- (-153.152) [-143.767] (-155.225) (-154.490) * [-146.261] (-154.548) (-149.762) (-155.641) -- 0:00:52
712500 -- (-162.616) [-143.037] (-153.505) (-157.392) * (-152.370) [-152.387] (-153.177) (-153.380) -- 0:00:52
713000 -- (-150.957) [-156.547] (-156.718) (-155.512) * (-162.548) (-158.571) (-154.906) [-153.738] -- 0:00:52
713500 -- [-149.093] (-155.178) (-157.577) (-151.017) * (-157.212) (-153.264) (-151.257) [-159.066] -- 0:00:52
714000 -- (-151.415) (-143.988) (-152.621) [-149.511] * (-155.030) [-156.613] (-146.732) (-146.722) -- 0:00:52
714500 -- (-148.429) (-146.801) [-153.958] (-157.361) * [-147.602] (-158.481) (-151.617) (-145.353) -- 0:00:52
715000 -- (-151.553) [-148.476] (-162.187) (-150.472) * [-148.294] (-154.933) (-153.234) (-156.842) -- 0:00:52
Average standard deviation of split frequencies: 0.010937
715500 -- (-149.679) (-156.484) (-155.207) [-147.234] * (-155.390) (-152.403) (-159.507) [-156.597] -- 0:00:52
716000 -- (-158.545) (-163.289) [-154.464] (-157.215) * (-146.261) [-153.611] (-154.387) (-151.867) -- 0:00:52
716500 -- (-150.722) [-153.500] (-149.408) (-158.530) * (-160.995) (-151.284) [-152.534] (-156.976) -- 0:00:52
717000 -- (-162.909) [-149.949] (-153.521) (-157.826) * (-148.005) [-149.764] (-155.178) (-155.498) -- 0:00:52
717500 -- [-152.634] (-147.554) (-148.938) (-152.807) * (-159.409) (-151.361) (-154.840) [-146.337] -- 0:00:51
718000 -- (-159.160) (-155.813) [-149.740] (-149.999) * (-156.693) (-159.408) [-153.950] (-155.368) -- 0:00:51
718500 -- (-154.622) [-143.594] (-151.979) (-153.762) * [-154.154] (-152.251) (-160.446) (-159.319) -- 0:00:51
719000 -- (-158.294) [-148.291] (-156.606) (-152.164) * (-160.862) [-156.906] (-157.497) (-152.682) -- 0:00:51
719500 -- (-151.248) [-147.199] (-154.827) (-151.920) * (-156.325) (-151.030) [-153.074] (-152.276) -- 0:00:51
720000 -- (-153.637) [-151.145] (-154.892) (-152.884) * (-155.886) [-146.465] (-156.585) (-150.575) -- 0:00:51
Average standard deviation of split frequencies: 0.010466
720500 -- [-147.874] (-161.563) (-150.371) (-158.288) * [-156.325] (-152.760) (-155.857) (-153.223) -- 0:00:51
721000 -- (-148.449) [-143.246] (-159.128) (-159.263) * [-151.292] (-144.211) (-156.018) (-149.337) -- 0:00:51
721500 -- (-154.605) [-146.265] (-142.774) (-156.906) * (-158.870) [-154.576] (-147.897) (-157.555) -- 0:00:51
722000 -- (-153.225) (-147.683) [-156.554] (-155.858) * (-157.328) (-148.393) (-150.322) [-150.069] -- 0:00:51
722500 -- (-162.545) [-151.198] (-162.119) (-158.157) * (-155.191) (-155.919) (-148.526) [-147.293] -- 0:00:51
723000 -- [-156.984] (-154.482) (-157.815) (-152.284) * (-159.597) (-158.477) (-149.694) [-146.462] -- 0:00:50
723500 -- [-152.123] (-148.316) (-156.810) (-154.852) * (-154.832) [-156.013] (-159.515) (-153.823) -- 0:00:50
724000 -- (-150.505) (-153.200) [-149.830] (-158.034) * [-153.355] (-152.112) (-156.923) (-152.709) -- 0:00:50
724500 -- (-152.399) [-157.313] (-161.533) (-158.631) * (-163.307) (-155.748) [-153.989] (-149.276) -- 0:00:50
725000 -- (-151.927) (-157.860) (-157.588) [-148.055] * (-160.766) (-150.079) [-153.730] (-148.379) -- 0:00:50
Average standard deviation of split frequencies: 0.010569
725500 -- [-148.541] (-153.305) (-159.068) (-153.419) * (-151.604) (-150.006) [-151.344] (-155.847) -- 0:00:50
726000 -- (-144.954) (-156.578) [-155.564] (-162.573) * [-152.783] (-152.169) (-154.166) (-149.258) -- 0:00:50
726500 -- [-148.334] (-158.186) (-151.207) (-154.788) * [-157.452] (-153.606) (-152.864) (-153.072) -- 0:00:50
727000 -- [-144.390] (-153.073) (-156.557) (-164.396) * (-159.133) [-156.609] (-153.220) (-160.341) -- 0:00:50
727500 -- (-153.935) (-159.490) [-153.645] (-156.610) * (-151.104) (-147.222) [-158.453] (-158.420) -- 0:00:50
728000 -- [-149.825] (-155.064) (-152.281) (-154.221) * (-152.716) (-150.921) [-152.222] (-158.995) -- 0:00:50
728500 -- (-160.320) (-156.630) [-152.693] (-150.362) * (-156.119) [-150.370] (-154.427) (-153.487) -- 0:00:49
729000 -- (-153.995) (-152.294) [-153.081] (-152.701) * (-152.156) (-158.893) [-150.227] (-152.102) -- 0:00:49
729500 -- (-161.390) (-159.215) [-154.173] (-150.832) * [-146.859] (-149.489) (-154.259) (-147.329) -- 0:00:49
730000 -- (-155.064) [-154.298] (-163.145) (-150.087) * [-145.004] (-150.763) (-154.621) (-146.295) -- 0:00:49
Average standard deviation of split frequencies: 0.010430
730500 -- [-159.557] (-149.599) (-152.182) (-151.803) * (-149.358) (-157.107) (-161.442) [-144.426] -- 0:00:49
731000 -- (-150.109) (-156.360) [-152.058] (-147.763) * (-146.271) (-154.831) (-157.654) [-147.182] -- 0:00:49
731500 -- (-151.671) (-147.334) [-144.761] (-152.756) * (-156.537) (-152.881) (-158.782) [-143.113] -- 0:00:49
732000 -- (-145.712) [-147.514] (-149.273) (-151.486) * (-146.259) (-148.684) (-158.632) [-153.033] -- 0:00:49
732500 -- [-154.598] (-155.421) (-153.688) (-151.201) * [-150.217] (-155.836) (-154.495) (-150.601) -- 0:00:49
733000 -- [-153.174] (-152.907) (-156.311) (-160.600) * (-152.678) (-151.482) (-157.749) [-144.656] -- 0:00:49
733500 -- (-157.672) (-155.255) (-155.803) [-146.296] * (-162.626) (-149.436) (-154.755) [-159.329] -- 0:00:49
734000 -- [-146.745] (-153.780) (-145.603) (-155.033) * (-154.782) (-147.188) [-155.243] (-157.075) -- 0:00:48
734500 -- (-148.690) (-152.995) [-151.564] (-159.424) * (-145.651) (-156.456) [-152.576] (-154.008) -- 0:00:48
735000 -- (-150.859) [-147.829] (-149.125) (-155.936) * [-158.539] (-153.020) (-153.201) (-155.373) -- 0:00:48
Average standard deviation of split frequencies: 0.010212
735500 -- [-152.372] (-147.393) (-157.437) (-160.969) * (-159.869) [-151.689] (-152.701) (-150.887) -- 0:00:48
736000 -- (-152.333) (-150.811) (-153.318) [-154.747] * (-158.868) (-155.814) [-147.482] (-158.497) -- 0:00:48
736500 -- (-152.240) [-160.277] (-152.139) (-152.153) * (-148.665) [-151.163] (-155.869) (-157.735) -- 0:00:48
737000 -- (-154.570) [-156.759] (-157.407) (-155.393) * (-158.809) (-154.420) (-164.084) [-153.283] -- 0:00:48
737500 -- (-150.115) [-148.667] (-144.369) (-158.450) * (-160.854) (-158.020) [-146.141] (-145.607) -- 0:00:48
738000 -- (-154.921) (-148.836) [-154.075] (-156.600) * (-155.654) [-153.894] (-155.441) (-149.099) -- 0:00:48
738500 -- (-157.202) (-149.933) [-155.560] (-152.448) * (-156.283) (-157.883) (-152.171) [-149.594] -- 0:00:48
739000 -- (-158.543) (-149.565) [-156.743] (-149.698) * (-158.285) (-153.364) [-151.684] (-151.958) -- 0:00:48
739500 -- (-160.081) [-145.255] (-153.670) (-153.770) * (-161.962) [-146.487] (-149.800) (-154.764) -- 0:00:47
740000 -- (-149.920) (-155.301) (-154.071) [-151.955] * (-156.801) (-151.546) [-150.831] (-157.530) -- 0:00:47
Average standard deviation of split frequencies: 0.010360
740500 -- (-147.662) (-149.293) [-153.018] (-164.341) * [-150.616] (-155.466) (-153.978) (-153.319) -- 0:00:47
741000 -- [-145.370] (-153.710) (-162.044) (-155.160) * (-149.367) (-152.302) [-149.571] (-152.346) -- 0:00:47
741500 -- [-153.565] (-155.297) (-150.389) (-156.914) * (-151.393) [-153.762] (-149.685) (-148.990) -- 0:00:47
742000 -- (-160.470) (-152.528) [-152.777] (-147.320) * (-150.945) (-158.850) (-156.214) [-150.553] -- 0:00:47
742500 -- [-153.390] (-153.000) (-160.821) (-149.875) * (-153.012) (-153.113) (-159.809) [-149.893] -- 0:00:47
743000 -- (-145.864) [-146.268] (-162.653) (-155.944) * (-151.937) (-146.673) (-150.485) [-149.318] -- 0:00:47
743500 -- (-151.126) (-160.195) [-154.162] (-156.738) * [-149.736] (-154.601) (-150.124) (-155.656) -- 0:00:47
744000 -- (-145.209) (-158.394) [-156.307] (-152.849) * (-149.337) [-147.677] (-155.833) (-154.465) -- 0:00:47
744500 -- (-151.591) (-154.105) [-150.811] (-156.860) * [-146.668] (-157.134) (-153.071) (-158.893) -- 0:00:47
745000 -- (-156.648) (-160.603) [-149.579] (-148.981) * [-153.660] (-153.207) (-149.371) (-155.302) -- 0:00:46
Average standard deviation of split frequencies: 0.010111
745500 -- (-152.832) [-153.058] (-156.214) (-156.290) * (-158.351) [-151.222] (-151.793) (-153.922) -- 0:00:46
746000 -- [-155.427] (-159.713) (-148.672) (-161.983) * (-152.386) (-151.549) (-153.354) [-153.586] -- 0:00:46
746500 -- (-152.040) (-155.880) (-152.516) [-148.290] * (-155.368) [-155.295] (-154.414) (-157.426) -- 0:00:46
747000 -- (-148.820) (-157.971) (-153.002) [-150.393] * (-159.316) (-153.497) [-158.401] (-160.611) -- 0:00:46
747500 -- (-151.290) (-159.418) (-159.527) [-153.263] * [-145.667] (-153.205) (-151.124) (-150.280) -- 0:00:46
748000 -- (-155.733) (-154.874) (-147.727) [-144.543] * (-146.826) (-156.399) [-152.264] (-157.637) -- 0:00:46
748500 -- (-147.939) (-157.087) (-155.498) [-157.338] * (-154.139) (-155.664) [-152.582] (-149.952) -- 0:00:46
749000 -- (-149.378) (-150.483) (-149.058) [-153.646] * (-148.782) [-148.626] (-159.816) (-153.536) -- 0:00:46
749500 -- (-153.340) [-153.087] (-150.123) (-152.051) * (-153.262) [-151.865] (-153.213) (-151.417) -- 0:00:46
750000 -- [-147.713] (-145.929) (-153.840) (-155.337) * (-160.453) [-152.252] (-153.463) (-156.241) -- 0:00:46
Average standard deviation of split frequencies: 0.010466
750500 -- (-158.601) (-153.348) [-149.465] (-154.227) * (-160.331) [-156.438] (-153.598) (-153.738) -- 0:00:45
751000 -- (-153.980) (-149.589) [-143.087] (-157.612) * (-154.136) (-156.607) (-154.239) [-152.126] -- 0:00:45
751500 -- [-155.335] (-159.362) (-153.243) (-147.315) * [-152.420] (-155.151) (-157.037) (-152.915) -- 0:00:45
752000 -- [-153.150] (-152.542) (-160.606) (-153.084) * (-158.209) [-148.496] (-156.828) (-156.368) -- 0:00:45
752500 -- (-143.356) (-149.268) (-150.491) [-150.230] * (-153.833) (-146.282) (-154.165) [-153.417] -- 0:00:45
753000 -- [-157.310] (-146.755) (-143.409) (-152.348) * (-156.507) (-152.033) (-151.216) [-148.225] -- 0:00:45
753500 -- (-160.943) (-148.059) (-145.012) [-153.005] * [-150.512] (-153.348) (-151.286) (-153.491) -- 0:00:45
754000 -- [-149.844] (-154.760) (-145.457) (-149.111) * [-145.941] (-152.475) (-154.211) (-153.230) -- 0:00:45
754500 -- (-151.536) (-154.969) (-152.214) [-142.829] * (-148.200) (-159.343) (-157.542) [-147.597] -- 0:00:45
755000 -- (-154.055) [-145.309] (-143.502) (-145.191) * (-156.164) (-162.764) [-157.940] (-151.153) -- 0:00:45
Average standard deviation of split frequencies: 0.010427
755500 -- [-157.245] (-151.626) (-152.642) (-155.427) * (-153.755) (-158.755) (-155.459) [-151.345] -- 0:00:44
756000 -- (-155.799) [-150.859] (-150.446) (-157.171) * (-146.354) [-154.275] (-162.469) (-152.650) -- 0:00:44
756500 -- (-147.071) (-151.633) [-147.416] (-163.264) * (-153.886) [-149.081] (-156.159) (-157.587) -- 0:00:44
757000 -- (-151.939) (-155.254) [-149.374] (-162.369) * (-148.417) [-152.939] (-154.082) (-152.507) -- 0:00:44
757500 -- (-158.322) (-152.656) [-152.996] (-147.859) * (-154.045) (-149.555) [-155.875] (-149.441) -- 0:00:44
758000 -- (-159.962) (-153.247) [-145.643] (-148.274) * (-152.396) [-152.629] (-161.450) (-150.100) -- 0:00:44
758500 -- [-154.873] (-157.710) (-149.792) (-152.052) * (-153.322) (-160.408) (-155.894) [-148.054] -- 0:00:44
759000 -- (-159.074) [-149.629] (-150.721) (-160.016) * [-150.404] (-160.958) (-156.354) (-150.374) -- 0:00:44
759500 -- (-161.180) (-145.591) [-147.696] (-154.340) * (-152.576) (-156.669) (-152.005) [-149.573] -- 0:00:44
760000 -- (-148.188) (-159.914) [-149.219] (-149.967) * [-149.148] (-163.408) (-153.381) (-159.053) -- 0:00:44
Average standard deviation of split frequencies: 0.010432
760500 -- (-149.080) (-159.806) (-149.641) [-151.544] * (-150.396) (-153.685) (-158.745) [-151.703] -- 0:00:44
761000 -- [-158.658] (-157.483) (-157.409) (-151.014) * (-151.038) (-159.825) (-155.864) [-151.018] -- 0:00:43
761500 -- (-153.808) (-153.419) [-154.432] (-154.479) * (-156.725) (-152.837) (-158.335) [-147.063] -- 0:00:43
762000 -- [-148.086] (-160.915) (-158.863) (-152.344) * (-152.721) (-151.416) (-157.520) [-149.036] -- 0:00:43
762500 -- (-153.796) (-157.900) [-161.795] (-152.454) * (-153.615) [-158.307] (-155.017) (-152.193) -- 0:00:43
763000 -- (-155.401) [-149.807] (-156.528) (-150.974) * (-146.455) (-150.461) [-157.112] (-147.603) -- 0:00:43
763500 -- (-151.314) [-149.302] (-146.091) (-154.592) * (-148.460) (-159.614) [-150.065] (-152.043) -- 0:00:43
764000 -- (-148.986) (-153.860) [-156.125] (-153.211) * (-156.791) (-156.943) (-163.718) [-157.597] -- 0:00:43
764500 -- (-152.157) (-147.985) (-158.044) [-155.747] * (-160.056) (-152.063) (-156.278) [-154.070] -- 0:00:43
765000 -- [-150.514] (-148.569) (-158.682) (-147.792) * (-152.353) [-150.532] (-161.584) (-155.564) -- 0:00:43
Average standard deviation of split frequencies: 0.010804
765500 -- (-152.953) (-152.206) (-147.759) [-152.061] * [-150.004] (-153.273) (-159.950) (-154.355) -- 0:00:43
766000 -- (-150.558) (-150.033) (-150.521) [-149.199] * (-152.921) (-155.710) (-158.487) [-149.836] -- 0:00:43
766500 -- (-151.333) (-150.117) (-147.345) [-144.717] * (-156.793) (-160.131) [-149.441] (-151.756) -- 0:00:42
767000 -- (-152.896) (-150.756) [-150.093] (-142.915) * (-154.961) [-153.612] (-153.517) (-156.914) -- 0:00:42
767500 -- [-154.562] (-158.142) (-150.873) (-150.948) * (-155.994) (-153.641) (-157.966) [-152.734] -- 0:00:42
768000 -- (-153.276) (-152.190) [-152.144] (-149.545) * [-149.712] (-160.791) (-161.165) (-154.037) -- 0:00:42
768500 -- (-151.573) (-156.577) [-158.762] (-158.256) * (-155.451) (-158.283) (-158.910) [-151.084] -- 0:00:42
769000 -- (-146.000) (-144.615) [-154.023] (-154.865) * (-164.529) (-160.096) (-160.173) [-146.277] -- 0:00:42
769500 -- (-158.007) (-156.957) [-144.698] (-154.104) * (-166.020) [-156.012] (-153.913) (-153.913) -- 0:00:42
770000 -- (-154.426) [-154.111] (-145.445) (-150.928) * (-164.709) (-154.329) (-154.115) [-152.606] -- 0:00:42
Average standard deviation of split frequencies: 0.010908
770500 -- [-147.664] (-152.844) (-150.515) (-152.744) * (-161.402) [-156.528] (-158.553) (-148.492) -- 0:00:42
771000 -- [-151.784] (-146.958) (-154.560) (-150.929) * [-163.847] (-157.613) (-154.606) (-154.362) -- 0:00:42
771500 -- (-147.968) [-145.762] (-153.875) (-156.105) * (-161.788) (-152.453) (-158.132) [-148.409] -- 0:00:42
772000 -- (-151.203) (-153.668) (-160.551) [-147.681] * [-149.577] (-157.728) (-154.428) (-146.365) -- 0:00:41
772500 -- (-157.419) [-157.454] (-149.107) (-155.467) * (-149.319) (-159.255) (-159.551) [-152.159] -- 0:00:41
773000 -- (-152.806) (-157.343) (-155.429) [-152.493] * [-155.313] (-158.958) (-160.154) (-153.040) -- 0:00:41
773500 -- (-152.811) [-146.032] (-145.908) (-152.647) * (-156.222) (-158.234) (-148.808) [-153.557] -- 0:00:41
774000 -- (-151.519) [-152.970] (-148.985) (-158.156) * [-149.214] (-153.413) (-151.915) (-153.132) -- 0:00:41
774500 -- (-157.149) (-153.582) (-150.411) [-147.890] * (-160.363) (-152.976) (-155.082) [-150.754] -- 0:00:41
775000 -- [-152.385] (-152.761) (-155.088) (-149.921) * [-151.210] (-151.502) (-158.217) (-144.980) -- 0:00:41
Average standard deviation of split frequencies: 0.010631
775500 -- (-150.109) (-149.821) (-161.186) [-145.556] * (-147.694) [-151.046] (-164.878) (-157.053) -- 0:00:41
776000 -- [-159.202] (-156.417) (-155.129) (-158.132) * (-154.756) (-151.663) [-152.126] (-149.722) -- 0:00:41
776500 -- (-163.183) [-151.650] (-155.275) (-154.267) * (-157.419) [-153.625] (-154.782) (-149.922) -- 0:00:41
777000 -- (-147.752) (-157.215) [-148.443] (-147.167) * (-158.321) (-154.606) (-156.931) [-144.823] -- 0:00:41
777500 -- [-151.839] (-152.656) (-148.995) (-154.926) * (-147.191) (-150.755) [-155.467] (-149.580) -- 0:00:40
778000 -- (-153.886) (-149.591) [-146.931] (-150.343) * [-156.694] (-152.687) (-157.893) (-153.269) -- 0:00:40
778500 -- (-155.561) [-155.239] (-147.471) (-151.282) * (-152.572) (-155.915) (-152.172) [-153.100] -- 0:00:40
779000 -- (-154.207) [-151.889] (-149.673) (-154.110) * (-146.462) (-156.443) [-150.780] (-154.317) -- 0:00:40
779500 -- [-151.830] (-156.030) (-149.089) (-161.150) * (-146.723) (-158.180) [-149.489] (-154.199) -- 0:00:40
780000 -- (-155.608) (-157.003) (-159.615) [-149.926] * (-148.213) (-156.038) (-154.493) [-159.222] -- 0:00:40
Average standard deviation of split frequencies: 0.010534
780500 -- (-152.653) (-151.560) [-151.829] (-159.322) * (-150.071) [-149.197] (-154.268) (-151.016) -- 0:00:40
781000 -- (-146.469) (-152.862) (-152.657) [-153.706] * (-151.320) (-159.091) [-151.534] (-149.581) -- 0:00:40
781500 -- [-146.243] (-156.885) (-155.655) (-154.093) * (-150.592) (-158.415) [-153.060] (-157.957) -- 0:00:40
782000 -- [-149.960] (-157.250) (-169.725) (-153.655) * (-152.169) (-155.931) [-153.120] (-148.090) -- 0:00:40
782500 -- (-160.874) (-158.670) (-153.640) [-150.444] * [-151.720] (-152.814) (-155.040) (-153.658) -- 0:00:40
783000 -- (-150.149) (-147.268) [-148.580] (-154.458) * (-156.595) [-145.973] (-153.730) (-149.131) -- 0:00:39
783500 -- (-157.373) (-152.253) [-152.352] (-155.640) * [-148.906] (-156.407) (-160.172) (-147.705) -- 0:00:39
784000 -- (-151.786) (-154.062) (-157.297) [-153.506] * [-156.415] (-157.413) (-153.896) (-153.076) -- 0:00:39
784500 -- (-158.923) [-147.505] (-149.210) (-149.139) * [-153.035] (-158.330) (-151.568) (-146.775) -- 0:00:39
785000 -- (-158.655) [-158.465] (-152.497) (-150.667) * (-162.937) (-161.309) (-146.805) [-151.331] -- 0:00:39
Average standard deviation of split frequencies: 0.010732
785500 -- (-155.577) (-149.039) (-147.918) [-153.367] * [-147.521] (-162.882) (-148.187) (-153.915) -- 0:00:39
786000 -- (-148.857) [-143.731] (-149.680) (-157.337) * (-148.857) (-160.163) [-147.819] (-153.244) -- 0:00:39
786500 -- (-165.948) (-146.581) (-152.722) [-162.859] * (-157.050) (-149.464) [-146.426] (-152.688) -- 0:00:39
787000 -- (-151.587) [-149.312] (-153.738) (-159.620) * (-155.749) (-151.977) [-148.110] (-154.214) -- 0:00:39
787500 -- (-150.452) [-146.915] (-157.780) (-151.115) * (-147.939) (-154.720) (-154.913) [-146.758] -- 0:00:39
788000 -- (-159.795) [-148.220] (-149.200) (-150.074) * (-151.388) (-146.413) (-157.551) [-150.270] -- 0:00:39
788500 -- (-150.551) (-156.475) [-152.089] (-146.907) * (-149.139) [-147.936] (-158.744) (-159.754) -- 0:00:38
789000 -- (-152.270) [-148.196] (-161.403) (-154.219) * (-152.261) [-152.512] (-156.939) (-155.356) -- 0:00:38
789500 -- (-156.826) (-154.979) (-161.311) [-154.210] * (-156.971) [-152.792] (-147.767) (-148.262) -- 0:00:38
790000 -- (-155.262) [-152.113] (-150.649) (-160.839) * (-154.300) (-156.593) [-150.408] (-153.847) -- 0:00:38
Average standard deviation of split frequencies: 0.010575
790500 -- (-161.823) [-148.161] (-153.291) (-157.026) * (-165.553) (-153.140) [-148.376] (-153.834) -- 0:00:38
791000 -- (-157.949) (-152.065) [-151.561] (-154.364) * [-156.327] (-163.388) (-156.543) (-157.273) -- 0:00:38
791500 -- (-158.165) (-151.920) [-150.260] (-150.053) * (-155.011) (-163.765) [-157.183] (-155.263) -- 0:00:38
792000 -- (-152.562) (-154.237) (-162.556) [-150.164] * (-160.010) (-156.816) (-152.917) [-150.866] -- 0:00:38
792500 -- [-144.805] (-156.966) (-164.497) (-154.305) * (-157.757) (-153.072) [-149.918] (-156.519) -- 0:00:38
793000 -- (-150.284) (-149.729) [-155.987] (-153.672) * (-157.051) (-161.628) (-149.523) [-150.331] -- 0:00:38
793500 -- [-149.468] (-147.157) (-150.806) (-157.773) * (-152.949) (-152.909) [-151.208] (-152.634) -- 0:00:37
794000 -- (-152.943) (-159.489) [-153.232] (-152.334) * (-160.856) [-150.397] (-155.647) (-148.823) -- 0:00:37
794500 -- [-150.229] (-155.659) (-148.558) (-152.415) * [-153.592] (-159.784) (-153.604) (-153.853) -- 0:00:37
795000 -- [-152.025] (-157.707) (-149.084) (-155.980) * (-159.036) (-157.694) (-150.777) [-151.682] -- 0:00:37
Average standard deviation of split frequencies: 0.010166
795500 -- (-150.955) [-150.135] (-155.277) (-147.352) * (-161.115) [-153.110] (-149.271) (-150.780) -- 0:00:37
796000 -- (-157.866) [-153.660] (-146.548) (-147.581) * (-158.746) [-149.662] (-159.543) (-156.670) -- 0:00:37
796500 -- (-157.909) (-153.994) (-150.465) [-148.893] * (-156.628) [-149.810] (-152.479) (-153.015) -- 0:00:37
797000 -- (-153.867) (-153.090) [-143.070] (-152.476) * [-149.089] (-150.089) (-154.795) (-156.760) -- 0:00:37
797500 -- (-155.198) (-160.008) (-153.782) [-153.836] * (-146.716) [-147.741] (-156.428) (-155.539) -- 0:00:37
798000 -- (-151.778) [-146.627] (-148.878) (-158.674) * [-147.163] (-158.171) (-159.855) (-146.680) -- 0:00:37
798500 -- (-154.717) (-155.332) (-147.992) [-155.531] * (-156.629) [-149.564] (-150.034) (-149.600) -- 0:00:37
799000 -- (-162.047) (-157.696) (-149.108) [-148.716] * (-145.176) [-151.471] (-150.521) (-154.063) -- 0:00:36
799500 -- (-157.127) (-151.882) (-150.422) [-144.093] * [-148.007] (-150.402) (-156.646) (-155.906) -- 0:00:36
800000 -- (-161.194) (-148.736) (-148.311) [-146.356] * (-150.807) (-158.482) [-155.021] (-154.201) -- 0:00:36
Average standard deviation of split frequencies: 0.010286
800500 -- (-145.163) [-148.649] (-157.406) (-152.794) * [-149.379] (-164.167) (-158.019) (-155.809) -- 0:00:36
801000 -- (-152.371) (-159.356) (-151.794) [-143.533] * (-153.501) (-161.106) (-158.011) [-153.556] -- 0:00:36
801500 -- [-151.160] (-159.861) (-151.909) (-153.388) * (-152.164) [-158.473] (-156.765) (-152.970) -- 0:00:36
802000 -- (-153.328) (-154.086) (-156.061) [-149.781] * (-154.320) (-158.615) [-150.095] (-161.733) -- 0:00:36
802500 -- (-154.123) (-150.487) (-148.065) [-151.296] * [-147.764] (-162.096) (-156.270) (-156.112) -- 0:00:36
803000 -- (-166.373) (-160.401) [-152.600] (-153.494) * (-151.059) (-161.976) [-151.345] (-165.553) -- 0:00:36
803500 -- (-156.506) (-153.082) [-153.248] (-159.505) * (-148.412) [-151.410] (-152.485) (-156.397) -- 0:00:36
804000 -- [-156.236] (-154.054) (-162.447) (-156.102) * (-149.462) [-152.132] (-155.632) (-157.488) -- 0:00:36
804500 -- (-152.125) (-152.536) (-159.962) [-147.796] * [-146.714] (-158.971) (-152.068) (-151.516) -- 0:00:35
805000 -- (-153.679) (-154.654) (-146.599) [-150.819] * (-152.666) (-154.721) (-157.608) [-148.102] -- 0:00:35
Average standard deviation of split frequencies: 0.010035
805500 -- [-152.358] (-155.297) (-149.167) (-154.039) * (-159.372) (-150.213) (-159.223) [-157.687] -- 0:00:35
806000 -- [-152.304] (-153.063) (-156.527) (-156.990) * (-157.044) (-160.567) (-151.960) [-154.766] -- 0:00:35
806500 -- [-151.202] (-158.187) (-160.245) (-151.137) * (-153.264) (-153.693) (-158.315) [-149.513] -- 0:00:35
807000 -- (-150.675) (-151.315) [-151.335] (-150.643) * [-148.568] (-160.060) (-157.500) (-146.622) -- 0:00:35
807500 -- (-148.161) (-158.914) (-147.907) [-148.758] * (-151.653) [-147.946] (-153.552) (-157.078) -- 0:00:35
808000 -- [-159.206] (-147.477) (-153.274) (-147.668) * [-153.759] (-150.932) (-151.665) (-158.817) -- 0:00:35
808500 -- (-150.582) (-148.874) [-151.800] (-150.574) * (-165.177) (-148.464) (-146.676) [-158.553] -- 0:00:35
809000 -- (-150.913) [-150.654] (-158.384) (-155.243) * (-152.225) [-150.256] (-158.119) (-156.686) -- 0:00:35
809500 -- (-155.086) (-157.628) [-147.926] (-153.946) * (-150.420) (-156.412) (-154.704) [-160.692] -- 0:00:35
810000 -- [-152.381] (-160.866) (-157.033) (-148.093) * (-160.238) (-157.135) [-147.532] (-152.213) -- 0:00:34
Average standard deviation of split frequencies: 0.009853
810500 -- [-148.713] (-155.823) (-168.140) (-147.216) * (-158.964) (-149.073) (-157.667) [-155.290] -- 0:00:34
811000 -- [-156.939] (-159.210) (-164.344) (-146.785) * (-155.871) [-153.625] (-151.978) (-149.853) -- 0:00:34
811500 -- (-158.565) [-155.600] (-146.758) (-150.851) * (-148.557) (-153.539) (-156.193) [-153.743] -- 0:00:34
812000 -- (-158.875) (-151.264) (-157.039) [-146.915] * (-147.164) (-158.359) [-146.748] (-157.022) -- 0:00:34
812500 -- [-160.160] (-151.797) (-160.054) (-160.809) * (-147.596) (-157.387) [-152.171] (-152.088) -- 0:00:34
813000 -- (-154.104) [-149.975] (-157.754) (-154.321) * (-154.157) (-151.972) [-150.614] (-148.039) -- 0:00:34
813500 -- (-153.513) [-150.986] (-153.525) (-154.706) * (-154.728) [-151.322] (-148.960) (-155.663) -- 0:00:34
814000 -- (-156.081) [-145.661] (-151.934) (-151.641) * [-151.295] (-156.574) (-148.997) (-157.208) -- 0:00:34
814500 -- (-163.193) (-153.611) (-150.979) [-154.943] * (-164.534) (-150.793) (-155.884) [-154.262] -- 0:00:34
815000 -- (-154.258) (-154.600) [-146.604] (-159.806) * (-157.817) (-155.210) (-157.779) [-148.042] -- 0:00:34
Average standard deviation of split frequencies: 0.009787
815500 -- (-158.586) (-158.154) [-146.082] (-156.489) * (-151.389) [-155.425] (-149.482) (-152.703) -- 0:00:33
816000 -- (-158.544) (-166.960) [-150.965] (-155.174) * (-155.032) (-150.124) [-147.208] (-156.873) -- 0:00:33
816500 -- (-150.465) (-149.544) (-146.982) [-154.419] * [-147.276] (-153.232) (-152.929) (-156.118) -- 0:00:33
817000 -- (-154.778) [-152.318] (-147.198) (-149.022) * [-148.492] (-159.530) (-155.336) (-161.672) -- 0:00:33
817500 -- (-154.003) (-150.219) [-159.346] (-157.079) * (-155.713) [-148.708] (-156.487) (-162.709) -- 0:00:33
818000 -- (-158.228) (-148.045) (-146.111) [-145.888] * [-150.945] (-155.305) (-156.996) (-148.807) -- 0:00:33
818500 -- (-163.776) (-147.568) (-156.752) [-150.018] * [-152.808] (-149.488) (-151.744) (-151.603) -- 0:00:33
819000 -- (-161.906) (-145.258) (-149.342) [-154.830] * (-155.294) [-147.265] (-151.931) (-156.224) -- 0:00:33
819500 -- (-161.121) [-148.971] (-151.596) (-151.217) * (-157.872) [-148.121] (-148.170) (-157.834) -- 0:00:33
820000 -- (-155.608) (-149.665) [-151.101] (-151.604) * (-152.030) (-165.819) [-152.572] (-153.272) -- 0:00:33
Average standard deviation of split frequencies: 0.009799
820500 -- (-155.665) [-147.853] (-147.942) (-153.179) * [-155.099] (-165.653) (-157.578) (-159.969) -- 0:00:33
821000 -- [-150.378] (-154.826) (-158.099) (-148.715) * (-159.780) (-156.258) [-150.841] (-160.144) -- 0:00:32
821500 -- (-152.455) (-150.569) [-154.809] (-156.569) * (-148.599) (-163.142) (-151.686) [-161.105] -- 0:00:32
822000 -- (-155.384) [-157.990] (-149.842) (-156.117) * (-154.062) (-163.730) [-156.624] (-152.821) -- 0:00:32
822500 -- (-159.958) [-146.948] (-150.641) (-152.102) * (-145.968) (-163.352) [-149.898] (-160.269) -- 0:00:32
823000 -- (-152.620) (-160.402) [-146.201] (-154.474) * [-149.923] (-161.925) (-146.914) (-163.169) -- 0:00:32
823500 -- (-159.434) [-157.997] (-152.287) (-153.026) * [-149.498] (-159.513) (-145.568) (-155.079) -- 0:00:32
824000 -- (-149.463) [-150.990] (-152.572) (-150.800) * (-146.818) (-166.763) [-150.935] (-165.101) -- 0:00:32
824500 -- (-152.534) (-155.273) [-144.628] (-153.195) * (-149.957) (-162.568) (-151.699) [-159.301] -- 0:00:32
825000 -- (-153.142) (-152.166) [-144.292] (-159.278) * [-166.746] (-155.806) (-148.222) (-148.366) -- 0:00:32
Average standard deviation of split frequencies: 0.009522
825500 -- [-147.720] (-150.366) (-161.877) (-154.440) * (-155.207) (-163.653) (-153.002) [-157.589] -- 0:00:32
826000 -- (-155.659) (-152.328) (-153.851) [-146.839] * (-159.661) (-158.179) (-148.005) [-146.651] -- 0:00:32
826500 -- (-156.349) [-157.376] (-151.697) (-154.667) * (-161.345) (-154.983) [-154.455] (-156.310) -- 0:00:31
827000 -- (-152.877) (-158.220) [-148.955] (-153.134) * [-153.093] (-153.739) (-154.600) (-150.836) -- 0:00:31
827500 -- (-148.461) (-152.895) [-148.484] (-163.865) * (-152.608) [-157.941] (-153.629) (-151.289) -- 0:00:31
828000 -- (-148.820) (-155.696) [-148.912] (-152.856) * (-152.295) (-152.279) [-156.788] (-161.944) -- 0:00:31
828500 -- [-144.003] (-155.647) (-154.941) (-149.067) * [-148.080] (-148.277) (-157.406) (-163.580) -- 0:00:31
829000 -- (-150.517) (-149.754) [-145.845] (-157.533) * (-151.659) (-157.073) (-155.445) [-151.397] -- 0:00:31
829500 -- (-146.600) (-156.610) [-145.557] (-161.950) * [-150.486] (-152.698) (-146.476) (-158.951) -- 0:00:31
830000 -- [-148.441] (-151.552) (-151.892) (-160.227) * (-153.230) [-155.860] (-157.697) (-153.520) -- 0:00:31
Average standard deviation of split frequencies: 0.009349
830500 -- (-156.222) (-153.532) [-145.368] (-155.373) * (-145.491) (-158.464) (-154.379) [-149.183] -- 0:00:31
831000 -- (-147.055) (-151.497) [-151.236] (-159.060) * (-152.701) (-159.789) (-150.602) [-152.845] -- 0:00:31
831500 -- (-151.326) [-148.101] (-150.995) (-150.109) * (-151.088) (-152.969) (-153.659) [-148.468] -- 0:00:31
832000 -- (-154.607) [-154.954] (-147.207) (-155.830) * (-156.261) [-157.264] (-150.415) (-151.327) -- 0:00:30
832500 -- (-158.214) (-161.018) [-147.291] (-154.497) * (-155.884) [-147.700] (-148.631) (-148.785) -- 0:00:30
833000 -- [-147.523] (-149.400) (-160.041) (-147.076) * (-150.024) (-154.694) [-146.517] (-156.540) -- 0:00:30
833500 -- (-159.473) (-155.203) (-147.830) [-151.968] * (-155.426) (-151.344) [-148.394] (-152.320) -- 0:00:30
834000 -- (-156.587) [-152.850] (-158.719) (-147.636) * (-158.802) [-147.667] (-146.366) (-154.893) -- 0:00:30
834500 -- (-145.690) [-157.492] (-151.779) (-152.377) * (-155.035) (-152.817) (-149.178) [-144.741] -- 0:00:30
835000 -- (-147.056) (-152.761) (-151.294) [-157.263] * (-149.666) (-152.197) (-145.534) [-148.383] -- 0:00:30
Average standard deviation of split frequencies: 0.009349
835500 -- (-155.579) (-148.881) [-148.669] (-152.636) * (-158.715) (-162.179) (-152.514) [-154.288] -- 0:00:30
836000 -- (-144.416) [-145.360] (-153.057) (-148.357) * (-158.494) (-155.119) (-152.277) [-152.344] -- 0:00:30
836500 -- (-152.654) (-149.348) (-149.489) [-154.499] * (-159.961) (-156.598) (-162.924) [-149.810] -- 0:00:30
837000 -- (-148.991) [-151.245] (-149.857) (-156.449) * (-148.448) (-152.203) (-152.613) [-149.936] -- 0:00:29
837500 -- [-150.886] (-144.624) (-154.227) (-158.010) * (-156.260) [-154.742] (-153.594) (-157.865) -- 0:00:29
838000 -- [-145.212] (-149.651) (-155.247) (-151.344) * (-157.990) [-149.119] (-152.298) (-154.095) -- 0:00:29
838500 -- (-158.595) (-160.963) (-156.104) [-153.154] * [-149.786] (-152.061) (-153.071) (-150.181) -- 0:00:29
839000 -- [-147.155] (-164.979) (-157.900) (-150.561) * (-150.644) (-153.255) (-151.895) [-149.204] -- 0:00:29
839500 -- [-146.891] (-156.915) (-155.957) (-152.940) * [-154.301] (-159.610) (-155.311) (-155.308) -- 0:00:29
840000 -- (-161.858) (-147.604) [-150.245] (-153.443) * (-155.429) (-148.347) [-149.211] (-149.366) -- 0:00:29
Average standard deviation of split frequencies: 0.008972
840500 -- (-157.353) [-146.766] (-158.874) (-156.676) * [-154.307] (-146.133) (-157.792) (-152.016) -- 0:00:29
841000 -- (-158.038) (-154.477) (-155.810) [-154.086] * (-152.088) (-147.420) [-153.597] (-146.921) -- 0:00:29
841500 -- [-157.598] (-146.906) (-152.361) (-146.960) * (-157.066) [-151.337] (-154.058) (-147.977) -- 0:00:29
842000 -- (-164.096) [-146.709] (-151.004) (-159.687) * (-153.824) (-146.995) [-150.174] (-155.111) -- 0:00:29
842500 -- (-154.221) (-150.430) [-155.374] (-160.728) * [-152.546] (-147.535) (-149.367) (-152.658) -- 0:00:28
843000 -- (-151.501) [-148.115] (-154.029) (-148.810) * [-157.431] (-158.787) (-152.598) (-157.264) -- 0:00:28
843500 -- (-152.014) (-155.485) (-148.615) [-153.333] * [-156.430] (-157.617) (-152.685) (-160.426) -- 0:00:28
844000 -- (-149.709) (-146.904) (-156.135) [-149.862] * (-151.170) (-154.069) (-155.485) [-148.063] -- 0:00:28
844500 -- (-156.356) [-143.534] (-156.951) (-152.832) * (-153.131) (-160.333) [-149.589] (-151.711) -- 0:00:28
845000 -- (-154.908) [-149.441] (-149.356) (-153.573) * (-165.600) (-149.286) (-151.715) [-147.189] -- 0:00:28
Average standard deviation of split frequencies: 0.009101
845500 -- (-160.027) (-150.695) [-148.947] (-152.726) * (-153.131) [-149.190] (-154.996) (-151.285) -- 0:00:28
846000 -- (-155.808) (-154.736) [-151.439] (-152.609) * (-151.305) [-145.396] (-156.894) (-148.216) -- 0:00:28
846500 -- (-151.487) (-155.160) [-159.219] (-158.383) * [-153.227] (-150.730) (-162.797) (-158.372) -- 0:00:28
847000 -- (-156.585) [-146.393] (-155.639) (-151.215) * (-151.685) (-151.994) (-150.814) [-154.915] -- 0:00:28
847500 -- (-156.728) (-146.389) [-152.325] (-155.418) * (-148.717) (-153.760) (-153.257) [-154.096] -- 0:00:28
848000 -- (-155.881) (-154.927) [-155.607] (-153.166) * (-151.661) [-144.489] (-149.876) (-153.835) -- 0:00:27
848500 -- [-159.914] (-156.416) (-158.171) (-149.071) * (-156.908) (-157.628) (-157.205) [-148.963] -- 0:00:27
849000 -- [-149.882] (-150.274) (-159.103) (-155.337) * (-151.971) (-160.025) (-152.354) [-156.663] -- 0:00:27
849500 -- (-154.176) (-150.504) (-153.057) [-145.638] * [-150.640] (-150.506) (-155.809) (-150.420) -- 0:00:27
850000 -- [-152.076] (-156.131) (-151.320) (-154.474) * (-152.367) [-150.327] (-154.032) (-151.514) -- 0:00:27
Average standard deviation of split frequencies: 0.009051
850500 -- (-156.555) (-148.015) (-151.600) [-146.791] * [-154.758] (-143.445) (-151.784) (-161.339) -- 0:00:27
851000 -- (-158.265) (-151.505) [-152.425] (-158.999) * (-148.381) (-149.954) [-149.976] (-157.815) -- 0:00:27
851500 -- [-154.377] (-155.220) (-150.436) (-150.937) * [-152.469] (-154.682) (-148.809) (-147.769) -- 0:00:27
852000 -- [-144.832] (-157.466) (-158.968) (-151.327) * (-148.976) (-152.579) (-156.277) [-144.862] -- 0:00:27
852500 -- [-146.940] (-150.893) (-155.689) (-156.480) * (-148.313) (-154.214) [-154.331] (-162.785) -- 0:00:27
853000 -- [-148.739] (-157.789) (-150.750) (-157.341) * (-155.648) (-156.986) (-153.576) [-149.791] -- 0:00:27
853500 -- (-154.839) (-155.181) [-151.976] (-156.834) * (-152.242) (-157.195) (-145.083) [-152.038] -- 0:00:26
854000 -- [-152.497] (-146.539) (-158.882) (-157.666) * (-152.579) [-159.176] (-158.107) (-152.272) -- 0:00:26
854500 -- (-146.573) [-144.629] (-149.894) (-163.604) * (-148.456) (-152.598) (-150.186) [-153.713] -- 0:00:26
855000 -- (-157.027) (-154.158) [-149.266] (-150.355) * [-149.442] (-160.463) (-147.442) (-151.523) -- 0:00:26
Average standard deviation of split frequencies: 0.009423
855500 -- (-147.933) (-150.442) (-148.466) [-149.503] * (-153.014) (-159.680) (-149.535) [-149.415] -- 0:00:26
856000 -- [-148.106] (-153.216) (-142.616) (-153.148) * (-144.876) (-157.551) [-141.946] (-153.849) -- 0:00:26
856500 -- [-151.056] (-156.552) (-147.035) (-155.735) * (-145.752) (-156.123) [-147.906] (-147.203) -- 0:00:26
857000 -- [-148.623] (-149.710) (-149.336) (-159.318) * (-151.549) (-156.654) (-148.670) [-153.996] -- 0:00:26
857500 -- [-147.260] (-158.974) (-151.345) (-155.873) * (-156.327) (-163.424) [-146.668] (-151.279) -- 0:00:26
858000 -- (-148.591) (-157.431) [-145.370] (-151.483) * (-153.670) (-166.003) [-143.141] (-154.019) -- 0:00:26
858500 -- (-152.063) (-158.811) [-155.692] (-151.303) * (-154.724) (-155.074) [-146.165] (-145.911) -- 0:00:26
859000 -- [-148.013] (-153.177) (-152.870) (-159.835) * (-160.172) (-153.671) (-154.920) [-144.913] -- 0:00:25
859500 -- [-147.411] (-150.596) (-147.875) (-152.942) * (-153.168) (-157.561) [-145.861] (-158.229) -- 0:00:25
860000 -- (-148.481) (-155.889) [-150.527] (-159.861) * (-158.441) (-149.989) [-146.579] (-152.753) -- 0:00:25
Average standard deviation of split frequencies: 0.009555
860500 -- (-146.402) [-146.058] (-157.558) (-153.488) * (-153.781) (-157.688) [-146.024] (-148.990) -- 0:00:25
861000 -- (-159.677) [-149.858] (-148.989) (-153.764) * (-156.445) (-152.798) (-150.390) [-146.765] -- 0:00:25
861500 -- (-149.998) [-144.970] (-147.151) (-154.021) * (-157.945) (-163.173) [-150.838] (-147.809) -- 0:00:25
862000 -- (-150.770) (-154.468) (-148.620) [-149.250] * (-146.017) (-153.758) (-154.676) [-151.448] -- 0:00:25
862500 -- (-153.491) (-157.241) (-153.334) [-150.110] * (-159.459) (-146.841) [-147.796] (-145.798) -- 0:00:25
863000 -- (-157.986) (-150.779) (-149.303) [-147.357] * (-158.181) (-151.065) [-147.445] (-148.749) -- 0:00:25
863500 -- (-154.585) (-146.232) (-148.363) [-155.304] * (-159.724) (-159.561) (-150.567) [-146.357] -- 0:00:25
864000 -- (-157.950) (-152.501) (-157.366) [-155.117] * (-152.110) (-153.231) (-148.688) [-153.722] -- 0:00:25
864500 -- [-155.648] (-149.591) (-154.713) (-154.386) * (-154.923) (-157.405) (-149.444) [-144.358] -- 0:00:24
865000 -- (-157.814) (-151.602) (-159.620) [-154.810] * (-149.723) (-150.809) (-163.641) [-147.019] -- 0:00:24
Average standard deviation of split frequencies: 0.009617
865500 -- (-151.662) (-147.114) [-148.748] (-150.609) * (-155.192) (-155.995) [-156.573] (-154.565) -- 0:00:24
866000 -- (-153.554) (-145.149) [-147.871] (-149.293) * (-153.555) (-155.383) [-150.651] (-157.005) -- 0:00:24
866500 -- [-149.511] (-149.532) (-146.170) (-150.619) * [-147.278] (-155.260) (-154.652) (-154.541) -- 0:00:24
867000 -- [-145.697] (-150.990) (-158.158) (-147.914) * (-155.522) (-156.853) [-144.733] (-160.830) -- 0:00:24
867500 -- (-149.874) (-161.493) (-156.211) [-150.542] * (-151.895) [-148.527] (-150.916) (-149.644) -- 0:00:24
868000 -- (-158.779) [-148.791] (-152.411) (-152.826) * [-148.909] (-157.077) (-148.630) (-152.597) -- 0:00:24
868500 -- (-147.433) (-153.678) [-148.164] (-152.575) * (-148.632) [-148.804] (-145.844) (-156.048) -- 0:00:24
869000 -- (-150.426) [-147.849] (-143.327) (-152.030) * (-164.348) (-147.836) [-143.531] (-151.233) -- 0:00:24
869500 -- (-149.365) [-150.120] (-149.779) (-155.943) * [-146.758] (-161.188) (-149.334) (-149.207) -- 0:00:24
870000 -- (-146.621) [-153.697] (-147.706) (-157.931) * [-151.669] (-148.645) (-147.715) (-155.682) -- 0:00:23
Average standard deviation of split frequencies: 0.009445
870500 -- (-154.892) (-151.294) [-144.801] (-156.849) * (-158.289) (-147.203) [-152.787] (-150.856) -- 0:00:23
871000 -- (-153.758) (-154.625) (-152.121) [-152.569] * (-162.334) [-152.224] (-149.461) (-152.368) -- 0:00:23
871500 -- [-153.729] (-153.958) (-152.712) (-154.370) * [-148.261] (-154.763) (-147.536) (-153.059) -- 0:00:23
872000 -- (-150.694) (-153.733) [-146.610] (-157.191) * [-144.617] (-160.605) (-146.908) (-156.930) -- 0:00:23
872500 -- [-147.875] (-155.333) (-152.384) (-157.088) * [-153.762] (-158.878) (-148.449) (-152.386) -- 0:00:23
873000 -- (-144.190) (-152.138) (-155.626) [-154.182] * (-157.439) (-154.735) [-154.522] (-151.047) -- 0:00:23
873500 -- [-150.401] (-155.251) (-149.364) (-151.245) * (-155.628) (-158.366) (-157.001) [-146.918] -- 0:00:23
874000 -- [-149.704] (-159.014) (-156.229) (-152.508) * [-147.984] (-158.260) (-152.496) (-152.089) -- 0:00:23
874500 -- (-149.298) (-149.027) [-149.884] (-158.332) * [-153.198] (-159.294) (-158.329) (-150.104) -- 0:00:23
875000 -- (-155.814) (-148.603) [-149.094] (-155.724) * [-146.151] (-150.664) (-151.519) (-152.458) -- 0:00:23
Average standard deviation of split frequencies: 0.009148
875500 -- (-157.909) [-151.773] (-154.690) (-150.880) * (-159.033) [-153.469] (-147.231) (-158.997) -- 0:00:22
876000 -- (-155.050) [-145.033] (-155.597) (-153.158) * [-148.836] (-157.527) (-157.386) (-157.313) -- 0:00:22
876500 -- (-157.875) [-145.113] (-146.409) (-156.863) * (-153.903) [-149.429] (-151.119) (-150.506) -- 0:00:22
877000 -- [-149.039] (-152.345) (-149.716) (-148.697) * (-151.200) (-148.236) (-151.983) [-149.413] -- 0:00:22
877500 -- (-153.205) (-151.019) [-155.850] (-152.904) * [-149.699] (-154.351) (-158.840) (-147.493) -- 0:00:22
878000 -- (-158.802) (-148.468) (-157.733) [-156.759] * (-148.904) (-152.968) [-149.393] (-153.132) -- 0:00:22
878500 -- (-158.393) (-160.478) [-157.697] (-165.507) * (-154.658) [-153.213] (-152.871) (-156.156) -- 0:00:22
879000 -- (-152.014) [-150.985] (-153.628) (-150.674) * (-148.598) (-158.156) (-151.676) [-155.196] -- 0:00:22
879500 -- (-155.141) [-147.903] (-147.038) (-168.508) * (-153.274) (-152.354) (-156.661) [-150.216] -- 0:00:22
880000 -- (-162.378) (-151.084) [-149.875] (-155.455) * (-159.303) (-147.437) (-160.728) [-149.875] -- 0:00:22
Average standard deviation of split frequencies: 0.009278
880500 -- (-161.143) [-152.343] (-152.727) (-162.276) * [-157.810] (-153.903) (-153.825) (-164.386) -- 0:00:21
881000 -- (-156.670) [-150.623] (-154.403) (-150.746) * (-161.981) (-151.990) (-153.022) [-148.055] -- 0:00:21
881500 -- (-159.106) (-159.067) (-157.955) [-150.745] * (-147.875) (-153.302) [-147.595] (-153.619) -- 0:00:21
882000 -- (-153.948) (-159.388) [-154.643] (-159.448) * (-149.017) (-153.648) (-152.150) [-147.243] -- 0:00:21
882500 -- (-155.027) (-157.448) (-152.401) [-148.679] * [-146.788] (-156.060) (-154.484) (-147.731) -- 0:00:21
883000 -- (-157.268) (-159.902) [-149.351] (-154.224) * (-149.227) (-152.607) (-150.582) [-145.439] -- 0:00:21
883500 -- (-146.079) [-149.801] (-158.508) (-157.102) * (-159.248) (-158.547) (-146.688) [-152.544] -- 0:00:21
884000 -- (-152.716) [-156.637] (-155.076) (-155.276) * (-154.512) (-156.431) (-157.278) [-146.093] -- 0:00:21
884500 -- (-152.020) (-149.406) (-157.289) [-150.888] * (-147.586) [-158.052] (-151.895) (-158.959) -- 0:00:21
885000 -- (-150.414) (-146.196) (-161.777) [-150.739] * (-156.377) (-152.016) (-149.313) [-147.946] -- 0:00:21
Average standard deviation of split frequencies: 0.009193
885500 -- [-148.644] (-152.786) (-161.389) (-154.800) * (-151.288) (-155.750) (-148.946) [-149.205] -- 0:00:21
886000 -- (-158.584) (-156.163) [-156.175] (-151.580) * (-159.902) (-153.809) [-151.192] (-153.756) -- 0:00:20
886500 -- (-159.379) [-146.341] (-152.409) (-151.878) * (-154.136) (-152.363) (-150.003) [-144.298] -- 0:00:20
887000 -- (-159.442) (-148.272) [-150.732] (-155.569) * [-148.828] (-153.100) (-152.111) (-156.080) -- 0:00:20
887500 -- (-161.614) (-151.113) (-151.321) [-145.403] * (-155.553) (-149.625) [-147.360] (-152.090) -- 0:00:20
888000 -- (-154.596) [-152.150] (-157.748) (-145.605) * [-149.174] (-147.921) (-148.643) (-158.602) -- 0:00:20
888500 -- (-151.802) (-153.971) [-151.820] (-152.242) * [-148.171] (-152.733) (-157.667) (-155.701) -- 0:00:20
889000 -- (-153.635) (-154.840) (-150.393) [-143.772] * (-153.856) (-155.751) (-147.393) [-156.625] -- 0:00:20
889500 -- [-149.914] (-154.782) (-146.749) (-152.592) * (-154.575) (-150.838) (-155.316) [-149.516] -- 0:00:20
890000 -- (-152.046) (-148.022) [-148.757] (-150.532) * (-154.024) [-154.797] (-149.078) (-149.859) -- 0:00:20
Average standard deviation of split frequencies: 0.008821
890500 -- (-153.766) [-147.031] (-148.769) (-164.480) * [-148.807] (-146.486) (-154.915) (-156.243) -- 0:00:20
891000 -- [-146.896] (-148.788) (-148.174) (-154.885) * [-147.432] (-154.672) (-153.675) (-150.778) -- 0:00:20
891500 -- [-146.927] (-154.532) (-154.486) (-149.884) * (-150.491) (-162.448) (-154.294) [-150.566] -- 0:00:19
892000 -- [-149.346] (-151.066) (-152.687) (-158.192) * [-147.866] (-154.502) (-147.965) (-146.894) -- 0:00:19
892500 -- [-149.832] (-151.734) (-160.587) (-151.893) * [-148.680] (-152.120) (-159.118) (-154.287) -- 0:00:19
893000 -- [-148.474] (-154.245) (-151.293) (-152.030) * [-150.889] (-153.019) (-155.855) (-159.291) -- 0:00:19
893500 -- [-146.753] (-159.739) (-159.893) (-153.714) * (-155.069) [-146.269] (-151.301) (-155.299) -- 0:00:19
894000 -- (-149.342) [-154.450] (-155.727) (-142.865) * (-160.651) [-146.255] (-155.308) (-152.701) -- 0:00:19
894500 -- (-155.296) [-152.224] (-153.933) (-154.004) * (-153.464) (-152.326) [-151.273] (-158.852) -- 0:00:19
895000 -- (-155.668) [-145.356] (-150.948) (-154.394) * (-158.367) (-153.074) (-153.282) [-145.879] -- 0:00:19
Average standard deviation of split frequencies: 0.008564
895500 -- (-156.470) (-150.541) (-152.458) [-146.105] * (-151.246) (-152.875) [-156.017] (-155.515) -- 0:00:19
896000 -- (-158.029) [-149.167] (-153.023) (-150.209) * [-144.261] (-154.463) (-150.497) (-157.995) -- 0:00:19
896500 -- (-161.184) (-144.664) (-146.993) [-150.693] * (-146.027) (-155.846) (-152.441) [-154.916] -- 0:00:19
897000 -- (-161.583) (-156.539) [-147.210] (-155.076) * [-146.058] (-163.404) (-145.132) (-152.794) -- 0:00:18
897500 -- (-157.282) (-155.895) (-146.880) [-153.837] * (-150.451) (-157.816) [-143.621] (-155.620) -- 0:00:18
898000 -- (-147.968) [-151.698] (-158.513) (-160.475) * (-150.997) (-152.737) [-144.874] (-155.227) -- 0:00:18
898500 -- [-146.508] (-155.619) (-154.816) (-156.697) * [-151.590] (-157.019) (-148.179) (-155.846) -- 0:00:18
899000 -- (-148.783) (-153.947) (-157.793) [-154.795] * (-155.716) (-153.088) [-153.701] (-155.631) -- 0:00:18
899500 -- (-153.042) [-145.758] (-152.398) (-155.189) * (-152.568) [-153.573] (-153.580) (-152.903) -- 0:00:18
900000 -- (-153.901) (-158.461) [-151.598] (-154.704) * (-148.651) [-157.075] (-160.623) (-157.986) -- 0:00:18
Average standard deviation of split frequencies: 0.008432
900500 -- (-152.193) (-152.981) (-156.724) [-148.993] * (-152.883) (-161.776) [-158.428] (-147.534) -- 0:00:18
901000 -- (-157.556) (-155.624) [-158.650] (-154.329) * (-149.841) [-153.153] (-160.592) (-157.700) -- 0:00:18
901500 -- (-154.890) [-151.659] (-153.039) (-159.847) * (-159.173) [-149.508] (-151.360) (-158.793) -- 0:00:18
902000 -- (-163.129) (-154.983) [-154.111] (-151.961) * (-149.361) [-148.616] (-152.972) (-156.303) -- 0:00:18
902500 -- [-147.179] (-155.187) (-153.275) (-158.853) * [-147.220] (-151.665) (-144.763) (-150.220) -- 0:00:17
903000 -- [-157.566] (-149.866) (-151.091) (-155.742) * (-147.086) (-155.431) (-159.029) [-148.666] -- 0:00:17
903500 -- [-149.503] (-161.268) (-153.237) (-155.882) * [-145.083] (-155.498) (-158.416) (-155.788) -- 0:00:17
904000 -- (-149.937) [-149.758] (-154.477) (-158.605) * (-150.114) [-149.202] (-162.189) (-153.081) -- 0:00:17
904500 -- (-146.723) (-152.450) [-146.648] (-148.277) * (-154.953) (-160.480) (-154.193) [-149.664] -- 0:00:17
905000 -- (-153.376) [-151.275] (-152.924) (-154.994) * (-147.976) (-154.019) [-151.338] (-159.803) -- 0:00:17
Average standard deviation of split frequencies: 0.008614
905500 -- (-155.678) (-152.621) [-157.055] (-147.614) * (-149.390) (-157.580) [-154.112] (-152.338) -- 0:00:17
906000 -- (-159.331) (-157.469) (-151.748) [-145.315] * (-150.268) (-148.038) [-157.014] (-159.140) -- 0:00:17
906500 -- (-151.588) (-154.655) (-150.440) [-145.492] * (-155.032) (-146.039) [-145.144] (-150.097) -- 0:00:17
907000 -- (-150.587) (-154.079) [-156.977] (-148.038) * (-157.681) [-146.222] (-149.039) (-152.058) -- 0:00:17
907500 -- [-149.686] (-145.264) (-150.852) (-144.036) * (-154.169) [-145.914] (-155.340) (-158.898) -- 0:00:17
908000 -- (-147.979) (-152.390) (-155.943) [-145.669] * (-153.073) [-146.083] (-147.440) (-148.306) -- 0:00:16
908500 -- (-150.600) (-145.384) [-150.907] (-149.660) * (-153.237) (-148.107) [-153.244] (-162.386) -- 0:00:16
909000 -- (-152.718) [-152.998] (-151.902) (-151.899) * (-157.954) [-148.035] (-155.216) (-147.301) -- 0:00:16
909500 -- (-153.925) [-153.629] (-150.188) (-144.750) * (-163.248) [-146.926] (-160.573) (-152.785) -- 0:00:16
910000 -- [-147.689] (-150.814) (-153.808) (-154.813) * (-153.154) (-153.447) (-156.988) [-147.194] -- 0:00:16
Average standard deviation of split frequencies: 0.008397
910500 -- [-148.680] (-151.610) (-154.511) (-160.620) * (-154.286) (-150.574) (-159.549) [-152.148] -- 0:00:16
911000 -- [-149.010] (-153.801) (-155.147) (-168.028) * (-158.580) [-149.883] (-146.473) (-158.461) -- 0:00:16
911500 -- [-150.064] (-155.905) (-158.419) (-160.062) * [-152.928] (-152.458) (-157.846) (-162.993) -- 0:00:16
912000 -- (-148.231) (-150.345) (-152.018) [-153.256] * (-154.360) (-154.738) (-156.036) [-158.571] -- 0:00:16
912500 -- (-159.043) (-155.861) [-149.353] (-153.922) * (-162.812) [-151.397] (-153.173) (-167.268) -- 0:00:16
913000 -- (-151.128) (-151.168) [-146.208] (-150.577) * (-146.548) (-155.248) [-152.422] (-164.746) -- 0:00:16
913500 -- [-148.848] (-156.085) (-154.401) (-148.647) * (-155.525) (-155.318) (-154.768) [-151.560] -- 0:00:15
914000 -- (-153.512) (-149.301) (-161.332) [-152.520] * [-157.527] (-147.395) (-152.973) (-167.250) -- 0:00:15
914500 -- (-149.645) [-162.785] (-154.646) (-151.099) * [-153.567] (-155.097) (-153.697) (-149.098) -- 0:00:15
915000 -- (-148.213) [-152.303] (-150.159) (-153.807) * (-157.833) (-159.915) (-152.408) [-152.649] -- 0:00:15
Average standard deviation of split frequencies: 0.008234
915500 -- (-156.797) (-159.682) (-149.077) [-153.539] * [-151.254] (-157.613) (-162.452) (-152.155) -- 0:00:15
916000 -- (-146.336) (-151.571) (-154.211) [-146.727] * (-162.492) (-160.181) [-149.417] (-156.082) -- 0:00:15
916500 -- (-155.657) (-147.351) (-159.237) [-146.908] * (-157.695) (-153.321) [-157.205] (-161.749) -- 0:00:15
917000 -- (-156.820) [-146.215] (-162.137) (-150.767) * [-152.731] (-155.974) (-156.052) (-159.959) -- 0:00:15
917500 -- (-152.517) (-154.052) (-151.625) [-147.818] * (-158.071) (-152.425) (-155.508) [-158.190] -- 0:00:15
918000 -- [-157.001] (-157.163) (-144.998) (-154.563) * (-157.171) [-146.846] (-147.250) (-167.347) -- 0:00:15
918500 -- (-151.527) (-153.200) [-147.223] (-153.539) * (-157.692) [-151.784] (-156.122) (-161.152) -- 0:00:14
919000 -- (-156.535) (-152.398) [-149.246] (-149.552) * (-153.970) (-148.572) [-149.693] (-151.727) -- 0:00:14
919500 -- (-157.454) (-158.700) (-154.186) [-143.624] * [-151.706] (-157.282) (-146.663) (-161.059) -- 0:00:14
920000 -- (-153.844) (-156.917) (-153.073) [-147.258] * [-150.421] (-147.504) (-150.569) (-161.392) -- 0:00:14
Average standard deviation of split frequencies: 0.008050
920500 -- (-144.819) (-156.661) [-153.334] (-149.730) * (-161.280) [-152.548] (-158.613) (-161.157) -- 0:00:14
921000 -- (-152.931) (-158.674) (-152.713) [-149.754] * [-155.204] (-147.761) (-159.279) (-157.227) -- 0:00:14
921500 -- [-148.162] (-151.597) (-163.945) (-147.545) * [-151.996] (-151.160) (-150.344) (-159.427) -- 0:00:14
922000 -- (-147.143) [-151.829] (-150.473) (-158.803) * (-148.107) (-159.785) (-154.744) [-159.006] -- 0:00:14
922500 -- [-154.420] (-156.301) (-150.356) (-162.064) * [-147.780] (-161.208) (-152.657) (-158.611) -- 0:00:14
923000 -- (-151.055) [-155.758] (-149.758) (-157.487) * (-151.035) (-152.959) [-148.236] (-156.933) -- 0:00:14
923500 -- (-161.616) (-154.025) (-149.576) [-151.712] * (-151.012) (-159.369) [-144.039] (-154.105) -- 0:00:14
924000 -- (-148.331) (-149.060) (-146.133) [-150.873] * (-159.275) (-149.301) [-147.379] (-148.965) -- 0:00:13
924500 -- (-150.601) [-142.570] (-148.449) (-154.374) * (-149.824) [-150.319] (-148.716) (-162.084) -- 0:00:13
925000 -- (-153.338) [-145.169] (-161.292) (-159.541) * (-153.588) (-158.759) (-156.812) [-150.433] -- 0:00:13
Average standard deviation of split frequencies: 0.007834
925500 -- (-156.351) [-151.130] (-154.788) (-158.970) * [-150.637] (-152.043) (-155.649) (-153.632) -- 0:00:13
926000 -- (-156.042) [-148.492] (-158.690) (-158.659) * [-147.825] (-154.001) (-156.169) (-152.003) -- 0:00:13
926500 -- (-161.119) (-150.618) [-150.246] (-156.869) * (-150.913) (-154.787) [-158.777] (-149.416) -- 0:00:13
927000 -- [-153.235] (-157.456) (-153.540) (-158.054) * (-157.841) (-148.796) (-151.836) [-145.629] -- 0:00:13
927500 -- (-154.311) [-146.566] (-154.217) (-157.110) * (-150.065) (-153.382) (-156.523) [-147.223] -- 0:00:13
928000 -- (-156.730) [-145.364] (-151.052) (-156.988) * (-151.587) (-152.994) [-154.449] (-156.837) -- 0:00:13
928500 -- (-153.466) (-150.802) (-159.955) [-154.425] * (-154.336) (-149.842) [-147.728] (-148.315) -- 0:00:13
929000 -- (-156.628) [-152.143] (-153.946) (-158.510) * [-148.327] (-153.295) (-154.922) (-148.955) -- 0:00:13
929500 -- (-143.075) (-158.998) [-157.527] (-148.406) * (-152.508) [-153.570] (-150.507) (-152.720) -- 0:00:12
930000 -- (-153.119) [-158.304] (-155.155) (-158.617) * (-156.382) (-162.970) [-147.279] (-158.133) -- 0:00:12
Average standard deviation of split frequencies: 0.007739
930500 -- [-148.483] (-147.886) (-159.392) (-157.834) * (-149.878) [-154.613] (-155.349) (-149.845) -- 0:00:12
931000 -- (-149.880) [-150.653] (-146.952) (-155.459) * (-149.390) [-164.504] (-151.735) (-151.378) -- 0:00:12
931500 -- (-150.694) [-149.413] (-149.996) (-162.417) * (-155.205) (-155.212) (-157.228) [-155.265] -- 0:00:12
932000 -- (-152.183) (-148.122) (-153.496) [-154.537] * (-149.451) (-154.594) (-154.949) [-155.401] -- 0:00:12
932500 -- (-152.346) (-159.838) (-156.005) [-151.280] * (-159.507) [-158.688] (-153.694) (-157.312) -- 0:00:12
933000 -- [-146.070] (-150.976) (-152.038) (-162.704) * (-148.361) [-150.635] (-153.731) (-157.328) -- 0:00:12
933500 -- [-146.560] (-145.968) (-146.400) (-151.488) * (-151.933) [-145.834] (-155.289) (-149.883) -- 0:00:12
934000 -- (-150.420) [-147.828] (-153.215) (-157.098) * (-158.689) (-150.400) (-151.915) [-146.454] -- 0:00:12
934500 -- (-167.230) [-154.762] (-150.595) (-155.188) * (-151.292) [-154.222] (-156.836) (-151.128) -- 0:00:12
935000 -- (-163.271) [-150.683] (-151.184) (-152.226) * (-155.136) (-145.158) (-158.655) [-151.226] -- 0:00:11
Average standard deviation of split frequencies: 0.007527
935500 -- (-155.464) [-155.191] (-148.491) (-154.232) * (-156.836) (-146.963) (-160.638) [-158.041] -- 0:00:11
936000 -- [-150.320] (-153.211) (-152.581) (-156.143) * [-150.323] (-152.301) (-155.332) (-153.562) -- 0:00:11
936500 -- (-155.227) (-148.237) [-147.944] (-156.541) * (-153.378) (-148.764) [-156.587] (-156.128) -- 0:00:11
937000 -- (-150.026) (-151.583) (-148.397) [-148.781] * (-149.380) [-149.222] (-157.319) (-160.124) -- 0:00:11
937500 -- (-157.533) (-153.924) (-148.266) [-159.520] * (-155.540) (-148.106) [-154.870] (-150.926) -- 0:00:11
938000 -- (-153.489) (-151.890) [-155.545] (-148.666) * (-149.907) (-153.737) [-153.902] (-148.352) -- 0:00:11
938500 -- (-153.079) (-158.625) [-153.723] (-153.349) * [-151.198] (-148.171) (-156.338) (-156.763) -- 0:00:11
939000 -- [-158.945] (-156.761) (-147.281) (-160.237) * (-159.321) [-152.235] (-159.340) (-152.403) -- 0:00:11
939500 -- [-152.856] (-156.768) (-145.800) (-163.050) * (-154.306) [-145.787] (-154.592) (-157.617) -- 0:00:11
940000 -- (-151.355) (-159.383) [-148.800] (-159.490) * (-151.835) [-146.234] (-147.857) (-151.830) -- 0:00:11
Average standard deviation of split frequencies: 0.007294
940500 -- (-164.535) (-153.424) [-147.626] (-156.103) * (-153.520) (-150.640) (-157.277) [-153.023] -- 0:00:10
941000 -- [-150.531] (-155.704) (-145.947) (-155.463) * (-158.395) (-154.607) [-152.916] (-147.674) -- 0:00:10
941500 -- (-157.865) [-147.988] (-151.268) (-153.534) * (-155.535) (-157.900) (-153.026) [-148.766] -- 0:00:10
942000 -- (-155.281) (-153.026) (-158.443) [-151.420] * (-149.545) (-149.290) (-158.595) [-149.613] -- 0:00:10
942500 -- (-158.766) (-163.263) [-154.119] (-151.223) * [-147.495] (-155.829) (-154.922) (-149.500) -- 0:00:10
943000 -- [-148.731] (-158.859) (-148.310) (-153.516) * (-153.561) (-155.744) (-148.946) [-145.624] -- 0:00:10
943500 -- (-155.015) (-150.110) (-152.014) [-155.276] * (-146.474) (-151.018) (-158.044) [-151.474] -- 0:00:10
944000 -- (-158.654) [-153.751] (-148.877) (-161.725) * (-151.452) (-146.888) (-151.635) [-150.931] -- 0:00:10
944500 -- (-157.100) (-149.617) (-154.770) [-153.541] * (-162.054) (-152.745) [-158.531] (-157.290) -- 0:00:10
945000 -- (-153.319) [-147.735] (-160.225) (-148.861) * (-157.250) (-159.893) (-158.255) [-151.782] -- 0:00:10
Average standard deviation of split frequencies: 0.007502
945500 -- (-155.963) [-147.228] (-154.438) (-146.348) * (-149.289) (-154.478) [-153.336] (-151.930) -- 0:00:10
946000 -- [-149.847] (-154.076) (-151.779) (-157.368) * (-156.067) (-152.798) [-150.082] (-155.771) -- 0:00:09
946500 -- (-151.163) (-157.174) [-153.018] (-152.429) * (-158.443) (-154.120) [-150.267] (-155.929) -- 0:00:09
947000 -- (-155.166) (-149.735) (-157.009) [-153.111] * (-154.796) (-150.813) [-156.737] (-153.341) -- 0:00:09
947500 -- (-158.197) (-155.365) (-150.049) [-160.379] * (-162.085) (-152.994) (-146.485) [-152.196] -- 0:00:09
948000 -- (-152.220) (-157.481) (-146.988) [-151.996] * (-155.845) [-144.422] (-148.268) (-154.658) -- 0:00:09
948500 -- (-152.126) [-157.824] (-149.780) (-154.606) * (-162.778) (-156.491) (-155.163) [-147.775] -- 0:00:09
949000 -- [-150.432] (-150.876) (-154.976) (-152.953) * (-157.977) (-154.537) [-145.194] (-158.264) -- 0:00:09
949500 -- (-147.819) [-153.081] (-150.750) (-156.065) * (-156.427) (-157.793) (-154.834) [-151.283] -- 0:00:09
950000 -- (-157.721) (-149.220) [-151.438] (-155.698) * (-153.449) [-150.127] (-152.749) (-154.233) -- 0:00:09
Average standard deviation of split frequencies: 0.007934
950500 -- (-152.655) (-150.602) (-150.550) [-151.872] * [-148.349] (-146.174) (-152.034) (-152.536) -- 0:00:09
951000 -- (-158.073) (-158.755) [-146.257] (-155.147) * (-151.785) (-150.810) [-153.652] (-152.471) -- 0:00:09
951500 -- (-155.003) (-154.797) [-149.910] (-149.619) * (-160.908) (-155.976) (-156.419) [-147.040] -- 0:00:08
952000 -- (-161.891) (-158.297) [-144.254] (-153.086) * [-148.333] (-157.748) (-155.573) (-148.323) -- 0:00:08
952500 -- (-155.979) (-152.915) [-150.451] (-149.645) * (-153.706) (-158.899) [-152.009] (-148.363) -- 0:00:08
953000 -- (-155.035) (-152.439) (-153.710) [-147.694] * (-160.397) (-156.377) (-149.027) [-148.334] -- 0:00:08
953500 -- (-154.834) (-159.533) (-152.937) [-150.857] * (-157.100) (-148.475) [-149.427] (-151.848) -- 0:00:08
954000 -- (-150.934) (-145.818) (-151.891) [-147.728] * (-152.447) (-153.023) [-143.394] (-152.220) -- 0:00:08
954500 -- (-153.491) [-146.425] (-150.780) (-147.688) * [-151.079] (-147.937) (-153.358) (-151.534) -- 0:00:08
955000 -- (-154.067) (-158.147) [-160.336] (-160.941) * (-155.638) (-153.836) [-148.873] (-147.962) -- 0:00:08
Average standard deviation of split frequencies: 0.007944
955500 -- (-156.002) (-157.671) (-151.647) [-148.013] * (-151.063) (-160.500) (-159.638) [-146.699] -- 0:00:08
956000 -- [-151.893] (-156.940) (-149.323) (-154.680) * (-158.347) (-150.080) (-157.452) [-144.085] -- 0:00:08
956500 -- (-147.913) (-160.132) (-154.966) [-152.457] * (-160.555) [-155.819] (-151.894) (-150.746) -- 0:00:08
957000 -- (-157.442) (-155.467) (-151.121) [-151.882] * (-150.619) [-149.997] (-150.529) (-159.603) -- 0:00:07
957500 -- (-147.723) [-145.036] (-154.630) (-155.710) * (-154.017) [-149.285] (-147.577) (-159.259) -- 0:00:07
958000 -- (-150.919) [-148.686] (-155.167) (-152.025) * (-156.252) [-155.176] (-146.399) (-155.255) -- 0:00:07
958500 -- (-148.106) (-156.487) (-159.512) [-156.604] * (-150.950) (-151.071) [-151.765] (-160.343) -- 0:00:07
959000 -- (-148.827) (-157.875) (-153.338) [-147.584] * (-152.945) (-152.958) (-150.323) [-158.300] -- 0:00:07
959500 -- [-149.473] (-154.972) (-152.272) (-154.639) * (-151.853) [-151.611] (-154.979) (-159.196) -- 0:00:07
960000 -- (-148.539) (-151.959) (-159.092) [-147.130] * [-144.799] (-159.030) (-154.188) (-154.809) -- 0:00:07
Average standard deviation of split frequencies: 0.007851
960500 -- [-150.649] (-146.828) (-153.813) (-156.219) * (-147.062) [-146.167] (-153.811) (-154.781) -- 0:00:07
961000 -- (-155.991) [-145.223] (-156.632) (-160.328) * (-162.856) [-142.157] (-155.086) (-158.619) -- 0:00:07
961500 -- (-157.791) [-150.992] (-155.902) (-158.068) * (-156.286) (-147.586) [-156.487] (-159.979) -- 0:00:07
962000 -- (-147.285) (-156.588) (-156.969) [-158.748] * (-160.481) (-151.798) [-154.558] (-159.107) -- 0:00:06
962500 -- (-152.687) [-152.106] (-157.874) (-159.721) * (-153.201) [-145.580] (-157.356) (-153.817) -- 0:00:06
963000 -- [-151.627] (-147.668) (-159.164) (-157.599) * [-154.426] (-150.895) (-160.140) (-149.016) -- 0:00:06
963500 -- (-149.358) [-148.121] (-161.628) (-155.530) * (-158.713) [-147.018] (-153.961) (-157.363) -- 0:00:06
964000 -- (-155.978) [-154.710] (-154.953) (-155.327) * [-157.242] (-153.027) (-154.593) (-150.678) -- 0:00:06
964500 -- (-152.911) (-155.938) (-156.619) [-158.428] * (-158.348) (-155.845) (-159.391) [-142.371] -- 0:00:06
965000 -- (-157.751) (-150.692) [-160.494] (-156.588) * (-156.237) [-153.137] (-159.516) (-151.721) -- 0:00:06
Average standard deviation of split frequencies: 0.008079
965500 -- (-156.881) [-149.242] (-149.557) (-151.006) * (-152.866) [-150.905] (-150.977) (-162.621) -- 0:00:06
966000 -- (-156.816) [-151.901] (-154.787) (-153.036) * [-148.136] (-157.685) (-151.487) (-158.467) -- 0:00:06
966500 -- (-156.391) [-148.501] (-153.917) (-158.564) * (-146.990) (-151.891) (-158.061) [-148.877] -- 0:00:06
967000 -- (-154.845) (-156.346) [-164.564] (-154.471) * (-149.607) [-146.850] (-160.363) (-145.073) -- 0:00:06
967500 -- (-150.840) [-149.269] (-155.628) (-151.916) * [-155.159] (-152.161) (-152.622) (-157.949) -- 0:00:05
968000 -- (-152.670) (-155.215) [-145.713] (-155.178) * (-148.134) (-151.015) (-155.375) [-159.049] -- 0:00:05
968500 -- (-154.822) (-153.539) (-147.180) [-151.899] * (-154.592) (-149.881) [-153.260] (-153.898) -- 0:00:05
969000 -- (-155.207) (-153.549) [-147.869] (-147.243) * (-150.036) (-160.594) (-155.178) [-151.154] -- 0:00:05
969500 -- (-158.187) (-161.019) (-150.119) [-153.883] * [-149.192] (-161.872) (-157.146) (-151.756) -- 0:00:05
970000 -- (-157.595) (-161.316) (-154.115) [-152.437] * (-155.748) (-151.928) [-150.202] (-151.164) -- 0:00:05
Average standard deviation of split frequencies: 0.008175
970500 -- (-160.764) (-156.408) [-155.086] (-151.846) * (-153.215) (-153.283) (-158.068) [-146.368] -- 0:00:05
971000 -- (-157.788) (-155.463) (-156.627) [-149.046] * [-148.797] (-155.820) (-156.579) (-150.103) -- 0:00:05
971500 -- [-153.356] (-155.597) (-149.567) (-149.402) * [-150.466] (-153.727) (-160.077) (-148.333) -- 0:00:05
972000 -- (-159.714) (-153.865) (-153.726) [-147.248] * (-151.048) (-161.938) (-163.607) [-150.863] -- 0:00:05
972500 -- (-156.972) [-146.675] (-151.505) (-152.822) * (-159.366) (-156.695) (-153.320) [-146.577] -- 0:00:05
973000 -- (-155.675) (-153.848) (-147.940) [-146.003] * [-148.877] (-154.739) (-145.938) (-152.496) -- 0:00:04
973500 -- (-165.366) (-150.073) [-153.643] (-150.831) * (-147.761) (-152.654) (-153.155) [-153.229] -- 0:00:04
974000 -- (-161.796) (-159.779) [-155.239] (-150.962) * [-152.062] (-157.401) (-154.518) (-154.310) -- 0:00:04
974500 -- [-161.775] (-158.457) (-149.604) (-154.252) * (-161.079) [-146.623] (-153.599) (-157.651) -- 0:00:04
975000 -- (-166.931) (-152.760) [-155.977] (-151.334) * (-159.138) (-155.252) [-148.702] (-147.483) -- 0:00:04
Average standard deviation of split frequencies: 0.008774
975500 -- (-161.747) [-148.156] (-158.231) (-152.302) * (-161.029) (-150.259) [-152.705] (-151.541) -- 0:00:04
976000 -- [-157.894] (-151.867) (-146.207) (-144.444) * (-160.220) [-154.300] (-149.885) (-145.928) -- 0:00:04
976500 -- (-167.698) (-160.478) [-148.730] (-151.129) * (-149.618) [-154.158] (-156.502) (-155.149) -- 0:00:04
977000 -- (-160.832) (-152.435) [-149.603] (-154.369) * [-143.545] (-157.714) (-153.872) (-161.590) -- 0:00:04
977500 -- [-153.952] (-151.182) (-161.795) (-157.692) * [-147.970] (-155.508) (-158.738) (-158.481) -- 0:00:04
978000 -- (-154.855) [-149.144] (-159.534) (-154.295) * (-154.375) (-153.295) [-156.844] (-152.172) -- 0:00:04
978500 -- (-156.005) (-158.033) (-152.919) [-151.482] * [-153.655] (-156.976) (-148.740) (-152.335) -- 0:00:03
979000 -- (-160.992) [-148.595] (-158.132) (-148.393) * (-153.522) (-156.157) (-155.536) [-148.186] -- 0:00:03
979500 -- (-156.511) [-146.186] (-147.288) (-154.278) * (-154.469) (-155.179) (-159.712) [-152.845] -- 0:00:03
980000 -- (-154.925) (-148.579) [-150.831] (-158.427) * (-154.870) (-156.121) (-157.468) [-150.862] -- 0:00:03
Average standard deviation of split frequencies: 0.008466
980500 -- (-153.413) (-151.630) [-144.774] (-151.525) * [-151.912] (-150.451) (-147.868) (-154.969) -- 0:00:03
981000 -- (-153.722) (-149.308) (-156.470) [-145.372] * (-151.254) (-148.268) [-147.330] (-159.015) -- 0:00:03
981500 -- (-152.323) [-160.803] (-151.153) (-148.087) * (-156.592) (-156.516) (-152.628) [-150.649] -- 0:00:03
982000 -- (-153.148) (-149.879) (-155.893) [-145.296] * (-147.264) (-160.362) [-146.925] (-153.198) -- 0:00:03
982500 -- (-152.236) (-150.354) (-152.328) [-150.028] * (-146.403) (-153.842) (-149.584) [-152.403] -- 0:00:03
983000 -- (-155.640) [-149.984] (-155.384) (-154.721) * (-153.700) (-151.951) [-150.945] (-151.236) -- 0:00:03
983500 -- (-150.106) (-150.966) (-155.913) [-151.068] * (-162.341) (-156.931) [-150.637] (-155.893) -- 0:00:03
984000 -- (-157.110) (-151.800) [-158.831] (-152.596) * [-151.635] (-164.521) (-153.164) (-146.809) -- 0:00:02
984500 -- [-154.580] (-152.889) (-157.645) (-156.437) * (-156.621) (-153.099) [-145.119] (-150.841) -- 0:00:02
985000 -- [-152.105] (-146.624) (-149.291) (-149.323) * (-152.657) (-160.837) [-156.018] (-152.614) -- 0:00:02
Average standard deviation of split frequencies: 0.008340
985500 -- (-149.756) (-153.999) [-148.798] (-144.189) * (-155.934) [-155.073] (-148.221) (-149.376) -- 0:00:02
986000 -- (-152.997) (-154.889) (-159.249) [-151.651] * (-149.188) (-148.560) [-152.976] (-155.106) -- 0:00:02
986500 -- [-148.270] (-155.091) (-155.559) (-150.840) * (-157.511) (-158.486) [-148.680] (-148.968) -- 0:00:02
987000 -- (-150.706) (-157.486) [-151.464] (-154.198) * (-145.055) (-161.180) [-145.543] (-147.456) -- 0:00:02
987500 -- (-151.867) (-158.434) (-156.250) [-150.095] * (-149.049) (-155.109) (-150.132) [-147.518] -- 0:00:02
988000 -- (-150.988) (-160.494) [-143.922] (-147.316) * [-148.961] (-148.373) (-155.843) (-155.496) -- 0:00:02
988500 -- [-151.026] (-160.342) (-149.010) (-146.981) * (-150.272) [-151.804] (-155.820) (-169.702) -- 0:00:02
989000 -- (-163.579) (-166.121) [-147.100] (-148.414) * (-154.055) (-152.011) [-150.048] (-157.430) -- 0:00:02
989500 -- (-161.244) (-148.247) [-158.052] (-164.823) * (-154.412) [-147.746] (-158.027) (-153.631) -- 0:00:01
990000 -- (-151.717) (-154.727) (-157.011) [-155.368] * [-151.974] (-151.575) (-154.941) (-151.943) -- 0:00:01
Average standard deviation of split frequencies: 0.008618
990500 -- (-150.914) (-149.817) [-153.978] (-152.075) * [-149.321] (-155.275) (-153.507) (-154.240) -- 0:00:01
991000 -- (-151.328) (-144.665) [-159.535] (-158.003) * [-154.097] (-151.629) (-155.874) (-152.992) -- 0:00:01
991500 -- (-146.568) [-146.640] (-146.080) (-151.523) * (-153.621) (-153.229) (-152.634) [-150.397] -- 0:00:01
992000 -- (-148.085) (-148.602) (-152.714) [-155.494] * (-151.620) [-148.530] (-158.672) (-149.182) -- 0:00:01
992500 -- (-157.028) (-152.460) [-152.768] (-148.450) * (-149.677) [-145.054] (-159.640) (-149.517) -- 0:00:01
993000 -- [-148.734] (-154.986) (-150.222) (-161.180) * (-153.938) [-157.713] (-154.508) (-152.635) -- 0:00:01
993500 -- (-150.844) (-151.369) [-150.486] (-150.317) * [-147.152] (-153.067) (-153.850) (-151.571) -- 0:00:01
994000 -- (-158.450) [-151.182] (-161.523) (-155.239) * (-151.562) (-144.051) [-146.622] (-157.897) -- 0:00:01
994500 -- (-150.277) (-149.227) (-159.113) [-154.498] * [-150.772] (-148.424) (-159.310) (-152.512) -- 0:00:01
995000 -- (-151.613) [-147.613] (-157.711) (-145.390) * (-151.609) (-150.039) [-154.415] (-149.965) -- 0:00:00
Average standard deviation of split frequencies: 0.008730
995500 -- [-148.296] (-158.903) (-144.714) (-152.372) * (-154.637) (-152.957) [-150.777] (-160.853) -- 0:00:00
996000 -- [-148.019] (-157.612) (-148.426) (-156.764) * (-144.531) (-151.030) (-151.358) [-155.942] -- 0:00:00
996500 -- [-148.340] (-159.680) (-153.911) (-153.584) * (-152.352) [-146.741] (-147.109) (-157.764) -- 0:00:00
997000 -- (-157.385) (-149.220) [-152.993] (-157.210) * (-148.686) (-155.097) (-156.519) [-150.363] -- 0:00:00
997500 -- [-150.705] (-148.372) (-151.103) (-157.508) * [-144.696] (-156.456) (-155.814) (-153.825) -- 0:00:00
998000 -- (-154.187) (-159.070) (-154.825) [-152.967] * [-153.529] (-150.666) (-152.083) (-156.331) -- 0:00:00
998500 -- [-149.702] (-155.935) (-155.971) (-153.796) * (-155.391) [-150.528] (-157.253) (-150.956) -- 0:00:00
999000 -- (-148.979) [-154.081] (-150.575) (-156.509) * (-157.797) [-154.243] (-152.932) (-156.548) -- 0:00:00
999500 -- (-155.243) (-151.771) [-155.163] (-150.970) * [-150.673] (-156.413) (-154.998) (-154.612) -- 0:00:00
1000000 -- (-153.832) (-155.259) (-151.538) [-148.186] * [-150.858] (-147.485) (-158.527) (-157.362) -- 0:00:00
Average standard deviation of split frequencies: 0.009055
Final log likelihoods and log prior probs for run 1 (stored and calculated):
Chain 1 -- -153.831827 -- 9.454060
Chain 1 -- -153.831828 -- 9.454060
Chain 2 -- -155.259367 -- 12.279751
Chain 2 -- -155.259367 -- 12.279751
Chain 3 -- -151.538471 -- 15.595044
Chain 3 -- -151.538470 -- 15.595044
Chain 4 -- -148.185563 -- 11.538277
Chain 4 -- -148.185567 -- 11.538277
Final log likelihoods and log prior probs for run 2 (stored and calculated):
Chain 1 -- -150.858496 -- 17.845061
Chain 1 -- -150.858495 -- 17.845061
Chain 2 -- -147.485430 -- 14.491443
Chain 2 -- -147.485430 -- 14.491443
Chain 3 -- -158.527286 -- 19.189758
Chain 3 -- -158.527285 -- 19.189758
Chain 4 -- -157.362012 -- 6.490306
Chain 4 -- -157.362012 -- 6.490306
Analysis completed in 3 mins 4 seconds
Analysis used 184.52 seconds of CPU time
Likelihood of best state for "cold" chain of run 1 was -140.12
Likelihood of best state for "cold" chain of run 2 was -140.17
Acceptance rates for the moves in the "cold" chain of run 1:
With prob. (last 100) chain accepted proposals by move
70.9 % ( 52 %) Dirichlet(Revmat{all})
90.4 % ( 88 %) Slider(Revmat{all})
60.6 % ( 64 %) Dirichlet(Pi{all})
58.3 % ( 32 %) Slider(Pi{all})
61.5 % ( 46 %) Multiplier(Alpha{1,2})
66.5 % ( 40 %) Multiplier(Alpha{3})
55.0 % ( 35 %) Slider(Pinvar{all})
73.3 % ( 60 %) ExtSPR(Tau{all},V{all})
30.3 % ( 29 %) ExtTBR(Tau{all},V{all})
79.4 % ( 84 %) NNI(Tau{all},V{all})
53.3 % ( 57 %) ParsSPR(Tau{all},V{all})
28.0 % ( 25 %) Multiplier(V{all})
85.9 % ( 86 %) Nodeslider(V{all})
27.7 % ( 28 %) TLMultiplier(V{all})
Acceptance rates for the moves in the "cold" chain of run 2:
With prob. (last 100) chain accepted proposals by move
70.6 % ( 62 %) Dirichlet(Revmat{all})
90.5 % ( 88 %) Slider(Revmat{all})
62.2 % ( 56 %) Dirichlet(Pi{all})
58.3 % ( 41 %) Slider(Pi{all})
60.6 % ( 33 %) Multiplier(Alpha{1,2})
65.9 % ( 39 %) Multiplier(Alpha{3})
56.3 % ( 37 %) Slider(Pinvar{all})
73.1 % ( 64 %) ExtSPR(Tau{all},V{all})
30.4 % ( 32 %) ExtTBR(Tau{all},V{all})
79.3 % ( 80 %) NNI(Tau{all},V{all})
53.3 % ( 60 %) ParsSPR(Tau{all},V{all})
28.0 % ( 24 %) Multiplier(V{all})
85.9 % ( 87 %) Nodeslider(V{all})
27.8 % ( 28 %) TLMultiplier(V{all})
Chain swap information for run 1:
1 2 3 4
----------------------------------
1 | 0.68 0.43 0.27
2 | 166994 0.71 0.48
3 | 166006 166669 0.74
4 | 166947 166731 166653
Chain swap information for run 2:
1 2 3 4
----------------------------------
1 | 0.68 0.43 0.26
2 | 166574 0.71 0.49
3 | 166215 167007 0.74
4 | 166310 166812 167082
Upper diagonal: Proportion of successful state exchanges between chains
Lower diagonal: Number of attempted state exchanges between chains
Chain information:
ID -- Heat
-----------
1 -- 1.00 (cold chain)
2 -- 0.91
3 -- 0.83
4 -- 0.77
Heat = 1 / (1 + T * (ID - 1))
(where T = 0.10 is the temperature and ID is the chain number)
Setting burn-in to 2500
Summarizing parameters in files /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p and /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p
Writing summary statistics to file /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat
Using relative burnin ('relburnin=yes'), discarding the first 25 % of samples
Below are rough plots of the generation (x-axis) versus the log
probability of observing the data (y-axis). You can use these
graphs to determine what the burn in for your analysis should be.
When the log probability starts to plateau you may be at station-
arity. Sample trees and parameters after the log probability
plateaus. Of course, this is not a guarantee that you are at sta-
tionarity. Also examine the convergence diagnostics provided by
the 'sump' and 'sumt' commands for all the parameters in your
model. Remember that the burn in is the number of samples to dis-
card. There are a total of ngen / samplefreq samples taken during
a MCMC analysis.
Overlay plot for both runs:
(1 = Run number 1; 2 = Run number 2; * = Both runs)
+------------------------------------------------------------+ -148.42
| 1 |
| 2 1 |
| 2 12 1 |
| 2 2 1 2 2 |
| 1 2 2 1 2 |
| 2 1 1 2 1 1 12 1 1 * |
| 2 1 2 2 22 1 12 2 2 1 1 1 2 2|
|2 2 2 2 1 2 1 1 2 1 2 12 |
|1 * 2 11 12 1 1 12 1 2 1 * |
| 2 2 1 11 2 2 11 1 |
| 1 1 12 2 2 11 2 1|
| 1 12 2 1 11 22 2 |
| 2 2 1 1 22 2 2 |
| 2 1 1 2 1 |
| 2 1 |
+------+-----+-----+-----+-----+-----+-----+-----+-----+-----+ -152.73
^ ^
250000 1000000
Estimated marginal likelihoods for runs sampled in files
"/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -146.62 -158.03
2 -146.29 -159.66
--------------------------------------
TOTAL -146.44 -159.15
--------------------------------------
Model parameter summaries over the runs sampled in files
"/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 1.935610 0.198518 1.111090 2.837366 1.903942 1014.70 1156.25 1.000
r(A<->C){all} 0.108573 0.011164 0.000001 0.306852 0.078195 296.03 358.02 1.001
r(A<->G){all} 0.236642 0.027127 0.000356 0.546968 0.207967 209.51 223.41 1.000
r(A<->T){all} 0.042910 0.002608 0.000012 0.146012 0.025807 318.14 466.27 1.003
r(C<->G){all} 0.139977 0.017977 0.000027 0.408171 0.099930 155.84 158.35 1.002
r(C<->T){all} 0.300297 0.030618 0.029522 0.652046 0.272245 113.00 129.07 1.005
r(G<->T){all} 0.171602 0.018371 0.000343 0.438034 0.139495 266.37 294.52 1.006
pi(A){all} 0.303991 0.002556 0.204507 0.400660 0.303246 991.79 1131.80 1.000
pi(C){all} 0.173664 0.001569 0.094457 0.245215 0.170129 1091.75 1120.09 1.001
pi(G){all} 0.180034 0.001702 0.102256 0.258420 0.177207 1079.36 1244.71 1.001
pi(T){all} 0.342310 0.002720 0.243510 0.445177 0.340408 1168.26 1218.77 1.000
alpha{1,2} 0.314421 0.089594 0.004390 0.904983 0.212644 1255.95 1326.59 1.000
alpha{3} 0.357305 0.086089 0.049131 0.916327 0.270757 1394.33 1394.48 1.000
pinvar{all} 0.866638 0.004713 0.734314 0.970401 0.879896 1155.91 1199.63 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
Setting urn-in to 2500
Summarizing trees in files "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.t"
Using relative burnin ('relburnin=yes'), discarding the first 25 % of sampled trees
Writing statistics to files /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.<parts|tstat|vstat|trprobs|con>
Examining first file ...
Found one tree block in file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.t" with 2001 trees in last block
Expecting the same number of trees in the last tree block of all files
Tree reading status:
0 10 20 30 40 50 60 70 80 90 100
v-------v-------v-------v-------v-------v-------v-------v-------v-------v-------v
*********************************************************************************
Read a total of 4002 trees in 2 files (sampling 3002 of them)
(Each file contained 2001 trees of which 1501 were sampled)
General explanation:
In an unrooted tree, a taxon bipartition (split) is specified by removing a
branch, thereby dividing the species into those to the left and those to the
right of the branch. Here, taxa to one side of the removed branch are denoted
'.' and those to the other side are denoted '*'. Specifically, the '.' symbol
is used for the taxa on the same side as the outgroup.
In a rooted or clock tree, the tree is rooted using the model and not by
reference to an outgroup. Each bipartition therefore corresponds to a clade,
that is, a group that includes all the descendants of a particular branch in
the tree. Taxa that are included in each clade are denoted using '*', and
taxa that are not included are denoted using the '.' symbol.
The output first includes a key to all the bipartitions with frequency larger
or equual to (Minpartfreq) in at least one run. Minpartfreq is a paramiter to
sumt command and currently it is set to 0.10. This is followed by a table
with statistics for the informative bipartitions (those including at least
two taxa), sorted from highest to lowest probability. For each bipartition,
the table gives the number of times the partition or split was observed in all
runs (#obs) and the posterior probability of the bipartition (Probab.), which
is the same as the split frequency. If several runs are summarized, this is
followed by the minimum split frequency (Min(s)), the maximum frequency
(Max(s)), and the standard deviation of frequencies (Stddev(s)) across runs.
The latter value should approach 0 for all bipartitions as MCMC runs converge.
This is followed by a table summarizing branch lengths, node heights (if a
clock model was used) and relaxed clock parameters (if a relaxed clock model
was used). The mean, variance, and 95 % credible interval are given for each
of these parameters. If several runs are summarized, the potential scale
reduction factor (PSRF) is also given; it should approach 1 as runs converge.
Node heights will take calibration points into account, if such points were
used in the analysis.
Note that Stddev may be unreliable if the partition is not present in all
runs (the last column indicates the number of runs that sampled the partition
if more than one run is summarized). The PSRF is not calculated at all if
the partition is not present in all runs.The PSRF is also sensitive to small
sample sizes and it should only be considered a rough guide to convergence
since some of the assumptions allowing one to interpret it as a true potential
scale reduction factor are violated in MrBayes.
List of taxa in bipartitions:
1 -- C1
2 -- C2
3 -- C3
4 -- C4
5 -- C5
6 -- C6
7 -- C7
8 -- C8
9 -- C9
10 -- C10
11 -- C11
12 -- C12
Key to taxon bipartitions (saved to file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.parts"):
ID -- Partition
------------------
1 -- .***********
2 -- .*..........
3 -- ..*.........
4 -- ...*........
5 -- ....*.......
6 -- .....*......
7 -- ......*.....
8 -- .......*....
9 -- ........*...
10 -- .........*..
11 -- ..........*.
12 -- ...........*
13 -- .**.........
14 -- .....***.***
15 -- .**......*..
16 -- .***.*******
17 -- .*******.***
18 -- ...**.......
19 -- .**..***.***
20 -- .....***..**
21 -- ....*...*...
22 -- ...*....*...
23 -- .**.********
24 -- .......*..*.
25 -- .....*.*....
26 -- .......*...*
27 -- .....*.....*
28 -- ......**....
29 -- .....*....*.
30 -- .....**.....
------------------
Summary statistics for informative taxon bipartitions
(saved to file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.tstat"):
ID #obs Probab. Sd(s)+ Min(s) Max(s) Nruns
----------------------------------------------------------------
13 1385 0.461359 0.020257 0.447035 0.475683 2
14 1181 0.393404 0.006124 0.389074 0.397735 2
15 732 0.243837 0.024497 0.226516 0.261159 2
16 401 0.133578 0.000471 0.133245 0.133911 2
17 400 0.133245 0.012248 0.124584 0.141905 2
18 385 0.128248 0.007066 0.123251 0.133245 2
19 372 0.123917 0.001884 0.122585 0.125250 2
20 367 0.122252 0.017430 0.109927 0.134577 2
21 367 0.122252 0.007066 0.117255 0.127249 2
22 358 0.119254 0.000942 0.118588 0.119920 2
23 357 0.118921 0.011777 0.110593 0.127249 2
24 342 0.113924 0.003769 0.111259 0.116589 2
25 331 0.110260 0.005182 0.106596 0.113924 2
26 328 0.109260 0.002827 0.107262 0.111259 2
27 321 0.106929 0.003298 0.104597 0.109260 2
28 308 0.102598 0.016017 0.091272 0.113924 2
29 306 0.101932 0.007537 0.096602 0.107262 2
30 291 0.096935 0.014604 0.086609 0.107262 2
----------------------------------------------------------------
+ Convergence diagnostic (standard deviation of split frequencies)
should approach 0.0 as runs converge.
Summary statistics for branch and node parameters
(saved to file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.vstat"):
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median PSRF+ Nruns
-------------------------------------------------------------------------------------------
length{all}[1] 0.076437 0.006147 0.000027 0.235598 0.052802 1.000 2
length{all}[2] 0.087182 0.007999 0.000011 0.263878 0.059517 1.001 2
length{all}[3] 0.087351 0.007666 0.000044 0.259815 0.060471 1.000 2
length{all}[4] 0.082110 0.007367 0.000011 0.251722 0.055500 1.000 2
length{all}[5] 0.078615 0.006749 0.000035 0.238115 0.053410 1.000 2
length{all}[6] 0.073127 0.005930 0.000006 0.230326 0.048114 1.000 2
length{all}[7] 0.140592 0.011721 0.000200 0.350138 0.115804 1.000 2
length{all}[8] 0.072599 0.005402 0.000005 0.221295 0.050689 1.000 2
length{all}[9] 0.077607 0.006321 0.000034 0.244453 0.052307 1.000 2
length{all}[10] 0.115785 0.009832 0.000034 0.305187 0.090609 1.000 2
length{all}[11] 0.076079 0.005983 0.000032 0.233707 0.052265 1.000 2
length{all}[12] 0.139220 0.012224 0.000111 0.360475 0.111098 1.000 2
length{all}[13] 0.129830 0.011794 0.000091 0.344610 0.098525 1.000 2
length{all}[14] 0.161322 0.013926 0.003967 0.376835 0.132477 1.000 2
length{all}[15] 0.152676 0.013025 0.000548 0.375198 0.124602 1.001 2
length{all}[16] 0.092433 0.008707 0.000089 0.258653 0.064891 0.998 2
length{all}[17] 0.078196 0.006620 0.000441 0.268799 0.052486 0.998 2
length{all}[18] 0.081571 0.006217 0.000187 0.238616 0.060358 0.997 2
length{all}[19] 0.114216 0.010400 0.000565 0.321131 0.083982 0.999 2
length{all}[20] 0.123165 0.011901 0.001405 0.342833 0.091886 0.997 2
length{all}[21] 0.083574 0.007446 0.000078 0.257471 0.059791 0.998 2
length{all}[22] 0.088596 0.007509 0.000042 0.258856 0.057716 0.997 2
length{all}[23] 0.081199 0.006836 0.000036 0.246769 0.054434 0.998 2
length{all}[24] 0.071897 0.005000 0.000001 0.224679 0.052143 0.997 2
length{all}[25] 0.076085 0.007422 0.000033 0.236059 0.049896 0.998 2
length{all}[26] 0.080529 0.007832 0.000133 0.246762 0.056610 1.013 2
length{all}[27] 0.075951 0.005682 0.000019 0.232689 0.050718 0.998 2
length{all}[28] 0.071404 0.005158 0.000447 0.203937 0.050180 0.999 2
length{all}[29] 0.074949 0.006159 0.000142 0.253416 0.047797 0.997 2
length{all}[30] 0.078806 0.005911 0.000146 0.223474 0.058381 0.997 2
-------------------------------------------------------------------------------------------
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge. NA is reported when
deviation of parameter values within all runs is 0 or when a parameter
value (a branch length, for instance) is not sampled in all runs.
Summary statistics for partitions with frequency >= 0.10 in at least one run:
Average standard deviation of split frequencies = 0.009055
Maximum standard deviation of split frequencies = 0.024497
Average PSRF for parameter values ( excluding NA and >10.0 ) = 0.999
Maximum PSRF for parameter values = 1.013
Clade credibility values:
/---------------------------------------------------------------------- C1 (1)
|
|---------------------------------------------------------------------- C2 (2)
|
|---------------------------------------------------------------------- C3 (3)
|
|---------------------------------------------------------------------- C4 (4)
|
|---------------------------------------------------------------------- C5 (5)
|
|---------------------------------------------------------------------- C6 (6)
+
|---------------------------------------------------------------------- C7 (7)
|
|---------------------------------------------------------------------- C8 (8)
|
|---------------------------------------------------------------------- C9 (9)
|
|---------------------------------------------------------------------- C10 (10)
|
|---------------------------------------------------------------------- C11 (11)
|
\---------------------------------------------------------------------- C12 (12)
Phylogram (based on average branch lengths):
/--------------------------------- C1 (1)
|
|------------------------------------- C2 (2)
|
|-------------------------------------- C3 (3)
|
|----------------------------------- C4 (4)
|
|--------------------------------- C5 (5)
|
|------------------------------ C6 (6)
+
|------------------------------------------------------------------------ C7 (7)
|
|-------------------------------- C8 (8)
|
|--------------------------------- C9 (9)
|
|-------------------------------------------------------- C10 (10)
|
|-------------------------------- C11 (11)
|
\--------------------------------------------------------------------- C12 (12)
|-----------| 0.020 expected changes per site
Calculating tree probabilities...
Credible sets of trees (3000 trees sampled):
50 % credible set contains 1499 trees
90 % credible set contains 2700 trees
95 % credible set contains 2850 trees
99 % credible set contains 2970 trees
Exiting mrbayes block
Reached end of file
Tasks completed, exiting program because mode is noninteractive
To return control to the command line after completion of file processing,
set mode to interactive with 'mb -i <filename>' (i is for interactive)
or use 'set mode=interactive'
MrBayes output code: 0
CODONML in paml version 4.8, March 2014
----------------------------------------------
Phe F TTT | Ser S TCT | Tyr Y TAT | Cys C TGT
TTC | TCC | TAC | TGC
Leu L TTA | TCA | *** * TAA | *** * TGA
TTG | TCG | TAG | Trp W TGG
----------------------------------------------
Leu L CTT | Pro P CCT | His H CAT | Arg R CGT
CTC | CCC | CAC | CGC
CTA | CCA | Gln Q CAA | CGA
CTG | CCG | CAG | CGG
----------------------------------------------
Ile I ATT | Thr T ACT | Asn N AAT | Ser S AGT
ATC | ACC | AAC | AGC
ATA | ACA | Lys K AAA | Arg R AGA
Met M ATG | ACG | AAG | AGG
----------------------------------------------
Val V GTT | Ala A GCT | Asp D GAT | Gly G GGT
GTC | GCC | GAC | GGC
GTA | GCA | Glu E GAA | GGA
GTG | GCG | GAG | GGG
----------------------------------------------
Nice code, uuh?
NSsites batch run (ncatG as in YNGP2000): 0 1 2 3 7 8
seq file is not paml/phylip format. Trying nexus format.
ns = 12 ls = 78
Reading sequences, sequential format..
Reading seq # 1: C1
Reading seq # 2: C2
Reading seq # 3: C3
Reading seq # 4: C4
Reading seq # 5: C5
Reading seq # 6: C6
Reading seq # 7: C7
Reading seq # 8: C8
Reading seq # 9: C9
Reading seq #10: C10
Reading seq #11: C11
Reading seq #12: C12
Sequences read..
Counting site patterns.. 0:00
20 patterns at 26 / 26 sites (100.0%), 0:00
Counting codons..
NG distances for seqs.:
1 2 3 4 5 6 7 8 9 10 11 12
528 bytes for distance
19520 bytes for conP
2720 bytes for fhK
5000000 bytes for space
Model 0: one-ratio
TREE # 1
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
0.012673 0.036359 0.036359 0.012673 0.012673 0.012763 0.053130 0.012763 0.012673 0.036271 0.012763 0.053130 0.300000 1.300000
ntime & nrate & np: 12 2 14
Bounds (np=14):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000100
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 999.000000
np = 14
lnL0 = -181.844094
Iterating by ming2
Initial: fx= 181.844094
x= 0.01267 0.03636 0.03636 0.01267 0.01267 0.01276 0.05313 0.01276 0.01267 0.03627 0.01276 0.05313 0.30000 1.30000
1 h-m-p 0.0015 3.0871 46.2169 CYCCC 181.055615 4 0.0009 27 | 0/14
2 h-m-p 0.0006 0.0028 37.3473 ++ 178.696091 m 0.0028 44 | 3/14
3 h-m-p 0.0022 0.0109 15.6304 YCYCCC 178.137395 5 0.0047 69 | 3/14
4 h-m-p 0.0017 0.0084 23.9622 YCCCCC 177.648589 5 0.0039 95 | 3/14
5 h-m-p 0.0025 0.0185 36.7904 YCCC 176.840014 3 0.0057 117 | 3/14
6 h-m-p 0.0017 0.0084 66.9198 CCCCC 176.106980 4 0.0028 142 | 3/14
7 h-m-p 0.2685 1.3424 0.2730 CYCCC 175.959482 4 0.4791 166 | 3/14
8 h-m-p 0.0025 0.0129 52.9059 YCCCCC 175.660024 5 0.0050 203 | 3/14
9 h-m-p 1.0986 7.9886 0.2407 YCCC 175.479208 3 1.8008 225 | 3/14
10 h-m-p 0.6267 3.1336 0.1304 CC 175.467087 1 0.2178 255 | 3/14
11 h-m-p 0.0021 0.0743 13.2968 +CCC 175.424732 2 0.0075 288 | 3/14
12 h-m-p 0.0073 0.0439 13.7006 YCC 175.400773 2 0.0041 308 | 3/14
13 h-m-p 0.0199 0.0995 0.7808 -CC 175.400458 1 0.0017 328 | 3/14
14 h-m-p 0.0160 8.0000 0.1316 +++YCC 175.384001 2 0.7676 362 | 3/14
15 h-m-p 0.0041 0.0367 24.7289 YC 175.375331 1 0.0022 391 | 3/14
16 h-m-p 1.6000 8.0000 0.0298 CC 175.374071 1 1.2654 410 | 3/14
17 h-m-p 1.6000 8.0000 0.0082 YC 175.373991 1 0.9428 439 | 3/14
18 h-m-p 1.6000 8.0000 0.0013 Y 175.373989 0 1.0920 467 | 3/14
19 h-m-p 1.6000 8.0000 0.0001 Y 175.373989 0 0.8320 495 | 3/14
20 h-m-p 1.6000 8.0000 0.0000 Y 175.373989 0 1.0955 523 | 3/14
21 h-m-p 1.6000 8.0000 0.0000 C 175.373989 0 1.3580 551 | 3/14
22 h-m-p 1.6000 8.0000 0.0000 -C 175.373989 0 0.1000 580 | 3/14
23 h-m-p 0.0762 8.0000 0.0000 -----C 175.373989 0 0.0000 613
Out..
lnL = -175.373989
614 lfun, 614 eigenQcodon, 7368 P(t)
Time used: 0:02
Model 1: NearlyNeutral
TREE # 1
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
0.012673 0.036359 0.036359 0.012673 0.012673 0.012763 0.053130 0.012763 0.012673 0.036271 0.012763 0.053130 1.662845 0.513725 0.554455
ntime & nrate & np: 12 2 15
Bounds (np=15):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 1.000000
Qfactor_NS = 5.376180
np = 15
lnL0 = -177.581903
Iterating by ming2
Initial: fx= 177.581903
x= 0.01267 0.03636 0.03636 0.01267 0.01267 0.01276 0.05313 0.01276 0.01267 0.03627 0.01276 0.05313 1.66284 0.51372 0.55445
1 h-m-p 0.0001 0.1308 45.3515 ++CYCCC 176.868653 4 0.0008 29 | 0/15
2 h-m-p 0.0006 0.0029 34.7948 ++ 174.833067 m 0.0029 47 | 3/15
3 h-m-p 0.0025 0.0125 10.6090 CYCCC 174.606779 4 0.0039 72 | 3/15
4 h-m-p 0.0031 0.0154 10.5522 CYCCC 174.390140 4 0.0060 97 | 3/15
5 h-m-p 0.0022 0.0173 28.3173 ++ 170.585302 m 0.0173 115 | 4/15
6 h-m-p 0.0249 0.1246 5.9012 CYC 170.527855 2 0.0070 136 | 4/15
7 h-m-p 0.0141 0.1357 2.9272 +YYCYCCCC 169.158886 7 0.0746 166 | 4/15
8 h-m-p 0.0033 0.0165 3.9412 YCC 169.137105 2 0.0022 187 | 4/15
9 h-m-p 0.0122 0.3452 0.7214 ++YYYYYYYYYY 168.042440 9 0.1954 216 | 4/15
10 h-m-p 0.0016 0.0079 8.3951 CCC 168.033439 2 0.0003 249 | 4/15
11 h-m-p 0.0033 0.4855 0.8432 +++YYYYYC 167.371834 5 0.2064 275 | 4/15
12 h-m-p 0.0003 0.0014 346.0095 YCCCC 166.757055 4 0.0005 311 | 4/15
13 h-m-p 0.0027 0.0136 4.1635 CC 166.749882 1 0.0010 331 | 4/15
14 h-m-p 0.0117 2.9221 0.3632 +++YYCC 166.542491 3 0.5592 356 | 4/15
15 h-m-p 0.4145 2.0723 0.2259 YCC 166.471216 2 0.2525 388 | 4/15
16 h-m-p 0.0102 0.1036 5.5934 CYC 166.380222 2 0.0126 420 | 4/15
17 h-m-p 0.2782 8.0000 0.2537 +CYC 166.259332 2 0.9534 442 | 4/15
18 h-m-p 1.6000 8.0000 0.1266 YYC 166.165093 2 1.2304 473 | 4/15
19 h-m-p 1.6000 8.0000 0.0266 YCCC 166.136425 3 1.1009 507 | 4/15
20 h-m-p 1.6000 8.0000 0.0028 CC 166.133748 1 1.5193 538 | 4/15
21 h-m-p 1.6000 8.0000 0.0025 YC 166.133366 1 2.6214 568 | 4/15
22 h-m-p 1.6000 8.0000 0.0024 CC 166.133078 1 2.5429 599 | 4/15
23 h-m-p 1.6000 8.0000 0.0018 C 166.133047 0 1.5934 628 | 4/15
24 h-m-p 1.6000 8.0000 0.0004 YC 166.133035 1 2.7507 658 | 4/15
25 h-m-p 1.6000 8.0000 0.0002 Y 166.133029 0 2.8660 687 | 4/15
26 h-m-p 1.6000 8.0000 0.0001 C 166.133028 0 1.4734 716 | 4/15
27 h-m-p 1.6000 8.0000 0.0000 C 166.133028 0 1.5514 745 | 4/15
28 h-m-p 1.6000 8.0000 0.0000 Y 166.133028 0 1.2772 774 | 4/15
29 h-m-p 1.6000 8.0000 0.0000 C 166.133028 0 1.2853 803 | 4/15
30 h-m-p 1.6000 8.0000 0.0000 C 166.133028 0 0.4000 832
Out..
lnL = -166.133028
833 lfun, 2499 eigenQcodon, 19992 P(t)
Time used: 0:06
Model 2: PositiveSelection
TREE # 1
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
0.012673 0.036359 0.036359 0.012673 0.012673 0.012763 0.053130 0.012763 0.012673 0.036271 0.012763 0.053130 0.990780 1.605788 0.590611 0.100545 1.203545
ntime & nrate & np: 12 3 17
Bounds (np=17):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 1.000000 999.000000
Qfactor_NS = 9.455073
np = 17
lnL0 = -173.595471
Iterating by ming2
Initial: fx= 173.595471
x= 0.01267 0.03636 0.03636 0.01267 0.01267 0.01276 0.05313 0.01276 0.01267 0.03627 0.01276 0.05313 0.99078 1.60579 0.59061 0.10054 1.20355
1 h-m-p 0.0000 0.0090 54.9337 +++YCYCCC 172.211527 5 0.0013 33 | 0/17
2 h-m-p 0.0007 0.0037 38.0045 ++ 168.540889 m 0.0037 53 | 3/17
3 h-m-p 0.0001 0.0003 53.0920 ++ 168.180277 m 0.0003 73 | 4/17
4 h-m-p 0.0003 0.0212 24.0936 +CCC 168.150936 2 0.0012 98 | 4/17
5 h-m-p 0.0009 0.0063 33.2078 +YYCCC 167.829215 4 0.0025 125 | 4/17
6 h-m-p 0.0070 0.0426 11.9530 +YYCCCC 166.903401 5 0.0236 154 | 4/17
7 h-m-p 0.0015 0.0076 38.6296 YCYCCC 166.536650 5 0.0033 182 | 4/17
8 h-m-p 0.0011 0.0057 16.0063 YYC 166.504125 2 0.0009 204 | 4/17
9 h-m-p 0.0028 1.3826 8.8099 ++++YYYC 160.568607 3 0.5842 231 | 4/17
10 h-m-p 0.2082 1.0412 1.9848 YCYC 159.237365 3 0.4558 255 | 4/17
11 h-m-p 0.1686 0.8432 1.3337 CCCC 158.878558 3 0.1917 281 | 4/17
12 h-m-p 0.0046 0.0229 45.0095 CC 158.564173 1 0.0049 303 | 4/17
13 h-m-p 0.1537 0.7683 0.9619 CC 158.519697 1 0.1537 325 | 4/17
14 h-m-p 0.0033 0.2232 44.9765 ++YCYCCCC 156.752956 6 0.1343 370 | 4/17
15 h-m-p 0.0937 0.4687 2.8640 YCC 156.709201 2 0.0646 393 | 4/17
16 h-m-p 0.0131 1.8096 14.1533 +YC 156.312162 1 0.1224 415 | 4/17
17 h-m-p 0.7878 3.9930 2.1989 YCYCCC 155.651432 5 2.0361 443 | 4/17
18 h-m-p 1.6000 8.0000 2.4549 CCCC 155.359700 3 1.8074 469 | 4/17
19 h-m-p 1.5112 7.8219 2.9360 YCCCC 155.226144 4 0.7971 496 | 4/17
20 h-m-p 0.6698 8.0000 3.4936 +YCYC 154.987863 3 1.8461 521 | 4/17
21 h-m-p 1.6000 8.0000 2.1191 CCCC 154.896503 3 1.4962 547 | 4/17
22 h-m-p 1.6000 8.0000 1.8023 CCC 154.861416 2 2.3173 571 | 4/17
23 h-m-p 0.9479 4.7394 1.0605 CC 154.859841 1 0.1991 593 | 4/17
24 h-m-p 0.0035 0.5083 60.8095 +YC 154.845573 1 0.0318 615 | 4/17
25 h-m-p 1.6000 8.0000 0.8145 YC 154.826535 1 3.4519 636 | 4/17
26 h-m-p 1.6000 8.0000 0.6242 YCC 154.806099 2 2.6192 672 | 4/17
27 h-m-p 1.6000 8.0000 0.3699 CCC 154.795904 2 2.5373 709 | 4/17
28 h-m-p 1.6000 8.0000 0.4366 YCCC 154.785781 3 2.9227 747 | 4/17
29 h-m-p 1.5761 8.0000 0.8095 C 154.784389 0 1.5761 780 | 4/17
30 h-m-p 1.6000 8.0000 0.2862 CC 154.784070 1 1.4499 815 | 4/17
31 h-m-p 1.6000 8.0000 0.0543 CC 154.783980 1 2.3118 850 | 4/17
32 h-m-p 0.7547 8.0000 0.1662 YC 154.783934 1 1.8262 884 | 4/17
33 h-m-p 1.6000 8.0000 0.0530 YC 154.783932 1 0.8163 918 | 4/17
34 h-m-p 1.6000 8.0000 0.0022 -----------C 154.783932 0 0.0000 962 | 4/17
35 h-m-p 0.0160 8.0000 0.2556 YC 154.783915 1 0.0384 996 | 4/17
36 h-m-p 1.1920 8.0000 0.0082 ++ 154.783688 m 8.0000 1029 | 4/17
37 h-m-p 0.1302 8.0000 0.5061 ++CCC 154.781587 2 2.0094 1068 | 4/17
38 h-m-p 1.6000 8.0000 0.2333 +YC 154.778856 1 4.2212 1103 | 4/17
39 h-m-p 1.6000 8.0000 0.3229 C 154.778491 0 1.7575 1136 | 4/17
40 h-m-p 1.6000 8.0000 0.2792 C 154.778407 0 1.8956 1169 | 4/17
41 h-m-p 1.6000 8.0000 0.0580 Y 154.778400 0 1.2524 1202 | 4/17
42 h-m-p 1.6000 8.0000 0.0134 Y 154.778398 0 3.2670 1235 | 4/17
43 h-m-p 1.6000 8.0000 0.0100 ++ 154.778378 m 8.0000 1268 | 4/17
44 h-m-p 0.2531 8.0000 0.3169 ++YC 154.778139 1 2.7531 1304 | 4/17
45 h-m-p 1.6000 8.0000 0.2411 ++ 154.776861 m 8.0000 1337 | 4/17
46 h-m-p 1.4631 8.0000 1.3185 CC 154.776187 1 1.3955 1372 | 4/17
47 h-m-p 1.6000 8.0000 0.2562 YC 154.776153 1 1.1560 1393 | 4/17
48 h-m-p 1.6000 8.0000 0.0788 +Y 154.776146 0 6.9694 1427 | 4/17
49 h-m-p 1.6000 8.0000 0.2761 YC 154.776133 1 3.9498 1461 | 4/17
50 h-m-p 1.6000 8.0000 0.3600 C 154.776129 0 2.3182 1494 | 4/17
51 h-m-p 1.6000 8.0000 0.3422 C 154.776128 0 2.4772 1527 | 4/17
52 h-m-p 1.6000 8.0000 0.3603 C 154.776127 0 2.3699 1560 | 4/17
53 h-m-p 1.6000 8.0000 0.3547 C 154.776127 0 2.4570 1593 | 4/17
54 h-m-p 1.6000 8.0000 0.3511 C 154.776127 0 2.4795 1626 | 4/17
55 h-m-p 1.6000 8.0000 0.3521 Y 154.776127 0 2.5811 1659 | 4/17
56 h-m-p 1.6000 8.0000 0.3456 C 154.776127 0 2.4550 1692 | 4/17
57 h-m-p 1.6000 8.0000 0.3530 Y 154.776127 0 2.7308 1725 | 4/17
58 h-m-p 1.6000 8.0000 0.3263 C 154.776127 0 2.2478 1758 | 4/17
59 h-m-p 1.6000 8.0000 0.3520 Y 154.776127 0 3.2248 1791 | 4/17
60 h-m-p 1.6000 8.0000 0.3412 C 154.776127 0 1.9835 1824 | 4/17
61 h-m-p 1.6000 8.0000 0.2617 Y 154.776127 0 3.0863 1857 | 4/17
62 h-m-p 1.6000 8.0000 0.3769 Y 154.776127 0 2.7707 1890 | 4/17
63 h-m-p 1.6000 8.0000 0.4532 Y 154.776127 0 2.8441 1923 | 4/17
64 h-m-p 1.6000 8.0000 0.0728 Y 154.776127 0 0.8782 1956 | 4/17
65 h-m-p 1.6000 8.0000 0.0191 -C 154.776127 0 0.1000 1990 | 4/17
66 h-m-p 0.1209 8.0000 0.0158 ----C 154.776127 0 0.0001 2027 | 4/17
67 h-m-p 0.0160 8.0000 0.1254 -------------.. | 4/17
68 h-m-p 0.0160 8.0000 0.0000 ---C 154.776127 0 0.0001 2107
Out..
lnL = -154.776127
2108 lfun, 8432 eigenQcodon, 75888 P(t)
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 21 w sets.
Calculating f(X), the marginal probability of data.
log(fX) = -166.580418 S = -154.688454 -6.926351
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 20 patterns 0:21
did 20 / 20 patterns 0:22
Time used: 0:22
Model 3: discrete
TREE # 1
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
0.012673 0.036359 0.036359 0.012673 0.012673 0.012763 0.053130 0.012763 0.012673 0.036271 0.012763 0.053130 0.937739 0.948231 0.346772 0.592413 1.351938 1.870646
ntime & nrate & np: 12 4 18
Bounds (np=18):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 -99.000000 -99.000000 0.000001 0.000001 0.000001
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000 999.000000 999.000000 999.000000
Qfactor_NS = 5.273326
np = 18
lnL0 = -176.349172
Iterating by ming2
Initial: fx= 176.349172
x= 0.01267 0.03636 0.03636 0.01267 0.01267 0.01276 0.05313 0.01276 0.01267 0.03627 0.01276 0.05313 0.93774 0.94823 0.34677 0.59241 1.35194 1.87065
1 h-m-p 0.0001 0.1388 46.2850 ++CYCCC 175.579738 4 0.0009 32 | 0/18
2 h-m-p 0.0006 0.0030 33.6662 ++ 173.412069 m 0.0030 53 | 3/18
3 h-m-p 0.0027 0.0137 10.9986 CYCCC 173.129017 4 0.0046 81 | 3/18
4 h-m-p 0.0031 0.0153 12.8130 YCYCCC 172.806535 5 0.0067 110 | 3/18
5 h-m-p 0.0021 0.0137 40.2683 ++ 170.073342 m 0.0137 131 | 4/18
6 h-m-p 0.0113 0.0768 24.4417 YCCCC 169.387687 4 0.0255 159 | 4/18
7 h-m-p 0.0140 0.0702 8.7804 +YYCCCC 168.486026 5 0.0441 189 | 4/18
8 h-m-p 0.0037 0.0207 105.3592 +YYYCYCCCC 164.646644 8 0.0162 223 | 4/18
9 h-m-p 0.0111 0.0556 11.3129 +YCYCCC 163.700752 5 0.0311 253 | 4/18
10 h-m-p 0.0005 0.0029 675.4570 +YCCC 161.854189 3 0.0014 280 | 4/18
11 h-m-p 0.0002 0.0011 1062.8085 CCCC 161.236155 3 0.0003 307 | 4/18
12 h-m-p 0.0036 0.0178 2.3750 CC 161.231531 1 0.0012 330 | 4/18
13 h-m-p 0.0006 0.2152 4.7321 ++++YYYCC 159.725793 4 0.1484 360 | 4/18
14 h-m-p 0.0302 0.1510 2.2025 ++ 159.181264 m 0.1510 381 | 5/18
15 h-m-p 0.0954 1.4414 3.1341 +YCYCCCC 157.475161 6 0.7482 414 | 5/18
16 h-m-p 0.0652 0.3261 2.9700 YYC 157.393045 2 0.0522 437 | 5/18
17 h-m-p 0.0023 0.0580 66.9040 +YCCC 156.632714 3 0.0222 464 | 5/18
18 h-m-p 0.5880 2.9402 0.9679 CCCCC 156.366182 4 0.8213 493 | 5/18
19 h-m-p 0.6544 8.0000 1.2148 CCC 156.125703 2 0.7447 531 | 5/18
20 h-m-p 0.5913 8.0000 1.5300 +YCCC 155.535292 3 3.4021 558 | 5/18
21 h-m-p 1.6000 8.0000 2.0100 YCCC 155.351963 3 1.2341 584 | 5/18
22 h-m-p 1.5896 8.0000 1.5604 YYCCC 155.218014 4 2.3561 611 | 5/18
23 h-m-p 1.6000 8.0000 1.2250 CCCC 155.176825 3 2.1281 638 | 5/18
24 h-m-p 1.6000 8.0000 0.4265 ++ 155.135693 m 8.0000 659 | 5/18
25 h-m-p 1.6000 8.0000 0.8603 +YCCC 155.049648 3 4.7709 699 | 5/18
26 h-m-p 1.6000 8.0000 0.4262 CCC 155.018210 2 1.7336 737 | 5/18
27 h-m-p 0.6627 8.0000 1.1150 +CCCC 154.952500 3 3.4498 778 | 5/18
28 h-m-p 1.6000 8.0000 1.9878 YCCCC 154.852836 4 3.1316 806 | 5/18
29 h-m-p 0.9017 8.0000 6.9039 CYCC 154.815278 3 0.7502 832 | 5/18
30 h-m-p 1.6000 8.0000 2.0381 YC 154.795153 1 2.6897 854 | 5/18
31 h-m-p 1.6000 8.0000 0.6912 CC 154.787989 1 2.4782 877 | 5/18
32 h-m-p 1.6000 8.0000 0.2528 CC 154.782032 1 2.1115 913 | 5/18
33 h-m-p 1.6000 8.0000 0.1588 CCC 154.779116 2 1.7659 951 | 5/18
34 h-m-p 1.2146 8.0000 0.2309 +YC 154.777606 1 4.0366 987 | 5/18
35 h-m-p 1.6000 8.0000 0.3069 CC 154.776947 1 1.7802 1023 | 5/18
36 h-m-p 1.6000 8.0000 0.2677 YC 154.776544 1 3.7250 1058 | 5/18
37 h-m-p 1.6000 8.0000 0.0132 YC 154.776358 1 2.6564 1093 | 5/18
38 h-m-p 0.2249 8.0000 0.1557 ++YC 154.776226 1 2.2689 1130 | 5/18
39 h-m-p 1.6000 8.0000 0.0236 +C 154.776150 0 5.6122 1165 | 5/18
40 h-m-p 1.6000 8.0000 0.0665 C 154.776128 0 1.4056 1199 | 5/18
41 h-m-p 1.6000 8.0000 0.0003 Y 154.776127 0 2.7453 1233 | 5/18
42 h-m-p 0.5332 8.0000 0.0017 +C 154.776127 0 2.0209 1268 | 5/18
43 h-m-p 1.6000 8.0000 0.0011 C 154.776127 0 1.5231 1302 | 5/18
44 h-m-p 1.6000 8.0000 0.0003 C 154.776127 0 1.6000 1336 | 5/18
45 h-m-p 1.6000 8.0000 0.0000 +Y 154.776127 0 4.3883 1371 | 5/18
46 h-m-p 1.6000 8.0000 0.0001 Y 154.776127 0 1.0034 1405 | 5/18
47 h-m-p 1.6000 8.0000 0.0000 --C 154.776127 0 0.0335 1441
Out..
lnL = -154.776127
1442 lfun, 5768 eigenQcodon, 51912 P(t)
Time used: 0:33
Model 7: beta
TREE # 1
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
0.012673 0.036359 0.036359 0.012673 0.012673 0.012763 0.053130 0.012763 0.012673 0.036271 0.012763 0.053130 0.937739 1.123969 1.634343
ntime & nrate & np: 12 1 15
Bounds (np=15):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.005000 0.005000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 99.000000 99.000000
Qfactor_NS = 10.252387
np = 15
lnL0 = -176.584992
Iterating by ming2
Initial: fx= 176.584992
x= 0.01267 0.03636 0.03636 0.01267 0.01267 0.01276 0.05313 0.01276 0.01267 0.03627 0.01276 0.05313 0.93774 1.12397 1.63434
1 h-m-p 0.0004 0.7081 49.1941 +YCCCC 175.701286 4 0.0009 28 | 0/15
2 h-m-p 0.0006 0.0029 34.1595 ++ 173.598532 m 0.0029 46 | 3/15
3 h-m-p 0.0030 0.0150 8.5832 CCCCC 173.448873 4 0.0038 72 | 3/15
4 h-m-p 0.0060 0.0299 4.0907 YCC 173.418442 2 0.0041 93 | 3/15
5 h-m-p 0.0047 0.2564 3.6076 ++YYYYCC 173.099718 5 0.0724 119 | 3/15
6 h-m-p 0.0018 0.0090 108.7356 +YCYYCCC 171.906845 6 0.0056 148 | 3/15
7 h-m-p 0.0097 0.0485 2.6292 YCC 171.893416 2 0.0054 169 | 3/15
8 h-m-p 0.0035 0.1672 4.0760 ++YYYYYYCCCC 171.582827 10 0.0646 202 | 3/15
9 h-m-p 0.0437 0.2817 6.0212 +YYYCYYYYCY 168.687802 10 0.2550 232 | 3/15
10 h-m-p 0.0011 0.0055 43.2628 +YCCCC 168.503628 4 0.0031 258 | 3/15
11 h-m-p 0.0113 0.0567 4.0416 YCCC 168.438883 3 0.0066 281 | 3/15
12 h-m-p 0.0303 0.1517 0.6781 +CCCC 168.122420 3 0.1104 306 | 3/15
13 h-m-p 0.0006 0.0028 10.4099 ++ 167.915615 m 0.0028 336 | 3/15
14 h-m-p -0.0000 -0.0000 1.9142
h-m-p: -0.00000000e+00 -0.00000000e+00 1.91416185e+00 167.915615
.. | 3/15
15 h-m-p 0.0000 0.0089 31.4062 ++Y
a 0.000071 0.000285 0.001139 0.000640
f 167.850493 167.693938 167.791379 168.457569
7.121691e-05 167.850493
1.246296e-04 167.805809
1.780423e-04 167.763863
2.314550e-04 167.725455
2.848676e-04 167.693938
3.382803e-04 167.678603
3.916930e-04 167.699871
4.451057e-04 167.790746
4.985184e-04 167.976409
5.519311e-04 168.220691
6.053438e-04 168.411241
6.587564e-04 168.453307
7.121691e-04 168.354283
7.655818e-04 168.202458
8.189945e-04 168.067130
8.724072e-04 167.966841
9.258199e-04 167.896756
9.792325e-04 167.848500
1.032645e-03 167.816187
1.086058e-03 167.797135
1.139471e-03 167.791379
Linesearch2 a4: multiple optima?
CCYCCC 167.678566 6 0.0003 402 | 3/15
16 h-m-p 0.0000 0.0001 218.0200 ++ 167.249471 m 0.0001 420 | 3/15
17 h-m-p 0.0020 0.0100 9.1020 CCCCC 167.157619 4 0.0023 446 | 3/15
18 h-m-p 0.0023 0.0116 1.1123 YC 167.154077 1 0.0054 465 | 3/15
19 h-m-p 0.0005 0.0024 3.0069 ++ 167.147073 m 0.0024 483 | 3/15
20 h-m-p -0.0000 -0.0000 173.4145
h-m-p: -0.00000000e+00 -0.00000000e+00 1.73414503e+02 167.147073
.. | 3/15
21 h-m-p 0.0002 0.1043 7.6870 CYYCC 167.128506 4 0.0005 523 | 3/15
22 h-m-p 0.0002 0.0008 17.9470 +YC 167.096297 1 0.0007 543 | 3/15
23 h-m-p 0.0051 0.0939 2.3602 CCC 167.085200 2 0.0046 565 | 3/15
24 h-m-p 0.0078 0.0391 1.1053 ++ 167.050390 m 0.0391 583 | 3/15
25 h-m-p -0.0000 -0.0000 100.2302
h-m-p: -0.00000000e+00 -0.00000000e+00 1.00230157e+02 167.050390
.. | 3/15
26 h-m-p 0.0005 0.2747 2.2827 +YCYC 167.045657 3 0.0016 621 | 3/15
27 h-m-p 0.0002 0.0008 3.5284 +YC 167.044104 1 0.0007 641 | 3/15
28 h-m-p 0.0018 0.3927 1.3417 ++CCCC 167.019049 3 0.0392 667 | 3/15
29 h-m-p 0.0005 0.0026 14.7859 ++ 166.987303 m 0.0026 685 | 3/15
30 h-m-p -0.0000 -0.0000 110.3199
h-m-p: -0.00000000e+00 -0.00000000e+00 1.10319929e+02 166.987303
.. | 3/15
31 h-m-p 0.0003 0.1421 3.4645 ++CCC 166.963270 2 0.0041 724 | 3/15
32 h-m-p 0.0004 0.0019 1.6374 ++ 166.960062 m 0.0019 742 | 3/15
33 h-m-p 0.0022 1.1227 1.5710 YCYCYC 166.955222 5 0.0044 767 | 3/15
34 h-m-p 0.0002 0.0185 33.6430 ++++ 166.501690 m 0.0185 787 | 4/15
35 h-m-p 0.0009 0.0046 352.7949 CYCYCCC 166.175225 6 0.0016 815 | 4/15
36 h-m-p 0.0010 0.0051 208.2614 YCYC 166.149029 3 0.0004 837 | 4/15
37 h-m-p 0.0202 0.1009 2.7273 CC 166.144243 1 0.0045 857 | 4/15
38 h-m-p 0.0438 0.3864 0.2825 -CC 166.144087 1 0.0032 878 | 4/15
39 h-m-p 0.0088 4.3995 0.1153 ++YC 166.140199 1 0.2724 910 | 4/15
40 h-m-p 0.0072 0.0885 4.3487 YC 166.138363 1 0.0035 940 | 4/15
41 h-m-p 1.0550 8.0000 0.0144 -YC 166.138343 1 0.0473 960 | 4/15
42 h-m-p 0.0073 3.6449 0.2747 +CC 166.138036 1 0.0353 992 | 4/15
43 h-m-p 1.6000 8.0000 0.0022 -YC 166.138032 1 0.0531 1023 | 4/15
44 h-m-p 0.0160 8.0000 0.0164 +CC 166.137919 1 0.0815 1055 | 4/15
45 h-m-p 1.3454 8.0000 0.0010 YC 166.137907 1 0.2457 1085 | 4/15
46 h-m-p 0.0113 5.6664 0.0444 +YCC 166.137567 2 0.0711 1118 | 4/15
47 h-m-p 1.6000 8.0000 0.0011 C 166.137445 0 1.8146 1147 | 4/15
48 h-m-p 1.6000 8.0000 0.0006 YC 166.137388 1 3.9828 1177 | 4/15
49 h-m-p 1.6000 8.0000 0.0008 C 166.137371 0 1.7335 1206 | 4/15
50 h-m-p 1.6000 8.0000 0.0005 C 166.137368 0 1.7214 1235 | 4/15
51 h-m-p 1.6000 8.0000 0.0001 Y 166.137368 0 0.9734 1264 | 4/15
52 h-m-p 1.6000 8.0000 0.0000 Y 166.137368 0 1.0651 1293 | 4/15
53 h-m-p 1.6000 8.0000 0.0000 ---C 166.137368 0 0.0063 1325
Out..
lnL = -166.137368
1326 lfun, 14586 eigenQcodon, 159120 P(t)
Time used: 1:05
Model 8: beta&w>1
TREE # 1
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
0.012673 0.036359 0.036359 0.012673 0.012673 0.012763 0.053130 0.012763 0.012673 0.036271 0.012763 0.053130 0.986261 0.900000 1.111233 1.927456 1.184825
ntime & nrate & np: 12 2 17
Bounds (np=17):
0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000004 0.000100 0.000010 0.005000 0.005000 1.000000
50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 50.000000 999.000000 0.999990 99.000000 99.000000 999.000000
Qfactor_NS = 9.526352
np = 17
lnL0 = -174.975783
Iterating by ming2
Initial: fx= 174.975783
x= 0.01267 0.03636 0.03636 0.01267 0.01267 0.01276 0.05313 0.01276 0.01267 0.03627 0.01276 0.05313 0.98626 0.90000 1.11123 1.92746 1.18483
1 h-m-p 0.0002 0.3664 49.1731 +YYCCC 174.067242 4 0.0009 29 | 0/17
2 h-m-p 0.0006 0.0030 34.2475 ++ 171.812332 m 0.0030 49 | 3/17
3 h-m-p 0.0030 0.0150 10.5706 CYCCC 171.523841 4 0.0050 76 | 3/17
4 h-m-p 0.0038 0.0190 11.0181 CCCCC 171.281077 4 0.0066 104 | 3/17
5 h-m-p 0.0029 0.0412 25.1268 +YYCCCCC 170.291268 6 0.0139 135 | 3/17
6 h-m-p 0.0030 0.0148 114.1041 YCCCC 168.521994 4 0.0063 162 | 3/17
7 h-m-p 0.0043 0.0215 41.7813 +
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
+ 163.025945 m 0.0215 182
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.100233e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063119e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41509) = 1.063120e-160 2000 rounds
| 4/17
8 h-m-p 0.0013 0.0066 44.0012
QuantileBeta(0.15, 0.00500, 2.43646) = 1.051640e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.50059) = 1.018631e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.45305) = 1.042900e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.45679) = 1.040947e-160 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.47869) = 1.029669e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46241) = 1.038031e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.46286) = 1.037798e-160 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.47077) = 1.033718e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46337) = 1.037533e-160 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.46707) = 1.035622e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
C 162.755611 5 0.0030 210
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.073728e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.46342) = 1.037509e-160 2000 rounds
| 4/17
9 h-m-p 0.0054 0.0924 24.2091
QuantileBeta(0.15, 0.00500, 2.53060) = 1.003877e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.73215) = 9.148165e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 3.53833) = 6.747403e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.93488) = 8.397769e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.00155) = 8.177048e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.26994) = 7.394089e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.40413) = 7.056026e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.15201) = 7.718935e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.16279) = 7.688063e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.21637) = 7.538226e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17450) = 7.654824e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.17504) = 7.653291e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.19570) = 7.595325e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17547) = 7.652076e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.18559) = 7.623595e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
C 159.859275 7 0.0578 243
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.919149e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652014e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.17549) = 7.652019e-161 2000 rounds
| 4/17
10 h-m-p 0.7258 3.6289 1.0281
QuantileBeta(0.15, 0.00500, 3.45887) = 6.926823e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.30899) = 5.391684e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.83926) = 6.144394e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.84146) = 6.140383e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 4.07523) = 5.741804e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87237) = 6.084548e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.97380) = 5.908225e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87414) = 6.081383e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.92397) = 5.993558e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
C 158.359868 4 1.7908 270
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.292651e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87470) = 6.080382e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87469) = 6.080386e-161 2000 rounds
| 4/17
11 h-m-p 0.0339 0.1695 2.2760
QuantileBeta(0.15, 0.00500, 3.87565) = 6.078681e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87851) = 6.073570e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87548) = 6.078974e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.87708) = 6.076125e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
C 158.286903 2 0.0310 293
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.291035e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078821e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87557) = 6.078825e-161 2000 rounds
| 4/17
12 h-m-p 0.0025 0.0798 28.5181
QuantileBeta(0.15, 0.00500, 3.87442) = 6.080875e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87098) = 6.087034e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 3.85722) = 6.111794e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86669) = 6.094730e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.86698) = 6.094215e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.86898) = 6.090622e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093907e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.86806) = 6.092264e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
C 157.770259 3 0.0182 319
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.306632e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86716) = 6.093892e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86715) = 6.093896e-161 2000 rounds
| 4/17
13 h-m-p 0.0027 0.0135 38.6529
QuantileBeta(0.15, 0.00500, 3.86614) = 6.095713e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86311) = 6.101169e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.86673) = 6.094661e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095437e-161 2000 rounds
C 157.684784 1 0.0023 341
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.308216e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095423e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86630) = 6.095427e-161 2000 rounds
| 4/17
14 h-m-p 0.0189 0.0943 2.1930
QuantileBeta(0.15, 0.00500, 3.87274) = 6.083880e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86791) = 6.092536e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86827) = 6.091895e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.87051) = 6.087885e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86823) = 6.091974e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.86807) = 6.092255e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
C 157.678583 2 0.0056 365
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.304648e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091975e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.86822) = 6.091979e-161 2000 rounds
| 4/17
15 h-m-p 0.0036 0.9797 3.3900
QuantileBeta(0.15, 0.00500, 3.87106) = 6.086896e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.87956) = 6.071699e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 3.91358) = 6.011657e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 4.04965) = 5.782878e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 4.59394) = 5.018529e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.08350) = 5.728647e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 4.33872) = 5.350191e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.15529) = 5.616892e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 4.15870) = 5.611693e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 4.24871) = 5.477831e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16419) = 5.603337e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 4.20645) = 5.539875e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
C 157.170698 4 0.3801 395
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.798369e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16457) = 5.602774e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16456) = 5.602778e-161 2000 rounds
| 4/17
16 h-m-p 0.0278 0.1390 2.8826
QuantileBeta(0.15, 0.00500, 4.16855) = 5.596736e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16556) = 5.601266e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600755e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 4.16722) = 5.598745e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
C 157.160936 1 0.0093 417
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.796266e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600742e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.16590) = 5.600746e-161 2000 rounds
| 4/17
17 h-m-p 0.0419 8.0000 0.6422
QuantileBeta(0.15, 0.00500, 4.14758) = 5.628688e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.09262) = 5.714206e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 3.87276) = 6.083851e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.99333) = 8.203646e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.58233) = 6.651989e-161 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 3.57544) = 6.666746e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.28438) = 7.356162e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56636) = 6.686302e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 3.42537) = 7.005327e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
C 156.955520 3 1.3726 444
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.920394e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56621) = 6.686620e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56590) = 6.687289e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 3.56606) = 6.686955e-161 2000 rounds
| 4/17
18 h-m-p 1.1175 6.0263 0.7889
QuantileBeta(0.15, 0.00500, 2.90574) = 8.498025e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.70308) = 9.266783e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.59895) = 9.718057e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.20644) = 1.189728e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58374) = 9.787687e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.39509) = 1.074086e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
C 156.845261 3 1.6669 483
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 1.014202e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58122) = 9.799301e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58096) = 9.800516e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.58109) = 9.799908e-161 2000 rounds
| 4/17
19 h-m-p 0.4005 2.0023 1.3777 +YYYYC 156.748927 4 1.5223 521 | 4/17
20 h-m-p 0.1413 0.7066 0.9903 CYYYCYCYC 156.737696 8 0.4191 552 | 4/17
21 h-m-p 1.6000 8.0000 0.1555 -YC 156.737258 1 0.1805 587 | 4/17
22 h-m-p 0.3497 3.4389 0.0802 ---------------.. | 4/17
23 h-m-p 0.0000 0.0239 8.0354 +++CCC 156.630603 2 0.0033 673 | 4/17
24 h-m-p 0.0020 0.0134 13.2897 CYCCC 156.471458 4 0.0036 700 | 4/17
25 h-m-p 0.0057 0.0283 4.6915 CCCCC 156.412857 4 0.0068 728 | 4/17
26 h-m-p 0.0077 0.0422 4.1492 CCCCC 156.363815 4 0.0096 756 | 4/17
27 h-m-p 0.0147 0.0879 2.7147 YCCC 156.347576 3 0.0075 781 | 4/17
28 h-m-p 0.0147 0.0813 1.3935 CCC 156.344609 2 0.0042 805 | 4/17
29 h-m-p 0.0093 1.5741 0.6328 ++YC 156.289053 1 0.2440 828 | 4/17
30 h-m-p 0.0040 0.0412 38.1406 CYC 156.233104 2 0.0042 864 | 4/17
31 h-m-p 0.0215 0.1077 1.3335 YC 156.232123 1 0.0028 885 | 4/17
32 h-m-p 0.0111 2.1057 0.3354 +YC 156.228631 1 0.0720 907 | 4/17
33 h-m-p 0.0074 0.2528 3.2863 +CCC 156.213840 2 0.0310 945 | 4/17
34 h-m-p 0.0033 0.1324 30.4023 +CCC 156.164500 2 0.0119 970 | 4/17
35 h-m-p 0.5033 8.0000 0.7191 ++ 155.758279 m 8.0000 990 | 4/17
36 h-m-p 0.8297 4.1487 2.2168 CYCCCCC 155.348109 6 1.2774 1034 | 4/17
37 h-m-p 1.2273 6.7584 2.3073 YCCCCC 155.012524 5 2.5857 1063 | 4/17
38 h-m-p 1.6000 8.0000 3.0567
QuantileBeta(0.15, 0.00500, 2.24239) = 1.165831e-160 2000 rounds
CCCC 154.882691 3 2.0221 1089 | 4/17
39 h-m-p 1.6000 8.0000 3.7406
QuantileBeta(0.15, 0.00500, 2.83050) = 8.768174e-161 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.39546) = 1.073880e-160 2000 rounds
YCC 154.806691 3 2.0004 1114 | 4/17
40 h-m-p 1.6000 8.0000 2.9392
QuantileBeta(0.15, 0.00500, 2.17273) = 1.213034e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.96345) = 8.301744e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.19724) = 1.196001e-160 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.58035) = 9.803330e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18539) = 1.204176e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
C 154.781834 2 1.6768 1137
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18538) = 1.204187e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.18537) = 1.204188e-160 2000 rounds
| 4/17
41 h-m-p 1.6000 8.0000 2.1469
QuantileBeta(0.15, 0.00500, 2.37781) = 1.083742e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95513) = 8.329502e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.29592) = 1.131956e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.29926) = 1.129904e-160 2000 rounds
C
QuantileBeta(0.15, 0.00500, 2.33854) = 1.106347e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
C 154.777532 2 0.9554 1160
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.168700e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.30029) = 1.129278e-160 2000 rounds
| 4/17
42 h-m-p 1.6000 8.0000 1.1507
QuantileBeta(0.15, 0.00500, 2.40350) = 1.069447e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.71314) = 9.225400e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37607) = 1.084728e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
C 154.776218 1 1.1490 1181
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.123567e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37441) = 1.085666e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.37440) = 1.085667e-160 2000 rounds
| 4/17
43 h-m-p 1.6000 8.0000 0.3527
QuantileBeta(0.15, 0.00500, 2.40601) = 1.068070e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.50082) = 1.018513e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39623) = 1.073454e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
C 154.776132 1 1.1024 1202
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.110956e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39631) = 1.073411e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39605) = 1.073551e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.39618) = 1.073481e-160 2000 rounds
| 4/17
44 h-m-p 1.6000 8.0000 0.0831
QuantileBeta(0.15, 0.00500, 2.40363) = 1.069374e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.42598) = 1.057236e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
Y
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
C 154.776127 1 0.9850 1236
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.108335e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40089) = 1.070879e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40064) = 1.071019e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40077) = 1.070949e-160 2000 rounds
| 4/17
45 h-m-p 1.6000 8.0000 0.0110
QuantileBeta(0.15, 0.00500, 2.40176) = 1.070401e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40475) = 1.068761e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
C 154.776127 0 1.3735 1269
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.107849e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40175) = 1.070409e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070549e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070479e-160 2000 rounds
| 4/17
46 h-m-p 1.6000 8.0000 0.0020
QuantileBeta(0.15, 0.00500, 2.40145) = 1.070575e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40092) = 1.070864e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
Y 154.776127 0 1.0804 1302
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.107916e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40163) = 1.070474e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40138) = 1.070614e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070544e-160 2000 rounds
| 4/17
47 h-m-p 1.6000 8.0000 0.0002
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070552e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40144) = 1.070579e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
Y 154.776127 0 1.2169 1335
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.107923e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40162) = 1.070480e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40136) = 1.070620e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40149) = 1.070550e-160 2000 rounds
| 4/17
48 h-m-p 1.6000 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070547e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40152) = 1.070535e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
C 154.776127 0 2.1087 1368
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.107918e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40163) = 1.070475e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40137) = 1.070615e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40150) = 1.070545e-160 2000 rounds
| 4/17
49 h-m-p 1.6000 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 2.40151) = 1.070540e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40154) = 1.070523e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
+ 154.776127 m 8.0000 1401
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.107888e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40168) = 1.070447e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40143) = 1.070587e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40155) = 1.070517e-160 2000 rounds
| 4/17
50 h-m-p 0.8084 8.0000 0.0001
QuantileBeta(0.15, 0.00500, 2.40165) = 1.070465e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40193) = 1.070309e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.40249) = 1.070002e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
C 154.776127 0 3.7264 1435
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.107640e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40212) = 1.070207e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40186) = 1.070347e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40199) = 1.070277e-160 2000 rounds
| 4/17
51 h-m-p 1.6000 8.0000 0.0003
QuantileBeta(0.15, 0.00500, 2.40240) = 1.070051e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40363) = 1.069374e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
+ 154.776127 m 8.0000 1468
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.106472e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40417) = 1.069078e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40392) = 1.069218e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.40404) = 1.069148e-160 2000 rounds
| 4/17
52 h-m-p 0.0292 8.0000 0.0707
QuantileBeta(0.15, 0.00500, 2.40611) = 1.068017e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.41229) = 1.064637e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.43705) = 1.051329e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.93211) = 8.407195e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53729) = 1.000643e-160 2000 rounds
C 154.776127 0 1.8705 1504
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.036190e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53619) = 1.001175e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53593) = 1.001300e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
QuantileBeta(0.15, 0.00500, 2.53606) = 1.001238e-160 2000 rounds
| 4/17
53 h-m-p 1.6000 8.0000 0.0524
QuantileBeta(0.15, 0.00500, 2.61986) = 9.624008e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.87124) = 8.619794e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
+ 154.776126 m 8.0000 1537
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.620578e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95518) = 8.329318e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95490) = 8.330258e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 2.95504) = 8.329788e-161 2000 rounds
| 4/17
54 h-m-p 0.4486 8.0000 0.9340
QuantileBeta(0.15, 0.00500, 3.37404) = 7.129136e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 4.63104) = 4.973707e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 9.65902) = 2.248370e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
Y 154.776124 0 3.9597 1571
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.460964e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65346) = 3.344100e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65303) = 3.344337e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 6.65324) = 3.344218e-161 2000 rounds
| 4/17
55 h-m-p 1.6000 8.0000 0.4988
QuantileBeta(0.15, 0.00500, 7.45114) = 2.961185e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 9.84482) = 2.203723e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
C 154.776123 0 1.4706 1604
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 3.093222e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38682) = 2.988780e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38636) = 2.988982e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 7.38659) = 2.988881e-161 2000 rounds
| 4/17
56 h-m-p 1.1565 8.0000 0.6342
QuantileBeta(0.15, 0.00500, 8.12008) = 2.701706e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 10.32053) = 2.097093e-161 2000 rounds
+
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
+ 154.776123 m 8.0000 1637
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.782341e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46071) = 1.722173e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46007) = 1.722264e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 12.46039) = 1.722218e-161 2000 rounds
| 4/17
57 h-m-p 1.6000 8.0000 2.5077
QuantileBeta(0.15, 0.00500, 16.47265) = 1.289837e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 28.50942) = 7.356726e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 32.52168) = 5.184418e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
Y 154.776123 0 4.7198 1671
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.961335e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29594) = 8.659046e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659050e-162 2000 rounds
| 4/17
58 h-m-p 1.6000 8.0000 1.3745
QuantileBeta(0.15, 0.00500, 22.09666) = 9.540580e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 15.49887) = 1.373534e-161 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
Y 154.776123 0 0.9676 1691
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.491704e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96595) = 9.171524e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 22.96594) = 9.171528e-162 2000 rounds
| 4/17
59 h-m-p 0.4745 8.0000 2.8029
QuantileBeta(0.15, 0.00500, 24.29593) = 8.659049e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 28.28591) = 7.415892e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
Y 154.776122 0 1.0803 1711
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.364589e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99401) = 8.082430e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 25.99400) = 8.082434e-162 2000 rounds
| 4/17
60 h-m-p 1.6000 8.0000 0.2301
QuantileBeta(0.15, 0.00500, 26.36217) = 7.967399e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 27.46667) = 7.641138e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
C 154.776122 0 1.4830 1731
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 8.254127e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33576) = 7.975539e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33474) = 7.975856e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 26.33525) = 7.975698e-162 2000 rounds
| 4/17
61 h-m-p 0.1687 8.0000 2.0227
QuantileBeta(0.15, 0.00500, 26.67651) = 7.871742e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 27.70030) = 7.575520e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 31.79544) = 5.304708e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 42.51674) = 3.951274e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
Y 154.776122 0 2.1575 1766
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 7.061596e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69914) = 6.823390e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 30.69912) = 6.823393e-162 2000 rounds
| 4/17
62 h-m-p 1.6000 8.0000 2.2913
QuantileBeta(0.15, 0.00500, 27.03302) = 7.765998e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.78260) = 7.036922e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
C 154.776122 0 0.4848 1786
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.331204e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58835) = 7.083904e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
| 4/17
63 h-m-p 0.2957 7.8749 3.7567
QuantileBeta(0.15, 0.00500, 28.47756) = 7.365102e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.31065) = 7.152174e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.51892) = 7.100851e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.57098) = 7.088136e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58400) = 7.084964e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58726) = 7.084171e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58807) = 7.083973e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58827) = 7.083924e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58832) = 7.083911e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083907e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
Y 154.776122 0 0.0000 1815
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.331205e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58835) = 7.083904e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58834) = 7.083908e-162 2000 rounds
| 4/17
64 h-m-p 0.0160 8.0000 0.0014
QuantileBeta(0.15, 0.00500, 29.58833) = 7.083911e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58828) = 7.083921e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 29.58812) = 7.083961e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 29.58747) = 7.084119e-162 2000 rounds
+
QuantileBeta(0.15, 0.00500, 29.58486) = 7.084754e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
C 154.776122 0 1.1277 1838
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.331446e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58793) = 7.084006e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58683) = 7.084275e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58738) = 7.084141e-162 2000 rounds
| 4/17
65 h-m-p 1.6000 8.0000 0.0003
QuantileBeta(0.15, 0.00500, 29.58728) = 7.084166e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58697) = 7.084241e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
Y 154.776122 0 1.1036 1871
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.331464e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58786) = 7.084023e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58676) = 7.084293e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58731) = 7.084158e-162 2000 rounds
| 4/17
66 h-m-p 1.6000 8.0000 0.0001
QuantileBeta(0.15, 0.00500, 29.58736) = 7.084145e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58753) = 7.084106e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
Y 154.776122 0 0.8807 1904
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.331457e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58789) = 7.084016e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58679) = 7.084285e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58734) = 7.084151e-162 2000 rounds
| 4/17
67 h-m-p 1.6000 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58739) = 7.084139e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
Y 154.776122 0 1.6000 1937
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.331453e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58791) = 7.084013e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58680) = 7.084282e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
| 4/17
68 h-m-p 1.6000 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58733) = 7.084152e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
C 154.776122 0 1.6000 1970
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.331455e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58790) = 7.084014e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58679) = 7.084284e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
| 4/17
69 h-m-p 1.6000 8.0000 0.0000
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084148e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
-
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
Y 154.776122 0 0.1000 2004
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
Out..
lnL = -154.776122
2005 lfun, 24060 eigenQcodon, 264660 P(t)
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
BEBing (dim = 4). This may take several minutes.
Calculating f(x_h|w): 10 categories 20 w sets.
Calculating f(X), the marginal probability of data.
log(fX) = -166.186748 S = -154.688427 -7.066145
Calculating f(w|X), posterior probabilities of site classes.
did 10 / 20 patterns 2:13
did 20 / 20 patterns 2:13
QuantileBeta(0.15, 0.00500, 29.58735) = 7.084149e-162 2000 rounds
Time used: 2:13
CodeML output code: -1
CLUSTAL FORMAT for T-COFFEE Version_10.00.r1613 [http://www.tcoffee.org] [MODE: ], CPU=0.00 sec, SCORE=100, Nseq=12, Len=26
D_melanogaster_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND
D_sechellia_CG46244-PA MMTSHLLTRLVISDDFRLSKMYLTND
D_simulans_CG46244-PA MMTSHLLTRLVISDDFRLSKMYLTND
D_yakuba_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND
D_erecta_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND
D_takahashii_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND
D_biarmipes_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND
D_suzukii_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND
D_eugracilis_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND
D_ficusphila_CG46244-PA MMTSHLLTRLVISDDFRLAKMYLTND
D_rhopaloa_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND
D_elegans_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND
********:*********:*******
>D_melanogaster_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTTCGAAAATGTATTTAACGAACGAT >D_sechellia_CG46244-PA ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG GCTTTCGAAAATGTATTTAACGAACGAT >D_simulans_CG46244-PA ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG GCTTTCGAAAATGTATTTAACGAACGAT >D_yakuba_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTTCGAAAATGTATTTAACGAACGAT >D_erecta_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTTCGAAAATGTATTTAACGAACGAT >D_takahashii_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTGCGAAAATGTATTTAACGAACGAT >D_biarmipes_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGACTTTCG GCTTGCGAAAATGTATTTAACGAACGAT >D_suzukii_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTGCGAAAATGTATTTAACGAACGAT >D_eugracilis_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTTCGAAAATGTATTTAACGAACGAT >D_ficusphila_CG46244-PA ATGATGACATCGCATTTACTAACACGTCTTGTAATATCCGATGATTTTCG GCTTGCGAAAATGTATTTAACGAACGAT >D_rhopaloa_CG46244-PA ATGATGACATCGCATTTACTAACACATCTTGTAATATCCGATGATTTTCG GCTTGCGAAAATGTATTTAACGAACGAT >D_elegans_CG46244-PA ATGATGACATCGCATTTACTAACACACCTTGTAATATCCGATGATTTTCG GCTTGCGAAAATGTATTTAACGAACGAT
>D_melanogaster_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND >D_sechellia_CG46244-PA MMTSHLLTRLVISDDFRLSKMYLTND >D_simulans_CG46244-PA MMTSHLLTRLVISDDFRLSKMYLTND >D_yakuba_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND >D_erecta_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND >D_takahashii_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND >D_biarmipes_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND >D_suzukii_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND >D_eugracilis_CG46244-PA MMTSHLLTHLVISDDFRLSKMYLTND >D_ficusphila_CG46244-PA MMTSHLLTRLVISDDFRLAKMYLTND >D_rhopaloa_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND >D_elegans_CG46244-PA MMTSHLLTHLVISDDFRLAKMYLTND
#NEXUS
[ID: 4519480281]
begin taxa;
dimensions ntax=12;
taxlabels
D_melanogaster_CG46244-PA
D_sechellia_CG46244-PA
D_simulans_CG46244-PA
D_yakuba_CG46244-PA
D_erecta_CG46244-PA
D_takahashii_CG46244-PA
D_biarmipes_CG46244-PA
D_suzukii_CG46244-PA
D_eugracilis_CG46244-PA
D_ficusphila_CG46244-PA
D_rhopaloa_CG46244-PA
D_elegans_CG46244-PA
;
end;
begin trees;
translate
1 D_melanogaster_CG46244-PA,
2 D_sechellia_CG46244-PA,
3 D_simulans_CG46244-PA,
4 D_yakuba_CG46244-PA,
5 D_erecta_CG46244-PA,
6 D_takahashii_CG46244-PA,
7 D_biarmipes_CG46244-PA,
8 D_suzukii_CG46244-PA,
9 D_eugracilis_CG46244-PA,
10 D_ficusphila_CG46244-PA,
11 D_rhopaloa_CG46244-PA,
12 D_elegans_CG46244-PA
;
[Note: This tree contains information on the topology,
branch lengths (if present), and the probability
of the partition indicated by the branch.]
tree con_50_majrule = (1:0.05280187,2:0.05951717,3:0.06047104,4:0.05550042,5:0.05341008,6:0.04811424,7:0.1158042,8:0.05068905,9:0.05230742,10:0.09060927,11:0.05226515,12:0.1110981);
[Note: This tree contains information only on the topology
and branch lengths (median of the posterior probability density).]
tree con_50_majrule = (1:0.05280187,2:0.05951717,3:0.06047104,4:0.05550042,5:0.05341008,6:0.04811424,7:0.1158042,8:0.05068905,9:0.05230742,10:0.09060927,11:0.05226515,12:0.1110981);
end;
Estimated marginal likelihoods for runs sampled in files
"/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
(Use the harmonic mean for Bayes factor comparisons of models)
(Values are saved to the file /opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.lstat)
Run Arithmetic mean Harmonic mean
--------------------------------------
1 -146.62 -158.03
2 -146.29 -159.66
--------------------------------------
TOTAL -146.44 -159.15
--------------------------------------
Model parameter summaries over the runs sampled in files
"/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run1.p" and "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.run2.p":
Summaries are based on a total of 3002 samples from 2 runs.
Each run produced 2001 samples of which 1501 samples were included.
Parameter summaries saved to file "/opt/ADOPS/161/CG46244-PA/batch/allfiles/mrbayes/input.fasta.fasta.mrb.pstat".
95% HPD Interval
--------------------
Parameter Mean Variance Lower Upper Median min ESS* avg ESS PSRF+
------------------------------------------------------------------------------------------------------
TL{all} 1.935610 0.198518 1.111090 2.837366 1.903942 1014.70 1156.25 1.000
r(A<->C){all} 0.108573 0.011164 0.000001 0.306852 0.078195 296.03 358.02 1.001
r(A<->G){all} 0.236642 0.027127 0.000356 0.546968 0.207967 209.51 223.41 1.000
r(A<->T){all} 0.042910 0.002608 0.000012 0.146012 0.025807 318.14 466.27 1.003
r(C<->G){all} 0.139977 0.017977 0.000027 0.408171 0.099930 155.84 158.35 1.002
r(C<->T){all} 0.300297 0.030618 0.029522 0.652046 0.272245 113.00 129.07 1.005
r(G<->T){all} 0.171602 0.018371 0.000343 0.438034 0.139495 266.37 294.52 1.006
pi(A){all} 0.303991 0.002556 0.204507 0.400660 0.303246 991.79 1131.80 1.000
pi(C){all} 0.173664 0.001569 0.094457 0.245215 0.170129 1091.75 1120.09 1.001
pi(G){all} 0.180034 0.001702 0.102256 0.258420 0.177207 1079.36 1244.71 1.001
pi(T){all} 0.342310 0.002720 0.243510 0.445177 0.340408 1168.26 1218.77 1.000
alpha{1,2} 0.314421 0.089594 0.004390 0.904983 0.212644 1255.95 1326.59 1.000
alpha{3} 0.357305 0.086089 0.049131 0.916327 0.270757 1394.33 1394.48 1.000
pinvar{all} 0.866638 0.004713 0.734314 0.970401 0.879896 1155.91 1199.63 1.000
------------------------------------------------------------------------------------------------------
* Convergence diagnostic (ESS = Estimated Sample Size); min and avg values
correspond to minimal and average ESS among runs.
ESS value below 100 may indicate that the parameter is undersampled.
+ Convergence diagnostic (PSRF = Potential Scale Reduction Factor; Gelman
and Rubin, 1992) should approach 1.0 as runs converge.
Setting sumt conformat to Simple
CODONML (in paml version 4.8, March 2014) /opt/ADOPS/161/CG46244-PA/batch/allfiles/codeml/input.fasta.fasta.pnxs
Model: One dN/dS ratio for branches,
Codon frequency model: F3x4
Site-class models:
ns = 12 ls = 26
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 0 0 0 0 0 0 | Tyr TAT 1 1 1 1 1 1 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 1 1 1 1 1 1 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 2 2 2 2 2 2 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 0 0 0 0 0 0 | TCG 2 2 2 2 2 1 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 2 2 2 2 2 2 | Pro CCT 0 0 0 0 0 0 | His CAT 2 1 1 2 2 2 | Arg CGT 0 1 1 0 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 0 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 0 0 0 0 0 0 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 1 1 1 1 1 1 | ACA 2 2 2 2 2 2 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 3 3 3 3 3 3 | ACG 1 1 1 1 1 1 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 0 0 0 0 0 0 | Ala GCT 0 0 0 0 0 0 | Asp GAT 3 3 3 3 3 3 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 0 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 1 1 1 1 1 1 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 0 0 0 0 0 1 | GAG 0 0 0 0 0 0 | GGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 1 1 1 1 1 1 | Ser TCT 0 0 0 0 0 0 | Tyr TAT 1 1 1 1 1 1 | Cys TGT 0 0 0 0 0 0
TTC 0 0 0 0 0 0 | TCC 1 1 1 1 1 1 | TAC 0 0 0 0 0 0 | TGC 0 0 0 0 0 0
Leu TTA 2 2 2 2 2 2 | TCA 0 0 0 0 0 0 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 0 0 0 0 0 0 | TCG 1 1 2 1 1 1 | TAG 0 0 0 0 0 0 | Trp TGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 2 2 2 2 2 2 | Pro CCT 0 0 0 0 0 0 | His CAT 2 2 2 1 2 1 | Arg CGT 0 0 0 1 0 0
CTC 0 0 0 0 0 0 | CCC 0 0 0 0 0 0 | CAC 0 0 0 0 0 1 | CGC 0 0 0 0 0 0
CTA 1 1 1 1 1 1 | CCA 0 0 0 0 0 0 | Gln CAA 0 0 0 0 0 0 | CGA 0 0 0 0 0 0
CTG 0 0 0 0 0 0 | CCG 0 0 0 0 0 0 | CAG 0 0 0 0 0 0 | CGG 1 1 1 1 1 1
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 0 0 0 0 0 0 | Thr ACT 0 0 0 0 0 0 | Asn AAT 0 0 0 0 0 0 | Ser AGT 0 0 0 0 0 0
ATC 0 0 0 0 0 0 | ACC 0 0 0 0 0 0 | AAC 1 1 1 1 1 1 | AGC 0 0 0 0 0 0
ATA 1 1 1 1 1 1 | ACA 2 2 2 2 2 2 | Lys AAA 1 1 1 1 1 1 | Arg AGA 0 0 0 0 0 0
Met ATG 3 3 3 3 3 3 | ACG 1 1 1 1 1 1 | AAG 0 0 0 0 0 0 | AGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 0 0 0 0 0 0 | Ala GCT 0 0 0 0 0 0 | Asp GAT 2 3 3 3 3 3 | Gly GGT 0 0 0 0 0 0
GTC 0 0 0 0 0 0 | GCC 0 0 0 0 0 0 | GAC 1 0 0 0 0 0 | GGC 0 0 0 0 0 0
GTA 1 1 1 1 1 1 | GCA 0 0 0 0 0 0 | Glu GAA 0 0 0 0 0 0 | GGA 0 0 0 0 0 0
GTG 0 0 0 0 0 0 | GCG 1 1 0 1 1 1 | GAG 0 0 0 0 0 0 | GGG 0 0 0 0 0 0
--------------------------------------------------------------------------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: D_melanogaster_CG46244-PA
position 1: T:0.26923 C:0.23077 A:0.34615 G:0.15385
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.34615 C:0.17949 A:0.32051 G:0.15385
#2: D_sechellia_CG46244-PA
position 1: T:0.26923 C:0.23077 A:0.34615 G:0.15385
position 2: T:0.42308 C:0.23077 A:0.26923 G:0.07692
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.34615 C:0.17949 A:0.30769 G:0.16667
#3: D_simulans_CG46244-PA
position 1: T:0.26923 C:0.23077 A:0.34615 G:0.15385
position 2: T:0.42308 C:0.23077 A:0.26923 G:0.07692
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.34615 C:0.17949 A:0.30769 G:0.16667
#4: D_yakuba_CG46244-PA
position 1: T:0.26923 C:0.23077 A:0.34615 G:0.15385
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.34615 C:0.17949 A:0.32051 G:0.15385
#5: D_erecta_CG46244-PA
position 1: T:0.26923 C:0.23077 A:0.34615 G:0.15385
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.34615 C:0.17949 A:0.32051 G:0.15385
#6: D_takahashii_CG46244-PA
position 1: T:0.23077 C:0.23077 A:0.34615 G:0.19231
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.33333 C:0.17949 A:0.32051 G:0.16667
#7: D_biarmipes_CG46244-PA
position 1: T:0.23077 C:0.23077 A:0.34615 G:0.19231
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.30769 C:0.11538 A:0.30769 G:0.26923
Average T:0.32051 C:0.19231 A:0.32051 G:0.16667
#8: D_suzukii_CG46244-PA
position 1: T:0.23077 C:0.23077 A:0.34615 G:0.19231
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.33333 C:0.17949 A:0.32051 G:0.16667
#9: D_eugracilis_CG46244-PA
position 1: T:0.26923 C:0.23077 A:0.34615 G:0.15385
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.34615 C:0.17949 A:0.32051 G:0.15385
#10: D_ficusphila_CG46244-PA
position 1: T:0.23077 C:0.23077 A:0.34615 G:0.19231
position 2: T:0.42308 C:0.23077 A:0.26923 G:0.07692
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.33333 C:0.17949 A:0.30769 G:0.17949
#11: D_rhopaloa_CG46244-PA
position 1: T:0.23077 C:0.23077 A:0.34615 G:0.19231
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.34615 C:0.07692 A:0.30769 G:0.26923
Average T:0.33333 C:0.17949 A:0.32051 G:0.16667
#12: D_elegans_CG46244-PA
position 1: T:0.23077 C:0.23077 A:0.34615 G:0.19231
position 2: T:0.42308 C:0.23077 A:0.30769 G:0.03846
position 3: T:0.30769 C:0.11538 A:0.30769 G:0.26923
Average T:0.32051 C:0.19231 A:0.32051 G:0.16667
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 12 | Ser S TCT 0 | Tyr Y TAT 12 | Cys C TGT 0
TTC 0 | TCC 12 | TAC 0 | TGC 0
Leu L TTA 24 | TCA 0 | *** * TAA 0 | *** * TGA 0
TTG 0 | TCG 18 | TAG 0 | Trp W TGG 0
------------------------------------------------------------------------------
Leu L CTT 24 | Pro P CCT 0 | His H CAT 20 | Arg R CGT 3
CTC 0 | CCC 0 | CAC 1 | CGC 0
CTA 12 | CCA 0 | Gln Q CAA 0 | CGA 0
CTG 0 | CCG 0 | CAG 0 | CGG 12
------------------------------------------------------------------------------
Ile I ATT 0 | Thr T ACT 0 | Asn N AAT 0 | Ser S AGT 0
ATC 0 | ACC 0 | AAC 12 | AGC 0
ATA 12 | ACA 24 | Lys K AAA 12 | Arg R AGA 0
Met M ATG 36 | ACG 12 | AAG 0 | AGG 0
------------------------------------------------------------------------------
Val V GTT 0 | Ala A GCT 0 | Asp D GAT 35 | Gly G GGT 0
GTC 0 | GCC 0 | GAC 1 | GGC 0
GTA 12 | GCA 0 | Glu E GAA 0 | GGA 0
GTG 0 | GCG 6 | GAG 0 | GGG 0
------------------------------------------------------------------------------
Codon position x base (3x4) table, overall
position 1: T:0.25000 C:0.23077 A:0.34615 G:0.17308
position 2: T:0.42308 C:0.23077 A:0.29808 G:0.04808
position 3: T:0.33974 C:0.08333 A:0.30769 G:0.26923
Average T:0.33761 C:0.18162 A:0.31731 G:0.16346
Nei & Gojobori 1986. dN/dS (dN, dS)
(Note: This matrix is not used in later ML. analysis.
Use runmode = -2 for ML pairwise comparison.)
D_melanogaster_CG46244-PA
D_sechellia_CG46244-PA -1.0000 (0.0168 0.0000)
D_simulans_CG46244-PA -1.0000 (0.0168 0.0000)-1.0000 (0.0000 0.0000)
D_yakuba_CG46244-PA -1.0000 (0.0000 0.0000)-1.0000 (0.0168 0.0000)-1.0000 (0.0168 0.0000)
D_erecta_CG46244-PA -1.0000 (0.0000 0.0000)-1.0000 (0.0168 0.0000)-1.0000 (0.0168 0.0000)-1.0000 (0.0000 0.0000)
D_takahashii_CG46244-PA -1.0000 (0.0167 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0167 0.0000)-1.0000 (0.0167 0.0000)
D_biarmipes_CG46244-PA 0.2768 (0.0167 0.0602) 0.5749 (0.0339 0.0589) 0.5749 (0.0339 0.0589) 0.2768 (0.0167 0.0602) 0.2768 (0.0167 0.0602)-1.0000 (0.0000 0.0603)
D_suzukii_CG46244-PA -1.0000 (0.0167 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0167 0.0000)-1.0000 (0.0167 0.0000)-1.0000 (0.0000 0.0000)-1.0000 (0.0000 0.0603)
D_eugracilis_CG46244-PA -1.0000 (0.0000 0.0000)-1.0000 (0.0168 0.0000)-1.0000 (0.0168 0.0000)-1.0000 (0.0000 0.0000)-1.0000 (0.0000 0.0000)-1.0000 (0.0167 0.0000) 0.2768 (0.0167 0.0602)-1.0000 (0.0167 0.0000)
D_ficusphila_CG46244-PA -1.0000 (0.0339 0.0000)-1.0000 (0.0169 0.0000)-1.0000 (0.0169 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0167 0.0000) 0.2834 (0.0167 0.0591)-1.0000 (0.0167 0.0000)-1.0000 (0.0339 0.0000)
D_rhopaloa_CG46244-PA -1.0000 (0.0167 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0339 0.0000)-1.0000 (0.0167 0.0000)-1.0000 (0.0167 0.0000)-1.0000 (0.0000 0.0000)-1.0000 (0.0000 0.0603)-1.0000 (0.0000 0.0000)-1.0000 (0.0167 0.0000)-1.0000 (0.0167 0.0000)
D_elegans_CG46244-PA 0.2768 (0.0167 0.0602) 0.5749 (0.0339 0.0589) 0.5749 (0.0339 0.0589) 0.2768 (0.0167 0.0602) 0.2768 (0.0167 0.0602)-1.0000 (0.0000 0.0603)-1.0000 (0.0000 0.1259)-1.0000 (0.0000 0.0603) 0.2768 (0.0167 0.0602) 0.2834 (0.0167 0.0591)-1.0000 (0.0000 0.0603)
Model 0: one-ratio
TREE # 1: (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
lnL(ntime: 12 np: 14): -175.373989 +0.000000
13..1 13..2 13..3 13..4 13..5 13..6 13..7 13..8 13..9 13..10 13..11 13..12
0.038102 0.077571 0.077571 0.038102 0.038102 0.000004 0.038324 0.000004 0.038102 0.038331 0.000004 0.038332 1.662845 1.184825
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.42255
(1: 0.038102, 2: 0.077571, 3: 0.077571, 4: 0.038102, 5: 0.038102, 6: 0.000004, 7: 0.038324, 8: 0.000004, 9: 0.038102, 10: 0.038331, 11: 0.000004, 12: 0.038332);
(D_melanogaster_CG46244-PA: 0.038102, D_sechellia_CG46244-PA: 0.077571, D_simulans_CG46244-PA: 0.077571, D_yakuba_CG46244-PA: 0.038102, D_erecta_CG46244-PA: 0.038102, D_takahashii_CG46244-PA: 0.000004, D_biarmipes_CG46244-PA: 0.038324, D_suzukii_CG46244-PA: 0.000004, D_eugracilis_CG46244-PA: 0.038102, D_ficusphila_CG46244-PA: 0.038331, D_rhopaloa_CG46244-PA: 0.000004, D_elegans_CG46244-PA: 0.038332);
Detailed output identifying parameters
kappa (ts/tv) = 1.66284
omega (dN/dS) = 1.18483
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
13..1 0.038 59.0 19.0 1.1848 0.0132 0.0111 0.8 0.2
13..2 0.078 59.0 19.0 1.1848 0.0269 0.0227 1.6 0.4
13..3 0.078 59.0 19.0 1.1848 0.0269 0.0227 1.6 0.4
13..4 0.038 59.0 19.0 1.1848 0.0132 0.0111 0.8 0.2
13..5 0.038 59.0 19.0 1.1848 0.0132 0.0111 0.8 0.2
13..6 0.000 59.0 19.0 1.1848 0.0000 0.0000 0.0 0.0
13..7 0.038 59.0 19.0 1.1848 0.0133 0.0112 0.8 0.2
13..8 0.000 59.0 19.0 1.1848 0.0000 0.0000 0.0 0.0
13..9 0.038 59.0 19.0 1.1848 0.0132 0.0111 0.8 0.2
13..10 0.038 59.0 19.0 1.1848 0.0133 0.0112 0.8 0.2
13..11 0.000 59.0 19.0 1.1848 0.0000 0.0000 0.0 0.0
13..12 0.038 59.0 19.0 1.1848 0.0133 0.0112 0.8 0.2
tree length for dN: 0.1464
tree length for dS: 0.1236
Time used: 0:02
Model 1: NearlyNeutral (2 categories)
TREE # 1: (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
lnL(ntime: 12 np: 15): -166.133028 +0.000000
13..1 13..2 13..3 13..4 13..5 13..6 13..7 13..8 13..9 13..10 13..11 13..12
0.046046 0.099854 0.099854 0.046046 0.046046 0.000004 0.045250 0.000004 0.046046 0.048117 0.000004 0.047886 0.990780 0.893213 0.000001
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.52516
(1: 0.046046, 2: 0.099854, 3: 0.099854, 4: 0.046046, 5: 0.046046, 6: 0.000004, 7: 0.045250, 8: 0.000004, 9: 0.046046, 10: 0.048117, 11: 0.000004, 12: 0.047886);
(D_melanogaster_CG46244-PA: 0.046046, D_sechellia_CG46244-PA: 0.099854, D_simulans_CG46244-PA: 0.099854, D_yakuba_CG46244-PA: 0.046046, D_erecta_CG46244-PA: 0.046046, D_takahashii_CG46244-PA: 0.000004, D_biarmipes_CG46244-PA: 0.045250, D_suzukii_CG46244-PA: 0.000004, D_eugracilis_CG46244-PA: 0.046046, D_ficusphila_CG46244-PA: 0.048117, D_rhopaloa_CG46244-PA: 0.000004, D_elegans_CG46244-PA: 0.047886);
Detailed output identifying parameters
kappa (ts/tv) = 0.99078
dN/dS (w) for site classes (K=2)
p: 0.89321 0.10679
w: 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
13..1 0.046 60.4 17.6 0.1068 0.0053 0.0497 0.3 0.9
13..2 0.100 60.4 17.6 0.1068 0.0115 0.1078 0.7 1.9
13..3 0.100 60.4 17.6 0.1068 0.0115 0.1078 0.7 1.9
13..4 0.046 60.4 17.6 0.1068 0.0053 0.0497 0.3 0.9
13..5 0.046 60.4 17.6 0.1068 0.0053 0.0497 0.3 0.9
13..6 0.000 60.4 17.6 0.1068 0.0000 0.0000 0.0 0.0
13..7 0.045 60.4 17.6 0.1068 0.0052 0.0489 0.3 0.9
13..8 0.000 60.4 17.6 0.1068 0.0000 0.0000 0.0 0.0
13..9 0.046 60.4 17.6 0.1068 0.0053 0.0497 0.3 0.9
13..10 0.048 60.4 17.6 0.1068 0.0055 0.0520 0.3 0.9
13..11 0.000 60.4 17.6 0.1068 0.0000 0.0000 0.0 0.0
13..12 0.048 60.4 17.6 0.1068 0.0055 0.0517 0.3 0.9
Time used: 0:06
Model 2: PositiveSelection (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
lnL(ntime: 12 np: 17): -154.776127 +0.000000
13..1 13..2 13..3 13..4 13..5 13..6 13..7 13..8 13..9 13..10 13..11 13..12
0.048295 0.142552 0.142552 0.048295 0.048295 0.000004 0.044206 0.000004 0.048295 0.058580 0.000004 0.107816 0.937739 0.922368 0.000000 0.000001 47.379420
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.68890
(1: 0.048295, 2: 0.142552, 3: 0.142552, 4: 0.048295, 5: 0.048295, 6: 0.000004, 7: 0.044206, 8: 0.000004, 9: 0.048295, 10: 0.058580, 11: 0.000004, 12: 0.107816);
(D_melanogaster_CG46244-PA: 0.048295, D_sechellia_CG46244-PA: 0.142552, D_simulans_CG46244-PA: 0.142552, D_yakuba_CG46244-PA: 0.048295, D_erecta_CG46244-PA: 0.048295, D_takahashii_CG46244-PA: 0.000004, D_biarmipes_CG46244-PA: 0.044206, D_suzukii_CG46244-PA: 0.000004, D_eugracilis_CG46244-PA: 0.048295, D_ficusphila_CG46244-PA: 0.058580, D_rhopaloa_CG46244-PA: 0.000004, D_elegans_CG46244-PA: 0.107816);
Detailed output identifying parameters
kappa (ts/tv) = 0.93774
dN/dS (w) for site classes (K=3)
p: 0.92237 0.00000 0.07763
w: 0.00000 1.00000 47.37942
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
13..1 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..2 0.143 60.5 17.5 3.6782 0.0568 0.0154 3.4 0.3
13..3 0.143 60.5 17.5 3.6782 0.0568 0.0154 3.4 0.3
13..4 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..5 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..6 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..7 0.044 60.5 17.5 3.6782 0.0176 0.0048 1.1 0.1
13..8 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..9 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..10 0.059 60.5 17.5 3.6782 0.0233 0.0063 1.4 0.1
13..11 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..12 0.108 60.5 17.5 3.6782 0.0430 0.0117 2.6 0.2
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 0.988* 9.485 +- 1.505
19 S 1.000** 9.588 +- 1.172
The grid (see ternary graph for p0-p1)
w0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
w2: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
w0: 0.283 0.202 0.145 0.106 0.078 0.059 0.044 0.034 0.027 0.021
w2: 0.000 0.000 0.001 0.003 0.010 0.027 0.064 0.137 0.268 0.491
Posterior for p0-p1 (see the ternary graph)
0.003
0.006 0.006 0.004
0.002 0.005 0.008 0.008 0.005
0.001 0.002 0.003 0.007 0.011 0.011 0.006
0.000 0.000 0.001 0.002 0.004 0.010 0.015 0.015 0.008
0.000 0.000 0.000 0.000 0.001 0.003 0.006 0.014 0.021 0.020 0.011
0.000 0.000 0.000 0.000 0.000 0.001 0.002 0.005 0.009 0.019 0.029 0.027 0.015
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.001 0.002 0.007 0.013 0.028 0.041 0.038 0.021
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.010 0.019 0.039 0.059 0.052 0.029
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.001 0.002 0.005 0.015 0.028 0.057 0.083 0.073 0.039
sum of density on p0-p1 = 1.000000
Time used: 0:22
Model 3: discrete (3 categories)
TREE # 1: (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
lnL(ntime: 12 np: 18): -154.776127 +0.000000
13..1 13..2 13..3 13..4 13..5 13..6 13..7 13..8 13..9 13..10 13..11 13..12
0.048295 0.142552 0.142552 0.048295 0.048295 0.000004 0.044206 0.000004 0.048295 0.058580 0.000004 0.107816 0.937739 0.922054 0.000314 0.000001 0.000001 47.379444
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.68890
(1: 0.048295, 2: 0.142552, 3: 0.142552, 4: 0.048295, 5: 0.048295, 6: 0.000004, 7: 0.044206, 8: 0.000004, 9: 0.048295, 10: 0.058580, 11: 0.000004, 12: 0.107816);
(D_melanogaster_CG46244-PA: 0.048295, D_sechellia_CG46244-PA: 0.142552, D_simulans_CG46244-PA: 0.142552, D_yakuba_CG46244-PA: 0.048295, D_erecta_CG46244-PA: 0.048295, D_takahashii_CG46244-PA: 0.000004, D_biarmipes_CG46244-PA: 0.044206, D_suzukii_CG46244-PA: 0.000004, D_eugracilis_CG46244-PA: 0.048295, D_ficusphila_CG46244-PA: 0.058580, D_rhopaloa_CG46244-PA: 0.000004, D_elegans_CG46244-PA: 0.107816);
Detailed output identifying parameters
kappa (ts/tv) = 0.93774
dN/dS (w) for site classes (K=3)
p: 0.92205 0.00031 0.07763
w: 0.00000 0.00000 47.37944
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
13..1 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..2 0.143 60.5 17.5 3.6782 0.0568 0.0154 3.4 0.3
13..3 0.143 60.5 17.5 3.6782 0.0568 0.0154 3.4 0.3
13..4 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..5 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..6 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..7 0.044 60.5 17.5 3.6782 0.0176 0.0048 1.1 0.1
13..8 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..9 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..10 0.059 60.5 17.5 3.6782 0.0233 0.0063 1.4 0.1
13..11 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..12 0.108 60.5 17.5 3.6782 0.0430 0.0117 2.6 0.2
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Time used: 0:33
Model 7: beta (10 categories)
TREE # 1: (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
lnL(ntime: 12 np: 15): -166.137368 +0.000000
13..1 13..2 13..3 13..4 13..5 13..6 13..7 13..8 13..9 13..10 13..11 13..12
0.045546 0.098839 0.098839 0.045546 0.045546 0.000004 0.044750 0.000004 0.045546 0.047619 0.000004 0.047388 0.986261 0.005000 0.047455
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.51963
(1: 0.045546, 2: 0.098839, 3: 0.098839, 4: 0.045546, 5: 0.045546, 6: 0.000004, 7: 0.044750, 8: 0.000004, 9: 0.045546, 10: 0.047619, 11: 0.000004, 12: 0.047388);
(D_melanogaster_CG46244-PA: 0.045546, D_sechellia_CG46244-PA: 0.098839, D_simulans_CG46244-PA: 0.098839, D_yakuba_CG46244-PA: 0.045546, D_erecta_CG46244-PA: 0.045546, D_takahashii_CG46244-PA: 0.000004, D_biarmipes_CG46244-PA: 0.044750, D_suzukii_CG46244-PA: 0.000004, D_eugracilis_CG46244-PA: 0.045546, D_ficusphila_CG46244-PA: 0.047619, D_rhopaloa_CG46244-PA: 0.000004, D_elegans_CG46244-PA: 0.047388);
Detailed output identifying parameters
kappa (ts/tv) = 0.98626
Parameters in M7 (beta):
p = 0.00500 q = 0.04745
dN/dS (w) for site classes (K=10)
p: 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000 0.10000
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 1.00000
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
13..1 0.046 60.4 17.6 0.1000 0.0050 0.0501 0.3 0.9
13..2 0.099 60.4 17.6 0.1000 0.0109 0.1086 0.7 1.9
13..3 0.099 60.4 17.6 0.1000 0.0109 0.1086 0.7 1.9
13..4 0.046 60.4 17.6 0.1000 0.0050 0.0501 0.3 0.9
13..5 0.046 60.4 17.6 0.1000 0.0050 0.0501 0.3 0.9
13..6 0.000 60.4 17.6 0.1000 0.0000 0.0000 0.0 0.0
13..7 0.045 60.4 17.6 0.1000 0.0049 0.0492 0.3 0.9
13..8 0.000 60.4 17.6 0.1000 0.0000 0.0000 0.0 0.0
13..9 0.046 60.4 17.6 0.1000 0.0050 0.0501 0.3 0.9
13..10 0.048 60.4 17.6 0.1000 0.0052 0.0523 0.3 0.9
13..11 0.000 60.4 17.6 0.1000 0.0000 0.0000 0.0 0.0
13..12 0.047 60.4 17.6 0.1000 0.0052 0.0521 0.3 0.9
Time used: 1:05
Model 8: beta&w>1 (11 categories)
TREE # 1: (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12); MP score: 11
lnL(ntime: 12 np: 17): -154.776122 +0.000000
13..1 13..2 13..3 13..4 13..5 13..6 13..7 13..8 13..9 13..10 13..11 13..12
0.048295 0.142553 0.142553 0.048295 0.048295 0.000004 0.044206 0.000004 0.048295 0.058580 0.000004 0.107817 0.937739 0.922368 0.005000 29.587348 47.379244
Note: Branch length is defined as number of nucleotide substitutions per codon (not per neucleotide site).
tree length = 0.68890
(1: 0.048295, 2: 0.142553, 3: 0.142553, 4: 0.048295, 5: 0.048295, 6: 0.000004, 7: 0.044206, 8: 0.000004, 9: 0.048295, 10: 0.058580, 11: 0.000004, 12: 0.107817);
(D_melanogaster_CG46244-PA: 0.048295, D_sechellia_CG46244-PA: 0.142553, D_simulans_CG46244-PA: 0.142553, D_yakuba_CG46244-PA: 0.048295, D_erecta_CG46244-PA: 0.048295, D_takahashii_CG46244-PA: 0.000004, D_biarmipes_CG46244-PA: 0.044206, D_suzukii_CG46244-PA: 0.000004, D_eugracilis_CG46244-PA: 0.048295, D_ficusphila_CG46244-PA: 0.058580, D_rhopaloa_CG46244-PA: 0.000004, D_elegans_CG46244-PA: 0.107817);
Detailed output identifying parameters
kappa (ts/tv) = 0.93774
Parameters in M8 (beta&w>1):
p0 = 0.92237 p = 0.00500 q = 29.58735
(p1 = 0.07763) w = 47.37924
dN/dS (w) for site classes (K=11)
p: 0.09224 0.09224 0.09224 0.09224 0.09224 0.09224 0.09224 0.09224 0.09224 0.09224 0.07763
w: 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 47.37924
dN & dS for each branch
branch t N S dN/dS dN dS N*dN S*dS
13..1 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..2 0.143 60.5 17.5 3.6782 0.0568 0.0154 3.4 0.3
13..3 0.143 60.5 17.5 3.6782 0.0568 0.0154 3.4 0.3
13..4 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..5 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..6 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..7 0.044 60.5 17.5 3.6782 0.0176 0.0048 1.1 0.1
13..8 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..9 0.048 60.5 17.5 3.6782 0.0192 0.0052 1.2 0.1
13..10 0.059 60.5 17.5 3.6782 0.0233 0.0063 1.4 0.1
13..11 0.000 60.5 17.5 3.6782 0.0000 0.0000 0.0 0.0
13..12 0.108 60.5 17.5 3.6782 0.0430 0.0117 2.6 0.2
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 0.995** 9.545 +- 1.328
19 S 1.000** 9.589 +- 1.172
The grid
p0: 0.050 0.150 0.250 0.350 0.450 0.550 0.650 0.750 0.850 0.950
p : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
q : 0.100 0.300 0.500 0.700 0.900 1.100 1.300 1.500 1.700 1.900
ws: 1.500 2.500 3.500 4.500 5.500 6.500 7.500 8.500 9.500 10.500
Posterior on the grid
p0: 0.000 0.000 0.000 0.000 0.000 0.003 0.025 0.138 0.451 0.383
p : 0.290 0.179 0.126 0.095 0.075 0.062 0.052 0.045 0.040 0.036
q : 0.020 0.043 0.063 0.081 0.098 0.113 0.127 0.140 0.152 0.163
ws: 0.000 0.000 0.001 0.003 0.010 0.027 0.064 0.137 0.268 0.491
Time used: 2:13
Model 1: NearlyNeutral -166.133028
Model 2: PositiveSelection -154.776127
Model 0: one-ratio -175.373989
Model 3: discrete -154.776127
Model 7: beta -166.137368
Model 8: beta&w>1 -154.776122
Model 0 vs 1 18.481921999999997
Model 2 vs 1 22.713801999999987
Additional information for M1 vs M2:
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 0.988* 9.485 +- 1.505
19 S 1.000** 9.588 +- 1.172
Model 8 vs 7 22.722492000000045
Additional information for M7 vs M8:
Naive Empirical Bayes (NEB) analysis
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 1.000** 47.379
19 S 1.000** 47.379
Bayes Empirical Bayes (BEB) analysis (Yang, Wong & Nielsen 2005. Mol. Biol. Evol. 22:1107-1118)
Positively selected sites (*: P>95%; **: P>99%)
(amino acids refer to 1st sequence: D_melanogaster_CG46244-PA)
Pr(w>1) post mean +- SE for w
9 H 0.995** 9.545 +- 1.328
19 S 1.000** 9.589 +- 1.172
Phone: +351 220 408 800
Email: info@i3s.up.pt
Address: Rua Alfredo Allen, 208
4200-135 Porto, Portugal
If you use B+, please cite us:
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2018) Large Scale Analyses and Visualization of Adaptive Amino Acid Changes Projects. Interdisciplinary Sciences: Computational Life Sciences. https://doi.org/10.1007/s12539-018-0282-7
N. Vázquez, C.P. Vieira, B.S.R. Amorin, A. Torres, H. López-Fernández, F. Fdez-Riverola, J.L.R. Sousa, M. Reboiro-Jato, J. Vieira (2017) Automated Collection and Sharing of Adaptive Amino Acid Changes Data. 11th International Conference on Practical Applications of Computational Biology & Bioinformatics. Porto, Portugal. https://doi.org/10.1007/978-3-319-60816-7_3
